Studi genomici nei microorganismi

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Studi genomici nei microorganismi"

Transcript

1 Studi genomici nei microorganismi Edoardo Puglisi Istituto di Microbiologia Facoltà di Agraria Università Cattolica del Sacro Cuore Piacenza, Italy BioDNA Workshop La genomica al servizio dell agricoltura Piacenza, Università Cattolica del Sacro Cuore, 25 Maggio 2012

2 SCHEMA La genomica dei microorganismi e la sua importanza in agricoltura Cenni a tecniche di sequenziamento, assemblaggio, annotazione Applicazioni della genomica microbica/casi studio: Biodiversità in Lactobacillus rhamnosus Degradazione dei contaminanti e resistenza al freddo in Pseudomonas Patogenicità e resistenza agli antibiotici: Enterococcus faecium ed Escherichi coli O157:H7 La genomica come anticamera delle scienze omiche Trascrittomica (DNA-microarrays, RNASeq) Metagenomica Metatrascrittomica Sviluppi futuri

3 L IMPORTANZA DELLA GENOMICA MICROBICA Superamento degli approcci riduzionistici Quadro completo dei geni di un organismo Biodiversità e mining genomico Studi di trasferimento genico laterale (e.g. antibiotico resistenze, metabolismo degli xenobiotici) Ricostruzione di vie metaboliche (KEGG) Un ponte per le scienze omiche Biologia dei sistemi it is like being given the operating manual for your car after you have been trying to trouble-shoot a problem with it for some time David Relman, Stanford University, intervistato nel 2011 dal New York Times

4 (BREVE) STORIA DEL SEQUENZIAMENTO DEI GENOMI MICROBICI 1977 primo genoma completamente sequenziato: batteriofago φx174 (5386 bp) Primo sequenziamento utilizzando frammenti random di DNA: batteriofago λ (48502 bp) 1986 sequenziamento dei genomi mitocondriali (187 kbp) e cloroplastici (121 kbp) di Marchantia polymorpha 1995 primo sequenziamento genomico completo di un organismo libero Haemophilus influenzae (1.83 Mbp) Studi di trasferimento genico laterale (e.g. antibiotico resistenze, metabolismo degli xenobiotici) Fine anni 90 diversi microorganismi di interesse, tra cui archaea (Methanococcus jannaschii 1996) ed eucarioti (Saccharomices cerevisiae 1996) Sanger et al. (1977) Nucleotide sequence of bacteriophage φx174 Nature 265:

5 OGGI 3173 genomi completi: 153 archaea, 2487 batteri, 173 eucarioti Informazioni genomiche incomplete per 248 archaea, batteri, 1805 eucarioti Lagesen et al. (2010) Genome update: the 1000 genome a cautionary tale Microbiology 156:

6 SEQUENZIAMENTO DI NUOVA GENERAZIONE

7 Glenn TC (2011) Field guide to next-generation DNA sequencers Mol Ecol Res 11: SEQUENZIAMENTO DI NUOVA GENERAZIONE

8 Stein LD (2010) The case of cloud computing in genome informatics Genome Biology 11:207 SEQUENZIAMENTO DI NUOVA GENERAZIONE

9 INNOVAZIONE E MINIATURIZZAZIONE Piastra microtiter usata nel sequenziamento Sanger Vetrini utilizzati in tecniche di seconda generazione Piastra pico-titer usata nel sequenziamento 454 Nanostrutture e membrane di silicio per sequenziamento a livello di singola molecola Ståhl and Lunderberg. (2012) Towards the single-hour high-quality genome Annu Rev Biochem 81:

10 TECNICHE PER LO STUDIO DELLA GENOMICA MICROBICA Prima del deep sequencing Clonaggio di frammenti Vettori BAC e PAC PCR Primer walking Anni prima di arrivare ad un singolo genoma Dopo il deep sequencing Frammentazione ed analisi Due giorni per il genoma completo di E. coli O104:H4

11 APPROCCIO ORDERED CLONES Grosso frammento di DNA Digestione e clonaggio Intero genoma Frammenti sequenziati casualmente Copertura dei gaps Ripetere per l intero genoma

12 APPROCCIO DI SEQUENZIAMENTO RANDOM ( SHOTHGUN ) Intero genoma Frammentazione e clonaggio Sequenziamento random dei frammenti Copertura dei gaps

