La regolazione genica nei eucarioti

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La regolazione genica nei eucarioti"

Transcript

1 La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri

2 Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono tutte lo stesso genoma ma il proteoma è diverso, cioè le cellule esprimono proteine differenti. Il differenziamento cellulare consiste quindi nell attivazione di geni differenti

3 Espressione del genoma eucariota Cellule di organismi della stessa specie contengono la stessa quantità di DNA. Nel genoma umano solo il 2% del DNA di ogni cellula codifica per le proteine.

4 Espressione genica negli eucarioti Nelle cellule eucariote, soprattutto negli organismi pluricellulari, i meccanismi della regolazione genica sono molto più complessi che nelle cellule procariote e si realizzano in vari modi: favorendo o impedendo la trascrizione del DNA rielaborando il trascritto primario dell mrna inibendo la traduzione

5 Livelli multipli di regolazione dell espressione genica degli eucarioti

6 Caratteristiche del cromosoma eucariote Per genoma si intende il corredo di cromosomi contenuto in ogni cellula di un organismo. Nelle cellule eucariote i cromosomi sono formati da una doppia elica di DNA che si avvolge intorno a proteine dette istoni, costituendo una struttura chiamata nucleosoma

7 Caratteristiche del cromosoma eucariote I nucleosomi si dispongono in maniera compatta formando un lungo filamento che si attorciglia più volte su se stesso assumendo varie configurazioni di diverso diametro.

8 La regolazione può precedere la trascrizione Quindi le cellule possono usare i più alti livelli di spiralizzazione per mantenere a lungo i geni inattivi, visto che per far attivare un gene, gli istoni devono staccarsi dal DNA (despiralizzazione). Infatti, affinché un gene possa essere trascritto, è necessario che i nucleosomi vengano «srotolati» da specifiche proteine chiamate proteine rimodellanti. Nella FIGURA si osserva come l azione di queste proteine rimodellanti permetta l apertura di uno o più nucleosomi e quindi la trascrizione di un gene specifico.

9 Eucromatina ed eterocromatina L eucromatina è la forma di DNA despiralizzato, che viene trascritto. L eterocromatina è la forma di DNA compatto, che non viene trascritto. Durante la divisione cellulare, per esempio, il compattamento è massimo e la trascrizione non avviene.

10 La regolazione del cromosoma X Nelle femmine dei mammiferi, può accadere, che uno dei due cromosomi X si presenta fortemente condensato in tutte le cellule somatiche e quasi del tutto inattivo. Questa disattivazione del cromosoma X, che può essere sia quello di origine materna che quello di origine paterna, si verifica in uno stadio precoce dello sviluppo embrionale coinvolgendo uno a caso dei due cromosomi X e viene ereditata da tutte le rispettive cellule figlie. Ad esempio, le gatte calicot sono riconoscibili per il pelo a macchie arancioni e nere. Il gene calicot si trova sul cromosoma X e il fenotipo richiede la presenza di due differenti alleli: uno per il colore del pelo arancione, e uno non arancione che risulta nero. Se una femmina è eterozigote per il gene calicot, si osserva il fenotipo calicot: le macchie arancioni sono formate da gruppi di cellule in cui è attivo il cromosoma X con l allele per il colore arancione, mentre le macchie nere sono dovute a cellule in cui è attivo il cromosoma X con l allele per il pelo non arancione. L inattivazione del cromosoma X viene annullata durante la meiosi: in tal modo ogni gamete riceve un cromosoma X funzionante.

11 Regolazione della sintesi proteica Nelle cellule eucariote la trascrizione e la traduzione avvengono separatamente nel tempo e nello spazio Il trascritto primario di RNA subisce un processo di maturazione detto splicing Da un singolo gene si possono formare diversi mrna (splicing alternativo)

12 La trascrizione presenta differenze nei procarioti e negli eucarioti Livello di regolazione Procarioti Soprattutto durante la trascrizione Eucarioti Prima, durante e dopo la trascrizione e la traduzione Siti regolatori Promotore Promotore e sequenze di controllo supplementari Coordinazione dell espressione genica Operone Tipi di RNA polimerasi Unica RNA polimerasi Interazioni RNA polimerasi Lega direttamente il promotore Ogni gene è sottoposto a una propria regolazione, anche se esistono elementi di controllo comune RNA polimerasi I (trascrive rrna) RNA polimerasi II (trascrive geni strutturali) RNA polimerasi III (trascrive trna) Lega promotore e diversi fattori di trascrizione (forma un complesso di trascrizione)

13 Gene eucariote Un gene eucariote è costituito da un promotore, da un sito di riconoscimento per l RNA polimerasi, e da sequenze codificanti (esoni) e non codificanti (introni)

14 La regolazione durante la trascrizione Diversamente dai geni degli operoni batterici, ogni gene eucariote ha di solito una propria serie di sequenze di controllo e in più, sono presenti gli induttori. Lo stato «normale», negli eucarioti pluricellulari sembra essere quello disattivato. Una cellula eucariotica ha bisogno di attivare (quindi di trascrivere) solo quella piccola parte dei geni necessaria per la sua specifica funzione all interno dell organismo. Cerchiamo di essere più chiari. Nelle cellule ci sono alcuni geni detti costitutivi, che sono sempre espressi, in quanto codificano per prodotti essenziali per tutte le cellule, ed altri geni la cui espressione deve essere precisamente regolata, in quanto i loro prodotti sono necessari solamente in una data fase della vita di una cellula in un determinato tessuto. Si pensi allo sviluppo embrionale e quindi al differenziamento cellulare.

15 La trascrizione differenziale Una delle modalità con cui le cellule ottengono tale diversificazione è basata sulla trascrizione differenziale di determinati geni in specifici tipi cellulari. Vediamo in che modo.

16 Promotore degli eucarioti Il promotore controlla la trascrizione tramite un complesso sistema costituito da una sequenza nucleotidica ricca di timina (T) e adenina (A), dal TATA box, da fattori di trascrizione (GTF) e da un sito di riconoscimento per l RNA polimerasi II.

17 Enhancer e silencer A monte del promotore si trovano siti regolatori chiamati: ENHANCER SILENCER che sono posti sotto il controllo di proteine dette: ATTIVATORI INIBITORI

18 Spesso i siti enhancer e silencer si trovano lontani dal sito di attacco dell RNApolimerasi e, pertanto, interviene un mediatore che mette in comunicazione questi geni. Ruolo del mediatore

19 Facciamo il punto sulla trascrizione differenziale L attivazione di un gene eucariotico coinvolge, oltre all RNA-polimerasi, alcune proteine di regolazione chiamate fattori di trascrizione, tra cui gli induttori; essi si legano ad alcune sequenze di DNA chiamate enhancer o intensificatori. Tramite l intervento del mediatore il DNA si ripiega e gli induttori interagiscono con altri fattori di trascrizione che poi si legano tra loro presso il promotore del gene. Questo complesso di proteine facilita il corretto legame tra l RNA-polimerasi e il promotore, e favorisce l inizio della trascrizione. Oltre agli enhancer e agli induttori, vi sono anche i repressori, proteine che possono legarsi alle sequenze di DNA chiamate silencer (silenziatori) e funzionare di conseguenza da inibitori per l avvio della trascrizione.

20 La regolazione di geni coordinati e l amplificazione genica Inoltre, i geni degli eucarioti, i cui prodotti hanno una correlazione funzionale (geni coordinati), generalmente non sono raggruppati negli operoni come succede nei procarioti, insomma non si trovano in posizione vicine su un cromosoma. Allora, per poter essere trascritti contemporaneamente questi geni devono contenere le stesse sequenze di regolazione, in grado di legarsi alle stesse proteine regolatrici (regolazione di geni coordinati). Uno dei tanti esempi di questo processo è il seguente: durante i periodi di siccità, le piante sintetizzano alcune proteine che ne permettono la sopravvivenza in condizioni di stress. Tali proteine sono codificate da geni posizionati in diverse parti del genoma, la cui espressione deve essere coordinata dato che tali proteine devono essere presenti nello stesso momento. Infine, per aumentare la produzione di una proteina rispetto ad un altra, le cellule possono ricorrere all amplificazione genica, cioè alla creazione di più copie dello stesso gene che vengono tutte trascritte contemporaneamente.

