Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa"

Transcript

1 Epigenetica ed espressione genica monoallelica

2 Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente, cioè la trascrizione avviene di preferenza a partire di un singolo alle in ciascuna cellula. Nella maggior parte dei casi di espressione genica monoallelica, le cellule scelgono a caso un allele da cui trascrivere un mrna e produrre una proteina. Il fenomeno è tipico delle cellule del sistema immunitario e dei neuroni olfattivi. Nell imprinting genomico la selezione dell allele attivo non è casuale e si basa sul genitore da cui è ereditato l allele.

3 Gene Cromosoma Selezione dell allele Geni sottoposti ad imprinting Autosomico Non casuale Geni dell X inattivato X Casuale Geni dell immunoglobuline Geni del recettore delle cellule T Geni dei recettori delle cellule natural killer Gene dell interleuchina 2 Autosomico Autosomico Autosomico Autosomico Casuale Casuale Casuale Casuale Espressione monoallelica dei geni di mammiferi

4 Marcatori epigenetici La ricerca epigenetica si occupa principalmente dello studio dei cambiamenti dell espressione genica ereditabili attraverso la mitosi e/o la meiosi senza che si verifichino cambiamenti della sequenza del DNA. La maggior parte dei processi di differenziamento cellulare è iniziata o mantenuta da processi epigenetici. La modificazione della struttura della cromatina è un esempio di caratteristica epigenetica. Il tipo principale di modificazione del DNA è la metilazione della citosina. Gli schemi di metilazione del DNA sono i marcatori epigenetici più studiati. Altra meccanismo di regolazione epigenetica: modificazione degli istoni.

5 Un gruppo metilico è trasferito da S-adenosilmetionina al carbonio 5 della citosina da una famiglia di citosina metitransferasi. Nei mammiferi, la metilazione del DNA avviene quasi esclusivamente a livello del dinucleotide CG (o CpG). La metilazione è un modo di marcare i geni per il silenziamento. La maggior parte delle 5-metilcitosine presenti nel genoma si trovano all interno di retrotrasposoni o di altre sequenze ripetitive. Normalmente il 70-80% circa di tutti i dinucleotidi CG presenti nel genoma dei mammiferi è metilato. I restanti dinucleotidi CG si trovano in gruppi noti come isole CpG vicini all estremità 5 dei geni e sono protetti dalla metilazione. Metilazione delle citosine

6 Eredità degli stati di metilazione

7 Induzione dell espresssione del gene BNIP3 (BCL2/adenovirus E1B interacting protein 3) mediante trattamento con 5-aza-dC.

8 Le isole CpG sono protette dalla metilazione e dalla Deaminazione.

9 Le isole CpG sono piccole regioni di DNA ricche di CG, lunghe 1-2 kb. Nel genoma umano sono sparse isole CpG associate con i promotori del 40-50% dei geni housekeeping. Le C nelle isole CpG non sono metilate e quindi sono protette dalla deaminazione spontanea della 5-metil citosina a timina. Ci sono alcune eccezioni alla protezione dalla metilazione delle C delle isole CpG: le isole associate a geni importanti, a geni soggetti ad inattivazione del cromosoma X ed ad elementi trasponibili. Le isole CpG

10 Le modificazioni degli istoni acetilazione e metilazione importanti per la regolazione della trascrizione molte modificazioni sono mantenute stabilmente durante la divisione cellulare. In genere l ipoacetilazione e l ipermetilazione degli istoni sono caratteristiche di sequenze di DNA che sono metilate ed inattive nelle cellule normali. Mantenimento stabile delle modificazioni degli istoni

11 Caratteristiche epigenetiche del cancro: ipermetilazione delle isole CpG ed ipometilazione di tutto il genoma silenziamento di geni oncosoppressori ed attivazione di oncogèni. L effetto principale dell ipometilazione, che avviene soprattutto in sequenze ripetute del DNA, è l instabilità cromosomica. La demetilazione di tutto il genoma sembra progredire con l età, ma è stata collegata anche alla scarsa nutrizione (mancanza di acido folico nella dieta). Nel cancro è stata riscontrata anche un iperacetilazione degli istoni, firma del cancro (istone H4 monoacetilazione di Lys 16, trimetilazione di Lys 20 ).

12 L imprinting genomico influenza una piccola serie di geni e porta all espressione di quei geni provenienti soltanto da uno dei due cromosomi ereditati dai genitori. Dovuto ad istruzioni epigenetiche depositate nelle cellule germinali dei genitori. Metilazione differenziale dei due alleli del gene sottoposto ad imprinting. L imprinting è caratteristico dei mammiferi (non in altri vertebrati) 80 geni diversi sottoposti a imprinting nei mammiferi. Questi geni hanno un ruolo nello sviluppo si conoscono alcune malattie gentiche in cui è coinvolta la perdita dell imprinting. In genere, i geni sottoposti ad imprinting sono organizzati a gruppi nel genoma. L imprinting genomico

13 I gruppi di geni sottoposti ad imprinting sono regolati in modo coordinato dalla metilazione del DNA di grandi regioni intergeniche specifiche Regioni di Controllo dell Imprinting (ICR). Queste regioni sono ricche di CG e molte sono vere e proprie isole CpG. Gli alleli silenti dei loci sottoposti ad imprinting sono marcati per la metilazione su C durante la gametogenesi. Nelle cellule germinali primordiali della linea germinale la marcatura della metilazione è cancellata. I geni sottoposti ad imprinting acquisiscono successivamente le marcature diverse nell uovo e nello spermatozoo. L imprinting genomico

14

15 Per la normale embriogenesi è essenziale il macchinario della regolazione epigenetica. Topi knock-out per la DNA metiltransferasi e i modificatori degli istoni muoiono durante la vita embrionale. Le regioni del genoma sottoposte ad imprinting sono associate a numerosi disordini dello sviluppo per regolazione difettosa, alterato dosaggio o mutazioni di questi domini. Interruzione di molti geni disordini multipli. Imprinting genomico e sviluppo

16 Tre meccanismi principali che assicurano l espressione monoallelica: (1) alterazione della struttura della cromatina a livello del promotore del gene; (2) espressione differenziale di un RNA antisenso; (3) blocco di un enhancer da parte di un isolatore. Espressione monoallelica

17 +metil-lys 9 H3 Cromosoma 17 +acetil-h3 + metil-h3-h4 Cromosoma 7

18 L eredità epigenetica è associata a numerose malattie umane: sindrome di Silver-Russell (nanismo asimmetrico); sindrome di Prader-Willi (PWS); sindrome di Angelman (AS) (sindrome del pupazzo felice); retinoblastoma; sindrome di Beckwith-Wiedemann (difetto congenito di espressione biallelica di Igf2) inibizione dell apoptosi e stimolazione della proliferazione cellulare. La perdita dell imprinting di Igf2 si verifica in molte neoplasie maligne umane (in 30% dei carcinomi del colon-retto).

19 Descritta nel 1961 da Mary Lyon. Studio della variegatura del colore del mantello dei topi. Silenziamento di un intero cromosoma X per bilanciare il dosaggio trascrizionale tra le femmine XX ed i maschi XY. Gatti calico. Inattivazione del cromosoma X

20

21 Inizio e mantenimento stabile dell inattivazione del cromosoma X

22 Profilo di inattivazione del cromosoma X umano

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Eredità non mendeliana

Eredità non mendeliana Eredità non mendeliana eredità extranucleare o citoplasmatica effetto materno eredità epigenetica (imprinting) anticipazione Eredità extranucleare eredità materna o paterna geni non nucleari: genomi mitocondriali

Dettagli

1 a LEGGE DI MENDEL Legge della Segregazione

1 a LEGGE DI MENDEL Legge della Segregazione IMPRINTING 1 a LEGGE DI MENDEL Legge della Segregazione I due membri di una coppia di alleli, durante la formazione dei gameti segregano in maniera indipendente, cioè in modo che metà dei gameti porti

Dettagli

Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Inattivazione del cromosoma X e eredita X-linked

Inattivazione del cromosoma X e eredita X-linked Inattivazione del cromosoma X e eredita X-linked By NA Lezione 15 1 X inattivo By NA 2 J L inattivazione domande Vengono inattivati tutti i geni della X? No, inizialmente si riteneva che l inattivazione

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Normale controllo della crescita cellulare

Normale controllo della crescita cellulare Normale controllo della crescita cellulare STOP STOP Cellula normale STOP Alterato controllo della crescita cellulare X STOP STOP Cellula tumorale STOP X Le cellule tumorali presentano alterazioni cromosomiche

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Geni e ambiente. Veronica Mariotti

Geni e ambiente. Veronica Mariotti Geni e ambiente nello sviluppo del fenotipo Veronica Mariotti Innato e Appreso XVII secolo- filosofo Jhon Locke : le esperienze hanno un ruolo predominante nella formazione dell individuo XIX secolo -

Dettagli

INATTIVAZIONE DEL CROMOSOMA X

INATTIVAZIONE DEL CROMOSOMA X INATTIVAZIONE DEL CROMOSOMA X Compensazione del dosaggio Nelle specie in cui la femmina ha due X e il maschio un solo X, esistono dei meccanismi di compensazione del dosaggio che rendono equivalente l

Dettagli

RIATTIVAZIONE EPIGENETICA DEL GENE FMR1

RIATTIVAZIONE EPIGENETICA DEL GENE FMR1 RIATTIVAZIONE EPIGENETICA DEL GENE FMR1 Pietro Chiurazzi Istituto di Genetica Medica Università Cattolica del Sacro Cuore Sindrome X Fragile (OMIM #300624) La FXS è la causa più comune di ritardo psicomotorio

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche La patogenesi di aborti dovuti ad anomalie cromosomiche è dovuta a: A) Ipoplasia placentare; B) Malformazioni

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI L Autrice v Prefazione xiii L aspetto umano xvi Applicazioni della genetica umana xvii Il sistema Lewis di apprendimento guidato xviii P A R T E 1 Introduzione 1 A P I T O L O 1 2.2 omponenti cellulari

Dettagli

L eredita legata al sesso

L eredita legata al sesso L eredita legata al sesso La maggior parte delle specie animali e vegetali presenta dimorfismo sessuale Individui maschi Individui femmine Il sesso e determinato da specifici cromosomi sessuali Nell uomo

Dettagli

LA GENETICA MENDELIANA NELLA SPECIE UMANA!

LA GENETICA MENDELIANA NELLA SPECIE UMANA! LA GENETICA MENDELIANA NELLA SPECIE UMANA! ALBERI GENEALOGICI ACCOPPIAMENTO PROGENIE in ordine di nascita (da sx a dx) EREDITA AUTOSOMICA DOMINANTE AUTOSOMICA: il locus genico che controlla il carattere

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici www.fisiokinesiterapia.biz Fattori estrinseci Ambiente Danno genotossico

Dettagli

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel il sesso di un individuo

Dettagli

The difference between genetics and epigenetics can probably be compared to the difference between writing and reading a book.

The difference between genetics and epigenetics can probably be compared to the difference between writing and reading a book. Epigenetica Definita come lo studio dei meccanismi responsabili di cambiamenti ereditabili nelle funzioni del genoma senza alcuna modificazione nella sequenza del DNA The difference between genetics and

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune

Dettagli

Crescita e divisione cellulare

Crescita e divisione cellulare 08-04-14 CANCRO Crescita e divisione cellulare ogni cellula deve essere in grado di crescere e riprodursi una cellula che cresce e si divide genera due nuove cellule figlie gene4camente iden4che alla cellula

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni

Dettagli

1 Gene => + fenotipi. ambiente

1 Gene => + fenotipi. ambiente 1 Gene => + fenotipi (Fattori di) trascrizione Cromatina (etero,eu, remodeling) Splicing Silenziamento (Interference) Modificazioni post traduzionali ambiente Lattosio nel mezzo Ormoni Heat shock Luce

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici

Dettagli

La rivoluzione epigenetica

La rivoluzione epigenetica La rivoluzione epigenetica Mauro Durante 2011 Perceptions of epigenetics Adrian Bird (2007) Geneticists study the gene; however, for epigeneticists, there is no obvious epigene. Nevertheless, during the

Dettagli

EPIGENETICA (2014) 1. Metilazione del DNA. 2. Organizzazione della cromatina. 3. Imprinting genomico

EPIGENETICA (2014) 1. Metilazione del DNA. 2. Organizzazione della cromatina. 3. Imprinting genomico EPIGENETICA (2014) Il "dogma centrale" della biologia molecolare sostiene che le informazioni ereditarie sono trasmesse attraverso meccanismi genetici. In realtà, lungo le generazioni, una cellula scambia

Dettagli

Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3

Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Grazia Cantelmi, AIF SUN Napoli Prof.ssa L.Perrone, Dipartimento della donna, del bambino, di chirurgia generale e specialistica

Dettagli

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi Patogenesi Terapia Diagnosi Dalla Genomica alla Medicina Molecolare Chimica Biochimica Biologia Biologia Molecolare Decodificazione Genoma Umano Post-Genomica Medicina Molecolare La CELLULA Nasce Si sviluppa

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

-malattie monogeniche o mendeliane:

-malattie monogeniche o mendeliane: Martedì 16 Febbraio è venuta nella nostra classe la dr.ssa Petrelli Maria a spiegarci le malattie sessualmente trasmissibili e ereditarie, sessualità e affettività. Ci ha spiegato la divisione delle cellule

Dettagli

ONCOLOGIA Dott.ssa Samantha Messina

ONCOLOGIA Dott.ssa Samantha Messina ONCOLOGIA Dott.ssa Samantha Messina Anno accademico 2011/2012 I anno, II trimestre Laurea Magistrale LM-67 Facoltà di Scienze Motorie Università degli Studi di Cassino e del Lazio Meridionale Elementi

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche costituzionali acquisite nelle cellule germinali nelle cellule somatiche Le alterazioni che avvengono nelle cellule germinali se compatibili con la vita porteranno alla nascita di

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

Gene Mutations and Disease

Gene Mutations and Disease Gene Mutations and Disease Mutazioni somatiche: Nuove mutazioni che insorgono casualmente nelle cellule somatiche o nella linea germinale di singoli individui. Le mutazioni germinali possono essere trasmesse

Dettagli

Che significa animale transgenico o animale Knockout???

Che significa animale transgenico o animale Knockout??? Che significa animale transgenico o animale Knockout??? ORGANISMI TRANSGENICI Gli animali che sono stati ingegnerizzati per inserzione di un gene, delezione di un gene o sostituzione di un gene si chiamano

Dettagli

EREDITA EPIGENETICA ED IMPRINTING GENOMICO

EREDITA EPIGENETICA ED IMPRINTING GENOMICO Talassemia β + causata da una mutazione di una G con una A in posizione 110 nel primo introne Questo porta alla creazione di un sito accettare di splicing anomalo, poiché la nuova sequenza contiene un

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Il differenziamento cellulare

Il differenziamento cellulare Liceo Classico M. Pagano Campobasso Docente: prof.ssa Patrizia PARADISO Allieve (cl. II sez. B e C): BARONE Silvia Antonella DI FABIO Angelica DI MARZO Isabella IANIRO Laura LAUDATI Federica PETRILLO Rosanna

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente!

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente! LEUCEMIE tessuto ematopoieitico MIELOMI più precisamente! TUMORI EVOLUZIONE E SELEZIONE CLONALE Cambiano: Velocita proliferazione Velocità di mutazione Stabilità genetica Attività telomerasica Vantaggi

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

GENETICA DEL TUMORE DEL COLON-RETTO

GENETICA DEL TUMORE DEL COLON-RETTO GENETICA DEL TUMORE DEL COLON-RETTO EPIDEMIOLOGIA In tutto l'occidente, il cancro del colon-retto occupa, per incidenza, il secondo posto tra i tumori maligni, preceduto dal tumore al polmone nell'uomo

Dettagli

4 modulo didattico - Modalità di trasmissione delle malattie

4 modulo didattico - Modalità di trasmissione delle malattie 4 modulo didattico - Modalità di trasmissione delle malattie monogeniche. L analisi dell albero genealogico: uno strumento indispensabile della genetica medica I SIMBOLI DELL ALBERO GENEALOGICO L ANEMIA

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 22

SOLUZIONI AI PROBLEMI DEL CAPITOLO 22 SOLUZIONI AI PROBLEMI DEL CAPITOLO 22 Domande Concettuali C1. I caratteri recessivi legati all X si distinguono dagli altri due per la loro prevalenza nei maschi. I caratteri dominanti legati all X (che

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

Neoplasia (o tumore) Neoplasie Maligne. Neoplasie Benigne. Si definisce Neoplasia:

Neoplasia (o tumore) Neoplasie Maligne. Neoplasie Benigne. Si definisce Neoplasia: Neoplasia (o tumore) Neoplasia: classificazione Si definisce Neoplasia: una massa abnorme di tessuto la cui crescita supera quella dei tessuti normali e progredisce anche dopo la cessazione degli stimoli

Dettagli

INAIL Settore Ricerca Certificazione e Verifica, Dipartimento installazioni di produzione ed Insediamenti antropici

INAIL Settore Ricerca Certificazione e Verifica, Dipartimento installazioni di produzione ed Insediamenti antropici Biotecnologie: Ricerca e Produzioni Industriali APPROFONDIMENTO IN TEMA DI EPIGENETICA Immagine grafica di Nicolas Bouvier Corso di formazione per gli studenti del IV e V anno Roma, 14 Marzo 2013 Atti

Dettagli

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

SINDROMI MIELODISPLASTICHE

SINDROMI MIELODISPLASTICHE SINDROMI MIELODISPLASTICHE MECCANISMI MOLECOLARI R. Piazza MECCANISMI MOLECOLARI Bejar R et al. JCO 2011;29:504-515 NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

La trasmissione delle malattie genetiche. Anna Onofri

La trasmissione delle malattie genetiche. Anna Onofri La trasmissione delle malattie genetiche Gli alberi genealogici Anna Onofri I simboli maggiormente utilizzati Le malattie genetiche Molte malattie genetiche sono legate ad un singolo gene e possono verificarsi

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

MODALITA DI TRASMISSIONE DEI CARATTERI EREDITARI UMANI. Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti

MODALITA DI TRASMISSIONE DEI CARATTERI EREDITARI UMANI. Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti MODALITA DI TRASMISSIONE DEI CARATTERI EREDITARI UMANI Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti A premessa di tale parte bisogna definire i caratteri Famigliare - carattere che

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

Marcatori Genetici Tumorali

Marcatori Genetici Tumorali a scuola di scienze della vita Liceo Scientifico N. Tron Schio (VI), 16 dicembre 2008 Marcatori Genetici Tumorali Tommaso Scarpa Schio (VI) - 16 Dicembre 2008 Il Tumore è una malattia genetica. 1 sola

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute

Dettagli

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI?

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? CARATTERE AUTOSOMICO -codificato da geni su cromosomi non sessuali -non ci sono differenze di trasmissione

Dettagli

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di GENETICA MEDICA Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di Perugia Centro Riferimento Regionale

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli