Esercitazioni di Genomica

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Esercitazioni di Genomica"


1 Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua

2 Calendario 2 dicembre Formati e strumenti 3 dicembre Alcune applicazioni dell NGS (e formazione gruppi di interesse per argomento) 9 dicembre Analisi dati 16S / genomi batterici 16 dicembre Analisi dati Human Resequencing Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

3 Alcune cose da fare ora Se non l avete già fatto, rispondere al sondaggio nel blog (ne faremo un altro dopo il laboratorio) Provare ad installare Java + IGV per chi non l ha fatto (nel blog istruzioni) Provare ad installare samtools Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

4 Stiamo preparando un piccolo repository di pacchetti bioinformatici a 32 bit e a 64 bit, che dovrebbero girare su qualsiasi *buntu. Li pubblicheremo nel blog, anche grazie al vostro feedback Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014


6 Il formato VCF

7 Cinque progetti in cerca d'autore Variant calling su pazienti affetti da cardiomiopatie Assemblaggio de novo di un batterio Analisi di comunità batteriche con 16S-Seq RNA-Seq per identificare geni differenzialmente espressi [per i temerari] Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

8 Variant Calling in Target Enrichment

9 Steps Allineamento sul reference è critico e se possibile va migliorato (riallineamento) Ricerca delle varianti (variant calling) Annotazione delle varianti Validazione! Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

10 Cosa faremo noi? Useremo dati di un target enrichment di poche kb di genoma umano (e un solo cromosoma) Analizzeremo le varianti presenti producendo un VCF Valideremo alcune varianti usando il buon vecchio Sanger Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

11 Esercitazioni di Genomica Lezione Applicazioni introduttiva biologiche del NGS 23 dicembre 2014

12 Varianti?

13 Variants?

14 Errors!


16 VEP: Variant Effect Predictor genes and transcripts affected by the variants location of the variants (e.g. upstream, in coding sequence, in non-coding RNA, in regulatory regions) consequence of your variants on the protein sequence (e.g. stop gained, missense, stop lost, frameshift) known variants that match yours, and associated minor allele frequencies from the 1000 Genomes Project SIFT and PolyPhen scores for changes to protein sequence


18 ANNOVAR ANNOVAR is an efficient tool to functionally annotate genetic variants. Gene-based annotation: identify whether SNPs or CNVs cause protein coding changes and the amino acids that are affected. Region-based annotations: identify variants in specific genomic regions, for example, conserved regions among 44 species, predicted transcription factor binding sites, Filter-based annotation: identify variants that are reported in dbsnp, or identify the subset of common SNPs (MAF>1%) in the 1000 Genome Project, or identify subset of non-synonymous SNPs with SIFT score>0.05,


20 De novo genome assembly

21 Shotgun ACGTACGTAGCTGACGA AGCTGACGATCGATCGTAGCTAGCTA ATCGTAGCTAGCTAGATTACA AGATTACAGTCTACGTACTATCGA Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

22 Shotgun ACGTACGTAGCTGACGA AGCTGACGATCGATCGTAGCTAGCTA ATCGTAGCTAGCTAGATTACA AGATTACAGTCTACGTACTATCGA Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

23 Shotgun ACGTACGTAGCTGACGATCGATCGTAGCTAGCTAGATTACAGTCTACGTACTATCGA contig Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

24 Problem Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

25 Problem Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

26 Solution Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

27 Solution Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

28 Metrics Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

29 Il progetto Dataset: reads FASTQ (Illumina MiSeq) Programma consigliato: Mira Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

30 Analisi di Ampliconi 16S


32 Microbial Biogeography of Public Restroom Surfaces Flores G. E. et al., 2011 (PLoS One)

33 Key questions Who is out there? What are they doing?

34 Cosa faremo? Avremo sequenze prodotte dal sequenziamento 16S di due campioni alimentari. Li classificheremo utilizzando due metodi: RDP Qiime (VirtualBox) Confronteremo i risultati Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

35 I passaggi chiave Clustering delle sequenze molto simili tra di loro (ogni cluster rappresenta, funzionalmente, una specie, più correttamente una OTU) Valutazione dell abbondanza di ogni cluster (più sequenze clusterizzano assieme, più abbondante è l unità tassonomica) Annotazione delle OTU Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

36 Buon lavoro

Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?


