Introduzione 1. Scopo della tesi 20

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Introduzione 1. Scopo della tesi 20"

Transcript

1 Indice Indice Introduzione 1 1. Le cellule staminali 1 2. Le cellule staminali mesenchimali Potenziale differenziativo e rigenerazione tissutale Proprietà immunoregolatorie delle colture di MSCs 5 3. Il microambiente del midollo osseo Stimoli proliferativi e migratori Stimoli differenziativi: differenziazione ostegenica e adipogenica Il tessuto adiposo nel midollo osseo Il sistema Fas/ FasL e il suo ruolo nella biologia delle BM-MSC Fas/FasL, attivatori del processo apoptico FasL/Fas, stimoli alla proliferazione cellulare e al differenziamento Il sistema FasL/Fas nelle BM-MSCs 18 Scopo della tesi 20 Materiali e metodi Reagenti Colture cellulari Colorazione degli adipociti con Oil Red Saggi di proliferazione Valutazione dell apoptosi Citofluorimetria a flusso (FACS) Estrazione dell RNA e qpcr Estrazione e dosaggio delle proteine Elettroforesi su gel di poliacrilammide e Western Blot Topi Fas lpr Analisi statistica 28 1

2 Indice Risultati Caratterizzazione delle BM-MSC FasL ha un duplice effetto, dose-dipendente, sulle BM-MSC Alte dosi di FasL hanno un effetto pro-apoptotico nelle BM-MSC Basse dosi di FasL inducono la proliferazione delle BM-MSC Segnali biochimici attivati da FasL nelle BM-MSC Attivazione delle caspasi Attivazione delle MAP chinasi ERK1/ FasL non altera il fenotipo delle BM-MSCs Ruolo di FasL nella differenziazione delle BM-MSC in adipociti L inibizione dell adipogenesi non dipende dalla morte per apoptosi delle BM-MSCs L effetto inibitorio di FasL è reversibile e le cellule mantengono il loro potenziale differenziativo I topi Fas lpr presentano aumentati livelli di marker adipogenici 44 Discussione 46 Bibliografia 51 2

3 Introduzione Introduzione 1. Le cellule staminali Le cellule staminali sono precursori immaturi in grado di dare origine ad una popolazione cellulare che si mantiene in uno stato indifferenziato e assicura la rigenerazione del tessuto di appartenenza, o a cellule con capacità proliferante che maturano e si differenziano. In base al grado di potenzialità differenziativa, le cellule staminali possono essere divise in: totipotenti: cellule staminali in grado di differenziare in ogni tessuto embrionale o extraembrionale e di dare origine a un intero individuo. Derivano da embrioni allo stadio di 4-8 cellule dopo 1-3 giorni dalla fecondazione; pluripotenti: si trovano nell embrione allo stadio di blastocisti, dopo 4-14 giorni dalla fecondazione: sono capaci di generare tessuti appartenenti ai tre strati germinali diversi ma non un intero individuo; multipotenti: possono differenziarsi in tessuti diversi ma appartenenti allo stesso foglietto embrionale: fanno parte di tale categoria le cellule dei tessuti fetali, del cordone ombelicale e le cellule staminali adulte; unipotenti: presenti nei tessuti adulti, sono in grado di auto-rinnovarsi (selfrenewal) e di differenziarsi nel tipo cellulare del tessuto di appartenenza, assicurandone la riparazione e il mantenimento. A seconda della fase maturativa dell individuo da cui sono isolate, sono classificate in embrionali e adulte. Le cellule staminali embrionali sono caratterizzate da un elevatissima capacità di replicazione e mantengono inalterata la loro potenzialità differenziativa. Tuttavia diverse problematiche impediscono l uso di queste cellule nella pratica clinica. Tali cellule, infatti, per essere coltivate in vitro, richiedono feeder layer per il nutrimento; proliferano indefinitamente in vitro e, iniettate in vivo, producono teratomi. Inoltre, una volta indotte alla differenziazione, solo in parte formano il tessuto richiesto e danno origine in percentuali diverse anche ad altri tipi di tessuto. Infine l utilizzo di embrioni per la produzione di tali cellule può sollevare complicazioni di carattere etico. La presenza di cellule staminali nei compartimenti rigenerativi intratissutali dell individuo adulto è nota da tempo: nei primi anni 60 Till e McCulloch scoprirono nel midollo osseo le cellule staminali ematopoietiche, capaci di 1

4 Introduzione autorinnovarsi e differenziarsi in diversi tipi cellulari. In seguito si scoprirono le cellule staminali gastrointestinali e iniziò la ricerca di precursori simili in altri tessuti: popolazioni di progenitori vennero ritrovate nel cervello, nella pelle, nei muscoli scheletrici, nel fegato, nel pancreas, nel grasso. nel cuore e nei polmoni. (4, 86).La loro progressiva caratterizzazione ha permesso di evidenziare la pluripotenzialità di alcuni di questi elementi, simile a quella delle cellule staminali embrionali, modificando profondamente il concetto di cellula staminale, secondo il quale esiste una differenziazione progressiva dei precursori immaturi che segue lo schema della filiera di derivazione embrionale a cui una cellula appartiene. 2. Le cellule staminali mesenchimali La rigenerazione dei tessuti di origine mesenchimale nell adulto dipende da una popolazione di cellule pluripotenti identificate come cellule mesenchimali staminali o cellule mesenchimali stromali (MSCs, mesenchymal stem or stromal cells). La presenza di cellule staminali non-ematopoietiche nel midollo osseo venne suggerita dal patologo tedesco Clonheim 130 anni fa, e fu confermata negli anni 70, dai lavori di Friedenstein, (21) che identificò nel midollo osseo del topo e della cavia una sottopopolazione di cellule con potenzialità osteogenica: da campioni di midollo osseo intero seminati in piastre di plastica isolarono pochi elementi aderenti con un aspetto fusato o simil-fibroblastico, che formavano foci di poche cellule, definiti fibroblast-colony-forming units (CFU-F). Dopo diversi passaggi in coltura, le cellule che sopravvivevano divenivano omogenee e conservavano la capacità di replicarsi e di dare origine a cellule della cartilagine e della struttura ossea (12, 70). Nel 1980 Castro-Malaspina et al utilizzarono la stessa tecnica per isolare cellule con caratteristiche simili da campioni di midollo osseo umano (11) e in quegli stessi anni Clark, B.R e Keating (14) iniziarono a studiare il ruolo di queste cellule nel supporto dell emopoiesi. Nel 1991 Caplan (10) propose che tali cellule fossero le cellule staminali mesenchimali (MSC, mesenchymal stem cells), capaci di differenziare in tutti i tipi cellulari di origine mesodermica. Tale ipotesi spinse diversi gruppi ad indagare la loro capacità differenziativa e il loro ruolo nella rigenerazone tissutale; tuttavia, anche se molti lavori hanno messo in evidenza la loro multipotenzialità (87), solo pochi hanno intrapreso lo studio dei singoli cloni per indagare se tali cellule 2

5 Introduzione possiedono davvero le caratteristiche di auto-rinnovamento e differenziamento delle staminali. (70) Muraglia et al.(38), analizzando cloni derivanti da una singola cellula, hanno dimostrato che un terzo di questi aveva la capacità di differenziare nelle 3 linee, un 60-80% presentava un potenziale osteo-condrogenico e tutti tranne uno differenziavano in osteoblasti mentre non sono stati osservati cloni con un potenziale osteo-adipogenico, condro-adipogenico o solo adipogenico o condrogenico. Anche Lee et al. (30) e Sarugaser et al. (71), studiando rispettivamente cellule del midollo osseo e cellule perivascolari del cordone ombelicale (HUCPVC), hanno messo in luce che soltanto piccole sottopopolazioni rispetto alla totalità delle cellule isolate mostrano capacità di auto-rinnovarsi e sono realmente multipotenti. Le variabilità di comportamento riscontrate studiando questi progenitori mesenchimali dipende quindi dal tessuto da cui sono isolate (i) ma anche dalla tecnica di isolamento utilizzata (ii). Il midollo osseo è la fonte più ricca di MSC, dove rappresentano lo % delle cellule nucleate ottenute da un aspirato midollare, (50) ma sono state isolate anche da altri tessuti ematopoietici, il sangue periferico e il sangue del cordone ombelicale, dai tessuti parenchimali come i muscoli, il grasso, il fegato, (60) o dalla placenta (42) e dal liquido amniotico (15). Inoltre l utilizzo di metodiche di purificazione e coltura diverse hanno influenzato profondamente il loro comportamento, o perché ogni volta queste condizioni hanno selettivamente promosso l espansione di popolazioni differenti, o perchè hanno provocato l assunzione di fenotipi diversi da parte di cellule simili(50). Dato il grande interesse per queste cellule pluripotenti e la grande confusione su quali fossero le loro reali caratteristiche nel 2006 la International Society for Cellular Therapy (ISCT) ha definito i criteri minimi per identificare una MSC: 1) deve aderire alla plastica e originare una colonia di cellule fibrobastoidi, la CFU- F, 2) deve essere positiva per l espressione di CD105, CD73 e CD90 e negativa per l espressione dei marker di superficie ematopoietici CD34, CD45, CD11a, CD19 e HLA-DR; 3

6 Introduzione 3) in seguito a specifiche stimolazioni differenziano in vitro in osteoblasti (con deposizione di cristalli di idrossiapatite), condrociti (con sintesi di matrice cartilaginea) e adipociti (con vacuoli citoplasmatici contenenti lipidi). Tuttavia tali criteri non permettono di identificare solo le cellule staminali: la maggior parte delle popolazioni cellulari che li possiedono non sono infatti composte da tutte cellule in grado di auto rinnovarsi e di proliferare per molti passaggi ma sono composte da diversi tipi cellulari con potenziale proliferativo e differenzaitivo incerti. (61) Per questo le popolazioni cellulari con le caratteristiche descritte dovrebbero essere considerate Mesenchymal Stromal Cells, cellule mesenchimali stromali, (88), che possono presentare alcuni elementi staminali più o meno numerosi Potenziale differenziativo e rigenerazione tissutale. Le MSC derivano principalmente dal mesoderma, il foglietto embrionale intermedio che si differenzia intorno al terzo mese di gestazione, ma possono originare anche da alcune porzioni degli altri due foglietti embrionali: l ectoderma della cresta neurale e l endoderma della placca precordale (72). È stato supposto che durante lo sviluppo embrionale tali cellule si distribuiscono ai vari distretti corporei e persistono nell adulto come riserva per la riparazione e la rigenerazione tissutale (16). Il fatto che originano da tutti i tre foglietti embrionali può spiegare la loro pluripotenza. Oltre a differenziare in cellule dei tessuti connettivi di origine mesodermica: osteociti, condrociti, adipociti e mioblasti, se vengono stimolate con gli opportuni fattori possono assumere la morfologia e le caratteristiche di cardiomiociti, neuroni e astrociti (24, 25). Nonostante i promettenti risultati ottenuti in vitro, la loro capacità di rigenerare in vivo tutti questi diversi tessuti è ancora oggetto di studio. È stato mostrato che le MSCs vengono naturalmente richiamate nei tessuti danneggiati, il miocardio, il polmone la pelle, il pancreas e l osso, e ne coadiuvano la rigenerazione (60). E ormai riconosciuto che tale effetto dipende, almeno in parte, dalla differenziazione delle MSCs in cellule del tessuto lesionato per sostituire quelle danneggiate. Nella fase acuta di infiammazione conseguente al danno le MSCs svolgono il loro effetto paracrino : secernono elevate quantità di molecole bioattive come citochine, antiossidanti e fattori trofici o pro-angiogenici che favoriscono il processo ripartivo reclutando cellule immunitarie e elementi che sostituiscono quelli 4

7 Introduzione danneggiati e riducendo la risposta allo stress e l apoptosi. (70, 60). Come è stato dimostrato da Anversa et al. per il cuore e il polmone (4), è probabile che le popolazioni di MSCs isolate dalle diverse fonti contengano cellule staminali tessutospecifiche che differenziano principalmente nei tipi cellulari presenti nel tessuto di origine. Quando tali cellule vengono immesse in un organo differente, a seconda degli stimoli con cui vengono a contatto, possono indirizzarsi verso un determinato processo differenziativo e, più probabilmente, possono stimolare la proliferazione e il differenziamento delle cellule staminali o progenitrici endogene tramite meccanismi attivati dal contatto cellula-cellula o tramite la produzione di citochine. Questo ruolo di citokine factories attira l attenzione di molti studiosi: comprenderlo più a fondo permetterebbe di scoprire nuovi meccanismi biologici e di identificare fattori utili alla rigenerazione tissutale che potrebbero sostituire l azione delle cellule (70). 2.2 Proprietà immunoregolatorie delle colture di MSCs Un altra interessante caratteristica delle MSC è il loro effetto pleiotropico sul sistema immunitario. Molti lavori hanno dimostrato che queste cellule modulano le funzioni dei linfociti T: innanzitutto presentano bassi livelli di MHC II e delle molecole di superficie costimolatorie CD80, CD86 e CD40, e quindi messe a contatto con linfociti allogenici non inducono una risposta proliferativa, anche quando l IFNγ determina l aumento di espressione di MHCII sulla loro superficie. Diverso è il loro comportamento a contatto con linfociti singenici: in questo in seguito alla stimolazione con IFNγ agiscono come cellule presentanti l antigene (APC) e sono in grado di attivare una risposta immunitaria antigene-specifica, esprimono inoltre numerosi recettori con cui interagire con i linfociti T (VCAM, ICAM-1, LFA-3). La loro azione inibitoria sui linfociti T dipende anche dalla loro espressione di IDO, un enzima che riduce i livelli di triptofano e diminuisce l attività dei linfociti, e dalla produzione di NO che ne.riduce la proliferazione.(50). Studi recenti sostengono che l azione antiproliferativa delle hmscs sui linfociti passa per una down-regolazione di NF-kB e dal blocco del loro ciclo cellulare in fase G0/G1. (70) Le MSCs agiscono anche sulle cellule dendritiche, inibendo l espressione di CD1a, CD40, CD80 e CB86 durante la loro maturazione (69) e riducono il loro potenziale pro-infiammatorio inibendo la loro produzione di TNF-a, IFN-c e IL-12 e 5

8 Introduzione aumentando i livelli di IL-10, che al contrario determina un fenotipo antiinfiammatorio delle DC. Altri studi mostrano che le MSC possono sfuggire all azione delle cellule NK, effettrici dell immunità innata e inibiscono la proliferazione di queste cellule tramite contatto diretto o con la liberazione di fattori solubili come TGF-b e PGE 2 (54) Negli ultimi anni sta suscitando particolare interesse lo studio dei recettori Toll-like nelle MSC e del loro ruolo modulazione della risposta immunitaria. In particolare Waterman (89), basandosi su esperimenti che mettevano in relazione l attivazione del TLR-3 e del TLR-4 con i profili di secrezione di citochine, la capacità migratoria e l espressione di proteine collegate ai pathway attivati da questi due diversi recettori, ha proposto un nuovo modello di azione delle MSC: quando viene attivato il TLR-4 le cellule assumono un ruolo pro-infiammatorio (MSC1) mentre l attivazione del TLR-3 determina un fenotipo immunosoppressivo (MSC-2) e stimola la migrazione, l assunzione di un comportamento piuttosto che l altro dipende dai livelli di citochine e chemochine presenti nel microambiente. Nonostante la grandissima mole di lavori sulle caratteristiche delle MSC e sulle loro possibili applicazioni cliniche, gli studi svolti in vitro non sempre vengono confermati in vivo e sappiamo molto poco delle caratteristiche e del ruolo fisiologico delle MSC nell organismo. Secondo Keating (70) la definizione di MSC utilizzata fino ad ora identifica un fenomeno di coltura cellulare e non si può dare per certo che ciò che si osserva in vitro siano attività proprie della cellula nel suo microambiente. È quindi importante intraprendere ricerche in vivo su MSC endogene, seguire il loro comportamento e capire in quali processi fisiologici sono coinvolte, ma parallelamente è indispensabile studiare l ambiente in cui agiscono e gli stimoli che le influenzano. 3. Il microambiente del midollo osseo Con il termine nicchia si intende un microambiente costituito da cellule e fattori solubili che regola la proliferazione o la maturazione delle cellule staminali, influenzato dai segnali del tessuto di cui fa parte o del resto dell organismo. (7) Sono stati fatte molte ipotesi sui meccanismi che regolano tale ambiente ma gli esiti degli studi non sono sempre univoci e comprendere i processi che regolano la staminalità nei tessuti adulti è tanto importante quanto difficile. 6

9 Introduzione Per quanto riguarda le MSC, le conoscenze sulle nicchie in cui fisiologicamente risiedono sono molto ridotte: secondo l ipotesi più accreditata si trovano nelle aree perivascolari del midollo osseo e sono strettamente associate alle HSC (37) e sottoposte in parte dagli stessi stimoli. Nell uomo adulto, il midollo osseo si localizza nello scheletro assile e nelle metafisi delle ossa lunghe. In queste regioni l osso è spugnoso e la cellule ematopoietiche, non ematopoietiche e i sinusoidi del midollo osseo si posizionano tra le trabecole ossee costituendo una struttura dall architettura intricata, dove tuttavia è possibile distinguere un aumento dei micro capillari in prossimità dell endostio, la lamina che riveste le trabecole. (7) Questa associazione tra tessuto osseo e microcircolazione sembra avere un ruolo importante per l emopoiesi: è stato osservato che quando delle HSC purificate vengono trapiantate in topi irradiati, vanno a localizzarsi vicino all endostio del tessuto osseo trabecolare. In questa zona, così favorevole all homing delle HSC sono presenti sia la nicchia dell endostio (endosteal niche) che quella perivascolare (perivascular niche). La prima è costituita principalmente dagli osteoblasti e dagli osteoclasti, la seconda dalle cellule endoteliali dei vasi, dalle cellule di Schwann, dai macrofagi e da cellule meno caratterizzate come le Cxcl12-abundant reticular (CAR), le cellule stromali perivascolati (perivascular stromal cells) e le MSC. (37, fig. 1) Figura 1: Mitsiadis TA, Exp Cell Res Oct 1;313(16): (37) 7

10 Introduzione Secondo una interessante ipotesi le due nicchie hanno funzioni distinte: quella dell endostio mantiene le HSC in uno stato quiescente per lunghi periodi mentre in quella vascolare le HSC risiedono per tempi brevi, sono in attiva proliferazione e vengono indirizzate verso la differenziazione mieloide e megacariocitica o vengono immesse nel circolo (32, 67). Per confermare tale teoria sarebbe necessario dimostrare che le HSC migrano da una zona all altra. Secondo numerosi lavori, sulla parete abluminale dei sinusoidi del midollo osseo risiedono, insieme alle HSC, cellule diverse dagli osteoblasti e dalle endoteliali. Alcuni di questi elementi, sono caratterizzati da una elevata espressione di CXCL 12 (SDF-1), un fattore fondamentale per il richiamo e il mantenimento delle HSC nella loro nicchia. Sono state identificate con nomi diversi: CXCL 12-abundant reticular (CAR) cells nel topo, adventitial reticular cells (ARCs) nell uomo, o semplicemente osteoprogenitors, ma è probabile che siano popolazioni in parte sovrapponibili, o stadi maturativi differenti dello stesso tipo cellulare e che coincidano con le MSCs (7, 17). Presentano infatti caratteristiche simili: generano cloni in vitro, sono capaci di auto-rinnovarsi, sono multi potenti e generano osteoblasti e adipociti. Lo studio di Mendes-Ferrer e collaboratori ha dimostrato che le cellule mesenchimali stromali positive per la nestina (Nestin + MSCs) esprimono molti fattori di mantenimento per le HSC, tra cui CXCL12, inoltre sono spazialmente associate alle fibre nervose adrenergiche e presentano sulla membrana il recettore β3 adrenergico Adrb3. La stimolazione nervosa attiva tale recettore e di conseguenza abbassa la produzione dei fattori che richiamano le HSC, inducendone la mobilizzazione, e inibisce la differenziazione osteogenica delle MSC, mentre la stimolazione del paratormone induce la proliferazione delle Nestin + MSCs, ne favorisce la differenziazione in osteoblasti e determina il mantenimento delle HSC nella nicchia. Questi risultati suggeriscono l esistenza di una nicchia unica dove i destini delle MSC e delle HSC sono associati e finemente regolati dagli stimoli locali e ma anche dai segnali ormonali e del sistema nervoso autonomo. Le MSC esprimono alti livelli di numerosi altri geni che sono implicati nella regolazione delle HSC: Jagged-1, N-Cadherin, Stem cell factor (SCF; c-kit ligand), thrombopoietin (Thpo or TPO). (17) 8

11 Introduzione Le MSC, e i tipi cellulari che ne derivano possono essere considerate gli organizzatori principali della nicchia emopoietica: infatti dirigono la formazione di cavità attivando gli osteoclasti, contribuiscono allo svipuppo dei sinusoidi, regolano la proliferazione e la mobilitazioone delle HSC, Quando differenziano in adipocti possono avere il ruolo di aumentare o diminuire il letto capillare nel midollo, mentre quando differenziano in osteoblasti hanno un ruolo nel mantenimento del pool staminale emopoietico. (7, figura 2) BM-CFU-F Osteoprogenitors, skeletal stem cells, MSC Figura 2: Bianco P, Blood May 19;117(20): (7) 3.1. Stimoli proliferativi e migratori Le MSC svolgono il ruolo essenziale di compartimento omeostatico, ma contemporaneamente l interazione delle BM-MSCs con il microambiente midollare influenza le loro capacità di rinnovamento e di differenziazione e quindi i processi di osteogenesi e adipogenesi nel midollo. I progenitori ematopoietici e la loro progenie insieme con fibroblasti, cellule endoteliali, osteoblasti, osteoclasti e cellule della linea mieloide e linfoide producono fattori che supportatano la proliferazione o i processi differenziativi delle MSC. Tra i numerosi fattori analizzati il fibroblast growth factor 2 (FGF-2) induce un forte segnale proliferativo in queste cellule, e favorisce l acquisizione di un fenotipo 9

12 Introduzione osteogenico con il risultato di una maggiore formazione di tessuto osseo quando le cellule sono state impiantate in un modello animale (35). Con uno studio in vitro, Krampera et al hanno mostrato che l heparin-binding epidermal growth factor-like growth factor (HB-EGF) attraverso la stimolazione di HER-1 aumenta il potenziale proliferativo delle BMMSCs e ne previene la differenziazione, indirizzandole verso il processo di self-renewal (29). L EGF solubile, così come l HB-EGF si lega ad HER-1 e attiva il processo mitotico e preserva i progenitori mesenchimali nel loro stato indifferenziato, tuttavia l esposizione delle BM-MSCs ad EGF legato ad una matrice induce il differenziamento osteogenico. L EGF solubile attiva il pathway della PI3K-protein kinase B/Akt ed induce, come l IL-6, una fosforilazione temporanea delle ERK/MAPK, mentre lo stimolo persistente con l EGF immobilizzato provoca un attivazione prolungata del pathway delle ERK/MAPK e una conseguente induzione dell osteogenesi (18) (Figura 3). Anche l interleuchina-6 può contribuire al mantenimento delle MSC in uno stato indifferenziato (43). Le MSC in coltura producono elevate quantità di IL-6, e tale espressione diminuisce dopo la differenziazione e in particolare durante il differenziamento osteogenico. Il trattamento con IL-6 aumenta inoltre la proliferazione delle MSC, sempre attraverso la fosforilazione temporanea di ERK 1/2, le protegge dall apoptosi e favorisce il processo di wound-healing in vitro. Figura 3: Fan VH Stem Cells May;25(5): (18). Il ritrovamento di elementi cellulari molto simili alle BM-MSC in molti tessuti connettivi e nel sangue periferico ha suggerito che in presenza di segnali specifici, tali elementi possano lasciare il midollo osseo e raggiungere tessuti danneggiati o infiammati, per partecipare alla loro rigenerazione. (20) 10

13 Introduzione Mansilla et al hanno dimostrato che nel sangue di pazienti severamente ustionati è presente un numero di MSCs significativamente più alto che nei controlli sani ed hanno osservato che la quantità di queste cellule nel sangue correlava con la gravità dell ustione (34). Lo studio di Wang mostra invece che ad una settimana da un infarto del miocardio, i pazienti presentavano meno MSC circolanti dei controlli, facendo ipotizzare che tali cellule fossero reclutate nel miocardio danneggiato (66). È stato supposto che, come accade per le HSC, il reclutamento delle MSC dipenda da meccanismi simili a quelli con cui vengono richiamati i leucociti ma che siano coinvolte molecole di adesione differenti: Ruster ha mostrato che la P-selectina è fondamentale per il rolling delle MSC sulle pareti dei vasi nel topo, e uno studio in vitro lo ha confermato (49) Stimoli differenziativi: Differenziazione ostegenica e adipogenica L indirizzamento delle BM-MSCs verso il processo differenziativo osteoblastico o adipogenico dipende da una stimolazione finemente regolata delle cellule che determina l espressione e l attivazione di specifici fattori di trascrizione. Diversi studi mostrano che questi due processi sono strettamente associati, ma a livello clinico si mostrano spesso inversamente correlati: la maggior parte delle patologie dove si osserva perdita di tessuto osseo sono accompagnate da un aumento di tessuto adiposo nel midollo. I fattori di trascrizione e i pathway intracellulari che guidano i processi differenziativi delle BM-MSC comprendono TAZ, PPARγ2, ΔFosB, Runx-2 e i pathway associati a Wnt e alla β-catenina (44, 73). Alcuni fattori possono aumentare il processo osteogenico o adipogenico a spese dell altro; ad esempio il fattore LIF o l IGF-1 promuove l adipogenesi inibendo l osteogenesi e viceversa le BMP o Wnt10b riducono l adipogenesi e inducono l osteogenesi (50). Tuttavia il sistema è sicuramente più complesso: secondo Abdallah e collaboratori gli stimoli che regolano l avvio di un processo differenziativo piuttosto che un altro sono prodotti dai pre-adipociti o dai pre-osteociti stessi: sfrp-1 and Dlk1/FA1 sono secrete dai pre-adipociti e influenzano le fasi precoci e tardive della differenziazione delle MSC (1). 11

14 Introduzione PPARγ2 (Peroxisome Proliferator Activated Receptor gamma) è il principale regolatore trascrizionale del differenziamento adipogenico (73). Pochi giorni dopo la stimolazione delle MSCs con i fattori che inducono l adipogenesi, come l insulina, il desametazone, l indometacina e l iso-butil-metilxantina, l espressione del trascritto di PPARγ aumenta di almeno dieci volte; anche successivamente e fino alle ultime fasi della maturazione, PPARγ svolge un ruolo cruciale nel controllo dell espressione di geni specifici che determinano il fenotipo e la funzione degli adipociti, come l adiponectina e la Fat Acids Binding Protein FABP4/aP210,11. Numerosi stimoli regolano la trascrizione di PPAR: gli stress meccanici determinano la soppressione di PPARγ in seguito ad una stabilizzazione della β-catenina mediata dalla fosforilazione di Akt, viceversa la degradazione della β-catenina determina un aumento dei fattori associati al signaling dell insulina mediato da PPARγ (44) Il tessuto adiposo nel midollo osseo L adipogenesi del midollo osseo è un processo fisiologico. Il grasso come gli altri tessuti presenti nel midollo ha un ruolo di mantenimento del microambiente e costituisce una fonte di energia non solo per l osso, (31) infatti partecipa al ruolo fondamentale dell osso sano nel mantenimento dell equilibrio energetico dell organismo poichè la sua regolazione energetica si associa alla funzione di integratore metabolico svolta dall osso attraverso il rilascio di fattori come l osteoclacina, che riducono il rischio di obesità e diabete (73). Secondo Naveiras (39) il tessuto adiposo nel midollo riduce l emopoiesi. È stato ipotizzato anche un altro meccanismo che potrebbe correlare fisiologicamente la presenza di tessuto adiposo con la riduzione dell emopoiesi: gli adipociti potrebbero avere un ruolo di regolazione sul letto capillare del midollo osseo (6), infatti i loro progenitori (cellule ARC o MSC (7, 17).) risiedono attorno ai sinusoidi, e il loro volume può variare accumulando o liberando lipidi,e di conseguenza tale variazione determina un restringimento o un ampliamento del lume dei capillari.(7). Questo meccanismo di chiusura reversibile del circolo microvascolare potrebbe andare di pari passo con la riduzione dell emopoiesi, e spiegare la conversione del midollo giallo in midollo rosso in condizioni come l anemia emolitica o il 12

15 Introduzione sanguinamento, quando l emopoiesi viene ristabilita per rispondere alla perdita o alla mancanza di cellule del sangue (7). Tale tessuto svolge diversi ruoli nell omeostasi dell organismo, e di conseguenza una produzione eccessiva o ridotta di tessuto adiposo midollare può caratterizzare diverse condizioni patologiche come il mieloma multiplo, l anoressia nervosa, l osteoartrite, la lipodistrofia associata all HIV e l osteoporosi (82, 83, 84). 4. Il sistema Fas/ FasL e il suo ruolo nella biologia delle BM-MSC: stato dell arte. Negli ultmi anni il concetto che le diverse funzioni cellulari: mitosi, apoptosi, migrazione, differenziamento, acquisizione di un fenotipo infiammatorio, siano attivate ciascuna da specifiche interazioni ligando/ recettore, è stato messo in discussione da evidenze che mostrano che i ruoli di recettori e ligandi considerati pro-proliferativi come EGF-R(45) e pro-apoptotici come TNF-α (23)o Fas (CD 95) (46) sono molto più interconnessi di quanto non si pensasse in precedenza. Negli ultimi anni lo studio del ruolo di Fas (CD95) e del suo ligando FasL (CD178) su diversi tesuti e tipi cellulari hanno rivelato l azione versatile e pleiotropica di questo sistema. Il FasL è fisiologicamente presente in due forme: può essere esposto sulla membrana cellulare (membrane-bound FasL, mfasl) o liberato come fattore solubile in seguito al taglio della sua porzione trans-membranale e intracellulare da parte di specifiche metallo-proteasi (51). O'Reilly e collaboratori in un importante studio del 2009 sono riusciti a produrre dei modelli murini che presentavano il solo mfasl o il solo sfasl. Secondo i loro risultati i topi mfasl-, in cui i linfociti T non possono attivare l apoptosi Fas-mediata degli altri linfociti, sviluppavano linfo-adenopatie e ipergammaglobulinemie in modo simile ai topi FasL gld, con la mutazione naturale di FasL. Quindi il FasL di membrana, con la sua attività citotossica controlla l insorgenza di patologie autoimmuni e protegge dall insorgenza delle neoplasia; il FasL solubile potrebbe invece svolgere ruoli non-apoptotici, come l attivazione di NF-kB, e un aumento eccessivo della sua produzione potrebbe favorire la progressione tumorale o un attivazione sregolata del sistema immunitario tramite una iper-produzione NF-kB-dipendente di citochine infiammatorie (74). Il ruolo pleiotropico di questo sistema può dipendere anche dal recettore Fas e dagli eventi successivi al suo legame con FasL. 13

16 Introduzione Autorevoli studi hanno dimostrato che dopo la sua attivazione, Fas può rimanere in membrana e trasdurre il segnale all interno della cellula attivando messaggeri secondari o può essere internalizzato in vescicole di endocitosi che reclutano tutti i componenti specifici per l attivazione di un determinato pathway. Schutze et al hanno dimostrato che in una prima fase il legame di Fas con il suo ligando detemina la rapida formazione degli SDS-stable microaggregates (CD95hi), che tramite un processo dipendente dalla palmitoleazione di Fas e dall associazione dell ezrina con l actina del citoscheletro, traslocano nei lipid-raft della membrana plasmatica. Questi complessi reclutano bassi livelli di FADD e di caspasi 8 che attivandosi determina l associazione di più CD95hi e la formazione delle signalling protein oligomerization transduction structures (SPOTS). Queste strutture non avviano il processo apoptotico delle cellule di tipo I ma possono innescare pathway non apoptotici come l attivazione delle MAPK o la trascrizione di NF- B. Dopo 5-15 minuti dalla sua attivazione, Fas è internalizzato in compartimenti endosomiali con un processo clatrina-dipendente e a questo punto vengono richiamate grandi quantità di FADD e caspasi-8 e si formano complessi DISC ad alto peso molecolare con una conseguente forte attivazione della caspasi-8 e la propagazione del segnale apoptotico (Fig. 4) (52). Il legame di Fas con l anticorpo agonista APO-1 determina la prima fase di aggregazione di Fas negli hicd95, ma la successiva internalizzazione e l attivazione della caspasi 8 non dipende dall attivazione del recettore bensì da processi successivi come la palmitoilazione della cisteina 199 di Fas (19). L inibizione dell internalizzazione blocca l apoptosi mentre i meccanismi di attivazione di NF- B e di ERK 1/2 si mantengono attivi (30). Si può quindi supporre che le dinamiche che regolano la localizzazione di membrana e l internalizzazione di Fas giocano un ruolo fondamentale nell indirizzare le cellula verso il signaling apoptotico dipendente dall internalizzazione o verso un signaling alternativo internalizzazioneindipendente. È probabile che i differenti ruoli del FasL di membrana e del FasL solubile siano, almeno in parte, correlati alla diversa localizzazione che Fas può assumere in seguito ai due diversi stimoli: tuttavia non ci sono ancora risultati chiari; l allestimento di cocolture di cellule sensibili al signaling apoptotico di FasL con cellule che esprimono soltanto il FasL di membrana ha permesso di osservare che il mfasl induce 14

17 Introduzione l internalizzazione di Fas e un livello di attivazione della caspasi-8 simile a quello ottenuto con il crosslinked scd95l (30). Figura 4: Schütze S Nat Rev Mol Cell Biol Aug;9(8): (52) Fas/FasL, attivatori del processo apoptico. FasL e Fas sono stati scoperti e studiati inizialmente per il loro importante ruolo nell attivazione del segnale apoptotico recettore-mediato (55). Fas (CD95) è un membro della famiglia dei Tumor Necrosis Factor Receptors (TNFR). Quando viene stimolato dal suo ligando FasL (CD178) (o da altri fattori), forma trimeri o oligomeri a livello della membrana cellulare e tale aggregazione induce la formazione del death-inducing signal complex (DISC): tramite l interazione reciproca e omotipica dei death domains (DDs), presenti nella porzione intracitosolica dei recettori, viene reclutata la proteina adattatrice FADD, che a sua volta recluta, tramite i death effector domains (DEDs), la caspasi-8 o FLIP, il suo analogo senza attività enzimatica. La caspasi 8 è una cisteino-proteasi, che taglia substrati, tra cui altre caspasi, in corrispondenza di un residuo di acido aspartico 15

18 Introduzione contenuto in sequenze specifiche. Le caspasi vengono sintetizzate come pro-enzimi inattivi contenenti un pro-dominio N-terminale e i domini p20 e p10 che, una volta scissi dal pro-enzima, formano tetrameri di due etero dimeri p20/p10, ovvero l enzima attivo con 2 siti di taglio. Tra il pro-dominio e i domini p10 e p20 sono presenti residui di aspartato, cioè siti di legame e di taglio per le caspasi attive, che possono a loro volta staccare il pro-dominio e generare altre caspasi attivate avviando la cosiddetta cascata apoptotica. La caspasi 8 iniziatrice promuove quindi l attivazione di numerose caspasi effettrici, come le caspasi 3, 6 e 7. Esse non hanno i domini DDs o DEDs e quindi non possono interagire con i recettori o le proteine adattatrici come FADD, ma possono digerire attraverso la loro azione specifica numerosi componenti cellulari come le lamine nucleari, le proteine citoscheletriche fodrina e gelsolina e gli inibitori delle DNAsi, avviando quindi il processo di degradazione del DNA (8). La caspasi 8 può anche attivare il pathway mitocondriale dell apoptosi, tagliando Bid per generare tbid. tbid si lega sulla membrana mitocondriale esterna al fattore antiapoptotico Bcl-2 inibendolo e al fattore pro-apoptotico BAX attivandolo. Quest ultimo provoca la destabilizzazione delle membrana mitocondriale e la fuoriuscita del citocromo c e di altre proteine responsabili della propagazione della via apoptotica intrinseca (65). Fas e FasL sono stati molto studiati nell ambito della regolazione del sistema immunitario. La sua attivazione ha un azione di controllo sui linfociti T, determinando la loro apoptosi quando sono presenti in eccesso o quando la risposta immunitaria sta volgendo al termine e i linfociti T attivati devono essere rimossi. Nell uomo e nel topo la mutazione e la disfunzione del recettore Fas provoca gravi linfoadenopatie e una predisposizione alle malattie autoimmuni (9). 16

19 Introduzione Figura 5: Schütze S Nat Rev Mol Cell Biol Aug;9(8): FasL/Fas, stimoli alla proliferazione cellulare e al differenziamento Tuttavia, è ormai dimostrato che l apoptosi non è il solo processo in cui il sistema FasL/Fas è coinvolto. A seconda del contesto e del tipo cellulare esso può avviare signaling non -apoptotici. Numerosi lavori mostrano che anche questi processi richiedono l attivazione delle caspasi e il reclutamento di alcune proteine presenti nella cascata apoptotica. Nei linfociti T il legame FasL-Fas determina l avvio del processo apoptotico, tuttavia le caspasi sono attivate anche nei linfociti T proliferanti (68); inoltre nei topi deprivati di FADD (2) i linfociti T mostrano una proliferazione difettiva: le caspasi sono quindi coinvolte anche nei processi proliferativi. E il loro ruolo potrebbe essere quello di tagliare alcuni componenti cellulari durante la riorganizzazione del citoscheletro e del nucleo necessarie alla divisione mitotica (8). Inoltre, numerose evidenze mostrano che la caspasi 8 o FLIP attivano il signaling delle MAPK. Infatti il processamento della caspasi 8 è necessario all attivazione di ERK e p-38 e inoltre 17

20 Introduzione la concentrazione delle due forme di c-flip, lunga e corta ( c-flip L e c-flip R ) regola tale processo determinando l inibizione o l attivazione della caspasi-8 e la conseguente la fosforilazione delle MAPK (28). Questi ed altri dati supportano l ipotesi che FLIP possa svolgere un ruolo regolatorio in base alla concentrazione dei fattori presenti in ogni momento, direzionando il signaling di Fas verso l apoptosi o verso la proliferazione. Nel secondo caso FLIP può associarsi a Raf-1 e attivare MEK ed ERK, o può legarsi a TRAF-1 e attivare NF- B. (26). La stretta interconnessione tra i meccanismi di morte e proliferazione cellulare è testimoniata dal doppio ruolo di altri fattori, come NF- B: tale proteina in molti casi funziona da segnale proliferativo, può anche essere un mediatore dell apoptosi, sempre a seguito degli equilibri che si istaurano tra la forma inattiva o attiva della caspasi 8 e le varie isoforme di FLIP.a livello del DISC (40) 4.3. Il sistema FasL/Fas nelle BM-MSCs Le BM-MSCs umane e murine appena isolate dal midollo esprimono Fas (94% delle cellule) e FasL (circa un 30% delle cellule) (90, 75). Nonostante l elevata espressione del recettore gli studi sull apoptosi Fas-mediata sono pochi e hanno dato risultati contrastanti. I lavori di Fan (18) e collaboratori mostrano che il FasL (100 ng/ml) determina un evidente effetto apoptotico sulle MSCs, e tale effetto permane durante il processo osteogenico ma può essere ridotto dal co-trattamento delle cellule con EGF. Anche Suzuki et al sostengono che Fas sia coinvolto nell apoptosi delle MSC e che il mir-146a possa abbassare l espressione di tale recettore e proteggere le cellule dalla morte cellulare, tuttavia non viene mostrato l effetto diretto dell attivazione di Fas nelle cellule (56). Secondo diversi gruppi l attivazione di Fas indotta in vitro con FasL ricombinante o anticorpi agonisti non scatena un importante evento apoptotico, così come accade nelle linee cellulari linfocitarie o monocitiche. Götherström (91) e collaboratori hanno osservato che le BM-MSCs fetali e adulte sono suscettibili all apoptosi quando vengono coltivate con cellule NK; per indagare i meccanismi molecolari del fenomeno hanno stimolato le cellule con TRAIL e con FasL ed hanno notato che le fetali sono più suscettibili al primo e le adulte al 18

21 Introduzione secondo, tuttavia hanno sottolineato che per osservare un effetto apoptotico hanno dovuto utilizzare dosi di TRAIL e FasL 5 volte più alte di quelle attive su altri tipi cellulari. Anche nel lavoro di Dimitriou le BM-MSCs di pazienti di diversa età vengono trattate per indurre il processo apoptotico, ma le cellule morte sono pochissime. Nonostante l espressione delle caspasi 9 e 3 e la loro attivazione mostri che i pathway apoptotici estrinseco ed intrinseco sono funzionali, le BM-MSCs sono poco suscettibili all apoptosi. L induzione della morte cellulare non è probabilmente il ruolo principale del sistema Fas/FasL per l omeostasi delle BM-MSCs e della loro progenie. Anche negli osteoclasti e negli osteoblasti, FasL ha ruolo pro-apoptotico limitato, tuttavia sembra essere un protagonista importante nell omeostasi del tessuto osseo. Nel topo, durante l osteoblastogenesi, l espressione di FasL decresce rapidamente e rimane bassa fino alla fine del processo differenziativo, mentre, al contrario, i livelli di Fas aumentano; ancora più interessante è il dato ottenuto analizzando il potenziale osteogenico dei topi Fas-/- e gld (mutazione di FasL): questi animali presentano un potenziale osteoblastogenico più elevato dei controlli (75). Il lavoro di Liu ha dimostrato che i linfociti T attraverso IFNγ e TNF-α regolano i processi differenziativi delle MSCs. Un aumento di espressione di queste due citochine inibisce la rigenerazione del tessuto osseo in vivo da parte delle BM- MSCs.esogene e tale effetto dipende dall attivazione IFN-γ indotta di Fas, che induce il pathway di Smad 6, un inibitore dei fattori pro-osteogenici Runx-2 e BMP, e dall innesco del signaling apoptotico di Fas da parte di TNF-α (33). Tali osservazioni vanno in direzioni opposte ma avvalorano entrambe l ipotesi che l osteogenesi non dipenda solo da stimoli proliferativi o differenziativi ma sia influenzata anche dai cosidetti fattori infiammatori prodotti dalle cellule della linea linfoide e mieloide, che nel midollo osseo si trovano a stretto contatto con le MSC, gli osteoblasti e gli adipociti. 19

