Sequence Alignment Algorithms

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Sequence Alignment Algorithms"

Transcript

1 Sequence Alignment Algorithms Algoritmi per l Allineamento di Sequenze Relatore: Prof. Giancarlo Mauri Correlatore: Prof. Gianluca Della Vedova Tesi di Laurea di: Mauro Baluda Matricola Part of ALiBio project

2 1 Obiettivi dello stage Scopo di questo stage è stata la realizzazione di un implementazione efficiente degli algoritmi per L Allineamento di Sequenze, un problema che riveste un grande interesse in ambito biologico essendo un metodo chiave per cercare aree importanti all interno del genoma, determinare la loro funzione e scoprirne l origine evoluzionistica. Lo stage è parte del progetto ALiBio che si propone di formire una raccolta di librerie per lo sviluppo di programmi di bioinformatica con particolare riguardo all efficenza dell implementazione. Quando ho incominciato lo stage, le strutture dati necessarie per rappresentare informazioni biologiche quali le sequenze di DNA, RNA e proteine erano già state implementate. Ho costruito le mie funzioni sulla base di queste strutture dati. 2 Allineamento di Sequenze Gli algoritmi implementati sono quelli per l allineamento globale, locale e semiglobale. Il codice prodotto segue le specifiche generali del progetto. Gli algoritmi di allineamento sono utilizzati per misurare la similitudine tra sequenze di proteine o DNA e per trovarne l allineamento migliore anche inserendo dei gaps nelle sequenze che migliorino il risultato finale. Gli algoritmi di allineamento globale cercano di far combaciare le due sequenze dall inizio alla fine ottenendo a volte allineamenti non molto convincenti tra sottosezioni delle sequenze originali, per esempio: CATTTAGATT-C X X X --GTT-GTTTAT D altro canto gli algoritmi per l allineamento locale cercano dei segmenti delle sequenze di partenza che coincidano al meglio. Utilizzando le sequenze già viste otterremmo: catttagattc gttgtttat L Allineamento semiglobale invece allinea un prefisso di una delle due sequenze con un suffisso dell altra e darebbe: CATttagattc gttgttt-at 2

3 3 Specifiche del progetto Nello sviluppo della libreria ho seguito le linee guida definite dal progetto ALiBio. Literate Programming Il primo requisito è di produrre il lavoro utilizzando uno strumento per il Literate Programming che si chiama noweb. Il Literate Programming è una metodologia di sviluppo che combina un linguaggio di programmazione con un linguaggio per la documentazione con l obiettivo di produrre lavori meglio documentati e perciò più robusti, portabili, facili da manutenere e probabilmente anche più divertenti da scrivere. L idea principale è quella di trattare un programma come un testo letterario, facile da leggere dagli uomini oltre che dai computers. Il prodotto finale è un documento ipertestuale, nello stile del World Wide Web. Linguaggi Come linguaggio per la documentazione ALiBio adotta il sistema di scrittura L A TEXche produce documentazione scientifica e matematica di grande qualità tipografica. L intero progetto è sviluppato con il linguaggio C++ che, assieme a C, è probabilmente il più usato dai programmatori di applicazioni scientifiche in tutto il mondo. Questa scelta garantisce la portabilità del codice verso tutti i compilatori che reispettino lo standard ISO e quindi la sua compatibilità con tutte le piattaforme hardware. Paradigmi di Programmazione Oltre ad utilizzare le caratteristiche del linguaggio C++ come l orientamento agli oggetti, il progetto adotta anche il concetto di Programmazione Generica come proposto dalla Standard Template Library che viene usata intensivamente in tutto il progetto. La Programmazione Generica è una tecnica che permette di implementare algoritmi in modo per quanto possibile indipendente dalle strutture dati sottostante. Questo significa che lo stesso codice sorgente può essere usato indipendentemente dal tipo di dato con il quale viene istanziato o che viene passato come parametro. Licenza Da un punto di vista legale e di distribuzione, ALiBio adotta una licenza libera che si chiama LGPL, permettendo a chiunque di accedere al codice ed alla documentazione. 3

4 4 Fasi dello sviluppo Conoscere gli strumenti di lavoro Prima di poter procedere con la fase di codifica vera e propria, ho dedicato un periodo di studio all apprendimento degli strumenti necessari per la realizzazione del progetto. Tutti i software utilizzati (noweb, L A TEX, Gnu C++ Compiler, CVS, GAWK) sono liberamente disponibili per il sistema operativo GNU/Linux, in questo modo ho avuto la possibilità di approfondire la mia conoscenza di questo sistema come piattaforma di sviluppo nonchè della suite di strumenti messi a disposizione dal progetto GNU e in particolare del programma make. Sebbene conoscessi già L A TEX, non avevo mai utilizzato il sistema noweb o più in generale il Literate Programming. Ho anche dovuto approfondire il mio livello di conoscenza del sistema di versioning CVS. Nel mio lavoro ho utilizzato alcune funzioni prese dalla Boost Library, la loro documentazione on-line è molto curata ed esaustiva. Studio ed implementazione degli algoritmi Una volta acquisiti gli strumenti necessari per la realizzazione del progetto, ho incominciato a studiare gli algoritmi che avrei dovuto implementare usando gli articoli originali scritti dai loro autori nonchè una moltitudine di altra documentazione ricavata dal World Wide Web. Nel progetto ho implementato le librerie che si occupano dell allineamento di sequenze con costo lineare ed affine per i gap, ho anche implementato una versione spazio-lineare dei medesimi algoritmi. Per ognuno dei possibili tipi di allineamento ho incluso una funzione per l allineamento globale, locale e semiglobale. Testing La fase di test ha un importanza fondamentale in questo progetto. Una volta che il codice è stato scritto, è necessario scrivere alcuni tests specifici per verificarne la correttezza. La tecnica adottata è chiamata automatic regression tests e permette di confrontare l effettivo output del test con quello atteso o con quello di versioni precedenti della funzione in esame. Sono state preparate due classi di test: uno per testare la correttezza e le funzionalità della classe score matrix e l altra per verificare l esecuzione della classe seq alignment che è quella che si occupa dell effettivo allineamento delle sequenze. Gli algoritmi sono stati implementati facendo largo uso di accessi diretti alla memoria, C++ non offre protezione automatica contro i memory leaks quindi abbiamo utilizzato uno strumento specifico chiamato Valgrind per riconoscere eventuali errori di lettura o scrittura in memoria. 4

5 Per essere certi che l algoritmo funzionasse correttamente su un grande numero di possibili inputs, abbiamo sviluppato un test randomizzato che utilizza le funzioni in esame su input casuali e ne verifica l output. Questo test ha rivelato alcuni errori nel codice che non era stato possibile notare precedentemente. La fase di test della libreria ha richiesto una quantità di lavoro notevole, paragonabile a quella dedicata all effettiva implementazione. Analisi delle performances Altri gruppi di lavoro negli scorsi anni hanno sviluppato altre librerie per risolvere il problema dell allineamento di sequenze, abbiamo pensato di confrontare i risultati e le performances della nostra implementazione con quelli di EMBOSS, uno dei pacchetti liberi più usati. Abbiamo notato che la nostra implementazione è paragonabile a quella di EMBOSS dal punto di vista dell utilizzo delle risorse della macchina tranne nel caso dell allineamento in spazio lineare che viene portato a termine da EMBOSS in un tempo significativamente minore. 5 Conclusioni Terminato il periodo di stage, gli obiettivi che ci eravamo posti sono stati raggiunti. Gli algoritmi richiesti sono stati implementati assieme alla loro documentazione come da specifiche di progetto, inoltre le performance della libreria sono in linea con quelle attese. La natura libera del progetto ALiBio è un incentivo per il suo ulteriore sviluppo, infatti i programmatori di software per la bioinformatica possono utilizzare liberamente ALiBio all interno dei loro programmi ma anche contribuire alla sua espansione ed al suo miglioramento. Possibili miglioramenti futuri Dal punto di vista delle performances è certamente possibile migliorare ancora il codice, in particolare per ridurne l utilizzo di memoria. Aggiunta di ulteriori algoritmi per l allineamento di sequenze, in particolare per la ricerca di allineamenti sub ottimali. ALiBio è un progetto rivolto agli sviluppatori per la creazione di applicazioni di bioinformatica, ad ogni modo le librerie presentate in questo lavoro potrebbero essere usate facilmente dagli utenti finali programmando un interfacca utente a linea di comando. A partire da quest interfaccia, con l aiuto di software specifici come Pise e Kaptain, sarebbe possibile sviluppare velocemente un interfaccia web ed una grafica. 5

Tesi di Laurea di Mauro Baluda matr. 038208

Tesi di Laurea di Mauro Baluda matr. 038208 Università degli Studi di Milano Bicocca Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea in Informatica Algoritmi per l'allineamento di Sequenze Tesi di Laurea di matr. 038208 Relatore:

Dettagli

Generazione Automatica di Asserzioni da Modelli di Specifica

Generazione Automatica di Asserzioni da Modelli di Specifica UNIVERSITÀ DEGLI STUDI DI MILANO BICOCCA FACOLTÀ DI SCIENZE MATEMATICHE FISICHE E NATURALI Corso di Laurea Magistrale in Informatica Generazione Automatica di Asserzioni da Modelli di Specifica Relatore:

Dettagli

Architetture Applicative

Architetture Applicative Alessandro Martinelli alessandro.martinelli@unipv.it 6 Marzo 2012 Architetture Architetture Applicative Introduzione Alcuni esempi di Architetture Applicative Architetture con più Applicazioni Architetture

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

Ingegneria del Software Progettazione

Ingegneria del Software Progettazione Ingegneria del Software Progettazione Obiettivi. Approfondire la fase di progettazione dettagliata che precede la fase di realizzazione e codifica. Definire il concetto di qualità del software. Presentare

Dettagli

Anno di corso: 2004/2005. Istruzioni. Istruzioni per lo svolgimento dei progetti didattici. versione 1.1

Anno di corso: 2004/2005. Istruzioni. Istruzioni per lo svolgimento dei progetti didattici. versione 1.1 versione 1.1 per lo svolgimento dei progetti didattici Corso di Laboratorio di Programmazione II Prof. Luca Forlizzi Anno Accademico 2004-2005 GENERALITÀ...3 Scopo del documento...3 Struttura del documento...3

Dettagli

Uno strumento per il deployment automatico di performance test su piattaforme per la distribuzione di dati

Uno strumento per il deployment automatico di performance test su piattaforme per la distribuzione di dati tesi di laurea Anno Accademico 2006/2007 relatore Ch.mo prof. Domenico Controneo correlatore Ing. Christiancarmine Esposito candidato Antonella Niola Matr. 534/158 .:: Contesto ::. www.cosmiclab.it Il

Dettagli

Realizzazione di un applicazione per la stesura di un Business Plan

Realizzazione di un applicazione per la stesura di un Business Plan tesi di laurea Anno Accademico 2006/2007 relatore Ch.mo prof. Porfirio Tramontana candidato Vincenzo Malzone Matr. 534/1173 Obiettivi Realizzare un applicazione desktop per la stesura di un documento di

Dettagli

Informatica. Prof. A. Longheu. Introduzione a Java

Informatica. Prof. A. Longheu. Introduzione a Java Informatica Prof. A. Longheu Introduzione a Java 1 Code-Name Green Nome del progetto Sun con l obiettivo di fornire intelligent consumer-electronic devices. Il risultato fu Oak Un linguaggio basato su

Dettagli

Prof. Pagani Corrado INGEGNERIA DEL SOFTWARE

Prof. Pagani Corrado INGEGNERIA DEL SOFTWARE Prof. Pagani Corrado INGEGNERIA DEL SOFTWARE INTRODUZIONE L ingegneria del software è la disciplina tecnologica e gestionalerelativa alla realizzazione sistematica e alla manutenzione di un software rispettando

Dettagli

Realizzazione di un prototipo di un software web based per la gestione di un inventario comunale

Realizzazione di un prototipo di un software web based per la gestione di un inventario comunale tesi di laurea inventario comunale Anno Accademico 2009/2010 relatore Ch.mo prof. Porfirio Tramontana correlatore Ch.mo Ing. Luigi Pontillo candidato Michele Vitelli Matr. 534 2170 Redazione dell Inventario

Dettagli

SVILUPPO ONTOLOGIE PER LA GESTIONE DOCUMENTALE E LORO INTEGRAZIONE ALL INTERNO DI UNA PIATTAFORMA WEB

SVILUPPO ONTOLOGIE PER LA GESTIONE DOCUMENTALE E LORO INTEGRAZIONE ALL INTERNO DI UNA PIATTAFORMA WEB Facoltà di Ingegneria Corso di Laurea Specialistica in Ingegneria Informatica SVILUPPO ONTOLOGIE PER LA GESTIONE DOCUMENTALE E LORO INTEGRAZIONE ALL INTERNO DI UNA PIATTAFORMA WEB Relatore Chiarissimo

Dettagli

TECNOLOGIE INFORMATICHE DELLA COMUNICAZIONE ORE SETTIMANALI 2 TIPO DI PROVA PER GIUDIZIO SOSPESO PROVA DI LABORATORIO

TECNOLOGIE INFORMATICHE DELLA COMUNICAZIONE ORE SETTIMANALI 2 TIPO DI PROVA PER GIUDIZIO SOSPESO PROVA DI LABORATORIO CLASSE DISCIPLINA MODULO Conoscenze Abilità e competenze Argomento 1 Concetti di base Argomento 2 Sistema di elaborazione Significato dei termini informazione, elaborazione, comunicazione, interfaccia,

Dettagli

Università degli studi di Messina

Università degli studi di Messina Università degli studi di Messina Facoltà di Ingegneria Corso di laurea in Ingegneria Elettronica Tesina di Sistemi di Telecomunicazione Prenotazione Esami con CSLU Speech - toolkit Docente: Prof. Salvatore

Dettagli

Verifica e Validazione (V & V) Software e difetti. Processo di V & V. Test

Verifica e Validazione (V & V) Software e difetti. Processo di V & V. Test Software e difetti Il software con difetti è un grande problema I difetti nel software sono comuni Come sappiamo che il software ha qualche difetto? Conosciamo tramite qualcosa, che non è il codice, cosa

Dettagli

Progettazione e realizzazione di una GUI multi-piattaforma per applicazioni mediche in 2D

Progettazione e realizzazione di una GUI multi-piattaforma per applicazioni mediche in 2D UNIVERSITÀ DEGLI STUDI DI BOLOGNA FACOLTÀ DI SCIENZE MATEMATICHE, FISICHE E NATURALI Corso di Laurea in Scienze dell Informazione Progettazione e realizzazione di una GUI multi-piattaforma per applicazioni

Dettagli

Software. Algoritmo. Algoritmo INFORMATICA PER LE DISCIPLINE UMANISTICHE 2 (13042)

Software. Algoritmo. Algoritmo INFORMATICA PER LE DISCIPLINE UMANISTICHE 2 (13042) INFORMATICA PER LE DISCIPLINE UMANISTICHE 2 (13042) Gli elaboratori utilizzano memoria per Dati da elaborare Istruzioni eseguite dall elaboratore software differenti risoluzione problemi differenti Algoritmo

Dettagli

Un sistema di sviluppo aziendale

Un sistema di sviluppo aziendale Un sistema di sviluppo aziendale Ing. Davide Bolcioni Amministratore di Sistema 3D Informatica Srl Scalare il processo di sviluppo Scalare in quantità Aumentano gli sviluppatori Rif. The Mythical Man-Month.

Dettagli

Informatica. Scopo della lezione

Informatica. Scopo della lezione 1 Informatica per laurea diarea non informatica LEZIONE 1 - Cos è l informatica 2 Scopo della lezione Introdurre le nozioni base della materia Definire le differenze tra hardware e software Individuare

Dettagli

La valutazione economico-tecnica del software contabile

La valutazione economico-tecnica del software contabile La valutazione economico-tecnica del software contabile fino a qualche tempo fa... hardware assorbe la maggiore quota dell investimento software predisposto internamente obiettivi nella valutazione degli

Dettagli

corrispondente server Web (l applicazione server) viene inviata una richiesta, alla quale il server normalmente risponde inviando la pagina HTML che

corrispondente server Web (l applicazione server) viene inviata una richiesta, alla quale il server normalmente risponde inviando la pagina HTML che Prefazione In questo volume completiamo l esplorazione del linguaggio Java che abbiamo iniziato in Java Fondamenti di programmazione. I due testi fanno parte di un percorso didattico unitario, come testimoniano

Dettagli

Fondamenti di Informatica 7. Linguaggi di programmazione

Fondamenti di Informatica 7. Linguaggi di programmazione I linguaggi di alto livello Fondamenti di Informatica 7. Linguaggi di programmazione Introduzione alla programmazione Caratteristiche dei linguaggi di programmazione I linguaggi di programmazione di alto

Dettagli

Introduzione al Calcolo Scientifico

Introduzione al Calcolo Scientifico Introduzione al Calcolo Scientifico Corso di Calcolo Numerico, a.a. 2010/2011 Francesca Mazzia Dipartimento di Matematica Università di Bari Francesca Mazzia (Univ. Bari) Introduzione al Calcolo Scientifico

Dettagli

Introduzione al Calcolo Scientifico

Introduzione al Calcolo Scientifico Introduzione al Calcolo Scientifico Corso di Calcolo Numerico, a.a. 2008/2009 Francesca Mazzia Dipartimento di Matematica Università di Bari Francesca Mazzia (Univ. Bari) Introduzione al Calcolo Scientifico

Dettagli

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze Curriculum Vitae SARA GRAZIANO Informazioni personali Cognome Nome Indirizzo Telefono E-mail Cittadinanza Data di nascita Sesso Settore professionale Graziano Sara sara.graziano1985@libero.it Italiana

Dettagli

TEORIA E LABORATORIO MODULO 2 - (IS) LA STRUTTURA E I SERVIZI DI INTERNET MODULO 3 - (AL) PROBLEMI E ALGORITMI. LE STRUTTURE DI CONTROLLO.

TEORIA E LABORATORIO MODULO 2 - (IS) LA STRUTTURA E I SERVIZI DI INTERNET MODULO 3 - (AL) PROBLEMI E ALGORITMI. LE STRUTTURE DI CONTROLLO. PROGRAMMA DI INFORMATICA SVOLTO NELL A.S. 2014/2015 CLASSE II A LICEO SCIENTIFICO SCIENZE APPLICATE PROF. DE BENEDETTI MARIANNA LIBRI DI TESTO: Marisa Addomine, Daniele Pons Informatica multimediale -

Dettagli

PROTOTIPAZIONE DI UN TRADUTTORE DA SORGENTE PLC AD ASSEMBLY DI UNA MACCHINA VIRTUALE

PROTOTIPAZIONE DI UN TRADUTTORE DA SORGENTE PLC AD ASSEMBLY DI UNA MACCHINA VIRTUALE PROTOTIPAZIONE DI UN TRADUTTORE DA SORGENTE PLC AD ASSEMBLY DI UNA MACCHINA VIRTUALE Relatore: prof. Michele Moro Laureando: Marco Beggio Corso di laurea in Ingegneria Informatica Anno Accademico 2006-2007

Dettagli

In legenda sono riportate le fasi R, P, C/T e I/SA come specificato nella norma ISO/IEC 12207.

In legenda sono riportate le fasi R, P, C/T e I/SA come specificato nella norma ISO/IEC 12207. Durante le attività di sviluppo del software applicativo è spesso utilizzato un ciclo di vita incrementale il cui schema di processo è sintetizzato nella figura seguente. In legenda sono riportate le fasi

Dettagli

Sistemi Informativi e WWW

Sistemi Informativi e WWW Premesse Sistemi Informativi e WWW WWW: introduce un nuovo paradigma di diffusione (per i fornitori) e acquisizione (per gli utilizzatori) delle informazioni, con facilità d uso, flessibilità ed economicità

Dettagli

12. FONDAMENTI DI INGEGNERIA DEL SOFTWARE

12. FONDAMENTI DI INGEGNERIA DEL SOFTWARE 12. FONDAMENTI DI INGEGNERIA DEL SOFTWARE PREMESSA La produzione del software non può essere affidata all improvvisazione: sapere scrivere algoritmi e programmi non garantisce di per se l avere un software

Dettagli

INFORMATICA 1 L. Mezzalira

INFORMATICA 1 L. Mezzalira INFORMATICA 1 L. Mezzalira Possibili domande 1 --- Caratteristiche delle macchine tipiche dell informatica Componenti hardware del modello funzionale di sistema informatico Componenti software del modello

Dettagli

Algoritmi Euristici. Corso di Laurea in Informatica e Corso di Laurea in Matematica. Roberto Cordone DI - Università degli Studi di Milano

Algoritmi Euristici. Corso di Laurea in Informatica e Corso di Laurea in Matematica. Roberto Cordone DI - Università degli Studi di Milano Algoritmi Euristici Corso di Laurea in Informatica e Corso di Laurea in Matematica Roberto Cordone DI - Università degli Studi di Milano Lezioni: Mercoledì 08.30-10.30 Venerdì 08.30-10.30 Ricevimento:

Dettagli

ALGORITMI e PROGRAMMI Programmazione: Lavoro che si fa per costruire sequenze di istruzioni (operazioni) adatte a svolgere un dato calcolo

ALGORITMI e PROGRAMMI Programmazione: Lavoro che si fa per costruire sequenze di istruzioni (operazioni) adatte a svolgere un dato calcolo ALGORITMI e PROGRAMMI Programmazione: Lavoro che si fa per costruire sequenze di istruzioni (operazioni) adatte a svolgere un dato calcolo INPUT: dati iniziali INPUT: x,y,z AZIONI esempio: Somma x ed y

Dettagli

Residenza: Via Rio Rosso n 73 Milazzo (ME) Domicilio: Via Vitaliano Brancati n 32 Gravina di Catania (CT) Esente dagli obblighi di leva

Residenza: Via Rio Rosso n 73 Milazzo (ME) Domicilio: Via Vitaliano Brancati n 32 Gravina di Catania (CT) Esente dagli obblighi di leva CURRICULUM VITAE INFORMAZIONI PERSONALI Nome e Cognome Indirizzo Stefano D Amico Residenza: Via Rio Rosso n 73 Milazzo (ME) Domicilio: Via Vitaliano Brancati n 32 Gravina di Catania (CT) Telefono Cellulare:

Dettagli

Esercitazioni di Programmazione I canale A-D. Alessio Malizia malizia@di.uniroma1.it

Esercitazioni di Programmazione I canale A-D. Alessio Malizia malizia@di.uniroma1.it Esercitazioni di Programmazione I canale A-D Alessio Malizia malizia@di.uniroma1.it I docenti Docente: T. Calamoneri Esercitatore: A. Malizia calamo@di.uniroma1.it Ricevimento: lun. 14.00-15.30 (mandando

Dettagli

Design patterns in Java

Design patterns in Java tesi di laurea Anno Accademico 2012/13 relatore Ch.mo prof. Porfirio Tramontana candidato Luciano Amitrano Matr. 534/2042 Progettare SW a oggetti è difficoltoso I progettisti devono cercare di far coesistere

Dettagli

Questi sistemi hanno le tipiche caratteristiche di tutti i sistemi software custom:

Questi sistemi hanno le tipiche caratteristiche di tutti i sistemi software custom: 3.9 NORMATIVA SUL RIUSO DEL SOFTWARE NELLA PA La Commissione propone che la commmissione tecnico-giuridica che studi la revisione della normativa, di cui alla proposta n. 3.1, valuti anche la problematica

Dettagli

Il diario di Francesco

Il diario di Francesco Il diario di Francesco Alunno: Francesco Altomare (Classe V A Programmatori Mercurio sez. Tecnico Economico, I.I.S. A. Guarasci Rogliano - Cs) Docenti referenti: Prof. Alessandro Citro, Insegnante di italiano

Dettagli

PROGRAMMA DI INFORMATICA

PROGRAMMA DI INFORMATICA LICEO SCIENTIFICO STATALE A. MESSEDAGLIA -VERONA Via Bertoni, 3b 37121 VERONA tel 045.596432-8034772 fax 045.8038213 Classe 2 Sezione G Anno scolastico 2014/2015 PROGRAMMA DI INFORMATICA docente: prof.

Dettagli

LINEE GUIDA PER LA STESURA DELLE SPECIFICHE TECNICO FUNZIONALI DEL SISTEMA DI GIOCO PER LE SCOMMESSE SU EVENTI SIMULATI

LINEE GUIDA PER LA STESURA DELLE SPECIFICHE TECNICO FUNZIONALI DEL SISTEMA DI GIOCO PER LE SCOMMESSE SU EVENTI SIMULATI LINEE GUIDA PER LA STESURA DELLE SPECIFICHE TECNICO FUNZIONALI DEL SISTEMA DI GIOCO PER LE SCOMMESSE SU EVENTI SIMULATI Premessa... 2 Percorso della verifica di conformità... 2 Documento specifiche tecnico-funzionali

Dettagli

Appunti del corso di Informatica 1 (IN110 Fondamenti) 4 Linguaggi di programmazione

Appunti del corso di Informatica 1 (IN110 Fondamenti) 4 Linguaggi di programmazione Università Roma Tre Dipartimento di Matematica e Fisica Corso di Laurea in Matematica Appunti del corso di Informatica 1 (IN110 Fondamenti) 4 Linguaggi di programmazione Marco Liverani (liverani@mat.uniroma3.it)

Dettagli

Fasi di creazione di un programma

Fasi di creazione di un programma Fasi di creazione di un programma 1. Studio Preliminare 2. Analisi del Sistema 6. Manutenzione e Test 3. Progettazione 5. Implementazione 4. Sviluppo 41 Sviluppo di programmi Per la costruzione di un programma

Dettagli

TECNICO SUPERIORE PER IL SISTEMA INFORMATIVO AZIENDALE

TECNICO SUPERIORE PER IL SISTEMA INFORMATIVO AZIENDALE ISTRUZIONE E FORMAZIONE TECNICA SUPERIORE SETTORE INDUSTRIA E ARTIGIANATO TECNICO SUPERIORE PER IL SISTEMA INFORMATIVO AZIENDALE STANDARD MINIMI DELLE COMPETENZE TECNICO PROFESSIONALI DESCRIZIONE DELLA

Dettagli

Progettazione e sviluppo di un Network Management System per reti wireless in configurazione Mesh-AP

Progettazione e sviluppo di un Network Management System per reti wireless in configurazione Mesh-AP Progettazione e sviluppo di un per reti wireless in configurazione Mesh-AP Relatore: Ing. TOMMASO PECORELLA 11 aprile 2006 Correlatore: Ing. LEONARDO MACCARI UNIVERSITÀ DEGLI STUDI DI FIRENZE Facoltà di

Dettagli

Modellazione dinamica e strumenti per la valutazione sperimentale del comportamento della via EGFR-IGF1R per la linea cellulare H1650

Modellazione dinamica e strumenti per la valutazione sperimentale del comportamento della via EGFR-IGF1R per la linea cellulare H1650 Università deglistudidiperugia FacoltàdiIngegneria Tesi di Laurea Magistrale in Ingegneria Informatica e dell Automazione Anno Accademico 2011/2012 Modellazione dinamica e strumenti per la valutazione

Dettagli

Ciclo di Vita Evolutivo

Ciclo di Vita Evolutivo Ciclo di Vita Evolutivo Prof.ssa Enrica Gentile a.a. 2011-2012 Modello del ciclo di vita Stabiliti gli obiettivi ed i requisiti Si procede: All analisi del sistema nella sua interezza Alla progettazione

Dettagli

Università degli studi Roma Tre Dipartimento di informatica ed automazione. Tesi di laurea

Università degli studi Roma Tre Dipartimento di informatica ed automazione. Tesi di laurea Università degli studi Roma Tre Dipartimento di informatica ed automazione Tesi di laurea Reingegnerizzazione ed estensione di uno strumento per la generazione di siti Web Relatore Prof. P.Atzeni Università

Dettagli

PIANO DI LAVORO - TECNOLOGIE INFORMATICHE - A.S. 2012/2013

PIANO DI LAVORO - TECNOLOGIE INFORMATICHE - A.S. 2012/2013 ISTITUTO ISTRUZIONE SECONDARIA SUPERIORE STATALE "S. BOSCARDIN" Sede: via Baden Powell, 35 36100 Vicenza tel. 0444/928688-928488 fax. 0444/928775 c.f. 80015110242 c.m. VIIS00800T email: amministrazione@boscardin.it

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Realizzazione di interazioni sincrone e asincrone tra applicazioni Web 2.0

Realizzazione di interazioni sincrone e asincrone tra applicazioni Web 2.0 tesi di laurea Realizzazione di interazioni sincrone e asincrone tra applicazioni Web 2.0 Anno Accademico 2008/2009 relatore Ch.mo prof. Porfirio Tramontana candidato Marco Coppola Matr. 534/002312 Obbiettivi

Dettagli

Programmazione per Bioinformatica Il Calcolatore e la Programmazione. Dr Damiano Macedonio Università di Verona

Programmazione per Bioinformatica Il Calcolatore e la Programmazione. Dr Damiano Macedonio Università di Verona Programmazione per Bioinformatica Il Calcolatore e la Programmazione Dr Damiano Macedonio Università di Verona Architettura del calcolatore La prima decomposizione di un calcolatore è relativa a due macrocomponenti:

Dettagli

di programmazione quali varargin/varargout, switch, i comandi e salvataggio dei dati. Tutto questo, migliorato da una maggiore

di programmazione quali varargin/varargout, switch, i comandi e salvataggio dei dati. Tutto questo, migliorato da una maggiore COMPILER 2.0 Generazione automatica di C-Mex file e impiego stand-alone. Maggior flessibilità ed efficienza nell esecuzione e nel controllo. La nuova versione del Compiler presenta tali migliorie ed aggiornamenti

Dettagli

Model Based Design per lo sviluppo e la verifica di moduli software in ambito Automotive

Model Based Design per lo sviluppo e la verifica di moduli software in ambito Automotive Model Based Design per lo sviluppo e la verifica di moduli software in ambito Automotive Automotive SPIN Italia - 4 Workshop on Automotive Software Roberto Sobrito, Software Engineer - FIAT Group Automobiles

Dettagli

Sistemi Operativi STRUTTURA DEI SISTEMI OPERATIVI 3.1. Sistemi Operativi. D. Talia - UNICAL

Sistemi Operativi STRUTTURA DEI SISTEMI OPERATIVI 3.1. Sistemi Operativi. D. Talia - UNICAL STRUTTURA DEI SISTEMI OPERATIVI 3.1 Struttura dei Componenti Servizi di un sistema operativo System Call Programmi di sistema Struttura del sistema operativo Macchine virtuali Progettazione e Realizzazione

Dettagli

Progetto ed implementazione di un tool di supporto allo sviluppo di applicazioni per Linux LibeRTOS

Progetto ed implementazione di un tool di supporto allo sviluppo di applicazioni per Linux LibeRTOS tesi di laurea Anno Accademico 2005/2006 relatore Ch.mo Prof. Ing. Domenico Cotroneo correlatore Ing. Armando Migliaccio candidato Giuseppe Di Luca Matr. 534/1493 LibeRTOS KUSP Contesto Linux based Real

Dettagli

PROGRAMMAZIONE DIDATTICA ANNUALE ANNO SCOLASTICO 2014/2015

PROGRAMMAZIONE DIDATTICA ANNUALE ANNO SCOLASTICO 2014/2015 PROGRAMMAZIONE DIDATTICA ANNUALE ANNO SCOLASTICO 2014/2015 DOCENTE PROF. LUCCHI ENEA MATERIA DI INSEGNAMENTO TECNOLOGIE DELL INFORMAZIONE E DELLA COMUNICAZIONE CLASSE 1 A - 1 B - 1 C Competenze di base

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Software. Definizione, tipologie, progettazione

Software. Definizione, tipologie, progettazione Software Definizione, tipologie, progettazione Definizione di software Dopo l hardware analizziamo l altra componente fondamentale di un sistema di elaborazione. La macchina come insieme di componenti

Dettagli

LA MATEMATIC A ROVESCIO CLAUDIO MARCHESANO

LA MATEMATIC A ROVESCIO CLAUDIO MARCHESANO 1 LA MATEMATIC A ROVESCIO 2 CLAUDIO MARCHESANO Per Iniziare C è sempre un modo diverso per vedere le cose 3 Cos e la flipped classroom? Inversione dei ruoli. A scuola si fanno i compiti e non solo A casa

Dettagli

-Sistemi per il rilevamento di flussi di persone- Progetto:

-Sistemi per il rilevamento di flussi di persone- Progetto: -Sistemi per il rilevamento di flussi di persone- Progetto: Sistema per il rilevamento e l analisi dei flussi dei clienti in un megastore di 1 piano di 1250m 2, composto da 20 corsie di 1m di lunghezza

Dettagli

PROGRAMMAZIONE DISCIPLINARE D ISTITUTO a.s. 2015/2016 PRIMO BIENNIO LICEO SCIENTIFICO OPZIONE SCIENZE APPLICATE

PROGRAMMAZIONE DISCIPLINARE D ISTITUTO a.s. 2015/2016 PRIMO BIENNIO LICEO SCIENTIFICO OPZIONE SCIENZE APPLICATE ISIS"Giulio Natta" Bergamo pag. 1 di 6 PRIMO BIENNIO LICEO SCIENTIFICO OPZIONE SCIENZE APPLICATE Disciplina INFORMATICA monte ore annuale previsto (n. ore settimanali per 33 settimane) 2X33 = 66 competenze

Dettagli

Definizione di metodi e tecniche per il testing di applicazioni Android Sensor Based

Definizione di metodi e tecniche per il testing di applicazioni Android Sensor Based tesi di laurea Definizione di metodi e tecniche per il testing di applicazioni Android Sensor Based Anno Accademico 2010/2011 relatore Ch.mo prof. Porfirio Tramontana correlatore Ing. Domenico Amalfitano

Dettagli

#guida 06 INBOUND MARKETING ROI CON HUBSPOT

#guida 06 INBOUND MARKETING ROI CON HUBSPOT #guida 06 INBOUND MARKETING ROI CON HUBSPOT ArchiMedia S.r.l. Viale delle Industrie 53/C 45100 Rovigo Italia Tel. +39 0425 471064 Fax +39 0425 475565 info@archimedia.it #guida 06 Indice 07 08 10 Prefazione

Dettagli

Problemi, Algoritmi e Programmi

Problemi, Algoritmi e Programmi MASTER Information Technology Excellence Road (I.T.E.R.) Problemi, Algoritmi e Programmi Maurizio Palesi Salvatore Serrano Master ITER Informatica di Base Maurizio Palesi, Salvatore Serrano 1 Introduzione

Dettagli

LPIC-1 Junior Level Linux Certification

LPIC-1 Junior Level Linux Certification Corso 2012/2013 Introduzione a GNU/Linux Obiettivi Il percorso formativo ha l obiettivo di fornire ai partecipanti le competenze basilari necessarie per installare, configurare e gestire un server/workstation

Dettagli

Informatica Applicata

Informatica Applicata Ing. Irina Trubitsyna Concetti Introduttivi Programma del corso Obiettivi: Il corso di illustra i principi fondamentali della programmazione con riferimento al linguaggio C. In particolare privilegia gli

Dettagli

Il sito Help-site.com fornisce un elenco di risorse sul Web inclusi tutorial e FAQ.

Il sito Help-site.com fornisce un elenco di risorse sul Web inclusi tutorial e FAQ. APPENDICE G Il C++ su Internet Questa appendice contiene una lista di risorse reperibili su Internet e il World Wide Web. Le risorse includono FAQ (Frequently Asked Questions, cioè le domande più comuni),

Dettagli

Informatica Documentale

Informatica Documentale Informatica Documentale Ivan Scagnetto (scagnett@dimi.uniud.it) Stanza 3, Nodo Sud Dipartimento di Matematica e Informatica Via delle Scienze, n. 206 33100 Udine Tel. 0432 558451 Ricevimento: giovedì,

Dettagli

Studente: SANTORO MC. Matricola : 528

Studente: SANTORO MC. Matricola : 528 CORSO di LAUREA in INFORMATICA Corso di CALCOLO NUMERICO a.a. 2004-05 Studente: SANTORO MC. Matricola : 528 PROGETTO PER L ESAME 1. Sviluppare una versione dell algoritmo di Gauss per sistemi con matrice

Dettagli

Linguaggi e Paradigmi di Programmazione

Linguaggi e Paradigmi di Programmazione Linguaggi e Paradigmi di Programmazione Cos è un linguaggio Definizione 1 Un linguaggio è un insieme di parole e di metodi di combinazione delle parole usati e compresi da una comunità di persone. È una

Dettagli

Algoritmi. a.a. 2013/14 Classe 2: matricole dispari

Algoritmi. a.a. 2013/14 Classe 2: matricole dispari Algoritmi a.a. 2013/14 Classe 2: matricole dispari Marcella Anselmo Presentazioni Info: http://www.di.unisa.it/professori/anselmo/ Orario ricevimento: Lunedì 15-17 Giovedì 12-13 Il mio studio è il n 57

Dettagli

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle

Dettagli

Sistemi Informativi I Lezioni di Ingegneria del Software

Sistemi Informativi I Lezioni di Ingegneria del Software 4 Codifica, Test e Collaudo. Al termine della fase di progettazione, a volte anche in parallelo, si passa alla fase di codifica e successivamente alla fase di test e collaudo. In questa parte viene approfondita

Dettagli

Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 IT PROCESS EXPERT

Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 IT PROCESS EXPERT IT PROCESS EXPERT 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 3 3. DOVE LAVORA... 4 4. CONDIZIONI DI LAVORO... 5 5. COMPETENZE... 6 Quali competenze sono necessarie... 6 Conoscenze... 8 Abilità... 9 Comportamenti

Dettagli

IDL. Scoprite cosa si nasconde nei vostri dati

IDL. Scoprite cosa si nasconde nei vostri dati IDL. Scoprite cosa si nasconde nei vostri dati L efficacia dell analisi IDL IDL include un motore di analisi solido e efficace, che consente di estrarre dai dati le specifiche informazioni statistiche

Dettagli

Informatica Università e Impresa Bologna, 24.05.2011

Informatica Università e Impresa Bologna, 24.05.2011 Informatica Università e Impresa Bologna, 24.05.2011 C'era una volta Qualcuno, da qualche parte, circa 5000 anni fa inventò la scrittura basi più solide per la trasmissione dell'informazione rispetto alla

Dettagli

Uso di librerie preconfezionate. pezzi di programma già scritto da altri; di solito ben collaudati;

Uso di librerie preconfezionate. pezzi di programma già scritto da altri; di solito ben collaudati; Uso di librerie preconfezionate Cosa sono: pezzi di programma già scritto da altri; di solito ben collaudati; comprendono le definizioni delle funzioni e il codice eseguibile; per librerie di pubblico

Dettagli

Analisi dei Requisiti

Analisi dei Requisiti Analisi dei Requisiti Pagina 1 di 16 Analisi dei Requisiti Indice 1 - INTRODUZIONE... 4 1.1 - OBIETTIVO DEL DOCUMENTO...4 1.2 - STRUTTURA DEL DOCUMENTO...4 1.3 - RIFERIMENTI...4 1.4 - STORIA DEL DOCUMENTO...4

Dettagli

Revisione e implementazione di algoritmi di elaborazione delle immagini

Revisione e implementazione di algoritmi di elaborazione delle immagini Stagnaro Francesca Mat. 2543707 Relazione Finale di Tirocinio: Revisione e implementazione di algoritmi di elaborazione delle immagini Svolto presso l azienda Numensoft Snc di M. Peri & Soci III Anno di

Dettagli

Robustezza crittografica della PEC

Robustezza crittografica della PEC Robustezza crittografica della PEC Prof. Massimiliano Sala Università degli Studi di Trento, Lab di Matematica Industriale e Crittografia Trento, 21 Novembre 2011 M. Sala (Università degli Studi di Trento)

Dettagli

UNIVERSITÀ DEGLI STUDI DI ROMA Tor Vergata

UNIVERSITÀ DEGLI STUDI DI ROMA Tor Vergata FACOLTÀ DI MEDICINA E DI SCIENZE MATEMATICHE FISICHE E NATURALI MASTER UNIVERSITARIO DI II LIVELLO IN STATISTICA PER LE SCIENZE BIO-MEDICHE A.A. 2008/2009 Nell'anno accademico 2008/2009 è attivato presso

Dettagli

Principi dell ingegneria del software Relazioni fra

Principi dell ingegneria del software Relazioni fra Sommario Principi dell ingegneria del software Leggere Cap. 3 Ghezzi et al. Principi dell ingegneria del software Relazioni fra Principi Metodi e tecniche Metodologie Strumenti Descrizione dei principi

Dettagli

Progetto e sviluppo di una Applicazione Android per l accesso a reti di sensori senza filo

Progetto e sviluppo di una Applicazione Android per l accesso a reti di sensori senza filo tesi di laurea Progetto e sviluppo di una Applicazione Android per l accesso a reti di sensori Anno Accademico 2009 2010 relatore Ch.mo prof. Marcello Cinque candidato Nicola Lubrano Matr. 534/1397 Contesto

Dettagli

Project Planning. Politecnico di Milano. Progetto di Ingegneria del Software 2. 15 novembre 2011. Elisabetta Di Nitto Raffaela Mirandola

Project Planning. Politecnico di Milano. Progetto di Ingegneria del Software 2. 15 novembre 2011. Elisabetta Di Nitto Raffaela Mirandola Politecnico di Milano Progetto di Ingegneria del Software 2 Project Planning Autori: Claudia Foglieni Giovanni Matteo Fumarola Massimo Maggi Professori: Elisabetta Di Nitto Raffaela Mirandola 15 novembre

Dettagli

La Laurea Magistrale in Informatica 2014-15

La Laurea Magistrale in Informatica 2014-15 Università degli studi di Udine La Laurea Magistrale in Informatica 2014-15 Consiglio del Corso di Studi (CCS) in Materie Informatiche Aprile 2014 E-mail: tutoratoinformatica@uniud.it Il piano di studi

Dettagli

Sistemi Informativi I Lezioni di Ingegneria del Software

Sistemi Informativi I Lezioni di Ingegneria del Software 1 Introduzione all Ingegneria del Software. In questa prima parte viene definita l Ingegneria del Software o Software Engineering (SWE), vengono presentate le caratteristiche del ciclo di vita di un prodotto

Dettagli

Software Testing. Lezione 1 Introduzione al processo di testing. Federica Spiga. federica_spiga@yahoo.it. A.A. 2010-2011 Autori: A. Bei/F.

Software Testing. Lezione 1 Introduzione al processo di testing. Federica Spiga. federica_spiga@yahoo.it. A.A. 2010-2011 Autori: A. Bei/F. Software Testing Lezione 1 Introduzione al processo di testing Federica Spiga federica_spiga@yahoo.it A.A. 2010-2011 Autori: A. Bei/F.Spiga 1 2 Definizione di Software Testing Glen Myers -The Art of Software

Dettagli

Corso AutoCAD. Perché usare il C.A.D.????? Struttura a blocchi. AutoCAD LT 2000 BASE. Programma. Obiettivo del corso AVANZATO.

Corso AutoCAD. Perché usare il C.A.D.????? Struttura a blocchi. AutoCAD LT 2000 BASE. Programma. Obiettivo del corso AVANZATO. EN.A.I.P. PIEMONTE C.S.F. DOMODOSSOLA Anno Formativo 2001/2002 Relatore: Rolandini Operatore Lunedì Mercoledì C.A.D. Giovedì dalle 19.30 Serale alle 22.30 250 ore Mario Presentazione Che cos è il C.A.D.?????

Dettagli

Esperienze di Apprendimento Automatico per il corso di Intelligenza Artificiale

Esperienze di Apprendimento Automatico per il corso di Intelligenza Artificiale Esperienze di Apprendimento Automatico per il corso di lippi@dsi.unifi.it Dipartimento Sistemi e Informatica Università di Firenze Dipartimento Ingegneria dell Informazione Università di Siena Introduzione

Dettagli

Vocabolario & Terminologie Informatiche

Vocabolario & Terminologie Informatiche Vocabolario & Terminologie Informatiche HARWARE: In ingegneria elettronica e informatica con il termine hardware si indica la parte fisica di un computer, ovvero tutte quelle parti elettroniche, elettriche,

Dettagli

ISTITUTO TECNICO ECONOMICO AMBROGIO FUSINIERI VICENZA PROGRAMMAZIONE ATTIVITA' DIDATTICA A.S. 2014-2015 MATERIA: TECNOLOGIE DELLA COMUNICAZIONE

ISTITUTO TECNICO ECONOMICO AMBROGIO FUSINIERI VICENZA PROGRAMMAZIONE ATTIVITA' DIDATTICA A.S. 2014-2015 MATERIA: TECNOLOGIE DELLA COMUNICAZIONE ISTITUTO TECNICO ECONOMICO AMBROGIO FUSINIERI VICENZA Via G. D Annunzio, 15-36100 VICENZA Tel. 0444563544 Fax 0444962574 sito web: www.itcfusinieri.eu E-mail: protocollo@itcfusinieri.it - vitd010003@pec.istruzione.it

Dettagli

----------------------------------------------------------------

---------------------------------------------------------------- ---------------------------------------------------------------- utilizzo frequente di chiamate a.. A differenza del Pascal, il C permette di operare con assegnamenti e confronti su dati di tipo diverso,

Dettagli

Gestione centralizzata delle anagrafiche in uno scenario complesso con SAP NetWeaver MDM

Gestione centralizzata delle anagrafiche in uno scenario complesso con SAP NetWeaver MDM UNIVERSITÀ DI PISA Facoltà di Ingegneria Laurea Specialistica in Ingegneria Informatica per la Gestione d Azienda Tesi di Laurea Sessione di Laurea del 18/12/2008 Gestione centralizzata delle anagrafiche

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Riconoscimento e recupero dell informazione per bioinformatica

Riconoscimento e recupero dell informazione per bioinformatica Riconoscimento e recupero dell informazione per bioinformatica Clustering: similarità Manuele Bicego Corso di Laurea in Bioinformatica Dipartimento di Informatica - Università di Verona Definizioni preliminari

Dettagli

PROGETTO ROBOT BIPEDE

PROGETTO ROBOT BIPEDE Esame di stato 2012/2013 PROGETTO ROBOT BIPEDE Dalla Pellegrina Ivan Indice Introduzione Progetto Ricerca I vantaggi della costruzione di un Robot Lista materiali (breve descrizione componenti) Principio

Dettagli

Ingegneria dei Requisiti

Ingegneria dei Requisiti Corso di Laurea Specialistica in Ingegneria Informatica Corso di Ingegneria del Software A. A. 2008 - Ingegneria dei Requisiti E. TINELLI Contenuti I requisiti del software Documento dei requisiti I processi

Dettagli

Corso di Web Programming

Corso di Web Programming Corso di Web Programming 1. Introduzione a Internet e al WWW Paolo Milazzo Dipartimento di Informatica, Università di Pisa http://www.di.unipi.it/ milazzo milazzo di.unipi.it Corso di Laurea in Informatica

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Milano 25 marzo 2015. Rossana Mazzuferi

Milano 25 marzo 2015. Rossana Mazzuferi Milano 25 marzo 2015 Rossana Mazzuferi I 13 Centri Territoriali Permanenti nelle Marche lavorano in rete dal 2011 Formazione e certificazione congiunta dei docenti corsi di lingua e preparazione al test

Dettagli