13 Contig 1 Contig 2 CONTIGS E COPERTURA DEL GENOMA

14 CONTIGS E COPERTURA DEL GENOMA Contig 1 Contig 2 Ri-sequenziamento Allineamento su un genoma noto (riferimento)

15 CONTIGS E COPERTURA DEL GENOMA Contig 1 Contig 2 Gap Sequenziamento de novo Chiusura dei gaps

16 DEEP SEQUENCING ED ASSEMBLAGGIO DEI GENOMI Assembly: unordered set of contigs Ordered sets of contigs (scaffolds) PCR product pri1 pri2 16 Clone walk PCR - sequence

17 ANNOTAZIONE DEI GENOMI MICROBICI Prima dell annotazione, un genoma appare come una sequenza di 4 basi distribuite casualmente Occorre una interpretazione che permetta una comprensione delle funzioni biologiche Steps fondamentali: identificazione di ORF (opening reading frames), CDS (coding sequences) e zone di regolazione L annotazione (=previsione della collocazione e della funzione di tutti i geni nella sequenza genomica di un organismo) è comunque solo il punto di partenza per la caratterizzazione e la comprensione di un organismo

18 ANNOTAZIONE DEI GENOMI MICROBICI Sequence Gene prediction Proteins Similarity searches against reference databases Calculations & predictions (MW, structure, location etc) Annotated Proteins Pathway prediction Annotated Proteins & pathways Manual editing Data visualization

19 L ONTOLOGIA DEI GENI Ontologie: rappresentazioni di oggetti misurabili o direttamente osservabili, e delle relazioni che avvengono tra essi (a livello logico, ogni cosa esistente è un sottotipo di qualcos altro) L ontologia dei geni è organizzata in tre gruppi separati: Funzioni molecolari Processi biologici Componenti cellulari Occorre tenere conto del fatto che ogni gene può: avere più di una funzione molecolare essere coinvolto in più processi biologici agire in più componenti cellulari

20 ANALISI E RICOSTRUZIONE DI VIE METABOLICHE ieri oggi

21 (ALCUNE) CARATTERISTICHE DEI GENOMI MICROBICI Giovannoni et al. (2005) Genome streaming in a cosmopolitan oceanic bacterium Science 309:

22 GENOMICA MICROBICA E PATOGENICITA : IL CASO ESCHERICHIA COLI O157:H7 Doppio habitat: Intestino, retto: caldo, costante, ricco di nutrienti, crescita vigorosa Acqua, suoli, sedimenti: freddo, fluttuante, nutrienti limitati E. coli O157:H7 ha circa 1000 geni in più rispetto a E. coli K12 Circa il 7.5% del genoma di E. coli O157:H7 è costituito da geni di virulenza Aree in rosso: geni presenti solo in E. coli K12 upregulated with epithelial cells 12% upregulated with norepinephrine 9% adhesion 23% Aree in arancione: geni presenti solo in E. coli O157:H7 Aree in blu: presenti in entrambi toxins 1% secretion systems 14% regulator 1% pathogen island 4% iron acquisition 3% defense from host barriers 8% hemolysin 2% effacing 1% effector 14% antigen 3% upregulated in human clinical isolates 5%

23 Eppinger et al (2011) Genomic anatomy of Escherichia coil O157:H7 PNAS 13: BIODIVERSITA MICROBICA E PATOGENICITA : IL CASO ESCHERICHIA COLI O157:H7

24 SCIENZE OMICHE E PROSPETTIVE FUTURE

25 UNA VISIONE DI INSIEME Biologia molecolare Scienze omiche Biologia dei sistemi

26 STUDI OMICI: TRASCRITTOMICA ug/kg PCB 28 PCB 52 PCB 101 PCB 114 PCB 138 PCB 153 Total HPCD RE HPCD BA PCB 180 BP GLU SPIKED PCB NON CONT CONT Puglisi et al (2010) Transcriptional response of R. aetherovorans I24 to PCB-contaminated sediments Microb Ecol 60:

27 PROSPETTIVE PER IL FUTURO: TRASCRITTOMICA A SINGOLA CELLULA Kang et al (2012) Transcript amplification from single bacterium for transciptome analysis Genome Research 21:

28 METAGENOMICA AMBIENTALE Suoli& Oceani& Ghiacciai& Acidobacteria" Firmicutes" Bacteroidetes" Ac=nobacteria" Chloroflexi" Gemma=monadates" Nitrospira" Planctomycetes" Proteobacteria" Verrucomicrobia" Cyanobacteria" Unclassified" (869)& (900)& (4127)& (4884)& (4638)& (1556)& (8138)& (10230)& (383115)& (82783)& (182084)& (252218)& 0" 5000" 10000" 15000" 20000" numero"di"sequenze"16s"depositate"in"rdp"(totali)"

29 METAGENOMICA AMBIENTALE soil% human% ocean% gut% freshwater% plants% other% bacteria( soil% human% ocean% gut% freshwater% plants% other% archaea& Tamames et al. BMC Microbiology 2010, 10:85 RDP (http://rdp.cme.msu.edu/) database query among (bacteria) and (archea) total sequences

30 Brul et al (2012) Omics technologies in quantitative microbial risk assessment Trends Food Sci Technol doi: /j.tifs

31 METATRASCRITTOMICA

32 CONCLUSIONI Avanzamento tecnologico fornisce strumenti sempre più potenti Necessità di una ancor maggiore comprensione dei processi biologici Opportuni strumenti bioinformatici accompagnati da solide ipotesi di ricerca Non scordarsi di altri approcci (e.g., coltivazione e studi fisiologici) Genomica come ponte per le scienze omiche Ampissime potenzialità di applicazione nei settori dell agricoltura, degli alimenti, dell ambiente e della salute

33 RINGRAZIAMENTI Prof. PierSandro Cocconcelli Dott. Fabrizio Cappa Dott.ssa Simona Gazzola Dott.ssa Daniela Bassi Dott.ssa Cecilia Fontana Dott.ssa Ester Pietta Istituto di Microbiologia, Università Cattolica del Sacro Cuore, Piacenza Prof. Marco Trevisan Dott. Sotirios Vasileiadis Istituto di Chimica Agraria, Università Cattolica del Sacro Cuore, Piacenza

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze Curriculum Vitae SARA GRAZIANO Informazioni personali Cognome Nome Indirizzo Telefono E-mail Cittadinanza Data di nascita Sesso Settore professionale Graziano Sara sara.graziano1985@libero.it Italiana

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Caratterizzazione della comunità microbica

Caratterizzazione della comunità microbica Caratterizzazione della comunità microbica Monitoraggio biologico annuale dell impianto Dipartimento di Biologia Università di Pisa Monitoraggio biologico del reattore Monitoraggio biologico del prototipo

Dettagli

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI 1953: scoperta del DNA (Watson e Crick) CENNI STORICI 1977: metodo di Sanger per il sequenziamento del DNA (pubblicazione della

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

SILA Sistema Integrato di Laboratori per l Ambiente

SILA Sistema Integrato di Laboratori per l Ambiente PIATTAFORMA TECNOLOGICA DI OMICA INTEGRATA (GENOMICA, PROTEOMICA, METABOLOMICA). Responsabili scientifici: Prof. Marcello Maggiolini Prof. Maria Beatrice Bitonti 0 La piattaforma tecnologica di OMICA

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Cosa manca alla pianta per essere resistente: analisi dei geni espressi durante l infezione. Studio dell interazione kiwi-psa

Cosa manca alla pianta per essere resistente: analisi dei geni espressi durante l infezione. Studio dell interazione kiwi-psa Cosa manca alla pianta per essere resistente: analisi dei geni espressi durante l infezione Studio dell interazione kiwi-psa Dr Gianni Tacconi (CRA-GPG) Centro di Ricerche per la Genomica e la Postgenomica

Dettagli

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

LA TERRA E UN PIANETA.. FONDATO SULLE ATTIVITA MICROBICHE

LA TERRA E UN PIANETA.. FONDATO SULLE ATTIVITA MICROBICHE LA TERRA E UN PIANETA.. FONDATO SULLE ATTIVITA MICROBICHE CHI SONO I MICRORGANISMI? PERCHE E COME POSSONO AVERLI? CHE EFFETTI HANNO SULL AMBIENTE? I principali protagonisti, nel mondo microbico, sono i

Dettagli

Biodiversità Molecolare: aspetti di base e nuove tecnologie

Biodiversità Molecolare: aspetti di base e nuove tecnologie Biodiversità Molecolare: aspetti di base e nuove tecnologie Graziano PESOLE Università di Bari & IBBE-CNR, Bari, Italy Seminari sulla Biodiversità Bari, 18 Febbraio 2011 La Biodiversità Per biodiversità

Dettagli

Il sequenziamento del DNA

Il sequenziamento del DNA Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo A COSA SERVE il

Dettagli

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Istituto Superiore di Sanità Roma 30 ottobre 2007 Rossella Briancesco Metodi tradizionali spesso poco sensibili Metodi

Dettagli

Polymerase Chain Reaction - PCR

Polymerase Chain Reaction - PCR Polymerase Chain Reaction - PCR Real-Time PCR Saggio Saggio di PCR monitorato di continuo Tubi Tubi chiusi Nessuna analisi post PCR Nessuna elettroforesi Caratterizzazione del prodotto Possibilità di quantificare

Dettagli

Il microbiota della vite: un assicurazione sulla salute della pianta

Il microbiota della vite: un assicurazione sulla salute della pianta Il microbiota della vite: un assicurazione sulla salute della pianta 26 marzo 2015 Costigliole d Asti Museo del Vino Barolo Paola Bonfante Dibios paola.bonfante@unito.it Il microbiota dell intestino umano

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

Controllo e monitoraggio della sicurezza e qualità

Controllo e monitoraggio della sicurezza e qualità Strategie innovative rispondenti ai bisogni delle imprese nel comparto degli ortofrutticoli della IV gamma STAYFRESH Controllo e monitoraggio della sicurezza e qualità Chiara Gorni, Donatella Allemand,

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing

Dettagli

CURRICULUM VITAE ET STUDIORUM. Dott. MONCALVO ALESSANDRO

CURRICULUM VITAE ET STUDIORUM. Dott. MONCALVO ALESSANDRO CURRICULUM VITAE ET STUDIORUM Dott. MONCALVO ALESSANDRO DATI ANAGRAFICI Nome: Alessandro Cognome: MONCALVO Luogo e data di nascita: Novi Ligure, 23-09-1984 Cittadinanza: italiana Stato civile: celibe Residente

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Controllo e monitoraggio della sicurezza e qualità

Controllo e monitoraggio della sicurezza e qualità Strategie innovative rispondenti ai bisogni delle imprese nel comparto degli ortofrutticoli della IV gamma - STAYFRESH Controllo e monitoraggio della sicurezza e qualità Chiara Gorni, Donatella Allemand,

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno

Dettagli

Controllo microbiologico degli alimenti: metodi a confronto

Controllo microbiologico degli alimenti: metodi a confronto Fiera di Cremona, venerdì 17 aprile 2009 Controllo microbiologico degli alimenti: metodi a confronto Valerio Giaccone Facoltà di Medicina veterinaria Università di Padova Dal 1 gennaio 2006 è entrata in

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Tecniche per il sequenziamento degli acidi nucleici

Tecniche per il sequenziamento degli acidi nucleici Tecniche per il sequenziamento degli acidi nucleici Nel 1965 viene determinata la prima sequenza completa di un Acido Nucleico: il trna dell alanina di lievito (78 nucleotidi) 1971: prima mappa di restrizione

Dettagli

Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633

Dettagli

La tecnologia dei microarray

La tecnologia dei microarray La tecnologia dei microarray Introduzione per l analisi dell espressione genica: Affymetrix GeneChip spotted arrays L analisi dei dati Campi di applicazione dei microarray Introduzione I progetti di sequenziamento

Dettagli

F O R M A T O E U R O P E O

F O R M A T O E U R O P E O F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Indirizzo Telefono Fax E-mail CARRERA PAOLA Nazionalità Data di nascita Codice fiscale italiana CRR PLA 57T45

Dettagli

INDIRIZZO TECNOLOGICO ARTICOLAZIONE SANITARIA

INDIRIZZO TECNOLOGICO ARTICOLAZIONE SANITARIA INDIRIZZO TECNOLOGICO ARTICOLAZIONE SANITARIA PROGRAMMA (di massima) DI BIOLOGIA E MICROBIOLOGIA CONTENUTI PER LA CLASSE QUINTA TEORIA METABOLISMO ED ENERGIA Le fermentazioni BIOLOGIE MICROBICHE Biotecnologie

Dettagli

L innovazione tecnologica contro le malattie del campo

L innovazione tecnologica contro le malattie del campo Milano, 16 ottobre 2014 L innovazione tecnologica contro le malattie del campo Camilo GIANINAZZI, IpadLab, PTP L impatto delle fitopatie sulla sostenibilità economica Le fitopatie causano ingenti perdite

Dettagli

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli

VETTORI DI CLONAGGIO

VETTORI DI CLONAGGIO VETTORI DI CLONAGGIO Perché clonare il DNA Per preparare una sonda di ibridazione Per costruire una genoteca allo scopo di isolare un gene o un cdna Per trascrivere un gene e ottenere quantità elevate

Dettagli

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni Anomalie Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni 17 Transcrittasi inversa 18 Codice genetico mitocondriale 19 Codone

Dettagli

Le biotecnologie e l ingegneria genetica 1

Le biotecnologie e l ingegneria genetica 1 Le biotecnologie e l ingegneria genetica 1 Le biotecnologie... Molti prodotti alimentari, come il pane, il vino e lo yogurt, da migliaia di anni presenti sulle nostre tavole, sono vivi, perché nella loro

Dettagli

BIOLOGA e BIOLOGO MOLECOLARE

BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...

Dettagli

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle

Dettagli

Biotecnologie animali per l'ambiente Bruno Stefanon, Fabio Pilla, Misa Sandri, Sandy Sgorlon Facoltà di Medicina Veterinaria - Università di Udine

Biotecnologie animali per l'ambiente Bruno Stefanon, Fabio Pilla, Misa Sandri, Sandy Sgorlon Facoltà di Medicina Veterinaria - Università di Udine Biotecnologie animali per l'ambiente Bruno Stefanon, Fabio Pilla, Misa Sandri, Sandy Sgorlon Facoltà di Medicina Veterinaria - Università di Udine Convegno Produzioni Animali e Sostenibilità 27 Gennaio

Dettagli

Informazioni generali e comunicazioni di servizio

Informazioni generali e comunicazioni di servizio P. Landini (paolo.landini@unimi.it) 4 piano torre B. Tel. 02-50315028 Corso di Microbiologia e Biotecnologia delle fermentazioni Unità Didattica di Microbiologia Anno accademico 2014-2015 Informazioni

Dettagli

Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013

Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013 1. Tabella degli insegnamenti Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013 Insegnamento SSD CFU Risultati di apprendimento previsti Applicazioni Web per la Biomedicina MED/04

Dettagli

ENERGIA: FORME UTILIZZATE DALLE CELLULE

ENERGIA: FORME UTILIZZATE DALLE CELLULE ENERGIA: FORME UTILIZZATE DALLE CELLULE NEI PROCESSI ANABOLICI - CHIMICA (ENERGIA METABOLICA): ATP ATP ADP + Pi + Energia che viene utilizzata per "far andare avanti" reazioni chimiche che "vorrebbero

Dettagli

I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE. Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino

I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE. Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino Sorveglianza delle malattie batteriche invasive Diagnosi di laboratorio

Dettagli

I mirna NEI MECCANISMI ANTIVIRALI

I mirna NEI MECCANISMI ANTIVIRALI Davide Schiavone Biochimica A.A. 2004-2005 I mirna NEI MECCANISMI ANTIVIRALI I processi di difesa antivirale operati da RNA sfruttano diversi meccanismi che sono raggruppati sotto il nome di RNA silencing.

Dettagli

Unità tecnica UTAGRI Laboratori INN e GEN

Unità tecnica UTAGRI Laboratori INN e GEN Unità tecnica UTAGRI Laboratori INN e GEN FOODFLAVOUR PL 77.2 Metodologie diagnostiche innovative per la caratterizzazione delle comunità microbiche Responsabile: Annamaria Bevivino Partecipanti: Patrizia

Dettagli

History of DNA Sequencing

History of DNA Sequencing History of DNA Sequencing Adapted from Eric Green, NIH; Adapted from Messing & Llaca, PNAS (1998) Efficiency (bp/person/year) 1 1870 1940 1953 Miescher: Discovers DNA Avery: Proposes DNA as Genetic Material

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

Avanzamento dei sistemi di sequenziamento

Avanzamento dei sistemi di sequenziamento Avanzamento dei sistemi di sequenziamento Sistemi di sequenziamento capillare basati su: Lunghezza delle read: 800 basi Poche sequenze prodotte in una singola corsa Second Generation Sequencing (SGS):

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare Facoltà di Ingegneria dell Informazione Laurea Specialistica e Magistrale in Ingegneria Informatica Facoltà di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica

Dettagli

Coordinatore Scientifico: Prof. VITO N. SAVINO Dip. Biologia e Chimica Agroforestale ed Ambientale Università di Bari

Coordinatore Scientifico: Prof. VITO N. SAVINO Dip. Biologia e Chimica Agroforestale ed Ambientale Università di Bari Angelantonio Minafra e Stefania Pollastro Istituto di Virologia Vegetale del CNR, Bari e Dipartimento Biologia e Chimica Agroforestale ed Ambientale Università di Bari Rete regionale di laboratori per

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà Bioinformatica Analisi del trascrittoma Dott. Alessandro Laganà Analisi del trascrittoma Regolazione dell espressione genica I microarray cdna microarray Oligo microarray Affymetrix Chip Analisi dei dati

Dettagli

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA 1 I PROGETTI OMICI Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA Studia il contenuto in mrna di una cellula (in differenti fasi di sviluppo, in risposta a vari stimoli o a

Dettagli

Il sequenziamento del genoma umano

Il sequenziamento del genoma umano Il sequenziamento del genoma umano 1. storia e risultati dei due progetti: HGP e Celera. 2. innovazioni e problematiche di ricerca connesse al progetto genoma umano: (a) sequenziamento su larga scala (b)

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

Analisi del DNA genomico mediante Southern Blot Hybridization

Analisi del DNA genomico mediante Southern Blot Hybridization Analisi del DNA genomico mediante Southern Blot Hybridization Permette la mappatura dei siti di restrizione attorno al frammento di DNA genomico per il quale si dispone di una sonda specifica a) Il DNA

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

L enigma del XXI secolo: decifrare il codice della vita

L enigma del XXI secolo: decifrare il codice della vita L enigma del XXI secolo: decifrare il codice della vita David Horner Dipar9mento di Bioscienze Università degli Studi di Milano Via Celoria 26 Milano 20133 david.horner@unimi.it Regola di Chargaff %A =

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Crescita microbica e metodi di determinazione del numero di cellule

Crescita microbica e metodi di determinazione del numero di cellule Crescita microbica e metodi di determinazione del numero di cellule La crescita microbica La crescita microbica 1 2 2 2 2 3 2 4 2 n Progressione geometrica in base 2 La crescita microbica Tempo di duplicazione

Dettagli

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

Caratterizzazione molecolare del sistema a Doppia Eredità Uniparentale (DUI) in Venerupis philippinarum.

Caratterizzazione molecolare del sistema a Doppia Eredità Uniparentale (DUI) in Venerupis philippinarum. RICHIESTA DI ASSEGNO DI RICERCA POST DOTTORALE (24 mesi) Titolo Caratterizzazione molecolare del sistema a Doppia Eredità Uniparentale (DUI) in Venerupis philippinarum. Proponente: Dr. Marco Passamonti

Dettagli

LA GRANDE MAPPA DELLA BIOLOGIA è popolata da un enorme quantità

LA GRANDE MAPPA DELLA BIOLOGIA è popolata da un enorme quantità VENTIMILA GENI SOTTO I MARI DEI TROPICI Fiorisce un nuovo approccio alla biologia per cercare di capire come dalle interazioni molecolari si originano le proprietà degli organismi DANIEL SEGRÈ LA GRANDE

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Applicazione di tecnologie innovative per il monitoraggio dell esposizione ambientale. Bologna, 25 Giugno 2009

Applicazione di tecnologie innovative per il monitoraggio dell esposizione ambientale. Bologna, 25 Giugno 2009 Applicazione di tecnologie innovative per il monitoraggio dell esposizione ambientale Bologna, 25 Giugno 2009 Perché innovative? Tecnologie che trovano le loro basi dal sequenziamento del genoma umano/altri

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

La contaminazione da nitrati delle acque

La contaminazione da nitrati delle acque Consiglio per la Ricerca in Agricoltura e l analisi dell Economia Agraria La contaminazione da nitrati delle acque Anna Benedetti Attività svolta presso il centro di Ricerca per lo Studio delle relazioni

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE?

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? A Flusso di attività B - INPUT C Descrizione dell attività D RISULTATO E - SISTEMA PROFESSIONALE 0. RICHIESTA DI STUDIARE E/O INDIVIDUARE

Dettagli

LA RICERCA SCIENTIFICA IN MEDICINA

LA RICERCA SCIENTIFICA IN MEDICINA Associazione Culturale Micene 1 Congresso Nazionale Evoluzione della Scienza e della Tecnica LA RICERCA SCIENTIFICA IN MEDICINA Dr. Federico Selvaggi Università degli Studi G. d Annunzio Chieti/Pescara

Dettagli

NOVITà. Scienza e Tecnologie dei Bio e Nanomateriali. Corso di Laurea Magistrale

NOVITà. Scienza e Tecnologie dei Bio e Nanomateriali. Corso di Laurea Magistrale Università Ca Foscari Venezia Dipartimento di Scienze Molecolari e Nanosistemi NOVITà Scienza e Tecnologie dei Bio e Nanomateriali Corso di Laurea Magistrale Cosa sono i Bio e Nanomateriali I nanomateriali

Dettagli