NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi"

Transcript

1 NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

2 Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio Nazionale delle Ricerche (UO1), capofila Unità di Grugliasco (TO) Sede di Torino Dipartimento di Biotecnologie dell Università di Verona (UO2) Vignaioli Piemontesi SCA (UO3)

3 Perché il Nebbiolo? Importanza economica dei vini a base Nebbiolo Diversi ambienti di coltivazione Stretto legame con il territorio

4 L obiettivo del progetto è la valorizzazione e la tutela del patrimonio vitivinicolo della provincia di Cuneo, attraverso la caratterizzazione genetica approfondita del Nebbiolo. L approccio proposto è pluridisciplinare, combinando informazioni agronomiche e metodi scientifici d avanguardia (analisi del genoma e del trascrittoma). I dati frutto di tale caratterizzazione saranno fondamentali per comprendere in modo organico vari aspetti patologici e qualitativi del Nebbiolo, e nel contempo saranno un modello di riferimento da estendere ad altri vitigni.

5 SOTTOPROGETTI: WP1) Sequenziamento del genoma del Nebbiolo WP2) Genomica funzionale dell interazione Flavescenza dorata (FD)-vitigno WP3) Definizione dei caratteri di tipicità dei cloni e delle uve Nebbiolo WP4) Coordinamento del progetto e disseminazione dei risultati

6 WP1) Sequenziamento del genoma del Nebbiolo Responsabile: Mario Pezzotti. Unità coinvolte: UO1, UO2 Scopo: rendere disponibili 3 genomi di riferimento di altrettanti cloni di Nebbiolo selezionati in base alle caratteristiche fenotipiche, in modo tale da ottenere un quadro genetico il più possibile preciso del vitigno, noto per l ampia variabilità intravarietale. CVT 71 (Nebbiolo Michet) CVT 185 (Nebbiolo Lampia) CVT 423 (Nebbiolo Picotener)

7 Il DNA di ciascun clone verrà estratto a partire dalle piante madri dei cloni conservate in un apposita screen-house a Guarene (CN). Seguiranno il sequenziamento e l assemblaggio. Per annotare i trascritti di ciascun clone verrà anche estratto l RNA da cui derivare i dati di predizione genica.

8 WP2) Genomica funzionale dell interazione FD-vitigno Responsabile: Cristina Marzachì. Unità coinvolte: UO1, UO2 Barbera è noto per la sua elevata suscettibilità alla malattia con sintomi drammatici che si manifestano fin dalle prime fasi vegetative con la comparsa di una sindrome precoce. Nebbiolo ha una bassa suscettibilità alla FD, con scarsa manifestazione di sintomi e bassa moltiplicazione del patogeno. Recovery: > 55% circa 20%

9 Questo WP si propone due obiettivi: 1) Identificazione di marcatori molecolari del fenomeno del recovery da FD 2) Analisi dell espressione di geni del fitoplasma associato alla FD Su Barbera e Nebbiolo, in 3 momenti della stagione vegetativa

10 Identificazione di markers di recovery da FD Su piante di Barbera e Nebbiolo sane e recovered, ossia infette da FD in precedenza ma che non presentano più infezione da due anni, si seguirà l espressione di una serie di geni appartenenti a diverse vie metaboliche. Vie metaboliche di interesse individuate: proteine floematiche metabolismo di zuccheri proteine PR difesa energia jasmonato Il lavoro sarà svolto mediante Real Time RT-PCR. L andamento dei geni sarà seguito in tre momenti della stagione per entrambe le cultivar

11 Analisi dell espressione di geni del fitoplasma di FD 1) arricchimento, mediante apposito kit, dell RNA del fitoplasma a partire da RNA totale di vite infetta 2) quindi sequenziamento per identificare le effettive sequenze codificanti del fitoplasma espresse nella pianta. Si otterranno dati sull espressione genica del fitoplasma nelle due cultivar, utili ad identificare i meccanismi con cui il batterio aggredisce la pianta ovvero a comprendere i meccanismi di interazione tra FD e vite con particolare riferimento al processo di patogenesi e guarigione.