21 La regolazione dopo la trascrizione I geni che presentano introni ed esoni sono detti geni interrotti e circa la metà dei geni umani è rappresentata da geni interrotti. Una volta completata la trascrizione, gli introni (segmenti non codificanti), vengono rimossi grazie al processo di splicing. Tutto il gene viene trascritto in mrna Viene aggiunto un cappuccio necessario per indirizzare l mrna sui ribosomi e una coda di poli A Vengono rimossi gli introni, e gli esoni si legano tra loro formando l mrna maturo.

22 La regolazione tramite splicing alternativo Il processo di splicing può avere diverse varianti: l informazione portata da un gene può infatti determinare la formazione di RNA maturi diversi e la conseguente sintesi di polipeptidi differenti (splicing alternativo).

23 La regolazione durante e dopo la traduzione Anche la traduzione può essere regolata. 1. Per esempio, è possibile ostacolare l attacco dell mrna ai ribosomi tramite: la modificazione della sequenza di attacco (chiamata sequenza leader); e l attivazione di un repressore che si lega all mrna impedendone la lettura da parte dei ribosomi. 2. Nel citoplasma si trovano degli enzimi che hanno il compito di degradare le molecole di mrna una volta finita la traduzione. Tuttavia, l mrna degli eucarioti può sopravvivere diverse ore o perfino settimane. 3. I polipeptidi che si formano dopo la traduzione devono essere modificati per diventare funzionali. Negli eucarioti i meccanismi di controllo post-traduzionali contemplano spesso l eliminazione di una porzione del polipeptide. Il risultato è una proteina più piccola e attiva. 4. Un altro meccanismo dopo la traduzione è la demolizione selettiva delle proteine. Un tale meccanismo di regolazione permette a una cellula di modificare il tipo e la quantità di proteine in risposta ai cambiamenti dell ambiente. Inoltre, con questo meccanismo vengono anche eliminate le proteine che hanno accumulato delle anomalie e che devono essere quindi sostituite.

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

IL CONTROLLO DELL ESPRESSIONE GENETICA

IL CONTROLLO DELL ESPRESSIONE GENETICA IL CONTROLLO DELL ESPRESSIONE GENETICA INDICE Scopo della regolazione genica Geni costitutivi e non costitutivi Regolazione genica dei procarioti Il modello dell operone Operone del triptofano e del lattosio

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Passiamo ora in rassegna i meccanismi di controllo nelle due principali suddivisioni di esseri viventi.

Passiamo ora in rassegna i meccanismi di controllo nelle due principali suddivisioni di esseri viventi. La regolazione dell espressione dei geni. (prof. Paolo Marchesi)..siete pregati di non divulgare questo materiale senza il consenso dell autore, grazie.. Problema: Il DNA di una cellula contiene i geni

Dettagli

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

Compattamento del DNA nel cromosoma

Compattamento del DNA nel cromosoma Compattamento del DNA nel cromosoma DOMA CENTRALE DELLA BIOLOIA l'informazione genetica, contenuta nel nucleo nella molecola di DNA, si trasferisce al citoplasma. I geni del DNA vengono, nel nucleo, trascritti

Dettagli

IL CODICE GENETICO E I CARATTERI EREDITARI

IL CODICE GENETICO E I CARATTERI EREDITARI IL CODICE GENETICO E I CARATTERI EREDITARI Il DNA porta le informazioni genetiche scritte nella sequenza di basi. Qualunque sequenza è possibile. Il DNA virus più semplici: 5000 basi appaiate; 46 cromosomi

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente 21) Il ph influenza l'attività enzimatica modificando la struttura del sito attivo con il cambiamento della distribuzione delle cariche coinvolte nei legami tra il substrato e il sito attivo. L'intervallo

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli