07/01/2015. La trasposasi induce l escissione del trasposone. Importanza dei trasposoni come fonte di diversità genetica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "07/01/2015. La trasposasi induce l escissione del trasposone. Importanza dei trasposoni come fonte di diversità genetica"

Transcript

1 La trasposasi induce l escissione del trasposone In maniera dipendente da segnali ambientali o dalla replicazione della cellula batterica, l espressione della trasposasi può essere attivata e portare al distacco (escissione) del trasposone. La rottura a doppia elica nel cromosoma può essere risaldata dalla trasposasi stessa Importanza dei trasposoni come fonte di diversità genetica I trasposoni possono portare geni codificanti per fattori di virulenza, resistenza ad antibiotici, vie metaboliche La loro capacità di saltare da un elemento genetico all altro (es. cromosoma>plasmide) ne permette un frequente trasferimento intercellulare e interspecie Ruolo dei virus batterici (batteriofagi) nella generazione di diversità genetica. Hershey and Chase, 1952 Utilizza il batteriofago T2 come sistema sperimentale Marcature specifiche delle macromolecole: DNA marcato con 32 P; proteine del fago marcato 35 S 1

2 Ciclo litico e ciclo lisogenico stessa informazione genetica (cromosoma batterico + DNA fagico) due diversi destini La trasduzione (generalizzata)-i Un fago litico si moltiplica all interno della cellula ospite replicando con alta efficienza il suo DNA. Il DNA dell ospite può essere degradato nel processo ed incorporato per errore in una particella fagica Particella fagica con DNA dell ospite 2

3 La trasduzione (generalizzata)-ii La particella fagica con DNA ospite (particella trasduttante) può adsorbirsi ad un nuovo batterio ed iniettarvi il DNA al suo interno. Questo DNA non codifica per funzioni fagiche: può essere degradato dalla cellula ospite o acquisito per eventi di ricombinazione nel cromosoma dell ospite. Conclusioni La diversità genetica nei microrganismi si origina da due processi fondamentali: Mutazioni Trasferimento genico orizzontale Trasformazione Coniugazione Trasposizione Trasduzione Lisogenia o da combinazioni di questi eventi Cosa sono i virus? elementi genetici (DNA o RNA) protetti da matrici proteiche e capaci di moltiplicarsi all interno di una cellula (dipendenza da un ospite) abbandonare la cellula in cui si sono moltiplicati entrare in (= infettare) altre cellule questi elementi genetici possono esistere temporaneamente anche al di fuori delle cellule, come particelle nucleoproteiche infettive (virioni) In questo stato, però, NON SONO CAPACI DI MOLTIPLICARSI. 3

4 Dove si trovano i virus? LE PARTICELLE VIRALI (DETTE VIRIONI) SONO PRESSOCHE UBIQUITARIE ma metabolicamente inattive I VIRUS (intesi come elementi genetici autoreplicantesi) LI TROVIAMO DENTRO LE CELLULE, ANIMALI, VEGETALI, O BATTERICHE, CHE LI OSPITANO OGNI ORGANISMO HA I SUOI VIRUS virus batterici e di archea (detti anche batteriofagi, o fagi) virus vegetali virus animali Come sono fatti i virus (i virioni)? Il virione contiene un solo acido nucleico: virus a RNA oppure virus a DNA Varietà nelle dimensioni del genoma ( bp) Varietà nella struttura dell acido nucleico: a singola elica, oppure a doppia elica. lineare, oppure circolare. un unica molecola, oppure più di una molecola: molecole diverse o copie della stessa Come sono fatti i virus (i virioni)? L INVOLUCRO E FATTO DI PROTEINE (TUTTI I VIRUS): CAPSIDE (o nucleocapside) capside, capsomeri, protomeri RIVESTIMENTO O ENVELOPE (non sempre presente): LIPIDI PIU O MENO MODIFICATI, POLISACCARIDI, PROTEINE E LIPOPROTEINE 4