12 WP3) Definizione dei caratteri di tipicità dei cloni e delle uve Nebbiolo Responsabile: Franco Mannini. Unità coinvolte: UO1, UO2, UO3 Scopo di questo WP è determinare le interazioni tra genotipo e ambiente di coltivazione. In particolare sarà studiata l espressione genica per quanto riguarda la sintesi degli antociani nelle bacche, per comprendere come l ambiente possa condizionare la peculiare composizione antocianica dell uva Nebbiolo

13 3 vigneti coetanei ed in piena produzione, aventi giacitura e terreni diversi, in cui sono presenti i 3 cloni di Nebbiolo di cui il WP1 ha sequenziato il genoma: 1) Treiso (CN): giacitura collinare, orientamento sud-est, con suolo di medio impasto a ph subalcalino 2) Monforte d Alba (CN), giacitura collinare, orientamento est-ovest, con suolo argilloso a ph fortemente basico 3) Monforte d Alba (CN), giacitura collinare a forte pendenza (45%), con suolo di medio impasto a ph sub-acido

14 Le analisi saranno svolte in 3 stadi di sviluppo degli acini: pre-invaiatura, invaiatura e maturità. Al fine di distinguere l influenza genetica da quella ambientale saranno effettuate in parallelo analoghe analisi anche su acini di Barbera

15 Le interazioni genotipo-ambiente saranno analizzate con diversi approcci: 1) Analisi agronomiche e qualitative 2) Analisi genetiche delle interazioni tra biodiversità genetica e ambiente mediante RNA-seq

16 Analisi agronomiche e qualitative: Caratterizzazione pedo-climatica degli ambienti Analisi serie storiche dei dati meteorologici Analisi chimico-fisiche dei suoli Evoluzione della maturazione Aspetti fenologici, agronomici (es. vigoria) e produttivi Analisi dei mosti, inclusi polifenoli

17 Analisi genetiche delle interazioni tra biodiversità genetica e ambiente mediante RNA-seq, tecnica che consentirà di analizzare l espressione differenziale dei geni di Nebbiolo in diversi ambienti pedoclimatici (terroirs) Estrazione RNA, suo sequenziamento, analisi bioinformatiche, allineamento sul genoma di riferimento, analisi di espressione, monitoraggio di particolari geni con Real Time RT-PCR

18 Inoltre: ricerca di marcatori clone-specifici I risultati del sequenziamenti verranno utilizzati per individuare mutazioni puntiformi (SNPs) Scopo è messa a punto di protocollo per il fingerprinting dei cloni, necessario per la loro tracciabilità e rintracciabilità.

19 WP4) Coordinamento del progetto e disseminazione dei risultati Responsabile: Ivana Gribaudo. Unità coinvolte: UO1, UO2, UO3 Disseminazione dei risultati: no richieste di brevetto, i risultati saranno valorizzati e resi pubblici attraverso articoli scientifici e tecnici ed incontri e conferenze, di carattere sia scientifico/specialistico sia divulgativo.

20 Grazie!

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Asse 1. Attività AZIONE AIUTI AI SOGGETTI AGGREGATI AI POLI DI INNOVAZIONE POLO DI INNOVAZIONE: AGROALIMENTARE FORMAT

Asse 1. Attività AZIONE AIUTI AI SOGGETTI AGGREGATI AI POLI DI INNOVAZIONE POLO DI INNOVAZIONE: AGROALIMENTARE FORMAT FONDO EUROPEO DI SVILUPPO REGIONALE P.O.R. 2007 2013 Programma Operativo Regionale Asse 1 Innovazione e transizione produttiva Competitività regionale e occupazione F.E.S.R. 2007/2013 Attività I.1.3 Innovazione

Dettagli

Piante certificate: necessità e vantaggi

Piante certificate: necessità e vantaggi Département fédéral de l'économie DFE Station de recherche Agroscope Changins-Wädenswil ACW Piante certificate: necessità e vantaggi 30 novembre 2012 Certificazione Basi legali 1. Ordinanza federale (RS

Dettagli

Coordinatore Scientifico: Prof. VITO N. SAVINO Dip. Biologia e Chimica Agroforestale ed Ambientale Università di Bari

Coordinatore Scientifico: Prof. VITO N. SAVINO Dip. Biologia e Chimica Agroforestale ed Ambientale Università di Bari Angelantonio Minafra e Stefania Pollastro Istituto di Virologia Vegetale del CNR, Bari e Dipartimento Biologia e Chimica Agroforestale ed Ambientale Università di Bari Rete regionale di laboratori per

Dettagli

MINISTERO DELLO SVILUPPO ECONOMICO MINISTERO DELL UNIVERSITA E DELLA RICERCA

MINISTERO DELLO SVILUPPO ECONOMICO MINISTERO DELL UNIVERSITA E DELLA RICERCA UNIONE EUROPEA Fondo Europeo di Sviluppo Regionale Fondo Sociale Europeo MINISTERO DELLO SVILUPPO ECONOMICO MINISTERO DELL UNIVERSITA E DELLA RICERCA REGIONE PUGLIA Angelantonio Minafra e Stefania Pollastro

Dettagli

Qualità della mela nell era della post-genomica, dalla creazione di nuovi genotipi alla post-raccolta: nutrizione e salute