Bioinformatica (modulo bioinf. dei genomi moderni )

Bioinformatica (modulo bioinf. dei genomi moderni ) Bioinformatica (modulo bioinf. dei genomi moderni ) Dr. Marco Fondi Lezione # 5 Corso di Laurea in Scienze Biologiche, AA 2011-2012 giovedì 3 novembre 2011 1 Sequenziamento ed analisi di genomi: la genomica


Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E30Q6) AA 205/206 Esempio di workflow Docente del laboratorio: Raffaella Rizzi Scopo del workflow Scopo: dato un insieme


Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633


Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa


Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi


Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL Alcuni aspetti legati al calcolo bioinformatico su CRESCO Giuseppe Aprea UTMEA-CAL Principali attività bioinformatiche ENEA legate al calcolo Assemblaggio de Novo* Trascrittomica Analisi filogenetica Metagenomica*


Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE


Il microbiota della vite: un assicurazione sulla salute della pianta

Il microbiota della vite: un assicurazione sulla salute della pianta Il microbiota della vite: un assicurazione sulla salute della pianta 26 marzo 2015 Costigliole d Asti Museo del Vino Barolo Paola Bonfante Dibios Il microbiota dell intestino umano


Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Summer School 2015 Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Applicazioni della Next-Generation Sequencing con tecnologia Illumina Roberto Cusano 04-06


Introduzione alla Genomica

Introduzione alla Genomica Laboratorio di Bioinformatica I Introduzione alla Genomica Dott. Sergio Marin Vargas (2014 / 2015) Il Genoma umano Gene codificanti proteine Gene non codificanti proteine Geni codificanti proteine 3 Il


Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY)


Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica


Metodologie informa/che per l analisi dei genomi

Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Perchè sono qui? Walter Sanseverino, CEO at !? Informa/cs = Genomics? We have a problem!!! Focus curve


Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting


Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente


A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,


Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli Fonti e testi di riferimento Dan Graur: >courses > bioinformatics


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%


Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015 Next Generation Sequencers: from the bacterial culture to raw data Valeria Michelacci NGS course, June 2015 COSTS ASSOCIATED WITH DNA SEQUENCING 80-100 $ per Bacterial Genome!! Benefits from NGS Massive


Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:



EVOLUZIONE MOLECOLARE. Silvia Fuselli EVOLUZIONE MOLECOLARE Silvia Fuselli TESTI Organizzazione del corso Graur and Li, Fundamentals of molecular evolution, Sinauer 2000 Michael Lynch, The Origins of Genome Architecture,


"Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là".

Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là. Lentamente muore chi diventa schiavo dell'abitudine, ripetendo ogni giorno gli stessi percorsi, chi non cambia la marca, chi non rischia e cambia colore dei vestiti, chi non parla a chi non conosce. Muore


Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,



B R O C H U R E D E I C O R S I Scuola di Dottorato in Scienze della Vita e della Salute B R O C H U R E D E I C O R S I Dottorato in Sistemi Complessi per le Scienze della Vita Printed by Campusnet - 24/01/2016 06:15 Indice Indice Giornate


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing


Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione


Elementi di Bioinformatica per lʼanalisi di dati NGS

Elementi di Bioinformatica per lʼanalisi di dati NGS Corso di Alta formazione in Elementi di Bioinformatica per lʼanalisi di dati NGS 21-23 Settembre 2011 Centro Didattico Morgagni Viale Morgagni 40, Firenze Presentazione del corso Il corso di alta formazione


Polimorfismi del DNA e loro applicazioni

Polimorfismi del DNA e loro applicazioni Polimorfismi del DNA e loro applicazioni WWW.FISIOKINESITERAPIA.BIZ Lo sviluppo dei marcatori genetici nell uomo TIPO DI MARCATORE N DI LOCI CARATTERISTICHE Gruppi sanguigni ~ 20 Può esserci bisogno di


Whole genome SNPs comparison: SNPtree, NDtree, CSI Phylogeny and kmer-based analysis

Whole genome SNPs comparison: SNPtree, NDtree, CSI Phylogeny and kmer-based analysis Whole genome SNPs comparison: SNPtree, NDtree, CSI Phylogeny and kmer-based analysis Valeria Michelacci NGS course, June 2016 Webserver-based free pipelines available NCBI pipeline FDA GenomeTrakr CGE/DTU


Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza


Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo


Laurea in Biotecnologie Sanitarie, Universita' di Padova Docente: Dr. Stefania Bortoluzzi

Laurea in Biotecnologie Sanitarie, Universita' di Padova Docente: Dr. Stefania Bortoluzzi Laurea in Biotecnologie Sanitarie, Universita' di Padova Docente: Dr. Stefania Bortoluzzi Corso di Bioinformatica


Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette


Analisi bioinformatica di esperimenti di Esoma Intero in trio

Analisi bioinformatica di esperimenti di Esoma Intero in trio Analisi bioinformatica di esperimenti di Esoma Intero in trio L analisi dell esoma intero applicata ai trio (genitori e figlio/figlia affetto) è un approccio molto potente al fine di identificare mutazioni


Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello


I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina


Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi

Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi Marco Seri (sottotitolo preso in prestito dal Prof. R.



INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare





GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente






SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico


Biotecnologie Mediche. Cinzia Di Pietro 0953782055

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 Biotecnologie Mediche Cinzia Di Pietro 0953782055 Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Biotecnologie Mediche Prevenzione Diagnostica


SETTIMANA 05 24-03-2014 25-03-2014 26-03-2014 27-03-2014 28-03-2014 LUN MAR MER GIO VEN

SETTIMANA 05 24-03-2014 25-03-2014 26-03-2014 27-03-2014 28-03-2014 LUN MAR MER GIO VEN SETTIMANA 01 24-02-2014 25-02-2014 26-02-2014 27-02-2014 28-02-2014 05-S:Introduzione al seq. Solanacee 18-S:Introduzione al seq. Drupacee 10-11 INTRODUZIONE GIORNATEGENOMICHE 06-S: Sequenziamento Solanacee


De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente


Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia

Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Lorenzo Morelli Istituto di Microbiologia Facoltà di Agraria UCSC Piacenza In questa presentazione Peculiarità del genoma dei



Quotidiano. Quotidiano 097156 Quotidiano 097156 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013


Perché abbiamo deciso di sequenziare il genoma umano

Perché abbiamo deciso di sequenziare il genoma umano L'immagine sopra rappresenta le tappe fondamentali per la scoperta del genoma umano. Una versione più interattiva della mappa è disponibile nel sito del progetto genoma umano, nella sezione dedicata alla


Avanzamento dei sistemi di sequenziamento

Avanzamento dei sistemi di sequenziamento Avanzamento dei sistemi di sequenziamento Sistemi di sequenziamento capillare basati su: Lunghezza delle read: 800 basi Poche sequenze prodotte in una singola corsa Second Generation Sequencing (SGS):


Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E3101Q116) AA 2016/2017 I dati in Bioinformatica Docente del laboratorio: Raffaella Rizzi 1 Il DNA (oggetto biologico)



INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare


Progetto Genoma Umano

Progetto Genoma Umano Progetto Genoma Umano Perché il Progetto Genoma? La determinazione e la conoscenza dell intera sequenza genomica sembrano essere la condizione necessaria per comprendere la completa biologia di un determinato


La metagenomica al servizio dell agricoltura

La metagenomica al servizio dell agricoltura La metagenomica al servizio dell agricoltura Marco Bazzicalupo Department of Biology University of Florence, Firenze, Italy L albero della vita è microbico RNA


Analisi di dati di sequenziamento del trascrittoma (RNA-Seq):

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): Il vostro progetto Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): 1. Analisi di qualità 2. Mappatura sul genoma 3. Calcolo dell espressione 4. Test di espressione differenziale 5. Visualizzazione


Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Brian J O Roak1, Pelagia Deriziotis2, Choli Lee1, Laura Vives1, Jerrod J Schwartz1, Santhosh Girirajan1, Emre


CORREZIONE: mercoledì BioMi-3

CORREZIONE: mercoledì BioMi-3 CORREZIONE: mercoledì 25.11 BioMi-3 Durante quale processo si manifestano le mutazioni spontanee? A. Replicazione del DNA B. Trasformazione C. Traduzione D. Trascrizione Una sostituzione di basi che non


La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:


Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito


PERFORMING IN ENGLISH. il coaching linguistico dedicato ai manager

PERFORMING IN ENGLISH. il coaching linguistico dedicato ai manager PERFORMING IN ENGLISH il coaching linguistico dedicato ai manager qual è la differenza tra teaching e coaching? Il teaching ha un approccio unidirezionale Il coaching ha un approccio bidirezionale TEACHING


Il progetto Genoma Umano è iniziato nel E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA.

Il progetto Genoma Umano è iniziato nel E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA. Il progetto Genoma Umano è iniziato nel 1990. E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA. Progetto internazionale finanziato da vari paesi, affidato


Corso di Elementi di Bionformatica

Corso di Elementi di Bionformatica Corso di Elementi di Bionformatica Laurea Triennale in Informatica Il formato FASTQ per la qualità delle sequenze Anno Accademico 2015-2016 Docente del laboratorio: Raffaella Rizzi 1 La qualità delle sequenze


Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida

Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida R.M. De Miccolis Angelini, D. Digiaro, C. Rotolo, S. Pollastro, F. Faretra Dipartimento di Scienze


Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle


NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio


Guida di riferimento del software MiSeq Reporter per i saggi IVD

Guida di riferimento del software MiSeq Reporter per i saggi IVD Guida di riferimento del software MiSeq Reporter per i saggi IVD PER USO DIAGNOSTICO IN VITRO DI PROPRIETÀ DI ILLUMINA N. codice 15038356 Rev. A ITA Marzo 2014 Questo documento e il suo contenuto sono


Sequence Alignment Algorithms

Sequence Alignment Algorithms Sequence Alignment Algorithms Algoritmi per l Allineamento di Sequenze Relatore: Prof. Giancarlo Mauri Correlatore: Prof. Gianluca Della Vedova Tesi di Laurea di: Mauro Baluda Matricola 038208 Part of


Basic Next Generation Sequencing (NGS) procedures

Basic Next Generation Sequencing (NGS) procedures Basic Next Generation Sequencing (NGS) procedures 24-25-26 novembre 2014 Sede: Università dell Insubria, Via Alberto da Giussano 12, Busto Arsizio, Aula informatica Orario delle lezioni: 9.30-16.30 Le


DNA sequencing. Reading Genomes. Giovanni Bacci

DNA sequencing. Reading Genomes. Giovanni Bacci Reading Genomes Giovanni Bacci Evoluzione del sequenziamento 1977 Frederick Sanger Prima tecnica di sequenziamento 1987 Applyed Biosystems Prima macchina automatica per il sequenziamento del DNA 1998 Phil


L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare


Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Watson & Crick DNA 1953 Tappe della GENETICA UMANA G. Mendel leggi dell


Analisi di dati di sequenziamento del trascrittoma (RNA-Seq):

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): Il vostro progetto Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): 1. Analisi di qualità 2. Mappatura sul genoma 3. Calcolo dell espressione 4. Test di espressione differenziale 5. Visualizzazione


ELTeach. Ottmizza lia preparazione pedagogica dei docenti all insegnamento dell inglese in inglese

ELTeach. Ottmizza lia preparazione pedagogica dei docenti all insegnamento dell inglese in inglese ELTeach Ottmizza lia preparazione pedagogica dei docenti all insegnamento dell inglese in inglese Porta a risultati quantificabili e genera dati non ricavabili dalle sessioni di formazione faccia a faccia



DATABASE DI GENETICA E BIOLOGIA MOLECOLARE DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance in Man EntrezGene curated sequence and descriptive information about genetic loci GenCards HGMD dbsnp database of human genes,


John S. Silva, Marion J. Ball, Prognosis for year 2013, International Journal of Medical Informatics 2002, vol. 66, pag. 45 49

John S. Silva, Marion J. Ball, Prognosis for year 2013, International Journal of Medical Informatics 2002, vol. 66, pag. 45 49 John S. Silva, Marion J. Ball, Prognosis for year 2013, International Journal of Medical Informatics 2002, vol. 66, pag. 45 49 Introduzione Nuove conoscenze fornite dalle biotecnologie Mappa del genoma


Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori


La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione



SCHEDA DEL DOCENTE - CV Studi di Cagliari Corso di laurea INFORMAZIONI ANAGRAFICHE Nome: FEDERICA Cognome: INCANI Nato a:cagliari Il 19/10/1975 Indirizzo di Residenza: VIA BERNINI 6 CAGLIARI Tel.: Mail: Cell.:3284494008


Bioinformatica: DNA e Algoritmi

Bioinformatica: DNA e Algoritmi Bioinformatica: DNA e Algoritmi Alberto Policriti Dpt. of Mathematics and Informatics, University of Udine. Applied Genomics Institute Di cosa parleremo In generale Deniamo i termini: DNA & Algoritmi Tecnologie



COSA FARE APPENA ACQUISTATA UNA SMARTBOARD TM COSA FARE APPENA ACQUISTATA UNA SMARTBOARD TM Una volta acquistata una Lavagna Interattiva Multimediale SMARTBoard TM, è necessario effettuare una procedura di registrazione al fine di:. Estendere la garanzia


U Corso di italiano, Lezione Diciassette

U Corso di italiano, Lezione Diciassette 1 U Corso di italiano, Lezione Diciassette U Oggi, facciamo un esercizio M Today we do an exercise U Oggi, facciamo un esercizio D Noi diremo una frase in inglese e tu cerca di pensare a come dirla in


U Corso di italiano, Lezione Dieci

U Corso di italiano, Lezione Dieci 1 U Corso di italiano, Lezione Dieci U Ricordi i numeri da uno a dieci? M Do you remember Italian numbers from one to ten? U Ricordi i numeri da uno a dieci? U Uno, due, tre, quattro, cinque, sei, sette,





Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization Università degli Studi di Genova Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica Anno Accademico 2009/2010 Tesi di Laurea Specialistica Elaborazione di dati


Epigenetica e differenziamento Chiara Lanzuolo

Epigenetica e differenziamento Chiara Lanzuolo Epigenetica e differenziamento Chiara Lanzuolo Institute of Cellular Biology and Neurobiology (IBCN-CNR) Epigenetica Conrad Waddington,1942: Epig! hich studies the causal interactions! genes and their


Elementi ripetuti del Genoma Umano. Milioni di anni

Elementi ripetuti del Genoma Umano. Milioni di anni Elementi ripetuti del Genoma Umano Patologia Milioni di anni Evoluzione Un gene è duplicato Un gene è riarrangiato Genoma Il Genoma è l intero DNA contenuto in una Cellula Geni Sequenze Intergeniche Sequenze


Raccolta e analisi di letteratura scientifica su studi genomici di popolazioni umane con riguardo alla condivisione dei dati sperimentali

Raccolta e analisi di letteratura scientifica su studi genomici di popolazioni umane con riguardo alla condivisione dei dati sperimentali DEFINIZIONE DI UNA OPEN ACCESS POLICY PER GLI ISTITUTI SCIENTIFICI Raccolta e analisi di letteratura scientifica su studi genomici di popolazioni umane con riguardo alla condivisione dei dati sperimentali


Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini

Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini Analisi del genoma umano: possibilità e limiti Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini What is DNA? It's a history book - a narrative of the journey of our species


Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery


Prof. Raffaele Calogero. Tel. 011 6705417 Cell. 333 3827080. in qualunque momento. Introduzione alla Genomica, Gibson & Muse (Zanichelli)

Prof. Raffaele Calogero. Tel. 011 6705417 Cell. 333 3827080. in qualunque momento. Introduzione alla Genomica, Gibson & Muse (Zanichelli) Bioinformatica Prof. Raffaele Calogero Tel. 011 6705417 Cell. 333 3827080 Orari di ricevimento: in qualunque momento Testo: Introduzione alla Genomica, Gibson & Muse (Zanichelli)


Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei


Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione


Corso di Elementi di Bioinformatica

Corso di Elementi di Bioinformatica Corso di Elementi di Bioinformatica Laurea Triennale in Informatica I dati e le banche dati in Bioinformatica Anno Accademico 2015-2016 Docente del laboratorio: Raffaella Rizzi 1 Il DNA (oggetto biologico)


La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA


Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare

Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare Insegnamento di Genomica Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare docenti: Silvia Fuselli ( Vincenza Colonna Inga Prokopenko Morena


Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una

Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp (150.000Mbp=150Gbp) di una Liliacea. Tra le graminacee il frumento ha un genoma


particolare sequenza di purine e pirimidine elica localmente sinistrorsa andamento a zig-zag (da cui il nome)

particolare sequenza di purine e pirimidine elica localmente sinistrorsa andamento a zig-zag (da cui il nome) particolare sequenza di purine e pirimidine elica localmente sinistrorsa andamento a zig-zag (da cui il nome) i due solchi, maggiore e minore, dell'elica B sono qui sostituiti da un singolo (profondo)


Sommario. Diversità genetica a livello di sequenza Trovare gli SNP Genotipizzare gli SNP Principali applicazioni

Sommario. Diversità genetica a livello di sequenza Trovare gli SNP Genotipizzare gli SNP Principali applicazioni Sommario Diversità genetica a livello di sequenza Trovare gli SNP Genotipizzare gli SNP Principali applicazioni SNP: definizioni Polimorfismo al singolo nucleotide, in genere si intende la sostituzione