5 Cosa fanno i virus Si riproducono, usando informazioni genetiche proprie l apparato metabolico della cellula ospite Interagiscono con gli organismi ospiti e contribuiscono alla loro evoluzione Possono instaurare interazioni permanenti con la cellula ospite, arricchendola di informazioni genetiche preconfezionate. Disseminano informazione genetica, sia propria che delle cellule che li hanno ospitati. Replicazione dei Virus Adsorbimento Penetrazione Sintesi degli acidi nucleici e delle proteine Montaggio Rilascio Grande varietà di strategie e meccanismi Virus del Mosaico del Tabacco (TMV) Struttura elicoidale, bastoncello rigido. Nello schema è rappresentato ca. il 5% di un virione. Diametro: 18 nm Lunghezza: 300 nm Protomeri: 17,400 Da; 49/3 giri d elica (ca. 2,130 protomeri/ virione) RNA: ca. 6,000 nt 5

6 Un virus icosaedrico Un batteriofago icosaedrico con testa e coda Fago P2 Fago l 6

7 Sviluppo dell infezione da un batteriofago altamente virulento, il fago T4 7

unità 4. Dalla genetica alle biotecnologie

unità 4. Dalla genetica alle biotecnologie I virus I virus non vengono considerati esseri viventi. Ciò è dovuto al fatto che queste particelle microscopiche non sono in grado di svolgere alcuna funzione metabolica e non possono riprodursi autonomamente.

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

aggregati di macromolecole dato virus contiene un solo tipo di acido nucleico (DNA o RNA)

aggregati di macromolecole dato virus contiene un solo tipo di acido nucleico (DNA o RNA) Virus Virus Non sono classificati fra gli organismi viventi in quanto non sono cellule, bensì aggregati di macromolecole (acidi nucleici, proteine, talvolta rivestite da membrana fosfolipidica) Non possono

Dettagli

DNA batterico. Nei batteri le mutazioni possono essere indotte e/o spontanee

DNA batterico. Nei batteri le mutazioni possono essere indotte e/o spontanee DNA batterico Il DNA batterico si replica in modo semiconservativo, utilizzando entrambi i filamenti come stampo e richiede l intervento di numerosi enzimi. Nei batteri le mutazioni possono essere indotte

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

ORGANIZZAZIONE DI UNA CELLULA PROCARIOTICA

ORGANIZZAZIONE DI UNA CELLULA PROCARIOTICA ORGANIZZAZIONE DI UNA CELLULA PROCARIOTICA Costituisce gli gli organismi PROCARIOTI = unicellulari BACILLI (bastoncelli) COCCHI (sferici) SPIRILLI (spirale) 0.3-2 µm Streptococchi (catenella) Stafilococchi,

Dettagli

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi Enorme diversità di forme Costanza di struttura interna La cellula è l unità fondamentale di tutti gli organismi viventi

Dettagli

segmenti genetici contenuti in due genomi separati vengono messi insieme in un unica unità

segmenti genetici contenuti in due genomi separati vengono messi insieme in un unica unità RICOMBINAZIONE GENICA segmenti genetici contenuti in due genomi separati vengono messi insieme in un unica unità Si ottengono nuove combinazioni di geni anche in assenza di mutazione Le modificazioni provocate

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

LA MOLTIPLICAZIONE DEI VIRUS

LA MOLTIPLICAZIONE DEI VIRUS LA MOLTIPLICAZIONE DEI VIRUS I virioni, rappresentano la fase biologicamente inattiva, dei singoli virus. Le diverse famiglie di virus utilizzano strategie replicative a causa della differente organizzazione

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Reovirus. Stabili in svariate condizioni di ph, T e negli aerosol.

Reovirus. Stabili in svariate condizioni di ph, T e negli aerosol. Orthoreovirus, Rotavirus, Orbivirus, Coltivirus Caratteri generali: Privi di mantello. Due involucri capsidici. 10-12 segmenti di RNA genomico a doppio filamento. Reovirus Stabili in svariate condizioni

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

8. MUTAZIONI CROMOSOMICHE

8. MUTAZIONI CROMOSOMICHE 8. MUTAZIONI CROMOSOMICHE CAUSA: segregazione mitotica o meiotica errata TIPI: Poliploidia (3n, 4n, ecc) Autopliploidia Allopoloploidia Cause: dispermia, endomitosi, meiosi anomala EFFETTI: spesso letale

Dettagli

UNIVERSITÀ DEGLI STUDI DI ROMA TOR VERGATA. Facoltà di Medicina e Chirurgia anno accademico 2007/2008 VIROLOGIA GENERALE T.G.

UNIVERSITÀ DEGLI STUDI DI ROMA TOR VERGATA. Facoltà di Medicina e Chirurgia anno accademico 2007/2008 VIROLOGIA GENERALE T.G. UNIVERSITÀ DEGLI STUDI DI ROMA TOR VERGATA Facoltà di Medicina e Chirurgia anno accademico 2007/2008 VIROLOGIA GENERALE T.G. La scoperta dei virus Prima descrizione di patologia di origine virale: Vaiolo

Dettagli

CELLULE EUCARIOTICHE

CELLULE EUCARIOTICHE CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica, citoplasma, DNA e ribosomi (comuni a

Dettagli

La natura dei virus. Caratteristiche morfologiche e proprietà distintive

La natura dei virus. Caratteristiche morfologiche e proprietà distintive La natura dei virus Caratteristiche morfologiche e proprietà distintive COS E UN VIRUS? MICRORGANISMO O AGENTE INFETTIVO??? PARASSITI INTRACELLULARI OBBLIGATI UN PROGRAMMA GENETICO RIVESTITO DA PROTEINE

Dettagli

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,

Dettagli

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO GENERALITA A causa della natura di PARASSITA INTRACELLULARE OBBLIGATO, il virus può esprimere la sua attività biologica solo all interno di una CELLULA OSPITE che permetta la completa espressione del suo

Dettagli

La metagenomica al servizio dell agricoltura

La metagenomica al servizio dell agricoltura La metagenomica al servizio dell agricoltura Marco Bazzicalupo Department of Biology University of Florence, Firenze, Italy http://www.unifi.it/dblage/mdswitch.html L albero della vita è microbico RNA

Dettagli

e prioni Introduzione C A P I T O L O 17 Virus, viroidi

e prioni Introduzione C A P I T O L O 17 Virus, viroidi 17_Schaechter_def 17-10-2007 16:35 Pagina 335 C A P I T O L O 17, viroidi e prioni Introduzione Struttura Ecologia e classificazione Replicazione virale Attacco e penetrazione Strategie di sintesi di acidi

Dettagli

Genetica dei microrganismi

Genetica dei microrganismi Genetica dei microrganismi Dott.ssa Silvia Preziuso Dipartimento di Scienze Veterinarie Università di Camerino Sezione di Patologia Animale, Profilassi e Igiene degli Alimenti Argomenti trattati Gli acidi

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

Elementi ripetuti del Genoma Umano. Milioni di anni

Elementi ripetuti del Genoma Umano. Milioni di anni Elementi ripetuti del Genoma Umano Patologia Milioni di anni Evoluzione Un gene è duplicato Un gene è riarrangiato Genoma Il Genoma è l intero DNA contenuto in una Cellula Geni Sequenze Intergeniche Sequenze

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

Livello di organizzazione degli esseri viventi

Livello di organizzazione degli esseri viventi Livello di organizzazione degli esseri viventi _Organismo; _Apparato; _Organo; _Tessuti; _Cellule; _Organelli cellulari; _Molecole. Atomo, elemento, molecola, composto, formula, legame, elettronegativita.

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

Lezione del 24 Ottobre 2014

Lezione del 24 Ottobre 2014 MECCANISMI MOLECOLARI DEGLI STATI PATOLOGICI MECCANISMI MOLECOLARI DELLE MALATTIE METABOLICHE Lezione del 24 Ottobre 2014 EZIOLOGIA Studia le cause che inducono un turbamento persistente dell omeostasi

Dettagli

Protocollo dei saperi imprescindibili

Protocollo dei saperi imprescindibili Protocollo dei saperi imprescindibili Ordine di scuola:professionale DISCIPLINA: Scienze integrate( Scienze della Terra e Biologia) RESPONSABILE: Meri Teti CLASSI SECONDE SEZIONE B INDIRIZZO: Grafico CONOSCENZE/CONTENUTI:

Dettagli

TRASFERIMENTO GENICO IN CELLULE VEGETALI: PIANTE TRANSGENICHE

TRASFERIMENTO GENICO IN CELLULE VEGETALI: PIANTE TRANSGENICHE TRASFERIMENTO GENICO IN CELLULE VEGETALI: PIANTE TRANSGENICHE Perché manipolare geneticamente le cellule vegetali Per studiare la funzione di geni e proteine tipici degli organismi vegetali Per produrre

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

CHE COSA E UNA MALATTIA INFETTIVA?

CHE COSA E UNA MALATTIA INFETTIVA? MALATTIE INFETTIVE CHE COSA E UNA MALATTIA INFETTIVA? E IL RISULTATO DEL CONTATTO TRA UN SOGGETTO SANO E UN MICRORGANISMO I MICRORGANISMI POSSONO ESSERE DI DIVERSI TIPI: BATTERI VIRUS FUNGHI BATTERI Posseggono

Dettagli

Dal DNA alle proteine: l espressione genica

Dal DNA alle proteine: l espressione genica Dal DNA alle proteine: l espressione genica La terapia genica costituisce una frontiera per la medicina moderna. Grazie a questa tecnica in futuro si potranno curare più efficacemente molte malattie. Per

Dettagli

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia Capitolo 6 Trasferimento genetico e mappatura genetica nei batteri e nei batteriofagi 6.1 Circa 10 8 cellule di Escherichia coli appartenenti a un ceppo mutante vengono inoculate su un terreno colturale

Dettagli

UNIVERSITA' degli STUDI di PERUGIA Facoltà di MEDICINA e CHIRURGIA Corso di Laurea in Medicina e Chirurgia AA 2011-2012.

UNIVERSITA' degli STUDI di PERUGIA Facoltà di MEDICINA e CHIRURGIA Corso di Laurea in Medicina e Chirurgia AA 2011-2012. UNIVERSITA' degli STUDI di PERUGIA Facoltà di MEDICINA e CHIRURGIA Corso di Laurea in Medicina e Chirurgia AA 2011-2012 Rhabdovirus Rhabdoviridae: Virus della rabbia a) Vesiculovirus - virus della stomatite

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Terapia Genica. Trattamento di patologie umane in cui il farmaco è materiale genetico

Terapia Genica. Trattamento di patologie umane in cui il farmaco è materiale genetico Terapia Genica Trattamento di patologie umane in cui il farmaco è materiale genetico Storia clinica della terapia genica E cominciata nel 1990 con trattamento ex vivo di pazienti affetti da immunodeficienza

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

MEMBRANE. struttura: fosfolipidi e proteine

MEMBRANE. struttura: fosfolipidi e proteine MEMBRANE struttura: fosfolipidi e proteine I lipidi sono sostanze di origine biologica insolubili in acqua. Vi fanno parte: trigliceridi, fosfolipidi, colesterolo, sfingolipidi, alcoli alifatici, cere,

Dettagli

Applicazioni della biologia molecolare

Applicazioni della biologia molecolare Applicazioni della biologia molecolare Il settore che ha maggiormente risentito dell impatto delle tecniche del DNA ricombinante è stato quello della medicina. 1)In questo campo la prima ricaduta è stata

Dettagli

Lipidi: funzioni. Strutturale. Riserva energetica. Segnale.

Lipidi: funzioni. Strutturale. Riserva energetica. Segnale. Lipidi: funzioni. Strutturale. Riserva energetica. Segnale. Lipidi:classificazione. Saponificabili Non saponificabili Semplici Complessi Prostaglandine Steroidi Cere Trigliceridi Fosfogliceridi Sfingolipidi

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Lezione n. 2 OLTRE LA MICROSCOPIA OTTICA:

Lezione n. 2 OLTRE LA MICROSCOPIA OTTICA: Lezione n. 2 OLTRE LA MICROSCOPIA OTTICA: Le nuove nano -scopie (Parte I) Sandro Carrara Corso di NanoBioTecnologie Il microscopio ci fa vedere le cose micro -scopiche Microbi Cellule I circuiti della

Dettagli

Caratteristiche generali dei virus

Caratteristiche generali dei virus CORSO DI LAUREA MAGISTRALE SCIENZE DELLA NUTRIZIONE UMANA ANNO ACCADEMICO 2013-2014 Corso Integrato di Microbiologia Agroalimentare e Microbiologia Applicata Caratteristiche generali dei virus Dr.ssa Claudia

Dettagli

Contenuti del SYLLABUS per Corsi Integrati Medicina e Chirurgia Corso di Laurea

Contenuti del SYLLABUS per Corsi Integrati Medicina e Chirurgia Corso di Laurea Facoltà Contenuti del SYLLABUS per Corsi Integrati Medicina e Chirurgia Corso di Laurea Tecniche di Radiologia Medica, per Immagini e Radioterapia Tipologia Corso di Laurea Triennale Nota per la compilazione:

Dettagli

VIRUS. Struttura Anatomica

VIRUS. Struttura Anatomica VIRUS 1 I virus sono parassiti intercellulari composti da materiale genetico (DNA o RNA) non protetto da alcun rivestimento proteico. Inerti finché si trovano all'esterno della cellula ospite, diventano

Dettagli

Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni

Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni Docente: dott. Tiziano Baroni (tbaroni@unipg.it) Il corso (1 CFU=30 ore), affronterà argomenti teorici e pratici concernenti

Dettagli

La ricombinazione del DNA

La ricombinazione del DNA La ricombinazione del DNA Ricombinazione omologa I modelli di Halliday e di Meselson-Redding. Il complesso RecBCD genera il filamento di DNA invasore. La proteina RecA promuove lo scambio dei filamenti

Dettagli

Attualmente le applicazioni più promettenti si hanno in campo biomedico, ambientale ed agroalimentare.

Attualmente le applicazioni più promettenti si hanno in campo biomedico, ambientale ed agroalimentare. 2007 INTRODUZIONE L ingegneria genetica è una scienza che si occupa di tecniche (biotecnologia) che hanno l obiettivo di inserire, eliminare, inattivare o modificare geni all interno di un organismo, producendo

Dettagli

Sistemi genetici batterici e virali. La genetica batterica, coniugazione, trasformazione La genetica virale, trasduzione

Sistemi genetici batterici e virali. La genetica batterica, coniugazione, trasformazione La genetica virale, trasduzione Genetica 3 Sistemi genetici batterici e virali La genetica batterica, coniugazione, trasformazione La genetica virale, trasduzione Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 Pierce, GENETICA,

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

INFEZIONE DA HIV ED AIDS WWW.SLIDETUBE.IT

INFEZIONE DA HIV ED AIDS WWW.SLIDETUBE.IT INFEZIONE DA HIV ED AIDS HIV 1 ed HIV 2 appartengono alla famiglia dei Retroviridae, genere lentovirus. L infezione da HIV provoca nell ospite una progressiva compromissione delle difese immunitarie, soprattutto

Dettagli

CLONAGGIO DEL DNA. Clonare significa produrre copie identiche: CLONI.

CLONAGGIO DEL DNA. Clonare significa produrre copie identiche: CLONI. CLONAGGIO CLONAGGIO DEL DNA Clonare significa produrre copie identiche: CLONI. Il CLONAGGIO consiste nella moltiplicazione di un segmento di DNA appartenente ad un dato genoma. Ciò si ottiene unendo tale

Dettagli

Normale controllo della crescita cellulare

Normale controllo della crescita cellulare Normale controllo della crescita cellulare STOP STOP Cellula normale STOP Alterato controllo della crescita cellulare X STOP STOP Cellula tumorale STOP X Le cellule tumorali presentano alterazioni cromosomiche

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Applicazione delle tecniche di Microscopia ad epifluorescenza e di Citometria a flusso allo studio del Materiale Particellare sospeso in atmosfera

Applicazione delle tecniche di Microscopia ad epifluorescenza e di Citometria a flusso allo studio del Materiale Particellare sospeso in atmosfera Applicazione delle tecniche di Microscopia ad epifluorescenza e di Citometria a flusso allo studio del Materiale Particellare sospeso in atmosfera F. Marcovecchio 1,2, C. Perrino 2, S. Amalfitano 3 1 Dipartimento

Dettagli

unità C1. All interno delle cellule

unità C1. All interno delle cellule Tutti gli organismi sono formati da cellule procariotiche (con DNA sparso all interno) eucariotiche (con DNA contenuto nel nulcleo) animali vegetali Le cellule hanno in comune la membrana plasmatica il

Dettagli

I virus vegetali nella formulazione di un vaccino contro il virus HIV-1

I virus vegetali nella formulazione di un vaccino contro il virus HIV-1 "Molecular Farming: produzione di cibi funzionali, di nutraceutici e biofarmaceutici" ENEA - Casaccia 4 Dicembre 2003 I virus vegetali nella formulazione di un vaccino contro il virus HIV-1 Carla Marusic

Dettagli

PROGRAMMA CONSUNTIVO

PROGRAMMA CONSUNTIVO PROGRAMMA CONSUNTIVO a.s. 2014/2015 MATERIA Scienze Naturali CLASSE Quinta SEZIONE C INDIRIZZO Liceo delle Scienze Applicate DOCENTE Virtuoso Assunta ORE DI LEZIONE Cinque OBIETTIVI **************** Spiegare

Dettagli

ELETTROFORESI SU GEL

ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi

Dettagli

Sulla base del tipo di acido nucleico e delle modalità di trascrizione del mrna, il virologo

Sulla base del tipo di acido nucleico e delle modalità di trascrizione del mrna, il virologo Classificazione dei virus Sulla base del tipo di acido nucleico e delle modalità di trascrizione del mrna, il virologo David Baltimore ha proposto una divisione che raggruppa i virus in 7 classi. Classe

Dettagli

04_12_08. Microscopia confocale. Esempio di analisi con focale: vedi il filmato corrispondente. Vedi filmato

04_12_08. Microscopia confocale. Esempio di analisi con focale: vedi il filmato corrispondente. Vedi filmato Citologia Animale e Vegetale (corso A - I. Perroteau) - microscopia confocale Microscopia confocale 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - microscopia confocale Esempio di analisi con

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

VETTORI DI CLONAGGIO

VETTORI DI CLONAGGIO VETTORI DI CLONAGGIO Perché clonare il DNA Per preparare una sonda di ibridazione Per costruire una genoteca allo scopo di isolare un gene o un cdna Per trascrivere un gene e ottenere quantità elevate

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

NORMATIVA OGM IN ALIMENTI, SEMENTI E COLTURE AGRARIE

NORMATIVA OGM IN ALIMENTI, SEMENTI E COLTURE AGRARIE NORMATIVA OGM IN ALIMENTI, SEMENTI E COLTURE AGRARIE Che cosa sono le piante transgeniche? Transgenesi indica il trasferimento di geni mediante la tecnologia del DNA ricombinante. Il gene viene trasferito

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna

Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Prof. Giorgio Gallinella Prof.ssa Giovanna Gentilomi Dott.ssa Francesca Bonvicini (ricercatore) Dott.ssa Elisabetta Manaresi

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Argomento della lezione

Argomento della lezione Argomento della lezione I linfociti T Struttura del TCR e dei corecettori CD3, CD4 e CD8 Maturazione dei linfociti T Struttura del timo Riarrangiamento genico delle catena α e β Selezione timica: acquisizione

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

LAB-NEWS Anno 1 n 4 Aprile 2006

LAB-NEWS Anno 1 n 4 Aprile 2006 1 FAVISMO (DEFICIT G6PD) Cos è il deficit di G6PD? Il deficit di G6PD o favismo è una condizione determinata dalla carenza dell enzima glucosio-6-fosfatodeidrogenasi (G6PD), importante in una via metabolica

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli

PROGRAMMA DELL INSEGNAMENTO. Scienze biomolecolari (5 CFU)

PROGRAMMA DELL INSEGNAMENTO. Scienze biomolecolari (5 CFU) Corso di Laurea in Infermieristica PROGRAMMA DELL INSEGNAMENTO Scienze biomolecolari (5 CFU) AREA DI APPRENDIMENTO Discipline biomediche di base Al termine del corso dell insegnamento Scienze biomolecolari

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente.

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. CHE COS E LA CELLULA? La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. DA COSA SONO COSTITUITE LE CELLULE? Tutte le

Dettagli

PSEUDORABBIA. Scheda pseudorabbia Pag. 1. Caratteristiche della patologia E.1 Malattia E.1.1 Nome patologia

PSEUDORABBIA. Scheda pseudorabbia Pag. 1. Caratteristiche della patologia E.1 Malattia E.1.1 Nome patologia PSEUDORABBIA Caratteristiche della patologia Informazioni E.1 Malattia E.1.1 Nome patologia Pseudorabbia (Malattia di Aujeszky). E.1.2 Agente/i eziologico/i Herpesvirus del suino (PRV). E.1.3 Breve descrizione

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

- lipidi strutturali, costituenti fondamentali delle membrane cellulari ed intracellulari (fosfolipidi, glicolipidi e colesterolo)

- lipidi strutturali, costituenti fondamentali delle membrane cellulari ed intracellulari (fosfolipidi, glicolipidi e colesterolo) I lipidi, o grassi, costituiscono un gruppo eterogeneo di sostanze accomunate dalla proprietà fisica della insolubilità nei solventi polari (es. acqua) (idrofobicità) e dalla solubilità nei soventi organici

Dettagli

Caratteristiche generali dei virus

Caratteristiche generali dei virus I virus 1898: Beijerinck e Iwanowsky dimostrano che il mosaico del tabacco è una malattia infettiva sostenuta da un agente filtrabile; Loeffler e Frosch isolano da animali il virus dell'afta epizootica

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

Programma Didattico Annuale

Programma Didattico Annuale LICEO SCIENTIFICO STATALE GALILEO GALILEI PdQ - 7.06 Ediz.: 1 Rev.: 0 Data 02/09/05 Alleg.: D01 PROG. M2 PROCEDURA della QUALITA' Programma Didattico Annuale Anno Scolastico 2012/2013 MATERIA : Scienze

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE

LA TECNOLOGIA DEL DNA RICOMBINANTE UNITÀ VET. DIDATTICA DI BIOLOGIA MOLECOLARE LA TECNOLOGIA DEL DNA RICOMBINANTE Roberto Giacominelli Stuffler 1. Gli enzimi di restrizione 2. La trascrittasi inversa 3. Il DNA ricombinante 4. La PCR 2 GLI

Dettagli

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia Ingegneria delle tecnologie per la salute Anatomia e istologia umana Cenni di Biologia Macromolecole: Glucidi Lipidi Proteine Acidi nucleici glucidi Monosaccaridi: glucosio, fruttosio, galattosio, desossiribosio,

Dettagli

STEFANO RUFINI Stanza: 371 Tel. 0672594371 email: rufini@uniroma2.it. Didattica web: Fisiologia per Biologia

STEFANO RUFINI Stanza: 371 Tel. 0672594371 email: rufini@uniroma2.it. Didattica web: Fisiologia per Biologia STEFANO RUFINI Stanza: 371 Tel. 0672594371 email: rufini@uniroma2.it Didattica web: Fisiologia per Biologia LIBRI TESTO CONSIGLIATI SILVERTHORN - FISIOLOGIA Pearson - 94 Euro STANFIELD-GERMAN - FISIOLOGIA

Dettagli

Uso di vettori lentivirali per trasdurre linee cellulari di adenocarcinoma colorettale con shrnas silenzianti il gene herg1

Uso di vettori lentivirali per trasdurre linee cellulari di adenocarcinoma colorettale con shrnas silenzianti il gene herg1 Uso di vettori lentivirali per trasdurre linee cellulari di adenocarcinoma colorettale con shrnas silenzianti il gene herg1 e loro applicazione in studi pre-clinici. Il trasferimento genico è una tecnologia

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

FENILCHETONURIA. Adattarsi ad una nuova realtà

FENILCHETONURIA. Adattarsi ad una nuova realtà FENILCHETONURIA Adattarsi ad una nuova realtà 9 Che cosa è la fenilchetonuria? Per capire la fenilchetonuria bisogna partire dal concetto che tutti gli alimenti, in quantità variabile, contengono una sostanza

Dettagli

PRINCIPI DI DIAGNOSTICA VIROLOGICA

PRINCIPI DI DIAGNOSTICA VIROLOGICA PRINCIPI DI DIAGNOSTICA VIROLOGICA PRINCIPI DI DIAGNOSTICA VIROLOGICA Generalità I virus sono parassiti endocellulari obbligati, la particella virale completa (virione) presenta il genoma costituito da

Dettagli

Orthomyxovirus. G. Di Bonaventura Università di Chieti-Pescara

Orthomyxovirus. G. Di Bonaventura Università di Chieti-Pescara G. Di Bonaventura Università di Chieti-Pescara Caratteri generali I virus dell influenza A, B, C sono gli unici membri della Famiglia Orthomyxoviridae Tutti patogeni per l uomo (A anche per animali) Virione

Dettagli