Qualità della mela nell era della post-genomica, dalla creazione di nuovi genotipi alla post-raccolta: nutrizione e salute Qualità della mela nell era della post-genomica, dalla creazione di nuovi genotipi alla post-raccolta: nutrizione e salute Ente capofila: Partners: Fondazione E. Mach San Michele all Adige Università di

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Assessorato Agricoltura e Foreste Regione Siciliana Valorizzazione dei vitigni autoctoni siciliani

Assessorato Agricoltura e Foreste Regione Siciliana Valorizzazione dei vitigni autoctoni siciliani Valorizzazione dei vitigni autoctoni siciliani Agrocllimatollogia e viticolltura Studi di vocazionallità territorialle e zonazioni dii Anttoniino Drrago Assessorato Agriicolltura e Foreste Regiione Siiciilliiana

Dettagli

Quarto programma annuale dei Poli di Innovazione

Quarto programma annuale dei Poli di Innovazione FONDO EUROPEO DI SVILUPPO REGIONALE P.O.R. 2007 2013 Asse 1 : Innovazione e transizione produttiva PAR FSC 2007-2013 Linea di azione Competitività industria e artigianato Sistema produttivo Piemontese

Dettagli

Il microbiota della vite: un assicurazione sulla salute della pianta

Il microbiota della vite: un assicurazione sulla salute della pianta Il microbiota della vite: un assicurazione sulla salute della pianta 26 marzo 2015 Costigliole d Asti Museo del Vino Barolo Paola Bonfante Dibios paola.bonfante@unito.it Il microbiota dell intestino umano

Dettagli

Viaggio al centro della Biodiversità

Viaggio al centro della Biodiversità Liceo G.M. Colombini - Piacenza - indirizzo scientifico-tecnologico Biodiversità all interno di ogni specie e varietà dovute all azione dell uomo in ambito genetico Viaggio al centro della Biodiversità

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Cosa manca alla pianta per essere resistente: analisi dei geni espressi durante l infezione. Studio dell interazione kiwi-psa

Cosa manca alla pianta per essere resistente: analisi dei geni espressi durante l infezione. Studio dell interazione kiwi-psa Cosa manca alla pianta per essere resistente: analisi dei geni espressi durante l infezione Studio dell interazione kiwi-psa Dr Gianni Tacconi (CRA-GPG) Centro di Ricerche per la Genomica e la Postgenomica

Dettagli

BAROLO Denominazione di Origine Controllata e Garantita

BAROLO Denominazione di Origine Controllata e Garantita BAROLO Denominazione di Origine Controllata e Garantita VITIGNO: RESA ETTARO: Nebbiolo, suddiviso fra le tre diverse tipologie: Michet, Lampia e Rosè. Ubicati nel comune di Barolo, più precisamente nella

Dettagli

Università degli Studi di Torino Scuola di Agraria e Medicina Veterinaria. Corso di Laurea in Viticoltura ed Enologia

Università degli Studi di Torino Scuola di Agraria e Medicina Veterinaria. Corso di Laurea in Viticoltura ed Enologia Corso di Laurea in Viticoltura ed Enologia FINALITA Preparare figure professionali, che secondo la legge 129/91 hanno diritto al titolo di Enologo. Compito dell Enologo è quello di soddisfare le esigenze

Dettagli

PROGETTO FINALIZZATO: "Prodotti e tecnologie innovative su piante ornamentali con paticolare riguardo alle aree del meridione"

PROGETTO FINALIZZATO: Prodotti e tecnologie innovative su piante ornamentali con paticolare riguardo alle aree del meridione PROGETTO FINALIZZATO: "Prodotti e tecnologie innovative su piante ornamentali con paticolare riguardo alle aree del meridione" SOTTOPROGETTO: "Germoplasma" TITOLO DELLA RICERCA: "Miglioramento genetico

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Dal seme alla farina: metodi tradizionali e innovativi per la tracciabilità genetica dei cereali

Dal seme alla farina: metodi tradizionali e innovativi per la tracciabilità genetica dei cereali Dal seme alla farina: metodi tradizionali e innovativi per la tracciabilità genetica dei cereali Chiara Delogu Lorella Andreani SCS- Centro per la sperimentazione e certificazione delle sementi SEME Materiale

Dettagli

PROGETTO VIN ALP SINTESI DEI RISULTATI DI PROVE CONDOTTE SUI VITIGNI AVANÀ, CHATUS, NEBBIOLO E MALVASIA MOSCATA MEDIANTE APPASSIMENTO DELLE UVE

PROGETTO VIN ALP SINTESI DEI RISULTATI DI PROVE CONDOTTE SUI VITIGNI AVANÀ, CHATUS, NEBBIOLO E MALVASIA MOSCATA MEDIANTE APPASSIMENTO DELLE UVE PROGETTO VIN ALP SINTESI DEI RISULTATI DI PROVE CONDOTTE SUI VITIGNI AVANÀ, CHATUS, NEBBIOLO E MALVASIA MOSCATA MEDIANTE APPASSIMENTO DELLE UVE Ricerca realizzata a cura di Luca Rolle, Fabrizio Torchio,

Dettagli

CAPITOLO 2 I TRATTI COMPLESSI

CAPITOLO 2 I TRATTI COMPLESSI CAPITOLO 2 I TRATTI COMPLESSI Tratti semplici e tratti complessi Come detto nel capitolo precedente, la genetica classica studia fondamentalmente i cosiddetti tratti mendeliani semplici, quelli in cui,

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Elementi di Bioinformatica per lʼanalisi di dati NGS

Elementi di Bioinformatica per lʼanalisi di dati NGS Corso di Alta formazione in Elementi di Bioinformatica per lʼanalisi di dati NGS 21-23 Settembre 2011 Centro Didattico Morgagni Viale Morgagni 40, Firenze Presentazione del corso Il corso di alta formazione

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Le biotecnologie e l ingegneria genetica 1

Le biotecnologie e l ingegneria genetica 1 Le biotecnologie e l ingegneria genetica 1 Le biotecnologie... Molti prodotti alimentari, come il pane, il vino e lo yogurt, da migliaia di anni presenti sulle nostre tavole, sono vivi, perché nella loro

Dettagli

BIOLOGA e BIOLOGO MOLECOLARE

BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...

Dettagli

DATA inizio e fine BUDGET. Euro 2.454.414,00 01/07/2011 31/03/2015. COORDINATORE PROGETTO Roberta Davoli. CAPOFILA Università di Bologna, DIPROVAL

DATA inizio e fine BUDGET. Euro 2.454.414,00 01/07/2011 31/03/2015. COORDINATORE PROGETTO Roberta Davoli. CAPOFILA Università di Bologna, DIPROVAL SETTORE INTERVENTO: ZOOTECNIA (SUINO) TITOLO PROGETTO: Ricerca avanzata in genomica e innovazioni tecnologiche per la filiera produttiva del suino pesante italiano (HEPIGET) Advanced research in genomics

Dettagli

RISOLUZIONE VITI-OENO 1/2005

RISOLUZIONE VITI-OENO 1/2005 CODICE DI BUONE PRATICHE VITIVINICOLE PER LIMITARE AL MASSIMO LA PRESENZA DI OCRATOSSINA A NEI PRODOTTI DERIVATI DALLA VITE Considerando la Risoluzione CST 1/2002 che fissa il tasso limite di ocratossina

Dettagli

Recupero e caratterizzazione di vecchi ecotipi autoctoni di fagiolo da granella

Recupero e caratterizzazione di vecchi ecotipi autoctoni di fagiolo da granella Recupero e caratterizzazione di vecchi ecotipi autoctoni di fagiolo da granella Carmagnola 25 marzo 2011 Michele Baudino, Ezio Portis Il fagiolo da granella in Piemonte Fagiolo per produzione di granella

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

MALATTIE E TECNICHE DI CONTENIMENTO

MALATTIE E TECNICHE DI CONTENIMENTO Le prospettive del vivaismo viticolo europeo MALATTIE E TECNICHE DI CONTENIMENTO Elisa Angelini CRA VIT Centro di Ricerca per la Viticoltura Conegliano (TV) 1. Giallumi (Flavescenza dorata e Legno nero):

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

LA SCELTA VARIETALE IN ASPARAGO È STRATEGICA. Agostino Falavigna agostino.falavigna@entecra.it. www.entecra.it. Badoere di Morgano 20 settembre 2013

LA SCELTA VARIETALE IN ASPARAGO È STRATEGICA. Agostino Falavigna agostino.falavigna@entecra.it. www.entecra.it. Badoere di Morgano 20 settembre 2013 1 www.entecra.it LA SCELTA VARIETALE IN ASPARAGO È STRATEGICA Agostino Falavigna agostino.falavigna@entecra.it Badoere di Morgano 20 settembre 2013 21/09/2013 CRA-Unità di Ricerca per l Orticoltura (Montanaso

Dettagli

Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida

Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida R.M. De Miccolis Angelini, D. Digiaro, C. Rotolo, S. Pollastro, F. Faretra Dipartimento di Scienze

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

PROGRAMMA OPERATIVO NAZIONALE RICERCA E COMPETITIVITÀ 2007-2013 AZIONE II - INTERVENTI DI SOSTEGNO ALLA RICERCA INDUSTRIALE

PROGRAMMA OPERATIVO NAZIONALE RICERCA E COMPETITIVITÀ 2007-2013 AZIONE II - INTERVENTI DI SOSTEGNO ALLA RICERCA INDUSTRIALE Progetto di Ricerca PON 01_02400/2 dal titolo IDEN.Pr.E.P.T- Identificazione del prodotto e della sua provenienza territoriale CUP B38I3000540005 Avviso finalizzato alla formazione di elenchi da utilizzare

Dettagli

CELIACHIA E TEST HLA RACCOMANDAZIONI

CELIACHIA E TEST HLA RACCOMANDAZIONI CELIACHIA E TEST HLA RACCOMANDAZIONI a cura di Maria Cristina Mazzilli 1 Antonio Calabrò 2 Carlo Catassi 2 Luigi Greco 2 Riccardo Troncone 2 Umberto Volta 2 Valerio Misefari 3 Antonio Amoroso 4 Ettore

Dettagli

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE?

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? A Flusso di attività B - INPUT C Descrizione dell attività D RISULTATO E - SISTEMA PROFESSIONALE 0. RICHIESTA DI STUDIARE E/O INDIVIDUARE

Dettagli

NUOVI CLONI DI VITE ISMA - AVIT

NUOVI CLONI DI VITE ISMA - AVIT NUOVI CLONI DI VITE ISMA - AVIT 2 NUOVI CLONI DI VITE ISMA - AVIT NUOVI CLONI DI VITE ISMA - AVIT di Umberto Malossini Le schede ISMA - AVIT 3001 da Goldtraminer, B. ISMA - AVIT 513 da Pinot grigio, G.

Dettagli

INDIRIZZO AGRARIA, AGROALIMENTARE E AGROINDUSTRIA ARTICOLAZIONE VITICOLTURA ED ENOLOGIA OPZIONE ENOTECNICO VI ANNO

INDIRIZZO AGRARIA, AGROALIMENTARE E AGROINDUSTRIA ARTICOLAZIONE VITICOLTURA ED ENOLOGIA OPZIONE ENOTECNICO VI ANNO INDIRIZZO AGRARIA, AGROALIMENTARE E AGROINDUSTRIA ARTICOLAZIONE VITICOLTURA ED ENOLOGIA OPZIONE ENOTECNICO VI ANNO 104 Attività e insegnamenti dell indirizzo Agraria, agroalimentare e agroindustria Articolazione:

Dettagli

Problematiche di Laboratorio nell applicazione del Protocollo regionale

Problematiche di Laboratorio nell applicazione del Protocollo regionale Problematiche di Laboratorio nell applicazione del Protocollo regionale UOC di Microbiologia e Virologia DAI di Patologia e Diagnostica AOUI di Verona MALATTIE TRASMESSE DA VETTORI E SORVEGLIANZA DELLE

Dettagli

NEL NOME DEL BAROLO P A S S I O N E E T R A D I Z I O N E, V E R I A R T I G I A N I D E L B A R O L O

NEL NOME DEL BAROLO P A S S I O N E E T R A D I Z I O N E, V E R I A R T I G I A N I D E L B A R O L O NEL NOME DEL BAROLO P A S S I O N E E T R A D I Z I O N E, V E R I A R T I G I A N I D E L B A R O L O LA STORIA A Z I E N D A V I T I V I N I C O L A P A O L O C O N T E R N O N E L N O M E D E L B A

Dettagli

( Da Marcuzzo, modificata )

( Da Marcuzzo, modificata ) ( Da Marcuzzo, modificata ) Curva cumulata N P K ( foglie, grappoli e germogli ) Macroeleme nti (Da Porro) Elemento N P K Ca Mg Funzioni fisiologiche per la Vite ( da Fregoni, rielaborata) Elemento che

Dettagli

ELETTRONICA ED ELETTROTECNICA

ELETTRONICA ED ELETTROTECNICA Istituto di Istruzione Secondaria Superiore Statale «Via Silvestri 301» Programma di BIOLOGIA Classe 2 a A Indirizzo ELETTRONICA ED ELETTROTECNICA n.1 Titolo La cellula La struttura della cellula La teoria

Dettagli

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

CORSI UNIVERSITARI. CORSI e MASTER. 270 CORSI e MASTER

CORSI UNIVERSITARI. CORSI e MASTER. 270 CORSI e MASTER 1_CORSI_MASTER JB: 10-12-2012 8:35 Pagina 220 CORSI UNIVERSITARI UNIVERSITÀ DEGLI STUDI DI PADOVA - Dipartimento di Agraria Corso di Laurea in Scienze e tecnologie viticole ed enologiche L-25 Obiettivi:

Dettagli

LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013

LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 I Ricercatori del Centro di Genomica e Bioinformatica Traslazionale stanno lavorando a linee di ricerca legate a 1. Sclerosi Multipla 2. Tumore della Prostata

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

Bollettino Agrometeorologico Viticoltura

Bollettino Agrometeorologico Viticoltura Viale Bornata 11 25123 Brescia tel 3.362285-3677 assistenzatecnica@centrovitivinicoloprovinciale.it Bollettini e schede del Manuale di Viticoltura del CVP su: www.centrovitivinicoloprovinciale.it - BOLLETTINO

Dettagli

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico ALLEGATO 1 DESCRIZIONE DELLA FORNITURA PROCEDURA APERTA PER LA FORNITURA IN PIU LOTTI, IN MODALITA SERVICE, DI SISTEMI ANALITICI DI BIOLOGIA MOLECOLARE PER I LABORATORI ANALISI DELL AZIENDA ASL N. 8 DI

Dettagli

Verbale n. 4: Prove didattiche

Verbale n. 4: Prove didattiche Verbale n. 4: Prove didattiche Il giorno 25.10.2011 alle ore 8,30 presso la sede dell Università degli Studi Parthenope di Napoli, in Via Acton 38, si riunisce in quarta seduta la Commissione Giudicatrice,

Dettagli

Diffusione della malattia.

Diffusione della malattia. IL VIRUS DEL MOSAICO COMUNE DEL FRUMENTO Angelo Sarti, ASTRA Innovazione e Sviluppo U.O. Mario Neri Imola (BO) angelo.sarti@astrainnovazione.it Coception Rubies-Autonnell, Dista Area di Patologia Vegetale

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

DNA RICOMBINANTE E BIOTECNOLOGIE

DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

Dipartimento di Scienze Agrarie e degli Alimenti

Dipartimento di Scienze Agrarie e degli Alimenti Dipartimento di Scienze Agrarie e degli Alimenti Università degli Studi di Modena e Reggio Emilia via Amerndola, 2 Pad. Besta - 42100 Reggio Emilia - Italy CONTRATTO DI RICERCA/CONSULENZA TRA L UNIVERSITÀ

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Screening dei soggetti a rischio e diagnostica molecolare

Screening dei soggetti a rischio e diagnostica molecolare Screening dei soggetti a rischio e diagnostica molecolare Daniela Furlan U.O. Anatomia Patologica Varese, 3 luglio 2012 Il carcinoma pancreatico Patogenesi Suscettibilità genetica Implicazioni diagnostiche

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

DIPARTIMENTO DI GENETICA Sezione di Genetica BIOLOGIA E BIOCHIMICA

DIPARTIMENTO DI GENETICA Sezione di Genetica BIOLOGIA E BIOCHIMICA Associazione Gli amici di Valentina via C.L.N. 42/A 10095 - Grugliasco (TO) Gent.li famiglie dell Associazione, Come per l anno in corso, anche per il prossimo anno la nostra attivita di laboratorio procedera

Dettagli

Progetto Cluster. Sottoprogetto Bioinformatica

Progetto Cluster. Sottoprogetto Bioinformatica Progetto Cluster Sottoprogetto Bioinformatica CRS4 (Centro di Ricerca, Sviluppo e Studi Superiori in Sardegna) Società costituita nel 1990 svolge attività di ricerca e sviluppo basate sulle tecnologie

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

L influenza del suolo sulla performance viticola: DALL APPARATO RADICALE ALLA QUALITÀ DEL VINO

L influenza del suolo sulla performance viticola: DALL APPARATO RADICALE ALLA QUALITÀ DEL VINO L influenza del suolo sulla performance viticola: DALL APPARATO RADICALE ALLA QUALITÀ DEL VINO Fabrizio Battista, Federica Gaiotti, Davide Mosetti, Gilberto Bragato, Diego Tomasi CRA-VIT CENTRO DI RICERCA

Dettagli

Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013

Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013 1. Tabella degli insegnamenti Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013 Insegnamento SSD CFU Risultati di apprendimento previsti Applicazioni Web per la Biomedicina MED/04

Dettagli

Importante conoscere per le diverse cultivar

Importante conoscere per le diverse cultivar Approfondimenti su: indici qualità dell uva e loro relazione con l uso di coadiuvanti enologici LUCA ROLLE Di.Va.P.R.A. Microbiologia e Industrie Agrarie Importante conoscere per le diverse cultivar cinetica

Dettagli

Risultati della Ricerca

Risultati della Ricerca Risultati della Ricerca Titolo Mappe di conducibilità elettrica Descrizione estesa del risultato Le mappe ottenute con il cokriging per le variabili di induzione elettromagnetica (EMI) sembrano rivelare

Dettagli

REGIONE PUGLIA AREA POLITICHE PER LO SVILUPPO RURALE Servizio Agricoltura

REGIONE PUGLIA AREA POLITICHE PER LO SVILUPPO RURALE Servizio Agricoltura ALLEGATO A REGIONE PUGLIA AREA POLITICHE PER LO SVILUPPO RURALE Servizio Agricoltura LINEE GUIDA PER IL PARCO DELLA RICERCA E SPERIMENTAZIONE FINALIZZATA ALLA PREVENZIONE E AL CONTENIMENTO DEL COMPLESSO

Dettagli

www.vinisanvalentino.com

www.vinisanvalentino.com www.vinisanvalentino.com ISTORIAHISTOR Oggi i vini dell Azienda Agricola San Valentino sono unanimamente riconosciuti come vini di riferimento della regione Emilia Romagna. Lo Scabi è stimato per il suo

Dettagli

GIALLUMI DELLA VITE: aggiornamenti tecnici

GIALLUMI DELLA VITE: aggiornamenti tecnici FEASR Programma di Sviluppo Rurale 2007-2013 Misura 111B Informazione e diffusione della conoscenza GIALLUMI DELLA VITE: aggiornamenti tecnici Piero Attilio Bianco DI.S.A.A - C.I.R.I.V.E. CENTRO INTERDIPARTIMENTALE

Dettagli

LA FLAVESCENZA DORATA DELLA VITE

LA FLAVESCENZA DORATA DELLA VITE PROVINCIA DI ASTI LA FLAVESCENZA DORATA DELLA VITE GIORNATA INFORMATIVA SULLA RICERCA SCIENTIFICA IN PIEMONTE ASTI, 11 DICEMBRE 2006 RUOLO DEI VIGNETI ABBANDONATI E DEGLI INCOLTI SULLA PRESENZA DI SCAPHOIDEUS

Dettagli

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi generali Metodi mirati Scoperta e sviluppo di nuovi

Dettagli

Organismi Geneticamente. Vademecum sugli OGM Cosa sono e quali sono le loro caratteristiche ed effetti

Organismi Geneticamente. Vademecum sugli OGM Cosa sono e quali sono le loro caratteristiche ed effetti Organismi Geneticamente Modificati Estratto da FederBio 2014 Vademecum sugli OGM Cosa sono e quali sono le loro caratteristiche ed effetti In Italia è vietata la coltivazione di OGM, anche se non ne è

Dettagli

Regolamento didattico del Corso di Laurea magistrale in Biotecnologie Mediche

Regolamento didattico del Corso di Laurea magistrale in Biotecnologie Mediche Regolamento didattico del Corso di Laurea magistrale in Biotecnologie Mediche 1. Denominazione e durata del Corso di Laurea Il Corso di Laurea magistrale o specialistica in Biotecnologie Mediche appartiene

Dettagli

AlphaReal BREAST Scheda Tecnica

AlphaReal BREAST Scheda Tecnica AlphaReal BREAST Scheda Tecnica A3 DS RT 607 ARBreast_01_2015.doc Pag. 1 di 5 Rev. 01 del Gennaio 2015 Prodotto: AlphaReal BREAST Codice prodotto: RT-607.05.20 / RT-607.10.20 N Tests: 5/10 tests Destinazione

Dettagli

FIGURE PROFESSIONALI NEL SETTORE VITIVINICOLO

FIGURE PROFESSIONALI NEL SETTORE VITIVINICOLO FIGURE PROFESSIONALI NEL SETTORE VITIVINICOLO Nota per la consultazione La voce denominazione in alcuni casi riporta diversi modi di definire la figura per come è stata proposta dagli esperti e dagli intervistati.

Dettagli

Si accompagna a: pasta ripiena di carne, arrosti di selvaggina, brasati di carne rossa, formaggi stagionati.

Si accompagna a: pasta ripiena di carne, arrosti di selvaggina, brasati di carne rossa, formaggi stagionati. Barbaresco Asili Denominazione: Barbaresco d.o.c.g. Provenienza: sottozona ASILI, comune di Barbaresco. Vinificazione: macerazione in rosso tradizionale di 12-15 giorni, con fermentazione a temperatura

Dettagli

vini doc dei colli piacentini in val tidone esperienza e passione da più di 20 anni

vini doc dei colli piacentini in val tidone esperienza e passione da più di 20 anni vini doc dei colli piacentini in val tidone esperienza e passione da più di 20 anni controllo diretto di tutta la filiera di produzione profumi della nostra terra L AZIENDA 41 ettari di vigneti di proprietà

Dettagli

GREEN HIGH TECH: la Scienza nell'arte di nutrire il mondo? Non si sequenzia solo il genoma umano: ecco perché usando l'esempio del pesco

GREEN HIGH TECH: la Scienza nell'arte di nutrire il mondo? Non si sequenzia solo il genoma umano: ecco perché usando l'esempio del pesco GREEN HIGH TECH: la Scienza nell'arte di nutrire il mondo? Non si sequenzia solo il genoma umano: ecco perché usando l'esempio del pesco Luca Dondini - Dipartimento di Scienze Agrarie (Università di Bologna)

Dettagli

Agricoltura del futuro: quali biotecnologie usare per garantire a tutti il diritto al cibo?

