Esercitazioni di Genomica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Esercitazioni di Genomica"

Transcript

1 Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua

2 Calendario 2 dicembre Formati e strumenti 3 dicembre Alcune applicazioni dell NGS (e formazione gruppi di interesse per argomento) 9 dicembre Analisi dati 16S / genomi batterici 16 dicembre Analisi dati Human Resequencing Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

3 Alcune cose da fare ora Se non l avete già fatto, rispondere al sondaggio nel blog (ne faremo un altro dopo il laboratorio) Provare ad installare Java + IGV per chi non l ha fatto (nel blog istruzioni) Provare ad installare samtools Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

4 Stiamo preparando un piccolo repository di pacchetti bioinformatici a 32 bit e a 64 bit, che dovrebbero girare su qualsiasi *buntu. Li pubblicheremo nel blog, anche grazie al vostro feedback Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

5 SAM ESEMPIO VISIVO

6 Il formato VCF

7 Cinque progetti in cerca d'autore Variant calling su pazienti affetti da cardiomiopatie Assemblaggio de novo di un batterio Analisi di comunità batteriche con 16S-Seq RNA-Seq per identificare geni differenzialmente espressi [per i temerari] Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

8 Variant Calling in Target Enrichment

9 Steps Allineamento sul reference è critico e se possibile va migliorato (riallineamento) Ricerca delle varianti (variant calling) Annotazione delle varianti Validazione! Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

10 Cosa faremo noi? Useremo dati di un target enrichment di poche kb di genoma umano (e un solo cromosoma) Analizzeremo le varianti presenti producendo un VCF Valideremo alcune varianti usando il buon vecchio Sanger Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

11 Esercitazioni di Genomica Lezione Applicazioni introduttiva biologiche del NGS 23 dicembre 2014

12 Varianti?

13 Variants?

14 Errors!

15

16 VEP: Variant Effect Predictor genes and transcripts affected by the variants location of the variants (e.g. upstream, in coding sequence, in non-coding RNA, in regulatory regions) consequence of your variants on the protein sequence (e.g. stop gained, missense, stop lost, frameshift) known variants that match yours, and associated minor allele frequencies from the 1000 Genomes Project SIFT and PolyPhen scores for changes to protein sequence

17

18 ANNOVAR ANNOVAR is an efficient tool to functionally annotate genetic variants. Gene-based annotation: identify whether SNPs or CNVs cause protein coding changes and the amino acids that are affected. Region-based annotations: identify variants in specific genomic regions, for example, conserved regions among 44 species, predicted transcription factor binding sites, Filter-based annotation: identify variants that are reported in dbsnp, or identify the subset of common SNPs (MAF>1%) in the 1000 Genome Project, or identify subset of non-synonymous SNPs with SIFT score>0.05,

19

20 De novo genome assembly

21 Shotgun ACGTACGTAGCTGACGA AGCTGACGATCGATCGTAGCTAGCTA ATCGTAGCTAGCTAGATTACA AGATTACAGTCTACGTACTATCGA Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

22 Shotgun ACGTACGTAGCTGACGA AGCTGACGATCGATCGTAGCTAGCTA ATCGTAGCTAGCTAGATTACA AGATTACAGTCTACGTACTATCGA Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

23 Shotgun ACGTACGTAGCTGACGATCGATCGTAGCTAGCTAGATTACAGTCTACGTACTATCGA contig Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

24 Problem Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

25 Problem Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

26 Solution Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

27 Solution Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

28 Metrics Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

29 Il progetto Dataset: reads FASTQ (Illumina MiSeq) Programma consigliato: Mira Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

30 Analisi di Ampliconi 16S

31

32 Microbial Biogeography of Public Restroom Surfaces Flores G. E. et al., 2011 (PLoS One)

33 Key questions Who is out there? What are they doing?

34 Cosa faremo? Avremo sequenze prodotte dal sequenziamento 16S di due campioni alimentari. Li classificheremo utilizzando due metodi: RDP Qiime (VirtualBox) Confronteremo i risultati Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

35 I passaggi chiave Clustering delle sequenze molto simili tra di loro (ogni cluster rappresenta, funzionalmente, una specie, più correttamente una OTU) Valutazione dell abbondanza di ogni cluster (più sequenze clusterizzano assieme, più abbondante è l unità tassonomica) Annotazione delle OTU Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

36 Buon lavoro

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza Simona Giampaoli, Anna Rita Ciccaglione Istituto Superiore di Sanità Prevalenza e carico dell infezione cronica da virus dell epatite

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Il ciclo di vita del software

Il ciclo di vita del software Il ciclo di vita del software Il ciclo di vita del software Definisce un modello per il software, dalla sua concezione iniziale fino al suo sviluppo completo, al suo rilascio, alla sua successiva evoluzione,

Dettagli

Il business risk reporting: lo. gestione continua dei rischi

Il business risk reporting: lo. gestione continua dei rischi 18 ottobre 2012 Il business risk reporting: lo strumento essenziale per la gestione continua dei rischi Stefano Oddone, EPM Sales Consulting Senior Manager di Oracle 1 AGENDA L importanza di misurare Business

Dettagli

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM ALLEGATO 2 FULL PROJECT FORM FORM 1 FORM 1 General information about the project PROJECT SCIENTIFIC COORDINATOR TITLE OF THE PROJECT (max 90 characters) TOTAL BUDGET OF THE PROJECT FUNDING REQUIRED TO

Dettagli

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07.

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07. Istruzione N 62 Data creazione 18/ 12/2009 Versione N 00 Ultima modifica TIPO ISTRUZIONE ASSEMBLAGGIO COLLAUDO TRAINING MODIFICA TEST FUNZIONALE RIPARAZIONE/SOSTITUZIONE IMBALLO TITOLO DELL ISTRUZIONE

Dettagli

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx. Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.com Avvertenza di Rischio: Il Margin Trading su forex e/o CFD comporta

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

MAP-BASED CLONING OF RESISTANCE GENE HOMOLOGUES IN THE Vf -REGION OF THE APPLE (Malus sp.)

MAP-BASED CLONING OF RESISTANCE GENE HOMOLOGUES IN THE Vf -REGION OF THE APPLE (Malus sp.) Diss. ETH Nr. 13793 MAP-BASED CLONING OF RESISTANCE GENE HOMOLOGUES IN THE Vf -REGION OF THE APPLE (Malus sp.) A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZÜRICH For the degree

Dettagli

Configurazione avanzata di IBM SPSS Modeler Entity Analytics

Configurazione avanzata di IBM SPSS Modeler Entity Analytics Configurazione avanzata di IBM SPSS Modeler Entity Analytics Introduzione I destinatari di questa guida sono gli amministratori di sistema che configurano IBM SPSS Modeler Entity Analytics (EA) in modo

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Sopra ogni aspettativa

Sopra ogni aspettativa Sopra ogni aspettativa Pipette elettroniche Eppendorf Xplorer e Eppendorf Xplorer plus »Un modo intuitivo di lavorare.«chi dà il massimo ogni giorno, merita anche il massimo in termini di strumenti ed

Dettagli

Analisi dei requisiti e casi d uso

Analisi dei requisiti e casi d uso Analisi dei requisiti e casi d uso Indice 1 Introduzione 2 1.1 Terminologia........................... 2 2 Modello del sistema 4 2.1 Requisiti hardware........................ 4 2.2 Requisiti software.........................

Dettagli

Indicizzazione terza parte e modello booleano

Indicizzazione terza parte e modello booleano Reperimento dell informazione (IR) - aa 2014-2015 Indicizzazione terza parte e modello booleano Gruppo di ricerca su Sistemi di Gestione delle Informazioni (IMS) Dipartimento di Ingegneria dell Informazione

Dettagli

Efficacia dei probio-ci nelle mala1e diges-ve

Efficacia dei probio-ci nelle mala1e diges-ve Efficacia dei probio-ci nelle mala1e diges-ve Le aree di incertezza nelle Cure Primarie: Quali sono le evidenze di efficacia dei probio-ci nelle patologie del tra9o gastrointes-nale? Edoardo Benede*o 1907

Dettagli

Informazioni su questo libro

Informazioni su questo libro Informazioni su questo libro Si tratta della copia digitale di un libro che per generazioni è stato conservata negli scaffali di una biblioteca prima di essere digitalizzato da Google nell ambito del progetto

Dettagli

Oncologici: Iniziative e sostenibilità della Regione. Valeria Fadda Unità di HTA di ESTAV centro, Regione Toscana

Oncologici: Iniziative e sostenibilità della Regione. Valeria Fadda Unità di HTA di ESTAV centro, Regione Toscana Oncologici: Iniziative e sostenibilità della Regione Valeria Fadda Unità di HTA di ESTAV centro, Regione Toscana 2.760.000.000 Euro 14.4% della spesa farmaceutica 32.8% della spesa farmaceutica ospedaliera

Dettagli

Nella prima lezione... Che cos è il Digitale. Prima parte: Che cos è il Digitale. Che cos è il Digitale. Che cos è il Digitale

Nella prima lezione... Che cos è il Digitale. Prima parte: Che cos è il Digitale. Che cos è il Digitale. Che cos è il Digitale !"$#%!" #% Nella prima lezione... Definizione di Informatica Cosa è una soluzione algoritmica Esempi di algoritmi cicalese@dia.unisa.it 2 Prima parte: Società dell informazione Ma cosa vuol dire società

Dettagli

Zeroshell come client OpenVPN

Zeroshell come client OpenVPN Zeroshell come client OpenVPN (di un server OpenVpn Linux) Le funzionalità di stabilire connessioni VPN di Zeroshell vede come scenario solito Zeroshell sia come client sia come server e per scelta architetturale,

Dettagli

IMAGING BIO_MOLECOLARE con DaTSCAN

IMAGING BIO_MOLECOLARE con DaTSCAN IMAGING BIO_MOLECOLARE con DaTSCAN Stelvio Sestini, MD, PhD Unità di Medicina Nucleare - USL4 Prato Università degli Studi di Firenze Concetto 1. Le M. Neurodegenerative sono in aumento Concetto 2. Le

Dettagli

Master of Business Administration Programma MBA Collège des Ingénieurs Italia

Master of Business Administration Programma MBA Collège des Ingénieurs Italia Master of Business Administration Programma MBA Collège des Ingénieurs Italia NetworkNetwor erpreneurship Enterpreneu Network L Enterpreneurship Passion Leadership Istituzione indipendente per la formazione

Dettagli

PMI. Management Maturity Model, OPM3 Second Edition 2008

PMI. Management Maturity Model, OPM3 Second Edition 2008 Nuovi standard PMI, certificazioni professionali e non solo Milano, 20 marzo 2009 PMI Organizational Project Management Maturity Model, OPM3 Second Edition 2008 Andrea Caccamese, PMP Prince2 Practitioner

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

APPLICATION FORM 1. YOUR MOTIVATION/ LA TUA MOTIVAZIONE

APPLICATION FORM 1. YOUR MOTIVATION/ LA TUA MOTIVAZIONE APPLICATION FORM Thank you for your interest in our project. We would like to understand better your motivation in taking part in this specific project. So please, read carefully the form, answer the questions

Dettagli

Web conferencing software. Massimiliano Greco - Ivan Cerato - Mario Salvetti

Web conferencing software. Massimiliano Greco - Ivan Cerato - Mario Salvetti 1 Web conferencing software Massimiliano Greco - Ivan Cerato - Mario Salvetti Arpa Piemonte 2 Che cosa è Big Blue Button? Free, open source, web conferencing software Semplice ed immediato ( Just push

Dettagli

12.5 UDP (User Datagram Protocol)

12.5 UDP (User Datagram Protocol) CAPITOLO 12. SUITE DI PROTOCOLLI TCP/IP 88 12.5 UDP (User Datagram Protocol) L UDP (User Datagram Protocol) é uno dei due protocolli del livello di trasporto. Come l IP, é un protocollo inaffidabile, che

Dettagli

Ambienti di sviluppo integrato

Ambienti di sviluppo integrato Ambienti di sviluppo integrato Un ambiente di sviluppo integrato (IDE - Integrated Development Environment) è un ambiente software che assiste i programmatori nello sviluppo di programmi Esso è normalmente

Dettagli

L analisi dei villi coriali

L analisi dei villi coriali 12 L analisi dei villi coriali Testo modificato dagli opuscoli prodotti dal Royal College of Obstetricians and Gynaecologists dell Ospedale Guy s and St Thomas di Londra. www.rcog.org.uk/index.asp?pageid=625

Dettagli

Smobilizzo pro-soluto di Lettere di Credito Import

Smobilizzo pro-soluto di Lettere di Credito Import definizione L operazione presuppone l emissione di una lettera di credito IMPORT in favore dell esportatore estero, con termine di pagamento differito (es. 180 gg dalla data di spedizione con documenti

Dettagli

CODE-STAT 9.0 SOFTWARE PER REVISIONE DATI BROCHURE ILLUSTRATIVA

CODE-STAT 9.0 SOFTWARE PER REVISIONE DATI BROCHURE ILLUSTRATIVA CODE-STAT 9.0 SOFTWARE PER REVISIONE DATI BROCHURE ILLUSTRATIVA La più potente analisi retrospettiva dei dati relativi a un evento cardiaco. Prestazioni migliorate. Livello di assistenza più elevato. 1

Dettagli

Analisi Costi e Benefici Laura Vici laura.vici@unibo.it LEZIONE 5

Analisi Costi e Benefici Laura Vici laura.vici@unibo.it LEZIONE 5 Analisi Costi e Benefici Laura Vici laura.vici@unibo.it LEZIONE 5 Rimini, 26 aprile 2006 1 The Inter temporal Effects of International Trade Valore in $ del consumo di beni oggi G D F H 1/(1+r) G Valore

Dettagli

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le tre leggi di Mendel, che descrivono la trasmissione dei caratteri ereditari da una generazione all altra, segnano l inizio della

Dettagli

Il test valuta la capacità di pensare?

Il test valuta la capacità di pensare? Il test valuta la capacità di pensare? Per favore compili il seguente questionario senza farsi aiutare da altri. Cognome e Nome Data di Nascita / / Quanti anni scolastici ha frequentato? Maschio Femmina

Dettagli

Profilo Aziendale ISO 9001: 2008. METISOFT spa - p.iva 00702470675 - www.metisoft.it - info@metisoft.it

Profilo Aziendale ISO 9001: 2008. METISOFT spa - p.iva 00702470675 - www.metisoft.it - info@metisoft.it ISO 9001: 2008 Profilo Aziendale METISOFT spa - p.iva 00702470675 - www.metisoft.it - info@metisoft.it Sede legale: * Viale Brodolini, 117-60044 - Fabriano (AN) - Tel. 0732.251856 Sede amministrativa:

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Struttura dei Programmi Operativi 2014-2020 Risultati attesi, realizzazioni, indicatori. Oriana Cuccu, Simona De Luca, DPS-UVAL

Struttura dei Programmi Operativi 2014-2020 Risultati attesi, realizzazioni, indicatori. Oriana Cuccu, Simona De Luca, DPS-UVAL Struttura dei Programmi Operativi 2014-2020 Risultati attesi, realizzazioni, indicatori, DPS-UVAL Struttura dei Programmi Operativi Innovazioni di metodo Risultati attesi Risultati Azioni attesi Tempi

Dettagli

How to Develop Accessible Linux Applications

How to Develop Accessible Linux Applications How to Develop Accessible Linux Applications Sharon Snider Copyright 2002 IBM Corporation v1.1, 2002-05-03 Diario delle Revisioni Revisione v1.1 2002-05-03 Revisionato da: sds Convertito in DocBook XML

Dettagli

Assessorato regionale dell'agricoltura, dello sviluppo rurale e della pesca mediterranea Dipartimento della pesca mediterranea

Assessorato regionale dell'agricoltura, dello sviluppo rurale e della pesca mediterranea Dipartimento della pesca mediterranea Assessorato regionale dell'agricoltura, dello sviluppo rurale e della pesca mediterranea Dipartimento della pesca mediterranea Ufficio del Responsabile Unico della Regione Sicilia per il Cluster Bio-Mediterraneo

Dettagli

/*dichiarazioni*/ // le frasi sono contenute in stringhe, cioè array di char char f1[max]; int i, giusto,len;

/*dichiarazioni*/ // le frasi sono contenute in stringhe, cioè array di char char f1[max]; int i, giusto,len; /* Date in ingresso una frase, dire se una è palindroma */ #include #define MAX 100 int main() /*dichiarazioni*/ // le frasi sono contenute in stringhe, cioè array di char char f1[max]; int i,

Dettagli

Controllare un nastro trasportatore fischertechnik con Arduino

Controllare un nastro trasportatore fischertechnik con Arduino TITOLO ESPERIENZA: Controllare un nastro trasportatore fischertechnik con Arduino PRODOTTI UTILIZZATI: OBIETTIVO: AUTORE: RINGRAZIAMENTI: Interfacciare e controllare un modello di nastro trasportatore

Dettagli

Ragazzi vietnamiti: (VIET L ANIMA HCM USSH) CLASSE 5 C: (21 TORTELLINI) 1. Trần Yến Ngọc 2. Nguyễn Ngọc Bách Châu AUTORI PROGETTO:

Ragazzi vietnamiti: (VIET L ANIMA HCM USSH) CLASSE 5 C: (21 TORTELLINI) 1. Trần Yến Ngọc 2. Nguyễn Ngọc Bách Châu AUTORI PROGETTO: Due mondi, due culture, due storie che si incontrano per dare vita a qualcosa di unico: la scoperta di ciò che ci rende unici ma fratelli. Per andare insieme verso EXPO 2015 Tutt altra storia Il viaggio

Dettagli

Comparazione dello stress dei caregiver di pazienti affetti da Malattia di Alzheimer o Demenza Vascolare

Comparazione dello stress dei caregiver di pazienti affetti da Malattia di Alzheimer o Demenza Vascolare Comparazione dello stress dei caregiver di pazienti affetti da Malattia di Alzheimer o Demenza Vascolare Grazia D Onofrio 1, Daniele Sancarlo 1, Francesco Paris 1, Leandro Cascavilla 1, Giulia Paroni 1,

Dettagli

Sistemi di gestione dei dati e dei processi aziendali. Information Technology General Controls

Sistemi di gestione dei dati e dei processi aziendali. Information Technology General Controls Information Technology General Controls Indice degli argomenti Introduzione agli ITGC ITGC e altre componenti del COSO Framework Sviluppo e manutenzione degli applicativi Gestione operativa delle infrastrutture

Dettagli

Progetto VirtualCED Clustered

Progetto VirtualCED Clustered Progetto VirtualCED Clustered Un passo indietro Il progetto VirtualCED, descritto in un precedente articolo 1, è ormai stato implementato con successo. Riassumendo brevemente, si tratta di un progetto

Dettagli

Materia: INGLESE Data: 24/10/2004

Materia: INGLESE Data: 24/10/2004 ! VERBI CHE TERMINANO IN... COME COSTRUIRE IL SIMPLE PAST ESEMPIO e aggiungere -d live - lived date - dated consonante + y 1 vocale + 1 consonante (ma non w o y) cambiare y in i, poi aggiungere -ed raddoppiare

Dettagli

Principali prove meccaniche su materiali polimerici

Principali prove meccaniche su materiali polimerici modulo: Proprietà viscoelastiche e proprietà meccaniche dei polimeri Principali prove meccaniche su materiali polimerici R. Pantani Scheda tecnica di un materiale polimerico Standard per prove meccaniche

Dettagli

Veniamo al dunque, per prima cosa recuperiamo il materiale necessario:

Veniamo al dunque, per prima cosa recuperiamo il materiale necessario: Probabilmente questo problema è stato già affrontato da altri, ma volevo portare la mia esperienza diretta, riguardo alla realizzazione di un alimentatore per il caricabatterie 12 volt, ottenuto trasformando

Dettagli

CMMI-Dev V1.3. Capability Maturity Model Integration for Software Development, Version 1.3. Roma, 2012 Ercole Colonese

CMMI-Dev V1.3. Capability Maturity Model Integration for Software Development, Version 1.3. Roma, 2012 Ercole Colonese CMMI-Dev V1.3 Capability Maturity Model Integration for Software Development, Version 1.3 Roma, 2012 Agenda Che cos è il CMMI Costellazione di modelli Approccio staged e continuous Aree di processo Goals

Dettagli

Articolazione didattica on-line

Articolazione didattica on-line L organizzazione della didattica per lo studente L impegno di tempo che lo studente deve dedicare alle attività didattiche offerte per ogni singolo insegnamento è così ripartito: - l auto-apprendimento

Dettagli

Stop press Disposizioni di vigilanza sulle partecipazioni detenibili dalle banche e dai gruppi bancari

Stop press Disposizioni di vigilanza sulle partecipazioni detenibili dalle banche e dai gruppi bancari Gennaio 2010 Stop press Disposizioni di vigilanza sulle partecipazioni detenibili dalle banche e dai gruppi bancari Introduzione In data 10 dicembre 2009, la Banca d'italia ha pubblicato un documento per

Dettagli

8. L'USO DEL PROGRAMMA DI POSTA ELETTRONICA INSIEME ALLA GESTIONE PROFESSIONALE DI DOCUMENTI IN FORMATO E-MAIL

8. L'USO DEL PROGRAMMA DI POSTA ELETTRONICA INSIEME ALLA GESTIONE PROFESSIONALE DI DOCUMENTI IN FORMATO E-MAIL This project funded by Leonardo da Vinci has been carried out with the support of the European Community. The content of this project does not necessarily reflect the position of the European Community

Dettagli

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine VITAMINA D: SINTESI, METABOLISMO E CARENZA Il 40-50% della

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

UN BUON VIAGGIO INIZIA PRIMA DI PARTIRE 3 SERVIZI ALITALIA. SEMPRE DI PIÙ, PER TE.

UN BUON VIAGGIO INIZIA PRIMA DI PARTIRE 3 SERVIZI ALITALIA. SEMPRE DI PIÙ, PER TE. UN BUON VIAGGIO INIZIA PRIMA DI PARTIR 3 RVIZI ALITALIA. MPR DI PIÙ, PR T. FAT TRACK. DDICATO A CHI NON AMA PRDR TMPO. La pazienza è una grande virtù. Ma è anche vero che ogni minuto è prezioso. Per questo

Dettagli

Business Process Management

Business Process Management Business Process Management Come si organizza un progetto di BPM 1 INDICE Organizzazione di un progetto di Business Process Management Tipo di intervento Struttura del progetto BPM Process Performance

Dettagli

Come si prepara una presentazione

Come si prepara una presentazione Analisi Critica della Letteratura Scientifica 1 Come si prepara una presentazione Perché? 2 Esperienza: Si vedono spesso presentazioni di scarsa qualità Evidenza: Un lavoro ottimo, presentato in modo pessimo,

Dettagli

Pila.h versione 6. class Pila { private: int marker; int * contenuto; public:

Pila.h versione 6. class Pila { private: int marker; int * contenuto; public: 1 Pila.h versione 6 struct Pila { private: int size; int defaultgrowthsize; int marker; int * contenuto; void cresci(int increment); public: Pila(int initialsize) ; Pila(); ~Pila() ; void copy(pila * to)

Dettagli

La disseminazione dei progetti europei

La disseminazione dei progetti europei La disseminazione dei progetti europei Indice 1. La disseminazione nel 7PQ: un obbligo! 2. Comunicare nei progetti europei 3. Target audience e Key Message 4. Sviluppare un dissemination plan 5. Message

Dettagli

Procedura per i reclami da parte degli inquilini e imposizione delle norme sulle abitazioni (Property Standards) negli appartamenti in affitto

Procedura per i reclami da parte degli inquilini e imposizione delle norme sulle abitazioni (Property Standards) negli appartamenti in affitto Procedura per i reclami da parte degli inquilini e imposizione delle norme sulle abitazioni (Property Standards) negli appartamenti in affitto Abbiamo cura delle nostre abitazioni. Avete un reclamo da

Dettagli

RefWorks Guida all utente Versione 4.0

RefWorks Guida all utente Versione 4.0 Accesso a RefWorks per utenti registrati RefWorks Guida all utente Versione 4.0 Dalla pagina web www.refworks.com/refworks Inserire il proprio username (indirizzo e-mail) e password NB: Agli utenti remoti

Dettagli

Un oggetto per la lettura dalla tastiera

Un oggetto per la lettura dalla tastiera Fondamenti di informatica Oggetti e Java ottobre 2012 1 Un oggetto per la lettura dalla tastiera Le API di Java hanno un oggetto System.in che rappresenta la tastiera del calcolatore, ma che non è semplice

Dettagli

Teoria della misurazione e misurabilità di grandezze non fisiche

Teoria della misurazione e misurabilità di grandezze non fisiche Teoria della misurazione e misurabilità di grandezze non fisiche Versione 12.6.05 Teoria della misurazione e misurabilità di grandezze non fisiche 1 Il contesto del discorso (dalla lezione introduttiva)

Dettagli

Esercizi per il corso di Algoritmi e Strutture Dati

Esercizi per il corso di Algoritmi e Strutture Dati 1 Esercizi per il corso di Algoritmi e Strutture Dati Esercizi sulla Tecnica Divide et Impera N.B. Tutti gli algoritmi vanno scritti in pseudocodice (non in Java, né in C++, etc. ). Di tutti gli algoritmi

Dettagli

Configuration Managment Configurare EC2 su AWS. Tutorial. Configuration Managment. Configurare il servizio EC2 su AWS. Pagina 1

Configuration Managment Configurare EC2 su AWS. Tutorial. Configuration Managment. Configurare il servizio EC2 su AWS. Pagina 1 Tutorial Configuration Managment Configurare il servizio EC2 su AWS Pagina 1 Sommario 1. INTRODUZIONE... 3 2. PROGRAMMI NECESSARI... 4 3. PANNELLO DI CONTROLLO... 5 4. CONFIGURARE E LANCIARE UN ISTANZA...

Dettagli

5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak

5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak Tipo: Type: 5 cabine (1 main deck+ 4 lower deck) 5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak Tessuti: Dedar Fanfara, Paola Lenti Fabrics: Dedar Fanfara,

Dettagli

Nessuno ha mai visto Dio; l'unigenito Dio, che è nel seno del Padre, è quello che l'ha fatto conoscere (NR, 1994).

Nessuno ha mai visto Dio; l'unigenito Dio, che è nel seno del Padre, è quello che l'ha fatto conoscere (NR, 1994). Giovanni 1:18 Nessuno ha mai visto Dio; l'unigenito Dio, che è nel seno del Padre, è quello che l'ha fatto conoscere (NR, 1994). (1) Introduzione (2) Esegesi e analisi testo (3) Contributi di vari studiosi

Dettagli

LINEE GUIDA PER LA REVISIONE SISTEMATICA DI LETTERATURA

LINEE GUIDA PER LA REVISIONE SISTEMATICA DI LETTERATURA LINEE GUIDA PER LA REVISIONE SISTEMATICA DI LETTERATURA report tecnico nr. 03/08 v. 1 indice dei contenuti 1. Utilità delle RSL Pag. 1 2. Principali metodi Pag. 2 3. Esempi di RSL Pag. 3 4. Protocollo

Dettagli

Semantica operazionale dei linguaggi di Programmazione

Semantica operazionale dei linguaggi di Programmazione Semantica operazionale dei linguaggi di Programmazione Oggetti sintattici e oggetti semantici Rosario Culmone, Luca Tesei Lucidi tratti dalla dispensa Elementi di Semantica Operazionale R. Barbuti, P.

Dettagli

Gi-Gi Art. 859 - User's Guide Istruzioni d'uso

Gi-Gi Art. 859 - User's Guide Istruzioni d'uso doc.4.12-06/03 Gi-Gi Art. 859 - User's Guide Istruzioni d'uso A belaying plate that can be used in many different conditions Una piastrina d'assicurazione che può essere utilizzata in condizioni diverse.

Dettagli

Manuale di installazione della piattaforma Business Intelligence per Windows

Manuale di installazione della piattaforma Business Intelligence per Windows Piattaforma SAP BusinessObjects Business Intelligence Versione del documento: 4.1 Support Package 3-2014-03-25 Manuale di installazione della piattaforma Business Intelligence per Windows Sommario 1 Cronologia

Dettagli

Traduzione di TeamLab in altre lingue

Traduzione di TeamLab in altre lingue Lingue disponibili TeamLab è disponibile nelle seguenti lingue nel mese di gennaio 2012: Traduzioni complete Lingue tradotte parzialmente Inglese Tedesco Francese Spagnolo Russo Lettone Italiano Cinese

Dettagli

Proposition for a case-study identification process. 6/7 May 2008 Helsinki

Proposition for a case-study identification process. 6/7 May 2008 Helsinki Conférence des Régions Périphériques Maritimes d Europe Conference of Peripheral Maritime Regions of Europe ANALYSIS PARTICIPATION TO THE FP THROUGH A TERRITORIAL AND REGIONAL PERSPECTIVE MEETING WITH

Dettagli

DISCIPLINA IVA NEL SUBAPPALTO

DISCIPLINA IVA NEL SUBAPPALTO DISCIPLINA IVA NEL SUBAPPALTO L articolo 35, comma 5, D.L. n. 223/2006 ha aggiunto il seguente comma all articolo 17, D.P.R. n. 633/72: Le disposizioni di cui al comma precedente si applicano anche alle

Dettagli

Release Management. Obiettivi. Definizioni. Responsabilità. Attività. Input

Release Management. Obiettivi. Definizioni. Responsabilità. Attività. Input Release Management Obiettivi Obiettivo del Release Management è di raggiungere una visione d insieme del cambiamento nei servizi IT e accertarsi che tutti gli aspetti di una release (tecnici e non) siano

Dettagli

Learning 4 All. Proposta di template per la descrizione comune dei Format didattici

Learning 4 All. Proposta di template per la descrizione comune dei Format didattici Learning 4 All Proposta di template per la descrizione comune dei Format didattici Autore/i Data Versione Reviewer Ferrari L., Lovece S. 12/10/2010 1.1 Luigi Guerra, Elena Pacetti, Manuela Fabbri, Enrico

Dettagli

Rilascio dei Permessi Volo

Rilascio dei Permessi Volo R E P U B L I C O F S A N M A R I N O C I V I L A V I A T I O N A U T H O R I T Y SAN MARINO CIVIL AVIATION REGULATION Rilascio dei Permessi Volo SM-CAR PART 5 Approvazione: Ing. Marco Conti official of

Dettagli

Informazioni per i pazienti e le famiglie

Informazioni per i pazienti e le famiglie Che cos è l MRSA? (What is MRSA? Italian) Reparto Prevenzione e controllo delle infezioni UHN Informazioni per i pazienti e le famiglie Patient Education Improving Health Through Education L MRSA è un

Dettagli

GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE

GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE D r. C a r l o D e s c o v i c h U.O.C. Governo Clinico Staff Direzione Aziendale AUSL Bologna Bologna 26 Maggio 2010 INDICATORE

Dettagli

DPS-Promatic Telecom Control Systems. Famiglia TCS-AWS. Stazioni Metereologiche Autonome. connesse alla rete GSM. Guida rapida all'uso versione 1.

DPS-Promatic Telecom Control Systems. Famiglia TCS-AWS. Stazioni Metereologiche Autonome. connesse alla rete GSM. Guida rapida all'uso versione 1. DPS-Promatic Telecom Control Systems Famiglia TCS-AWS di Stazioni Metereologiche Autonome connesse alla rete GSM (www.dpspro.com) Guida rapida all'uso versione 1.0 Modelli che compongono a famiglia TCS-AWS:

Dettagli

IT Service Management, le best practice per la gestione dei servizi

IT Service Management, le best practice per la gestione dei servizi Il Framework ITIL e gli Standard di PMI : : possibili sinergie Milano, Venerdì, 11 Luglio 2008 IT Service Management, le best practice per la gestione dei servizi Maxime Sottini Slide 1 Agenda Introduzione

Dettagli

AGREE nella valutazione della qualità delle LG per la diagnosi e terapia delle cefalee in età pediatrica

AGREE nella valutazione della qualità delle LG per la diagnosi e terapia delle cefalee in età pediatrica AGREE nella valutazione della qualità delle LG per la diagnosi e terapia delle cefalee in età pediatrica Pasquale Parisi, MD PhD et. al. Outpatience Service of Paediatric Neurology Child Neurology, Chair

Dettagli

Prof. Like you. Prof. Like you. Tel. +39 075 801 23 18 / Fax +39 075 801 29 01. Email info@zerounoinformatica.it / Web www.hottimo.

Prof. Like you. Prof. Like you. Tel. +39 075 801 23 18 / Fax +39 075 801 29 01. Email info@zerounoinformatica.it / Web www.hottimo. Pag. 1/7 Prof. Like you Tel. +39 075 801 23 18 / Fax +39 075 801 29 01 Email / Web / Social Pag. 2/7 hottimo.crm Con CRM (Customer Relationship Management) si indicano tutti gli aspetti di interazione

Dettagli

Luca Mambella Disaster recovery: dalle soluzioni tradizionali al cloud, come far evolvere le soluzioni contenendone i costi.

Luca Mambella Disaster recovery: dalle soluzioni tradizionali al cloud, come far evolvere le soluzioni contenendone i costi. Luca Mambella Disaster recovery: dalle soluzioni tradizionali al cloud, come far evolvere le soluzioni contenendone i costi. I modelli di sourcing Il mercato offre una varietà di modelli di sourcing, ispirati

Dettagli

Manipolazione di testi: espressioni regolari

Manipolazione di testi: espressioni regolari Manipolazione di testi: espressioni regolari Un meccanismo per specificare un pattern, che, di fatto, è la rappresentazione sintetica di un insieme (eventualmente infinito) di stringhe: il pattern viene

Dettagli

CARATTERISTICHE DELLE CRYPTO BOX

CARATTERISTICHE DELLE CRYPTO BOX Secure Stream PANORAMICA Il sistema Secure Stream è costituito da due appliance (Crypto BOX) in grado di stabilire tra loro un collegamento sicuro. Le Crypto BOX sono dei veri e propri router in grado

Dettagli

Servizi di consulenza e soluzioni ICT

Servizi di consulenza e soluzioni ICT Servizi di consulenza e soluzioni ICT Juniortek S.r.l. Fondata nell'anno 2004, Juniortek offre consulenza e servizi nell ambito dell informatica ad imprese e professionisti. L'organizzazione dell'azienda

Dettagli

4832015 FOTOCAMERA GSM. Manuale Utente. Versione manuale 1.9

4832015 FOTOCAMERA GSM. Manuale Utente. Versione manuale 1.9 4832015 FOTOCAMERA GSM Manuale Utente Versione manuale 1.9 4832015 Fotocamera GSM con controllo Remoto Grazie per aver acquistato questo dispositivo. Questa telecamera controllata a distanza, è in grado

Dettagli

DNS (Domain Name System) Gruppo Linux

DNS (Domain Name System) Gruppo Linux DNS (Domain Name System) Gruppo Linux Luca Sozio Matteo Giordano Vincenzo Sgaramella Enrico Palmerini DNS (Domain Name System) Ci sono due modi per identificare un host nella rete: - Attraverso un hostname

Dettagli

Ereditarietà legata al cromosoma X

Ereditarietà legata al cromosoma X 16 Ereditarietà legata al cromosoma X Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle

Dettagli

Procedura per scaricare le carte PREPAGATE Navionics Gold dal ChartInstaller Navionics

Procedura per scaricare le carte PREPAGATE Navionics Gold dal ChartInstaller Navionics Procedura per scaricare le carte PREPAGATE Navionics Gold dal ChartInstaller Navionics Come scaricare Le carte Gold dal ChartInstaller Navionics Accedere al sito: www.navionics.com La procedura di download

Dettagli

T H O R A F L Y. Sistemi di drenaggio toracico Thoracic drainage systems. Catalogo 2009 - Catalogue 2009 GRUPPO C GROUP C

T H O R A F L Y. Sistemi di drenaggio toracico Thoracic drainage systems. Catalogo 2009 - Catalogue 2009 GRUPPO C GROUP C T H O R A F L Y Sistemi di drenaggio toracico Thoracic drainage systems Catalogo 2009 - Catalogue 2009 GRUPPO C GROUP C SOMMARIO GRUPPO C (SUMMARY C GROUP) 1/C II SISTEMI DI DRENAGGIO TORACICO COMPLETI

Dettagli

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office Gestione delle Architetture e dei Servizi IT con ADOit Un Prodotto della Suite BOC Management Office Controllo Globale e Permanente delle Architetture IT Aziendali e dei Processi IT: IT-Governance Definire

Dettagli

Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale.

Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale. Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale. L analisi modale è un approccio molto efficace al comportamento dinamico delle strutture, alla verifica di modelli di calcolo

Dettagli

ALGORITMI 1 a Parte. di Ippolito Perlasca. Algoritmo:

ALGORITMI 1 a Parte. di Ippolito Perlasca. Algoritmo: ALGORITMI 1 a Parte di Ippolito Perlasca Algoritmo: Insieme di regole che forniscono una sequenza di operazioni atte a risolvere un particolare problema (De Mauro) Procedimento che consente di ottenere

Dettagli