22 Scopo della tesi Scopo della tesi Il sistema Fas/FasL è coinvolto nella regolazione dell omeostasi cellulare nell osso ma il ruolo biologico ed i meccanismi che regolano la sua azione sulle BM-MSC, come l attivazione del processo apoptotico, sono stati poco studiati e i dati pubblicati sono in parte contrastanti (27, 47, 57, 80, 90, 91). Inoltre, in alcuni sistemi cellulari, FasL oltre ad attivare segnali pro-apoptotici è in grado di indurre proliferazione o differenziamento. In particolare Liu e Kovacic (33, 75) hanno dimostrato che esso inibisce il differenziamento dei progenitori midollari in osteoblasti. L obiettivo di tale studio è stato quindi quello di analizzare gli effetti di FasL su colture primarie di BM-MSC umane: dopo aver caratterizzato le cellule e analizzato i livelli di espressione di Fas e del suo ligando, sono stati studiati gli effetti proliferativo e differenziativo indotti dal trattamento con il FasL ricombinante. In particolare è stato effettuato un accurato studio sul processo adipogenico in vitro che poi è stato validato in vivo su un modello murino caratterizzato dal.la deficienza del signaing di Fas (topi lpr). I dati ottenuti possono contribuire a chiarire i meccanismi molecolari di molte patologie associate ad aumento o riduzione del grasso midollare, e quindi porre le basi per eventuali applicazione terapeutiche. 20

23 Materiali e Metodi Materiali e Metodi 1. Reagenti Il SuperFasLigand e l inibitore delle caspasi z-vad sono stati acquistati dalla Enzo Life Sciences (Farmingdale, NY). L anticorpo attivante anti-fas human CH11 ae l anti-fas neutralizzante ZB4 sono stati forniti dalla Millipore (Billerica, MA), l EGF è dalla Upstate (Lake Placid, NY) e l FGF dalla Peprotech (Rocky Hill, NJ). 2. Colture cellulari I tre campioni di cellule mesenchimali staminali utilizzati sono stati acquistati dalla Lonza (Allendale, NJ), sono tutti ottenuti a partire dall aspirato di midollo osseo di volontari e nel lavoro sono indicati con le seguenti sigle: #1 (#110877, uomo, 22 anni), #2 (#296577, uomo, 45 anni), and #3 (#1F4019, uomo, 29 anni). Dopo lo scongelamento le cellule sono state seminate e mantenute in coltura in α-mem supplementato con il 10% di FBS l l % di 2 mm L-glutammina e l 1 % di 100 U/ml di penicillina/streptomicina (Euroclone, 20016, Milano, Italy) in incubatore a 37 C e al 5% di CO 2 / 95% di aria. Tutti gli esperimenti sono stati effettuati con MSCs fino al 5 passaggio. Differenziazione adipogenica Per gli esperimenti di differenziazione le MSC sono state seminate su piastre da 6 pozzetti ad una densità di 5000 cellule/cm 2 in terreno adipogenico (AD) costituito da α-mem completo (supplementato con il 10% di FBS, l l % di 2 mm L-glutammina e l 1 % di 100 U/ml di penicillina/streptomicina), desametazone 1mM, insulina 10 mg/ml, indometacina 100 mm e isobutil-metil-xantina 500mM (Sigma-Aldrich, St. Louis, MO). Dopo 24 ore le cellule sono state trattate con l anticorpo neutralizzante anti-fas ZB4 500 ng/ml, aggiunto 20 minuti prima del FasL, (Millipore) e/o con FasL 25 ng/ml (Alexis). Il mezzo è stato cambiato ogni 3-4 giorni, e i trattamenti riaggiunti per 14 giorni. Le stesse cellule mantenute in α-mem completo sono state utilizzate come controllo. Per confermare il dato l esperimento è stato svolto in una seconda modalità: dopo 24 ore dalla piastratura le cellule sono state lasciate in α-mem completo e trattate per 48 h con FasL 25 ng/ml (Alexis), quindi il mezzo dove galleggiavano le cellule 21

24 Materiali e Metodi apoptotiche è stato rimosso e sostituito con il terreno AD e 25 ng/ml FasL, con o senza l anti-fas ZB4, sempre aggiunto 20 minuti prima. Anche in questo caso il terreno e i trattamenti sono stati cambiati ogni 3-4 giorni, per 14 giorni. 3. Colorazione degli adipociti con Oil Red O. Per evidenziare gli adipociti è stata utilizzata la colorazione Oil Red O. Le colture cellulari sono state lavate due volte con PBS (phosphate buffered saline), fissate con paraformaldeide al 4% per 5 minuti e incubate per 20 minuti a temperatura ambiente in leggera agitazione con la soluzione Oil Red O, che si ottiene unendo 6 parti di soluzione satura di Oil Red O (0.5% Oil Red O in isopropanolo) e 4 parti di acqua deionizzata e filtrando dopo 10 minuti con un filtro da 0.2 µm. Il colorante è stato rimosso e completamente eliminato con 3 lavaggi con acqua deionizzata, infine le cellule sono state contro-colorate con blu di metilene (0.5% in acqua deionizzata), per visualizzare quelle non differenziate. Gli adipociti appaiono al microscopio ottico come cellule tondeggianti con accumuli lipidici di colore arancio-rosso. La percentuale di cellule differenziate in ogni tipo di trattamento è stata calcolata contando al microscopio ottico, ad un ingrandimento 10X, le cellule totali e quelle che mostravano accumuli lipidici, su venti foto di campi casuali della piastra. 4. Saggi di proliferazione. Per valutare il grado di proliferazione delle MSC in seguito alla stimolazione con FasL, le cellule sono state seminate ad una densità di 5000 cellule/cm2 in piastre da 6 pozzetti o fiasche T-25 e trattate con dosi crescenti di FasL, da 0.1 a 5 ng/ml, in α- MEM completo con o senza l anti-fas ZB4 500 ng/ml (aggiunto 20 minuti prima). Le BM-MSCs sono state stimolate anche con FGF (5 ng/ml) o EFG (50 ng/ml), in modo di potersi riferire ad un controllo positivo di proliferazione. Il terreno e i trattamenti sono stati sostituiti ogni 2 giorni. Ai giorni 2, 4, 6 e 14 le cellule sono state staccate e contate al microscopio ottico con la camera di Burker. Per il saggio della Bromo-desossi-uridina (BrdU) le cellule sono state di nuovo piastrate in α-mem completo ad una densità di 5000 cellule/cm2 in triplicato su piastre da 96 pozzetti e trattate con FasL 0.5 ng/ml, con o senza l anti-fas ZB4 (aggiunto 20 minuti prima). 22

25 Materiali e Metodi Il terreno e i trattamenti sono stati sostituiti ogni 2 giorni; al 5 giorno è stata aggiunta la BrdU labeling solution e 24 ore dopo, a 6 giorni, sono stati effettuati i passaggi successivi indicati dal protocollo del kit DNA Cell proliferation ELISA BrdU (colorimetric) (Roche Diagnostics, Mannheim, Germany). 5. Valutazione dell apoptosi Le cellule sono state seminate alla densità di 5000 cellule/cm 2 su chamber slides (BD, Franklin Lakes, NJ). Dopo 24 ore sono state trattate con diverse dosi di FasL o con l anticorpo anti-fas attivante CH11 (Millipore) alle concentrazioni di 50 ng/ml o 1 µg/ml per 2 giorni e con FasL alla sola dose 25 ng/ml per 1, 2, 4, 6 giorni. A fine trattamento il mezzo di coltura è stato eliminato, le cellule sono state lavate 2 volte con PBS, fissate con paraformaldeide 4% per 5 minuti e colorate con il colorante nucleare Hoechst (Molecular Probes, Eugene, OR) per 10 minuti. La percentuale di cellule apoptotiche è stata calcolata dopo aver contato i nuclei picnotici su dieci foto di campi casuali del vetrino, con il miroscopio a fluorescenza (Nikon Eclipse 80i, Nikon, Japan), con filtro EX e BA 420, a ingrandimento 10X. 6. Citofluorimetria a flusso (FACS) Le cellule sono state trattate con FasL 0.5 ng/ml e 25 ng/ml per 1 e 6 giorni o mantenute per lo stesso tempo in α-mem senza trattamento e analizzate al FACS (FACScan cytometer, BD) per confrontare l espressione degli antigeni di superficie CD105 (DiaClone, Gen-Probe, San Diego, CA), CD73 (BD), CD90 (Stem Cell Technologies, Vancouver, Canada) e CD44 (Miltenyi Biotech, Cologne, Germany). Gli isotipi negativi IgG1-PE and IgG2a-FITC (DiaClone) sono stati utilizzati come anticorpi di controllo. Per l analisi dell espressione di membrana di Fas e FasL le cellule sono state incubate per 30 minuti a temperatura ambiente con anti-fas ottenuto direttamente dal clone DX2 o FasL (clone 5G51, Enzo Life Sciences), e successivamente, dopo 2 lavaggi con PBS, per altri 20 minuti con l anticorpo secondario PE-coniugated antimouse IgG (Sigma Aldrich) 23

26 Materiali e Metodi 7. Estrazione dell RNA e qpcr L RNA totale è stato estratto con il kit RNAeasy Extraction Kit (Quiagen, Hilden, Germany) ed è stato quantizzato con lo spettrofotometro Nanodrop ND-1000 (NanoDrop Technologies, Wilmington, DE). 500 pg di RNA sono stati retrotrascritti con il kit QuantiTect Reverse Transcription Kit (Quiagen), nel termociclatore Chromo 4 PTC-200 Peltier Therma Cycler (MJ Research, Waltham, MA). La reazione di Real Time quantitativa è stata svolta in duplicato: 1 μl di c-dna per ogni campione è stato amplificato utilizzando la 2X SsoFast EvaGreen SuperMix (Bio-Rad)in un volume totale di 10 μl, secondo il protocollo della ditta produttrice, con le seguenti condizioni di reazione nel termociclatore Chromo 4 PTC-200 Peltier Therma Cycler (MJ Research, Waltham, MA): una prima fase di denaturazione e attivazione della Taq a 95 C per 30 secondi e 40 cicli con 95 C per 10 secondi, 60 C per 30 secondi e 72 C per 30 secondi. I risultati sono stati analizzati con il programma Time PCR Opticon Monitor version 2 (MJ Research). L actina è stata utilizzata come gene di controllo endogeno. Sequenze dei primers per lo studio dell espressione di actina, Fas, Rex-1, Nanog, Oct-4, CD44 and PPARγ nelle cellule umane (Invitrogen Life Technologies): Actin FW: AAACTGGAACGGTGAAGGTG Actin RV: CAAGGGACTTCCTGTAACAATGC; CD44st FW: ATCACCGACAGCACAGACAG CD44st RV: GGTTGTGTTTGCTCCACCTT; Fas FW: CGTCTGTTGCTAGATTATCG Fas RV: TTGTCTGTGTACTCCTTCC PPARγ FW: AGCCTCATGAAGAGCCTTCCA PPARγ RV: ACCCTTGCATCCTTCACAAGC; Oct-4 FW: AGTGAGAGGCAACCTGGAGA Oct-4 RV: ACACTCGGACCACATCCTTC; Nanog FW: GATTTGTGGGCCTGAAGAAA Nanog RV: AAGTGGGTTGTTTGCCTTTG; Rex-1 FW: AAGGCACTGAACGAGGAGAA Rex-1 RV: CTGAGCGAGAAGCTGGTCTT). 24

27 Materiali e Metodi I primer dell adiponectina e dell FABP4/aP2 sono stati gentilmente forniti dalla Dott. A. Poloni (47 articolo). Sequenze dei primer per l analisi di GAPDH, PPARγ, FABP4/aP2 e RUNX2 nel topo: GAPDH FW: TGCGACTTCAACAGCAACTC GAPDH RV: ATGTAGGCCATGAGGTCCAC; PPARγ FW: GCCCTTTGGTGACTTTATGG PPARγ RV: CTCGATGGGCTTCACGTT; FABP4/aP2 FW: TCACCTGGAAGACAGCTCCT FABP4/aP2 RV: AAGCCCACTCCCACTTCTTT; RUNX2 FW: GATGACACTGCCACCTCTGA RUNX2 RV: ATGAAATGCTTGGGAACTGC; 8. Estrazione e dosaggio delle proteine A fine trattamento è stato eliminato il mezzo di coltura e le cellule sono state staccate dal supporto con la tripsina (Sigma-Aldrich, St. Louis, MO). Le proteine sono state estratte con il tampone RIPA (NaCl 150 nm, Tris 10 mm ph 7.2, SDS 0.1%, Triton X %, Sodio Deossicolato5mg/ml) a cui è stato aggiunto il cocktail di inibitori delle proteasi Complete Mini (Roche Applied Science, Indianapolis, IN) e dopo 15 minuti in ghiaccio il lisato cellulare è stato centrifugato a 14,000 rpm per 15 minuti a 4 C. Il surnatante è stato recuperato ed eventualmente mantenuto a -80 C fino al momento dell'uso. La quantità di proteine totali contenute in ogni campione è stata misurata con il metodo di dosaggio delle proteine di Bradford (Bradford, M., 1976). Il Bradford Reagent (Comassie Brillant Blue G-250 in acido fosforico e metanolo) (Sigma- Aldrich, Milano, Italy) è stato diluito con uno stesso volume di acqua deionizzata e ad 1 ml di tale soluzione sono stati aggiunti da 1 a 8 µg di proteina standard BSA o 1 µl di ciascun campione di lisato proteico, quindi è stata misurata l assorbanza a 595 nm e la concentrazione delle proteine è stata calcolata in base all equazione della curva di taratura. 25

28 Materiali e Metodi Per studiare un eventuale aumento della fosforilazione delle chinasi ERK, e confermare che Fasl potesse avere il ruolo di fattore pro-proliferativo. Le MSC, piastrate su piastre da 6 pozzetti, sono state mantenute per 24 ore in α-mem senza FBS (condizione di starvation, in assenza dei fattori di crescita), prima di essere trattate con FasL 0.5 ng/ml per 5, 15, 30, 60 minuti, quindi sono state lavate con PBS freddo e lisate direttamente nel pozzetto con 80 µl di RIPA buffer con inibitore proteasi Roche e sodio ortovanadato (1.8 mg/ml). 9. Elettroforesi su gel di poliacrilammide e Western Blot L elettroforesi su gel di poliacrilammide in SDS (SDS-PAGE) è stata eseguita in accordo con il metodo descritto da Laemmli (Laemmli, U.K., 1970). L estratto proteico (15-20 µg di proteine per campione) è stato denaturato aggiungendo Laemmli buffer 5X e acqua deionizzata per eguagliare i volumi e incubando a 95 C per 5 minuti. I campioni sono stati caricati su un gel di poliacrilammide al 10, 12 o 15%, a seconda della peso delle proteine da studiare, posizionato su un apparato elettroforetico verticale (Gibco BRL) e immerso in Running Buffer (glicina 250 mm, Tris-HCl 25 mm e SDS 0.1 %) e le proteine sono state separate applicando un intensità di corrente costante di 20 ma. A fine corsa le proteine sono state trasferite dal gel ad una membrana di nitrocellulosa (Whatman, Dassel, Germany) mediante la tecnica del Western Blot con un apparato semi-secco (Hoefer), in tampone di trasferimento (Tris-Base 3g/L; Glicina 14,4g/L e metanolo al 20%), impostando un intensità di corrente di circa ma a seconda della grandezza del gel. Le membrane sono state bloccate in una soluzione di latte al 5% per un ora e quindi incubate sempre in latte al 5% con gli anticorpi:, mouse anti-caspase 3 (#9668, Cell Signaling, Danvers, MA), anti-caspase 8 (clone 3-1-9, BD), rabbit polyclonal anti-caspase 3 (#9662, Cell Signaling), anti-survivin (Novus Biologicals, Littleton, CO), Anti-phospho-ERK (Cell Signaling), anti-total-erk (Upstate, Millipore) e β-actin (Santa Cruz Biotechnology, Santa Cruz, CA) e successivamente con gli anticorpi secondari Goat anti-mouse HRP-coniugate (Bio-Rad)e Goat antirabbit HRP-coniugate ( Thermo Scientific, Rockford, IL) Dopo l esposizione al substrato dell HRP, Luminata Forte (Millipore), una lastra fotografica a contatto con 26

29 Materiali e Metodi la membrana ha rivelato il segnale chemioluminescente corrispondente alla banda dela proteina di interesse. Come marker di peso molecolare è stato utilizzato il Rainbow Full Range (GE Healthcare). L analisi densitometrica è stata eseguita con il programma di imaging Quantity- One (Bio-Rad) e il livello di espressione delle proteine è stato calcolato come percentuale dell intensità delle bande di interesse rispetto alla β-actina. 10. Topi Fas lpr I topi B6.MRL-Fas lpr/j e i C57BL/6J, usati come controllo, sono stati acquistati dalla Jackson laboratories (Frederick, MD). Hanno vissuto in gabbie da2 a 5 animali, con cibo e acqua ad libitum, in uno stabulario con temperatura e umidità controllate e un ciclo luce/buio di 12 ore. L utilizzo degli animali, in linea con la guida della cura e uso degli animali da laboratorio del National Institutes of Health, è stato approvato dagli Institutional Animal Care and Use Committees. Quando hanno raggiunto la decima settimana di vita gli animali sono stati sacrificati in una camera a CO 2, entrambe le tibie sono state prelevate, pesate e congelate immediatamente,dopo aver eliminato ogni residuo dei tessuti molli circostanti. Per studiare l espressione dell mrna e delle proteine nel midollo osseo dei due ceppi, le tibie sono state omogeneizzate con il Precellys 24 homogenizer (Bertin Technologies, Montigny le Bretonneux, France) in tubi MK28-R 2 volte per 20 secondi a 5600 rpm utilizzando il RIPA buffer con il cocktail di inibitori delle proteasi Complete Mini (Roche Applied Science ) per l estrazione delle proteine e la soluzione lysis buffer del Qiagen RNAeasy Plus Universal Mini Kit (Quiagen) per l estrazione dell mrna, secondo il protocollo della ditta produttrice. Una tibia è stata utilizzata e l altra per l estrazione delle proteine. La concentrazione delle proteine è stata misurata con il metodo BCA (Pierce, Thermo Scientific, Rockford, IL); 5 mg di proteine in Laemmli loading buffer sono stati caricati su minigel di poliacrilammide a gradiente 4-12% pre-casted (Novex, Life Technologies)e quindi trasferite su membrana Invitronol PVDF (Life Technologies). Le membrane sono state ibridate con gli anticorpi PPARγ (C26H12), FABP4 (D25B3) e GAPDH (D16H11) della Cell Signaling e gli appropriati anticorpi 27

30 Materiali e Metodi secondari coniugati all enzima HRP, per la successiva reazione chemioluminescente (Pierce ECL plus, Thermo Scientific, Rockford, IL). Le immagini sono state registrate con il CCD (Syngene GeneGnome, Frederick, MD)ad intervalli di 30 secondi ad esposizioni diverse per le diverse proteine. L analisi densitometrica è stata svolta con il programma ImageJ (NIH). 11. Analisi statistica Per l analisi dei dati è stato utilizzato il programma SPSS/Win program version 18 (Spss, Chicago, IL). I valori medi sono stati confrontati con un T-test a due code, considerando significativi gli eventi con P <

31 Risultati Risultati 1. Caratterizzazione delle BM-MSC Le cellule, acquistate dalla Lonza e già caratterizzate per l espressione di marcatori di superficie dalla ditta stessa, sono state processate per l analisi di espressione in Real Time del recettore Fas, del ligando FasL nonché dei marker di staminalità NANOG, OCT-4, REX-1, fattori di trascrizione altamente presenti nelle ESC, che contribuiscono a mantenere la multipotenzialità delle cellule che li esprimono (62). I risultati sono stati calcolati come DCt, ovvero come la differenza tra il Ct del gene di interesse e quello dell actina, per evidenziare la differenza di espressione dei diversi trascritti. È risultato che Rex-1 è il fattore più espresso nelle BM-MSC, con un DCt simile a quello di Fas, mentre Oct-4 e NANOG sono espressi a livelli bassi ma costanti nei diversi campioni studiati (Fig. 6A). L espressione in membrana delle proteine Fas e FasLè stata studiata mediante analisi citofluorimetrica (FACS), dalla quale è emerso che il 95% delle cellule esprimono Fas (Fig 6B), mentre il FasL è espresso a livelli non rilevabli sia dall analisi in RealTime che dall analisi citofluorimetrica (dati non riportati). Infine la multipotenzialità delle BM-MSC è stata testata inducendo la differenziazione in adipociti e osteoblasti. (Fig. 6C,D) e, in particolare, il potenziale adipogenico è stato confrontato nelle tre colture utilizzate (Fig.6E) 29

32 Risultati Fig 6: Caratterizzazione delle BM-MSC. A) Analisi dell espressione dell mrna dei marker di staminalità Nanog, Oct-4, Rex-1 e del recettore Fas. B) Analisi dell espressione di membrana di Fas tramite analisi citofluorimetrica, come controllo sono state usate le stesse cellule incubate con il solo anticorpo secondario associato al fluorocromo PE, C, D) colture di BM-MSC indotte al differenziamento adipogenico (C) e osteogenico (D) e colorate rispettivamente con la colorazione Oil Red e con il metodo Von Kossa (ingrandimento 10X). E) confronto della capacità adipogenica delle tre colture cellulari utilizzate negli esperimenti. 2. FasL ha un duplice effetto, dose-dipendente, sulle BM-MSC 2.1. Alte dosi di FasL hanno un effetto pro-apoptotico nelle BM-MSC Per chiarire il ruolo pro-apoptotico di FasL su queste cellule, le cellule sono state trattate con diverse dosi di FasL (da 0.5 a 25 ng/ml) per 24 h. In questo sistema cellulare, dopo un giorno di trattamento le cellule apoptotiche sono ancora adese al vetrino e possono essere distinte dalle altre per il caratteristico aspetto dei loro nuclei condensati o frammentati in seguito all azione delle endonuclesi attivate nel processo apoptotico, e quindi visualizzate con la colorazione Hoechst 33342, una molecola 30

33 Risultati che si lega al DNA e permette di valutare la morfologia dei nuclei. I risultati ottenuti calcolando la percentuale delle cellule con nuclei ipodiploidi rispetto al totale delle cellule,hanno mostrato una scarsa suscettibilità all apoptosi rispetto ad altre linee cellulari come quella linfocitaria HuT78. Come mostrato in figura 7A le dosi più basse hanno avuto un debolissimo effetto pro-apoptotico, la dose 5 ng/ml ha indotto l apoptosi del 7% delle cellule mentre la dose 25 ng/ml (il cui effetto sulle HuT78 è l induzione della morte nel 95% delle cellule), ha indotto apoptosi nel 22% della popolazione. Tali risultati sono stati confrontati anche con quelli ottenuti utilizzando l anticorpo agonista anti-fas CH11, utilizzato in altri lavori Questo ha avuto un effetto più blando, a parità di dose, rispetto a quello del FasL ricombinante. Il trattamento con la dose FasL 25ng/ml è stato quindi protratto fino a 6 giorni, rinnovando terreno e stimolo ogni 2 giorni, per studiare se l effetto apoptotico aumentasse. La figura 7B mostra i risultati ottenuti ai tempi di trattamento 1, 2,4 e 6 giorni. Sorprendentemente l effetto apoptotico è andato scemando progressivamente nel tempo suggerendo che le cellule che sopravvivono al primo trattamento sono successivamente resistenti all apoptosi mediata da FasL. 31

34 Risultati Figura 7: Apoptosi indotta da FasL nelle BM-MSC. A) Le BM-MSCs (batch #1) sono state trattate con diverse dosi di FasL, da 0.5 a 25 ng/ml (barre nere) o con 50 e ng/ml dell anticorpo agonista anti-fas umano CH11 (barre bianche). B) Le BM-MSCs del batch #1 sono state trattate con 25 ng/ml FasL (barre nere) o lasciate senza trattamento (barre bianche) per 1, 2, 4, e 6. Come controllo positivo di apoptosi sono state utilizzate le Hut78, trattate con FasL 25 ng/ml per 1 giorno.** P< Basse dosi di FasL inducono la proliferazione delle BM-MSC Poichè Fas è espresso nelle BM-MSC (Fig. 6B) ma la sua stimolazione con il FasL ha una scarsa azione pro-apoptotica (Fig. 7), abbiamo voluto studiare se questo sistema ligando/recettore potesse avere funzioni alternative, come l induzione della proliferazione. Pertanto le cellule sono state trattate per 2, 4, 6 e 14 giorni con le dosi di FasL che non hanno un significativo effetto pro-apoptotico (da 0.1 a 5 ng/ml,) cambiando e supplementando con nuovo FasL il terreno ogni 2 giorni, quindi sono state staccate e contate. La dose 5 ng/ml ha determinato una diminuzione del numero di cellule, probabilmente dovuta alla sua blanda azione pro-apoptotica, mentre con dosi minori le cellule stimolate hanno presentato una capacità proliferativa superiore rispetto al controllo (Fig. 8A). La dose più efficace ad indurre la proliferazione è stata 0.5 ng/ml, che a 6 giorni ha determinato un aumento del numero delle cellule del 30% rispetto al non trattato, un effetto inferiore ma non troppo differente da quello dell EGF 50 ng/ml o del FGF 5 ng/ml (circa 45%), fattori noti per la loro capacità di indurre proliferazione delle BM-MSC (29, 57) e qui utilizzati come controllo positivo (fig. 8B). Per accertare che l effetto fosse mediato dal legame FasL/Fas, l esperimento con la dose 0.5 ng/ml è stato ripetuto in presenza dell anticorpo neutralizzante anti-fas ZB4 ai tempi di 6 e 14 giorni (Fig.8B e 8C) ed il risultato ottenuto è stato confermato con il saggio della BrdU, dove l incorporazione di BrdU è proporzionale al tasso proliferativo delle cellule (Fig. 8D). 32

35 Risultati 33

36 Risultati Figura 8. FasL-induced BM-MSC proliferation. A) Le BM-MSCs del batch #1 sono state trattate con dosi di FasL da 0.1 a 5 ng/ml. La crescita cellulare è stata valutata contando le cellule ai giorni 2, 4, 6. FasL 0.5 ng/ml ha avuto l effeto proliferativo maggiore (media di 4 esperimenti). B) La proliferazione indotta da FasL al giorno 6 (espressa come % del controllo) è stata paragonata a quella indotta da FGF (5 ng/ml) e da EGF (50 ng/ml) N=4. C) Proliferazione a lungo termine (14 giorni) delle BM-MSC con FasL 0.5 ng/ml. D) Saggio della BrdU al giorno 6 delle BM-MSC del batch #1 trattate con FasL 0.5 ng/ml. I risultati sono espressi come fold change rispetto al controllo (cntrl). N=3. Dove indicato, le BM-MSC sono state trattate con l anticorpo anti-fas neutralizzante ZB-4 (α- Fas), aggiunto 20 minuti prima del trattamento con FasL, per provare che l effetto proliferativo osservato fosse specifico. ** P<0.01, * P<0.05 N=3, B-D: Student s t-test. 3. Segnali biochimici attivati da FasL nelle BM-MSC 3.1 Attivazione delle caspasi I principali mediatori biochimici in grado di propagare il segnale apoptotico all interno della cellula sono le caspasi (8). Poiché dosi di FasL superiori a 5ng/ml hanno un effetto pro-apoptotico nelle cellule mesenchimali staminali, è stata analizzata l attivazione delle principali caspasi, la caspasi iniziatrice 8 e la caspasi effettrice 3, per caratterizzare il segnale apoptotico. I dati ottenuti confermano l osservazione che la dose 25 ng/ml induce apoptosi al contrario di quella 0.5 ng/ml. A 24 ore dal trattamento con la dose 25 ng/ml le forme inattive delle caspasi (pro-caspasi) risultano diminuite rispetto al controllo e rispetto al trattamento con 0.5 ng/ml. La riduzione della banda relativa alle pro-caspasi è dovuta al loro taglio proteolitico che porta alla formazione di frammenti attivi., infatti questo fenomeno è inibito dall inibitore specifico delle caspasi z-vad-fmk (Fig. 9A). A tempi brevi di trattamento (4, 8 e 12 ore ) con FasL 25 ng/ml si osserva la comparsa del frammento attivo della caspasi 3, che scompare inseguito a pretrattamento con l inibitore z-vad-fmk e non si riscontra nelle cellule trattate con 0.5 ng/ml. (Fig. 9B) 34

37 Risultati Figura 9 Attivazione delle caspasi 8 e 3 analizzata tramite Western Blot. A) Dopo un giorno di trattamento le forme inattivate pro-caspasi 8 e 3 diminuiscono con FasL 25 ng/ml ma non con FasL 0.5 ng/ml, e il fenomeno è bloccato dall inibitore delle caspasi zvad (20 μm) N=3. B) Western blot della caspasi 3 processata, analizzata dopo 4, 8 e 12 ore dal trattamento. N= Attivazione delle MAP chinasi ERK 1/2 Per valutare l attivazione di segnali biochimici in grado di mediare lo stimolo proliferativo indotto da FasL 0.5 ng/ml è stata analizzata l espressione e la fosforilazione di ERK 1/2. Le cellule sono state trattate per tempi brevi con FasL e quindi sono state processate per l analisi di western blot delle proteine. L esperimento ha mostrato che la dose di FasL 0.5 ng/ml induce la fosforilazione di ERK con una cinetica caratterizzata da due picchi di fosforilazione a 5 e 30 minuti, come mostrato in figura 10 dove nel pannello A è presentato uno dei western blot eseguiti e nel pannello B l analisi densitometrica. 35

38 Risultati Inoltre, come altro marcatore di proliferazione è stata analizzata l espressione della survivina, poichè questa non è soltanto una importante proteina anti-apoptotica, ma è anche coinvolta nella regolazione del ciclo cellulare, come dimostrato nelle cellule staminali ematopoietiche (HSC) (22). Sebbene a 2 giorni dal trattamento proliferativo la sua espressione sia minore rispetto a quella delle cellule non trattate, così come è stato osservato da Rodrigues e collaboratori (47), a 4 e 6 giorni, essa aumenta significativamente, come mostra anche l analisi densitometrica (Fig. 10 C e D). Possiamo quindi concludere che l effetto biologico del FasL sulla crescita e l apoptosi delle BM-MSCs è dose-dipendente: il FasL 0.5 ng/ml attiva ERK 1/2 e aumenta i livelli di survivina (Fig. 10) senza avviare il processo apoptotico mentre con la dose 25 ng/ml si osserva l attivazione delle caspasi e un effetto apoptotico evidente ma limitato, testimoniato dall attivazione delle caspasi 8 e 3 (Fig. 9). Figura 10: Marcatori biochimici di proliferazione. A) Nelle BM-MSC trattate con FasL 0.5 ng/ml la fosforilazione di ERK 1/2 aumenta a 5 e 30 minuti, come dimostrato dall analisi densitometrica (B) N=3. C) La proliferazione mediata da FasL 0.5 ng/ml è correlata con l aumento di espressione della survivina a 4 e 6 giorni. D) Analisi densitometrica della survivina. N=3 36

39 Risultati 4. FasL non altera il fenotipo delle BM-MSCs Per capire se il trattamento con FasL modifica il loro fenotipo e le loro caratteristiche di staminalità abbiamo effettuato l analisi citofluorimetrica dell espressione degli antigeni di superficie caratteristici delle BM-MSC: CD105, CD73, CD44 and CD90 (49) e valutato la presenza e la variazione degli mrna dei fattori di trascrizione Rex-1, Nanog, Oct-4 e CD44 con la Real time PCR quantitativa. Le cellule sono state trattate nuovamente con FasL 0.5 ng/ml e 25 ng/ml per 1 e 6 giorni, per studiare se una particolare popolazione venisse selezionata dopo l induzione dell iniziale apoptosi o se la stimolazione inducesse cambiamenti in tempi più lunghi. Abbiamo osservato che CD105, CD73, CD44 e CD90 sono espresse in maniera sovrapponibile al controllo con entrambe le concentrazioni ad entrambi i tempi di trattamento (Fig. 11A e 11B, pannelli in alto), con la sola eccezione di CD73, che è leggermente aumentato nelle cellule trattate per 6 giorni con la dose di FasL 25 ng/ml. Per quanto riguarda l analisi dei fattori di trascrizione, REX-1, NANOG, OCT-4 e CD44 non vengono modulati dal trattamento FasL 0.5 ng/ml mentre con 25 ng/ml i loro livelli sono aumentati ad 1 giorno di trattamento e tornati ugulai al controllo dopo 6 giorni.(fig. 11A e 11B, pannelli in basso). Questi risultati mostrano che BM- MSC trattate con il FasL non perdono le loro caratteristiche originali, mantengono infatti i marker che le caratterizzano come mesenchimali e continuano ad esprimere i fattori di trascrizione caratteristici delle cellule staminali. Il lieve aumento di questi ultimi in seguito al trattamento con FasL 25 ng/ml suggerisce inoltre che le cellule che muoiono inizialmente per apoptosi siano quelle committed e che quindi la popolazione resistente mostri caratteristiche di maggiore staminalità. 37

40 Risultati 38

41 Risultati Figura 11: Effetto di FasL sul fenotipo delle BM-MSC. A e B, pannello in alto) Espressione dei marker di superficie delle mesenchimai analizzati al citofluorimetro (FACS). La stimolazione con FasL ad entrambe le dosi non modifica l espressione di tali proteine a breve e a lungo termine N=3. A e B, pannello in basso) Espressione degli mrna dei marker di staminalità NANOG, OCT-4, REX-1 e di CD44. FasL 0,5 ng/ml non modifica l espressione dei fattori di trascrizione e di CD44, mentre FasL 25 ng/ml determina un loro aumento dopo 1 giorno di trattamento. I risultati sono espressi come X- fold del controllo (*p<0.05). N= Ruolo di FasL nella differenziazione delle BM-MSC in adipociti. Diverse pubblicazioni mettono in relazione FasL e il processo di rigenerazione ossea (29, 34) a cui le BM-MSC partecipano come pool staminale. Ci siamo quindi chiesti se tale citochina potesse avere un ruolo anche nell adipogenesi midollare. Pertanto è stato allestito un protocollo di induzione dell adipogenesi coltivando le cellule in terreno adipogenico al quale è stato aggiunto, ove necessario, il FasL. Nello specifico le BM-MSCs sono state coltivate per 14 giorni nel mezzo adipogenico (AD) o in AD supplementato con FasL 0.5 ng/ml o 25 ng/ml. Le colorazioni con Oil Red e blu di metilene hanno permesso di mettere in evidenza gli adipociti, caratterizzati dalle presenza di gocciole lipidiche, le cellule non differenziate ed il numero di cellule totali (Fig. 12A). Per poter quantificare la capacità differenziativa nelle diverse condizioni, è stata calcolata la percentuale di adipociti sul numero totale di cellule in ogni trattamento e questo valore è stato rapportato con quello ottenuto per le cellule coltivate in AD, considerato il 100% (Fig. 12B). Mentre il FasL 0.5 ng/ml (dati non riportati) non provoca differenze nel numero di adipociti rispetto al non trattato, con il FasL 25 ng/ml si è osservata una inibizione del 50% nella formazione di adipociti maturi (Fig. 12B, AD e AD/FasL). Per confermare che l effetto fosse mediato dall attivazione di Fas le cellule sono state trattate contemporaneamente con l anticorpo neutralizzante Anti-Fas ZB4 e con FasL 25 ng /ml: il cotrattamento blocca l effetto di FasL 25 ng/ml e riporta gli adipociti ad un numero molto più simile al non trattato (82% degli adipociti del trattamento AD), mentre l anti-fas ZB4 da solo non ha nessun effetto (98%) (Fig. 12B, AD/α-Fas e AD/FasL/ α-fas). In accordo con questi risultati, l espressione degli mrna dei principali fattori e marcatori adipogenici, quali PPARγ, adiponectin e FABP4/aP2, diminuisce a seguito 39

42 Risultati del trattamento con FasL 25 ng/ml e tale effetto è neutralizzato dal cotrattamento con l anticorpo neutralizzante anti-fas ZB4 (Fig. 12C). Figura 12: Inibizione dell adipogenesi mediata da Fas. A) Le BM-MSC sono state differenziate in mezzo adipogenico in presenza di FasL 25 ng/ml e/o α-fas e colorate con Oil Red e blu di metilene (Ingrandimento 10X). B) Gli adipociti sono stati contati in 20 campi e rapportati con il numero di cellule totali, quindi è stata fatta la percentuale di tale valore su quello ottenuto nel controllo AD presentato come 100%. C) X-fold (2-ΔΔCt) rispetto al controllo non differenziato di PPARγ, adiponectina e FABP4/aP2. * p<0.05, N=3 40

43 Risultati 6. L inibizione dell adipogenesi non dipende dalla morte per apoptosi delle BM- MSCs. Come è stato mostrato in precedenza, l esposizione ad una dose di FasL di 25 ng/ml determina un apoptosi del 22% delle BM-MSCs. Era quindi possibile che il minor numero di adipociti ottenuto in presenza di FasL fosse correlato a questo fenomeno più che ad un vero e proprio effetto inibitorio. Per chiarire questo punto, abbiamo adottato la stretegia di indurre in tutte le cellule apoptosi prima di farle differenziare. Perciò le BM-MSC sono state prima trattate con FasL 25 ng/ml mantenendole in α MEM, ovvero in terreno non adipogenico, per due giorni, tempo sufficiente ad indurre l apoptosi delle cellule suscettibili (Fig. 7B), successivamente il terreno con le cellule apoptotiche è stato eliminato ed è stato sostituito con il terreno prodifferenziante AD da solo o in presenza di FasL 25 ng/ml o FasL 25 ng/ml e α-fas per 14 giorni. L esperimento è stato eseguito su 3 colture cellulari ottenute da pazienti diversi (batch #1, #2 e #3) per escludere che il fenomeno dipendesse dal donatore. Le cellule sono state colorate con Oil Red, blu di metilene e Hoechst, per visualizzare eventuali cellule apoptotiche e quindi contate al microscopio ottico ad un ingrandimento 10X in 20 campi scelti casualmente (fig. 13A). A fine esperimento il numero delle cellule differenziate in presenza e in assenza di FasL non presenta una variazione significativa (AD 29.3 cellule/campo ± 7.7; AD+FasL 24.8 cellule/campo ± 5.6, AD+FasL+αFas 31.3 cellule/campo ± 8.5 ), ma il numero di adipociti è considerevolmente inferiore nel trattato con FasL e anche in questo caso l effetto viene revertito dall aggiunta di αfas (AD 9.0 cellule/campo ± 3.0; AD+FasL 2.8 cellule/campo ± 1.1, AD+FasL+αFas 9.7 cellule/campo ± 2.4 ). Inoltre, anche in questo esperimento dopo il primo trattamento con FasL, a cui tutte le cellule sono state sottoposte, le BM-MSC risultano poco sensibili al segnale apoptotico e la colorazione con l HOECHST a 16 giorni non evidenzia nuclei picnotici con nessuno dei trattamenti (Fig. 13A, pannello a destra). Come nell esperimento precedente, la percentuale delle cellule differenziate rispetto alle cellule totali in ogni trattamento è stata rapportata a quella del trattamento AD, considerato il 100% (Fig. 13B). Poiché con questo approccio sperimentale l inibizione dell adipogenesi mediata da FasL è evidente ed è addirittura del 60%, 41

44 Risultati possiamo concludere che FasL interferisce con il processo di adipogenesi in vitro inibendo la differenziazione delle BM-MSCs in adipociti. 42

Citochine dell immunità specifica

Citochine dell immunità specifica Citochine dell immunità specifica Proprietà biologiche delle citochine Sono proteine prodotte e secrete dalle cellule in risposta agli antigeni Attivano le risposte difensive: - infiammazione (immunità

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

Presentando le cellule staminali

Presentando le cellule staminali Presentando le cellule staminali 1 Alcune note prima di iniziare Questa presentazione va considerata come uno strumento flessibile per scienziati, divulgatori scientifici ed insegnanti. Non tutte le diapositive

Dettagli

Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione

Dettagli

I I SEGNALI COSTIMOLATORI DEI LINFOCITI T FEDERICA COLLINO

I I SEGNALI COSTIMOLATORI DEI LINFOCITI T FEDERICA COLLINO I I SEGNALI COSTIMOLATORI DEI LINFOCITI T FEDERICA COLLINO ATTIVAZIONE DEI LINFOCITI T L attivazione dei linfociti T vergini richiede la presenza di una particolare regione di contatto tra le cellule T

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Vitamina D, PTH ed omeostasi del calcio

Vitamina D, PTH ed omeostasi del calcio Vitamina D, PTH ed omeostasi del calcio Funzioni principali della vit D Stimolazione dell'assorbimento del calcio e del fosforo a livello intestinale; Regolazione, in sinergia con l'ormone paratiroideo,

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Differenziamento = Creazione cellule specializzate. Il tuo corpo ha bisogno delle cellule staminali

Differenziamento = Creazione cellule specializzate. Il tuo corpo ha bisogno delle cellule staminali Differenziamento = Creazione cellule specializzate Cos è una cellula staminale? Cosa mostra la foto Un pezzo di metallo e molti diversi tipi di viti. Dare origine a diversi tipi di cellule è un processo

Dettagli

ORGAN ON A CHIP. Un promettente sostituto alla sperimentazione animale

ORGAN ON A CHIP. Un promettente sostituto alla sperimentazione animale ORGAN ON A CHIP Un promettente sostituto alla sperimentazione animale 1 1.Fasi di sviluppo di un farmaco La ricerca e lo sviluppo di un farmaco sono indirizzate al processo dell identificazione di molecole

Dettagli

PREVENZIONE E SALUTE GLOBALE

PREVENZIONE E SALUTE GLOBALE PREVENZIONE E SALUTE GLOBALE SI PARTE DALLA VITAMINA D Relatore dr Donata Soppelsa Medico di medicina generale Associato alla Società Italiana di Nutriceutica Quali domande? E sufficiente l integrazione

Dettagli

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la INFIAMMAZIONE Risposta protettiva che ha lo scopo di eliminare sia la causa iniziale del danno cellulare (es. microbi, tossine etc), sia i detriti cellulari e le cellule necrotiche che compaiono a seguito

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

Monossido d azoto NO (Nitric Oxide) Messaggero del segnale cellulare. Molecola regolatoria nel sistema nervoso centrale e periferico

Monossido d azoto NO (Nitric Oxide) Messaggero del segnale cellulare. Molecola regolatoria nel sistema nervoso centrale e periferico Monossido d azoto NO (Nitric Oxide) Ruolo biologico: Messaggero del segnale cellulare Molecola regolatoria nel sistema cardiovascolare Molecola regolatoria nel sistema nervoso centrale e periferico Componente

Dettagli

VADEMECUM PER MISURA DELLA VITAMINA D (25-idrossivitamina D e 1,25-diidrossivitamina D)

VADEMECUM PER MISURA DELLA VITAMINA D (25-idrossivitamina D e 1,25-diidrossivitamina D) DAI Diagnostica di Laboratorio - Laboratorio Generale - Direttore Dr. Gianni Messeri Gentile Collega, negli ultimi anni abbiamo assistito ad un incremento delle richieste di dosaggio di vitamina D (25-

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Corso di Laurea Specialistica in Biotecnologie Biomolecolari. Corso di Immunologia Molecolare

Corso di Laurea Specialistica in Biotecnologie Biomolecolari. Corso di Immunologia Molecolare Corso di Laurea Specialistica in Biotecnologie Biomolecolari ANTONELLA GROSSO Corso di Immunologia Molecolare ILAN RIESS LA MOLECOLA Interleukin 4 From Wikipedia, the free encyclopedia Interleukin-4, abbreviated

Dettagli

Liponax Sol. Innovativa formulazione LIQUIDA. ad elevata biodisponibilità. Acido R (+) a-lipoico

Liponax Sol. Innovativa formulazione LIQUIDA. ad elevata biodisponibilità. Acido R (+) a-lipoico Innovativa formulazione LIQUIDA ad elevata biodisponibilità L acido a lipoico è una sostanza naturale che ricopre un ruolo chiave nel metabolismo energetico cellulare L acido a lipoico mostra un effetto

Dettagli

SVILUPPO EMBRIONALE (PARTE PRIMA)

SVILUPPO EMBRIONALE (PARTE PRIMA) SVILUPPO EMBRIONALE (PARTE PRIMA) Lo sviluppo embrionale è il processo che, per successive mitosi porta dallo zigote all'individuo completo. Lo sviluppo embrionale comprende in realtà vari aspetti, che

Dettagli

Bilancia emostatica. Ipercoagulabilità. Ipocoagulabilità. Normale. Trombosi. Emorragie

Bilancia emostatica. Ipercoagulabilità. Ipocoagulabilità. Normale. Trombosi. Emorragie Coagulazione 1 Bilancia emostatica Ipercoagulabilità Ipocoagulabilità Normale Trombosi Emorragie 2 emostasi primaria emostasi secondaria Fattori coinvolti nell emostasi Vasi + endotelio Proteine della

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Nuove acquisizioni patogenetiche nell osteodistrofia renale.

Nuove acquisizioni patogenetiche nell osteodistrofia renale. Nuove acquisizioni patogenetiche nell osteodistrofia renale. Sequenza di eventi patogenetici (seconda metà anni 70 seconda metà anni 90) IRC deficit di attivazione ridotta escrezione della vitamina D di

Dettagli

LA MEMBRANA PLASMATICA

LA MEMBRANA PLASMATICA LA MEMBRANA PLASMATICA 1. LE FUNZIONI DELLA MEMBRANA PLASMATICA La membrana plasmatica svolge le seguenti funzioni: 1. tenere concentrate tutte le sostanze indispensabili alla vita: è proprio la membrana

Dettagli

1 LEZIONE CHE COS E L ALLENAMENTO

1 LEZIONE CHE COS E L ALLENAMENTO 1 LEZIONE CHE COS E L ALLENAMENTO Sono molte le definizioni di allenamento: Definizione generale: E un processo che produce nell organismo un cambiamento di stato che può essere fisico, motorio, psicologico.

Dettagli

Alimentazione e salute dell intestino: siamo quello che mangiamo

Alimentazione e salute dell intestino: siamo quello che mangiamo Alimentazione e salute dell intestino: siamo quello che mangiamo La dieta, il microbiota intestinale e la salute digestiva sono intrecciati fra loro. Questi legami e il potenziale benefico dei probiotici

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

Cosa sono le vitamine?

Cosa sono le vitamine? Cosa sono le vitamine? Le vitamine sono sostanze di natura organica indispensabili per la vita e per l accrescimento. Queste molecole non forniscono energia all organismo umano ma sono indispensabili in

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

I linfomi non-hodgkin

I linfomi non-hodgkin LINFOMA NON HODGKIN I linfomi non-hodgkin (LNH) sono un eterogeneo gruppo di malattie neoplastiche che tendono a riprodurre le caratteristiche morfologiche e immunofenotipiche di una o più tappe dei processi

Dettagli

Gli Omega-3 e la Vitamina D contro l Alzheimer - Le nuove prospettive per il terzo millennio -

Gli Omega-3 e la Vitamina D contro l Alzheimer - Le nuove prospettive per il terzo millennio - nutrizione & composizione corporea fisioterapia & recupero funzionale medicina d alta quota piani di allenamento articoli, studi, ricerche dal mondo della Nutrizione, delle Terapie Fisiche, delle Neuroscienze

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

VLT. Aminoacidi Caffeina Derivati botanici Vitamine idrosolubili.

VLT. Aminoacidi Caffeina Derivati botanici Vitamine idrosolubili. VLT VLT (leggi Volt) è un gel energizzante il cui effetto si fonda sulla combinazione e sinergia d azione propria dei componenti in esso contenuti. In VLT si ritrovano, difatti, molteplici principi attivi

Dettagli

VITAMINE. Composti organici eterogenei; indispensabili all organismo; non hanno valore energetico; agiscono in dosi minime (LARN: 1-200 mg/die);

VITAMINE. Composti organici eterogenei; indispensabili all organismo; non hanno valore energetico; agiscono in dosi minime (LARN: 1-200 mg/die); VITAMINE Composti organici eterogenei; indispensabili all organismo; non hanno valore energetico; agiscono in dosi minime (LARN: 1-200 mg/die); hanno funzioni specifiche e funzioni comuni, tra cui: - agiscono

Dettagli

UNIVERSITA DEGLI STUDI DI PARMA. Effetti della Vitamina D sul sistema immunitario: reazione di fase acuta dopo somministrazione di Acido Zoledronico

UNIVERSITA DEGLI STUDI DI PARMA. Effetti della Vitamina D sul sistema immunitario: reazione di fase acuta dopo somministrazione di Acido Zoledronico UNIVERSITA DEGLI STUDI DI PARMA Dottorato di Ricerca in Malattie Osteometaboliche e Disordini del Metabolismo Idroelettrolitico e Acido-Base Ciclo XXIV Effetti della Vitamina D sul sistema immunitario:

Dettagli

Il fabbisogno alimentare e il ruolo dei nutrienti

Il fabbisogno alimentare e il ruolo dei nutrienti Il fabbisogno alimentare e il ruolo dei nutrienti Le necessità del nostro corpo Cibo e bevande sono i mezzi con cui il nostro organismo si procura le sostanze di cui ha bisogno per le sue attività vitali.

Dettagli

Glossario. Allogeniche Indica le cellule ottenute da un donatore e idonee per l'infusione in un'altra persona.

Glossario. Allogeniche Indica le cellule ottenute da un donatore e idonee per l'infusione in un'altra persona. Glossario Il seguente glossario è stato concordato da numerose nazioni europee coinvolte nel progetto Eurocet con l intento di armonizzare la terminologia utilizzata nel settore della donazione e del trapianto

Dettagli

Fenomeni di trasporto. Fenomeni di trasporto

Fenomeni di trasporto. Fenomeni di trasporto La comprensione dei processi fisici, chimici e biologici che governano il trasporto di materia e la trasmissione delle forze è di fondamentale importanza per lo studio della fisiologia cellulare e l ingegnerizzazione

Dettagli

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale?

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Questo vecchio slogan pubblicitario riconduce ad una parziale verità scientifica, oggi più che attuale. E risaputo che parlare di zucchero

Dettagli

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 Cisteina di 3 gruppo (176) Unità ripetute ricche di leucina Cisteine di 2 gruppo

Dettagli

Il sistema endocrino Il sistema endocrino sistema ormonale ghiandole cellule proteiche lipidiche organismo umano sistema nervoso

Il sistema endocrino Il sistema endocrino sistema ormonale ghiandole cellule proteiche lipidiche organismo umano sistema nervoso Il sistema endocrino Il sistema endocrino o sistema ormonale è rappresentato da un insieme di ghiandole e cellule (dette ghiandole endocrine e cellule endocrine) le quali secernono delle sostanze proteiche

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Vitamina D: passato, presente e futuro. Dott. Giuliano Bucciardini MMG

Vitamina D: passato, presente e futuro. Dott. Giuliano Bucciardini MMG Vitamina D: passato, presente e futuro Dott. Giuliano Bucciardini MMG Un po' di storia Nel 1650 l'inglese Francis Glisson descrive accuratamente il rachitismo (peraltro noto sin dall'antichità) in De rachitade.

Dettagli

STUDI PRELIMINARI COMPARATIVI SULLA BIODISPONIBILITA E CAPACITA DI PERMEARE LA PELLE DI:

STUDI PRELIMINARI COMPARATIVI SULLA BIODISPONIBILITA E CAPACITA DI PERMEARE LA PELLE DI: STUDI PRELIMINARI COMPARATIVI SULLA BIODISPONIBILITA E CAPACITA DI PERMEARE LA PELLE DI: - RETINOLO PURO - RETINOLO IN LIPOSOMI - RETINOLO IN LIPOSYSTEM COMPLEX - RETINOLO IN CYCLOSYSTEM COMPLEX - VITAMINA

Dettagli

OSTEOPOROSI. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI. *Come prevenirla* *Come curarla* *Consigli pratici* Resp. Dott.

OSTEOPOROSI. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI. *Come prevenirla* *Come curarla* *Consigli pratici* Resp. Dott. C. I. D. I. M. U. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI Resp. Dott. Antonio Vercelli OSTEOPOROSI *Come prevenirla* *Come curarla* *Consigli pratici* *Cos è l osteoporosi?* L osteoporosi

Dettagli

L ALIMENTAZIONE ANTINFIAMMATORIA PER IL PODISTA. Dott.ssa Elisa Seghetti Biologa Nutrizionista - Neurobiologa

L ALIMENTAZIONE ANTINFIAMMATORIA PER IL PODISTA. Dott.ssa Elisa Seghetti Biologa Nutrizionista - Neurobiologa L ALIMENTAZIONE ANTINFIAMMATORIA PER IL PODISTA Dott.ssa Elisa Seghetti Biologa Nutrizionista - Neurobiologa L atleta moderno ha bisogno di un maggior numero di adattamenti metabolici all esercizio fisico.

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

DOTTORATO DI RICERCA. Biochimica. Ciclo XXI. Settore scientifico disciplinari di afferenza: BIO/10

DOTTORATO DI RICERCA. Biochimica. Ciclo XXI. Settore scientifico disciplinari di afferenza: BIO/10 Alma Mater Studiorum Università di Bologna DOTTORATO DI RICERCA Biochimica Ciclo XXI Settore scientifico disciplinari di afferenza: BIO/10 TITOLO TESI Trasduzione del segnale e poliamine nell apoptosi

Dettagli

SISTEMA CIRCOLATORIO. Permette, attraverso il sangue, il trasporto di O 2. , sostanze nutritizie ed ormoni ai tessuti e la rimozione di CO 2

SISTEMA CIRCOLATORIO. Permette, attraverso il sangue, il trasporto di O 2. , sostanze nutritizie ed ormoni ai tessuti e la rimozione di CO 2 SISTEMA CIRCOLATORIO Permette, attraverso il sangue, il trasporto di O 2, sostanze nutritizie ed ormoni ai tessuti e la rimozione di CO 2 e cataboliti, per mantenere costante la composizione del liquido

Dettagli

STEATOSI EPATICA. EPIDEMIOLOGIA, FISIOPATOLOGIA, DIAGNOSI, TRATTAMENTO DIETOTERAPICO E NUTRACEUTICO

STEATOSI EPATICA. EPIDEMIOLOGIA, FISIOPATOLOGIA, DIAGNOSI, TRATTAMENTO DIETOTERAPICO E NUTRACEUTICO Università degli Studi della Repubblica dii San Marino Università degli Studi di Parma Master in Sicurezza e Qualità dell Alimentazione in Età Evolutiva STEATOSI EPATICA. EPIDEMIOLOGIA, FISIOPATOLOGIA,

Dettagli

Il sistema immunitario

Il sistema immunitario QUADERNI SULLE IMMUNODEFICIENZE PRIMITIVE N. 2 Il sistema immunitario ASSOCIAZIONE IMMUNODEFICIENZE PRIMITIVE ONLUS Quaderni pubblicati da AIP ONLUS N.1 La sindrome di Wiskott Aldrich (WAS) N.2 Il sistema

Dettagli

FONDAMENTI DI BIOLOGIA DELLO SVILUPPO

FONDAMENTI DI BIOLOGIA DELLO SVILUPPO FONDAMENTI DI BIOLOGIA DELLO SVILUPPO Grazyna Ptak, PhD, DSc Dipartimento di Scienze Biomediche Comparate Università degli Studi di Teramo Il ciclo della vita: gli stadi dello sviluppo animale 1. specificazione

Dettagli

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali:

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali: Gli enzimi Nel metabolismo energetico le cellule producono notevoli quantità di CO 2 che deve essere eliminata con l apparato respiratorio. Il trasferimento della CO 2 dalle cellule al sangue e da esso

Dettagli

LA MALNUTRIZIONE NELL ANZIANO E LE SINDROMI CARENZIALI

LA MALNUTRIZIONE NELL ANZIANO E LE SINDROMI CARENZIALI LA MALNUTRIZIONE NELL ANZIANO E LE SINDROMI CARENZIALI Daniela Livadiotti Società Italiana di Medicina di Prevenzione e degli Stili di Vita INVECCHIAMENTO L invecchiamento può essere definito come la regressione

Dettagli

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS)

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) Pædiatric Rheumatology InterNational Trials Organisation Che cos é? Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) La sindrome di Blau è una malattia genetica. I pazienti affetti presentano rash

Dettagli

Apparato scheletrico. Le funzioni dello scheletro

Apparato scheletrico. Le funzioni dello scheletro Apparato scheletrico Le funzioni dello scheletro Lo scheletro ha la funzione molto importante di sostenere l organismo e di dargli una forma; con l aiuto dei muscoli, a cui offre un attacco, permette al

Dettagli

Tecnica ed esperienza per prestazioni elevate.

Tecnica ed esperienza per prestazioni elevate. Tecnica ed esperienza per prestazioni elevate. INDICE La presente guida contiene suggerimenti e indicazioni di carattere generale e a scopo puramente informativo. Non si deve prescindere dal leggere attentamente

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

Nel moderno allevamento intensivo di specie ittiche, nutrizione e salute del pesce allevato sono due fattori intimamente connessi, da un lato devono

Nel moderno allevamento intensivo di specie ittiche, nutrizione e salute del pesce allevato sono due fattori intimamente connessi, da un lato devono Nel moderno allevamento intensivo di specie ittiche, nutrizione e salute del pesce allevato sono due fattori intimamente connessi, da un lato devono essere soddisfatti i fabbisogni di nutrienti necessari

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Fonti alimentari di Inositolo

Fonti alimentari di Inositolo Fonti alimentari di Inositolo Agrumi Cereali integrali Frutta secca(arachidi) Semi(germe di grano) Legumi(fagioli) Lievito di birra Gli alimenti freschi contengono molto più Inositolo rispetto ai prodotti

Dettagli

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria?

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria? DOMANDE E RISPOSTE 1. Che cos è un vaccino? Un vaccino è un prodotto la cui somministrazione è in grado di indurre una risposta immunitaria specifica contro un determinato microrganismo (virus, batterio

Dettagli

BORTEZOMIB (Velcade)

BORTEZOMIB (Velcade) BORTEZOMIB (Velcade) POTENZIALI EFFETTI COLLATERALI Le informazioni contenute in questo modello sono fornite in collaborazione con la Associazione Italiana Malati di Cancro, parenti ed amici ; per maggiori

Dettagli

VITAMINA D : Nuove evidenze per una vitamina poco conosciuta

VITAMINA D : Nuove evidenze per una vitamina poco conosciuta - WELKOME FITNESS 2013 Evoluzione e ricerca nel mondo degli integratori Vitamina D3: aggiornamenti e nuove applicazioni Dott Marco Neri: Comitato Tecnico Nazionale FIPCF/CONI Comitato scientifico Federazione

Dettagli

Non nasconda la salute futura di suo figlio... sotto al cuscino...

Non nasconda la salute futura di suo figlio... sotto al cuscino... Non nasconda la salute futura di suo figlio... sotto al cuscino... Non nasconda la salute futura di suo figlio sotto al cuscino I denti da latte contengono cellule staminali che possono essere usate per

Dettagli

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine VITAMINA D: SINTESI, METABOLISMO E CARENZA Il 40-50% della

Dettagli

OMEOSTASI DEL Ca 2+ e FOSFORO

OMEOSTASI DEL Ca 2+ e FOSFORO OMEOSTASI DEL Ca 2+ e FOSFORO Metabolismo del calcio Il calcio è il minerale più rappresentato nell organismo umano (1000-1200 gr) Il 99% del Ca corporeo si trova nello scheletro e nei denti, per lo più

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

13. Anticorpi. (vedi singoli sottocapitoli) I edizione. 13. Anticorpi...1

13. Anticorpi. (vedi singoli sottocapitoli) I edizione. 13. Anticorpi...1 1 13. Anticorpi I edizione (vedi singoli sottocapitoli) 13. Anticorpi...1 13.1. STRUTTURA DEGLI ANTICORPI ED I GENI DELLE IMMUNOGLOBULINE...3 13.1.1. Struttura/funzione degli anticorpi...4 13.1.2. Dominii

Dettagli

Terapie con cellule staminali nella SM. Quali cellule staminali per quale tipologia di SM? 9

Terapie con cellule staminali nella SM. Quali cellule staminali per quale tipologia di SM? 9 Indice Introduzione 3 Cos è la SM? 4 Cosa sono le cellule staminali? 5 Cos è una terapia con cellule staminali? 7 Quali possibili utilizzi delle cellule staminali nella SM? 7 Quali cellule staminali per

Dettagli

Cos'è esattamente la gelatina

Cos'è esattamente la gelatina Cos'è esattamente la gelatina LA GELATINA È PURA E NATURALE La gelatina attualmente in commercio viene prodotta in moderni stabilimenti operanti in conformità ai più rigorosi standard di igiene e sicurezza.

Dettagli

FARMACOLOGIA DEL SISTEMA NERVOSO AUTONOMO SIMPATICO. Il sistema ortosimpatico media le risposte della reazione di lotta e fuga

FARMACOLOGIA DEL SISTEMA NERVOSO AUTONOMO SIMPATICO. Il sistema ortosimpatico media le risposte della reazione di lotta e fuga FARMACOLOGIA DEL SISTEMA NERVOSO AUTONOMO SIMPATICO Il sistema ortosimpatico media le risposte della reazione di lotta e fuga Le basi anatomiche del sistema nervoso autonomo Reazioni connesse alla digestione

Dettagli

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD)

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Pædiatric Rheumatology InterNational Trials Organisation Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Che cos è? Il deficit di mevalonato chinasi è una malattia genetica. E un errore congenito

Dettagli

Relazione tra Vitamina D, Obesità infantile e Sindrome Metabolica: un puzzle in via di risoluzione

Relazione tra Vitamina D, Obesità infantile e Sindrome Metabolica: un puzzle in via di risoluzione 3 Maggio 2012 Relazione tra Vitamina D, Obesità infantile e Sindrome Metabolica: un puzzle in via di risoluzione Emanuele Miraglia del Giudice Seconda Università degli Studi di Napoli Dipartimento di Pediatria

Dettagli

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è Emofilia Malattia ereditaria X cromosomica recessiva A deficit del fatt VIII B deficit del fatt IX Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Antiossidanti endogeni. fotoprotezione

Antiossidanti endogeni. fotoprotezione Pietro Santoianni Professore Emerito di Dermatologia Docente nel Dottorato di Ricerca in Dermatologia Sperimentale Dipartimento di Patologia sistematica, Sezione di Dermatologia Università di Napoli Federico

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

INFLUENZA. Che cos è

INFLUENZA. Che cos è INFLUENZA Che cos è L influenza è una malattia infettiva provocata da virus del genere Othomixovirus che colpiscono le vie aeree come naso, gola e polmoni. I soggetti colpiti nel nostro Paese vanno dai

Dettagli

-uno o più IONI INORGANICI

-uno o più IONI INORGANICI Coenzimi e vitamine Alcuni enzimi, per svolgere la loro funzione, hanno bisogno di componenti chimici addizionali, i COFATTORI APOENZIMA + COFATTORE = OLOENZIMA = enzima cataliticamente attivo Il cofattore

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

Descrivere la struttura e la funzione di un fuso neuromuscolare. Che cosa si intende per coattivazione alfa-gamma? Differenziare fra riflesso

Descrivere la struttura e la funzione di un fuso neuromuscolare. Che cosa si intende per coattivazione alfa-gamma? Differenziare fra riflesso Descrivere la struttura e la funzione di un fuso neuromuscolare. Che cosa si intende per coattivazione alfa-gamma? Differenziare fra riflesso miotatico fasico e riflesso miotatico tonico. Inibizione dell

Dettagli

ISTITUTO ONCOLOGICO VENETO Istituto di ricovero e cura a carattere scientifico. Linea di ricerca. Via Gattamelata, 64 35128 Padova

ISTITUTO ONCOLOGICO VENETO Istituto di ricovero e cura a carattere scientifico. Linea di ricerca. Via Gattamelata, 64 35128 Padova ISTITUTO ONCOLOGICO VENETO Istituto di ricovero e cura a carattere scientifico Linea di ricerca Via Gattamelata, 64 35128 Padova Linea di ricerca 8 Immunologia dei tumori e approcci terapeutici Innovativi

Dettagli

INTERVENTO DI ARTROPROTESI D ANCA

INTERVENTO DI ARTROPROTESI D ANCA INTERVENTO DI ARTROPROTESI D ANCA Particolare dell incisione chirurgica Componenti di protesi d anca 2 Immagine di atrosi dell anca Sostituzione mediante artroprotesi La protesizzazione dell anca (PTA)

Dettagli

-Composti organici essenziali per la vita

-Composti organici essenziali per la vita -Composti organici essenziali per la vita -La maggior parte dei vertebrati (tra cui l uomo) non sono in grado di sintetizzarle (come gli amminoacidi essenziali) -Sono assunte con la dieta -Alcune malattie

Dettagli

Catene Leggere Libere nel Siero

Catene Leggere Libere nel Siero Conoscere e capire il dosaggio delle Catene Leggere Libere nel Siero International Myeloma Foundation 12650 Riverside Drive, Suite 206 North Hollywood, CA 91607 USA Telephone: 800-452-CURE (2873) (USA

Dettagli

L ACQUA : STRUTTURA E PROPRIETA

L ACQUA : STRUTTURA E PROPRIETA L ACQUA : STRUTTURA E PROPRIETA 1. Sostanza più abbondante in tutti gli esseri viventi 2. Più del 70% del peso di tutti gli esseri viventi 3. Influenza la struttura e la proprietà di tutte le molecole

Dettagli

da Norda una Novità nel Mondo del Beverage

da Norda una Novità nel Mondo del Beverage da Norda una Novità nel Mondo del Beverage Benessere da Bere una Carica di Energia Prima in Italia, Norda lancia sul mercato, una Linea INNOVATIVA di Bevande Funzionali che è già un Grande Successo negli

Dettagli

Dall inizio alla fine, un binomio inscindibile: Calcio piu vit. A e D

Dall inizio alla fine, un binomio inscindibile: Calcio piu vit. A e D Dall inizio alla fine, un binomio inscindibile: Calcio piu vit. A e D IL CALCIO La definizione classica per questo elemento e quella di essere un Metallo Alcalino Terroso. Non si trova libero in Natura,

Dettagli

Diabete e nefropatia cronica (o malattia renale cronica)

Diabete e nefropatia cronica (o malattia renale cronica) Diabete e nefropatia cronica (o malattia renale cronica) Cos è il diabete? Il diabete mellito, meglio noto come diabete, è una malattia che compare quando l organismo non produce insulina a sufficienza

Dettagli

La programmazione di uno studio clinico: dalla domanda al disegno

La programmazione di uno studio clinico: dalla domanda al disegno Metodo epidemiologici per la clinica _efficacia / 1 La programmazione di uno studio clinico: dalla domanda al disegno La buona ricerca clinica Non è etico ciò che non è rilevante scientificamente Non è

Dettagli

Documento 02 Tipologia di Prodotto/Servizio Sezione Ematologia. Documento 02 Tipologia di Prodotto/Servizio Sezione Ematologia

Documento 02 Tipologia di Prodotto/Servizio Sezione Ematologia. Documento 02 Tipologia di Prodotto/Servizio Sezione Ematologia Pag. 1 di 6 Rev Data Redatto e elaborato Approvato Firma 0 04/03/2011 Coord.Infermieristico M.Renovi Dirigente Medico Resp. Dr. A. Stefanelli Direttore U.O.C. Medicina Generale Dott.ssa P. Lambelet Direttore

Dettagli

La DIGESTIONE. I principi nutritivi sono: le proteine, i glucidi, i lipidi, le vitamine, i sali minerali e l acqua.

La DIGESTIONE. I principi nutritivi sono: le proteine, i glucidi, i lipidi, le vitamine, i sali minerali e l acqua. La DIGESTIONE Perché è necessario nutrirsi? Il corpo umano consuma energia per muoversi, pensare, mantenere la temperatura costante, ma anche solo per riposarsi. Il consumo minimo di energia è detto metabolismo

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

Fabbisogni vitaminici: ci sono le basi per ri-valutare le specifiche delle diete?

Fabbisogni vitaminici: ci sono le basi per ri-valutare le specifiche delle diete? Fabbisogni vitaminici: ci sono le basi per ri-valutare le specifiche delle diete? Tratto da Vitamin requirements: is there basis for re-evaluating dietary specifications? S. LEESON 1 Tradotto, adattato

Dettagli

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza?

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Con ALLIANCE Uvitec di Eppendorf Italia risparmi tempo e materiale di consumo, ottieni immagini quantificabili e ci guadagni anche in salute.

Dettagli

LA MOBILITÀ ARTICOLARE

LA MOBILITÀ ARTICOLARE LA MOBILITÀ ARTICOLARE DEFINIZIONE La mobilità articolare (detta anche flessibilità o scioltezza articolare) è la capacità di eseguire, nel rispetto dei limiti fisiologicamente imposti dalle articolazioni,

Dettagli