Agricoltura del futuro: quali biotecnologie usare per garantire a tutti il diritto al cibo? Agricoltura del futuro: quali biotecnologie usare per garantire a tutti il diritto al cibo? SOSTENIBILITA Nel 'genome editing' la risposta alla sfida per l'agricoltura del futuro Roma, 24 set. (AdnKronos)

Dettagli

Viticoltura assistita da satellite

Viticoltura assistita da satellite POSSIBILITÀ APPLICATIVE Viticoltura assistita da satellite Questa metodologia operativa rende possibile pianificare le strategie di vendemmia e ottimizzare le pratiche colturali nelle singole porzioni

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

VALTÈNESI: DEFINIZIONE DELLE PECULIARITÀ ORGANOLETTICHE

VALTÈNESI: DEFINIZIONE DELLE PECULIARITÀ ORGANOLETTICHE Progetto: VALTÈNESI: DEFINIZIONE DELLE PECULIARITÀ ORGANOLETTICHE Definizione delle caratteristiche e delle peculiarità dei Vini di Valtènesi. Indagini organolettiche e valutazione delle attitudini enologiche

Dettagli

Risultati della Ricerca

Risultati della Ricerca Risultati della Ricerca Titolo Protocollo diagnostico per il viroide Potato spindle tuber viroid (PSTVd) agente dell'affusolamento del tubero di patata Descrizione estesa del risultato Il viroide del tubero

Dettagli

Scheda di presentazione del progetto. Carafierizzazione varietale e diversità genetica in O/ea europaea mediante l'impiego di marcatori molecolari'

Scheda di presentazione del progetto. Carafierizzazione varietale e diversità genetica in O/ea europaea mediante l'impiego di marcatori molecolari' Carafierizzazione varietale e diversità genetica in O/ea europaea mediante l'impiego di marcatori molecolari' L'olivo (Olea europaea L.) è una delle piu antich e importanti piante coltivate nell'areale

Dettagli

Gli Organismi Geneticamente Modificati (OGM) Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana

Gli Organismi Geneticamente Modificati (OGM) Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana Gli Organismi Geneticamente Modificati (OGM) Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana IL DNA L'acido desossiribonucleico o deossiribonucleico (DNA) presente nelle cellule di

Dettagli

SCHEDA DI PROGETTO (MODELLO A) 4. Tipo di progetto Bando Affidamento diretto Sportello 1 2 X 1.550.000 1.550.000

SCHEDA DI PROGETTO (MODELLO A) 4. Tipo di progetto Bando Affidamento diretto Sportello 1 2 X 1.550.000 1.550.000 SCHEDA DI PROGETTO (MODELLO A) 1. Tematica/ Filiera Emergenze fitosanitarie 2. Titolo Interventi di coordinamento ed implementazione alle azioni di ricerca, lotta e difesa al cancro batterico dell'actinidia

Dettagli

SCHEDA DI PROGETTO (MODELLO A) 4. Tipo di progetto Bando Affidamento diretto Sportello 1 2 X 1.550.000 1.550.000

SCHEDA DI PROGETTO (MODELLO A) 4. Tipo di progetto Bando Affidamento diretto Sportello 1 2 X 1.550.000 1.550.000 SCHEDA DI PROGETTO (MODELLO A) 1. Tematica/ Filiera Emergenze fitosanitarie 2. Titolo Interventi di coordinamento ed implementazione alle azioni di ricerca, lotta e difesa al cancro batterico dell'actinidia

Dettagli

20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra

Dettagli

Sperimenta il BioLab

Sperimenta il BioLab Progetto Sperimenta il BioLab Centro Università di Milano - Scuola per le Bioscienze e le Biotecnologie http://www.cusmibio.unimi.it/ I laboratori del Cus-Mi-Bio dedicati a "SPERIMENTA IL BIOLAB" si trovano

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Modelli matematici per la Pest Risk Analysis

Modelli matematici per la Pest Risk Analysis Modelli matematici per la Pest Risk Analysis Vittorio Rossi Istituto di Entomologia e Patologia vegetale Università Cattolica S. Cuore - Piacenza Gianni Gilioli Dipartimento di Gestione dei sistemi Agrari

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli