Esercitazioni di Genomica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Esercitazioni di Genomica"

Transcript

1 Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua

2 Calendario 2 dicembre Formati e strumenti 3 dicembre Alcune applicazioni dell NGS (e formazione gruppi di interesse per argomento) 9 dicembre Analisi dati 16S / genomi batterici 16 dicembre Analisi dati Human Resequencing Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

3 Alcune cose da fare ora Se non l avete già fatto, rispondere al sondaggio nel blog (ne faremo un altro dopo il laboratorio) Provare ad installare Java + IGV per chi non l ha fatto (nel blog istruzioni) Provare ad installare samtools Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

4 Stiamo preparando un piccolo repository di pacchetti bioinformatici a 32 bit e a 64 bit, che dovrebbero girare su qualsiasi *buntu. Li pubblicheremo nel blog, anche grazie al vostro feedback Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

5 SAM ESEMPIO VISIVO

6 Il formato VCF

7 Cinque progetti in cerca d'autore Variant calling su pazienti affetti da cardiomiopatie Assemblaggio de novo di un batterio Analisi di comunità batteriche con 16S-Seq RNA-Seq per identificare geni differenzialmente espressi [per i temerari] Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

8 Variant Calling in Target Enrichment

9 Steps Allineamento sul reference è critico e se possibile va migliorato (riallineamento) Ricerca delle varianti (variant calling) Annotazione delle varianti Validazione! Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

10 Cosa faremo noi? Useremo dati di un target enrichment di poche kb di genoma umano (e un solo cromosoma) Analizzeremo le varianti presenti producendo un VCF Valideremo alcune varianti usando il buon vecchio Sanger Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

11 Esercitazioni di Genomica Lezione Applicazioni introduttiva biologiche del NGS 23 dicembre 2014

12 Varianti?

13 Variants?

14 Errors!

15

16 VEP: Variant Effect Predictor genes and transcripts affected by the variants location of the variants (e.g. upstream, in coding sequence, in non-coding RNA, in regulatory regions) consequence of your variants on the protein sequence (e.g. stop gained, missense, stop lost, frameshift) known variants that match yours, and associated minor allele frequencies from the 1000 Genomes Project SIFT and PolyPhen scores for changes to protein sequence

17

18 ANNOVAR ANNOVAR is an efficient tool to functionally annotate genetic variants. Gene-based annotation: identify whether SNPs or CNVs cause protein coding changes and the amino acids that are affected. Region-based annotations: identify variants in specific genomic regions, for example, conserved regions among 44 species, predicted transcription factor binding sites, Filter-based annotation: identify variants that are reported in dbsnp, or identify the subset of common SNPs (MAF>1%) in the 1000 Genome Project, or identify subset of non-synonymous SNPs with SIFT score>0.05,

19

20 De novo genome assembly

21 Shotgun ACGTACGTAGCTGACGA AGCTGACGATCGATCGTAGCTAGCTA ATCGTAGCTAGCTAGATTACA AGATTACAGTCTACGTACTATCGA Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

22 Shotgun ACGTACGTAGCTGACGA AGCTGACGATCGATCGTAGCTAGCTA ATCGTAGCTAGCTAGATTACA AGATTACAGTCTACGTACTATCGA Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

23 Shotgun ACGTACGTAGCTGACGATCGATCGTAGCTAGCTAGATTACAGTCTACGTACTATCGA contig Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

24 Problem Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

25 Problem Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

26 Solution Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

27 Solution Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

28 Metrics Esercitazioni di Genomica Becoming a Bioinformatician Applicazioni biologiche del NGS 3 dicembre 2014

29 Il progetto Dataset: reads FASTQ (Illumina MiSeq) Programma consigliato: Mira Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

30 Analisi di Ampliconi 16S

31

32 Microbial Biogeography of Public Restroom Surfaces Flores G. E. et al., 2011 (PLoS One)

33 Key questions Who is out there? What are they doing?

34 Cosa faremo? Avremo sequenze prodotte dal sequenziamento 16S di due campioni alimentari. Li classificheremo utilizzando due metodi: RDP Qiime (VirtualBox) Confronteremo i risultati Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

35 I passaggi chiave Clustering delle sequenze molto simili tra di loro (ogni cluster rappresenta, funzionalmente, una specie, più correttamente una OTU) Valutazione dell abbondanza di ogni cluster (più sequenze clusterizzano assieme, più abbondante è l unità tassonomica) Annotazione delle OTU Esercitazioni di Genomica Applicazioni biologiche del NGS 3 dicembre 2014

36 Buon lavoro

Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?

Dettagli

Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Summer School 2015 Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Applicazioni della Next-Generation Sequencing con tecnologia Illumina Roberto Cusano 04-06

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Metodologie informa/che per l analisi dei genomi

Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Perchè sono qui? Walter Sanseverino, CEO at !? Informa/cs = Genomics? We have a problem!!! Focus curve

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Elementi di Bioinformatica per lʼanalisi di dati NGS

Elementi di Bioinformatica per lʼanalisi di dati NGS Corso di Alta formazione in Elementi di Bioinformatica per lʼanalisi di dati NGS 21-23 Settembre 2011 Centro Didattico Morgagni Viale Morgagni 40, Firenze Presentazione del corso Il corso di alta formazione

Dettagli

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL Alcuni aspetti legati al calcolo bioinformatico su CRESCO Giuseppe Aprea UTMEA-CAL Principali attività bioinformatiche ENEA legate al calcolo Assemblaggio de Novo* Trascrittomica Analisi filogenetica Metagenomica*

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

Il microbiota della vite: un assicurazione sulla salute della pianta

Il microbiota della vite: un assicurazione sulla salute della pianta Il microbiota della vite: un assicurazione sulla salute della pianta 26 marzo 2015 Costigliole d Asti Museo del Vino Barolo Paola Bonfante Dibios paola.bonfante@unito.it Il microbiota dell intestino umano

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015 Next Generation Sequencers: from the bacterial culture to raw data Valeria Michelacci NGS course, June 2015 COSTS ASSOCIATED WITH DNA SEQUENCING 80-100 $ per Bacterial Genome!! Benefits from NGS Massive

Dettagli

Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi

Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi Marco Seri (sottotitolo preso in prestito dal Prof. R.

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

"Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là".

Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là. Lentamente muore chi diventa schiavo dell'abitudine, ripetendo ogni giorno gli stessi percorsi, chi non cambia la marca, chi non rischia e cambia colore dei vestiti, chi non parla a chi non conosce. Muore

Dettagli

Guida di riferimento del software MiSeq Reporter per i saggi IVD

Guida di riferimento del software MiSeq Reporter per i saggi IVD Guida di riferimento del software MiSeq Reporter per i saggi IVD PER USO DIAGNOSTICO IN VITRO DI PROPRIETÀ DI ILLUMINA N. codice 15038356 Rev. A ITA Marzo 2014 Questo documento e il suo contenuto sono

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Basic Next Generation Sequencing (NGS) procedures

Basic Next Generation Sequencing (NGS) procedures Basic Next Generation Sequencing (NGS) procedures 24-25-26 novembre 2014 Sede: Università dell Insubria, Via Alberto da Giussano 12, Busto Arsizio, Aula informatica Orario delle lezioni: 9.30-16.30 Le

Dettagli

SCHEDA DEL DOCENTE - CV

SCHEDA DEL DOCENTE - CV Studi di Cagliari Corso di laurea INFORMAZIONI ANAGRAFICHE Nome: FEDERICA Cognome: INCANI Nato a:cagliari Il 19/10/1975 Indirizzo di Residenza: VIA BERNINI 6 CAGLIARI Tel.: Mail: feincani@yahoo.it Cell.:3284494008

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

DNA sequencing. Reading Genomes. Giovanni Bacci

DNA sequencing. Reading Genomes. Giovanni Bacci Reading Genomes Giovanni Bacci Evoluzione del sequenziamento 1977 Frederick Sanger Prima tecnica di sequenziamento 1987 Applyed Biosystems Prima macchina automatica per il sequenziamento del DNA 1998 Phil

Dettagli

Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery

Dettagli

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Brian J O Roak1, Pelagia Deriziotis2, Choli Lee1, Laura Vives1, Jerrod J Schwartz1, Santhosh Girirajan1, Emre

Dettagli

Avanzamento dei sistemi di sequenziamento

Avanzamento dei sistemi di sequenziamento Avanzamento dei sistemi di sequenziamento Sistemi di sequenziamento capillare basati su: Lunghezza delle read: 800 basi Poche sequenze prodotte in una singola corsa Second Generation Sequencing (SGS):

Dettagli

Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida

Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida R.M. De Miccolis Angelini, D. Digiaro, C. Rotolo, S. Pollastro, F. Faretra Dipartimento di Scienze

Dettagli

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Università degli Studi di Padova Dipartimento di Ingegneria dell Informazione Corso di Laurea in Ingegneria dell Informazione Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Laureando:

Dettagli

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente

Dettagli

Biodiversità Molecolare: aspetti di base e nuove tecnologie

Biodiversità Molecolare: aspetti di base e nuove tecnologie Biodiversità Molecolare: aspetti di base e nuove tecnologie Graziano PESOLE Università di Bari & IBBE-CNR, Bari, Italy Seminari sulla Biodiversità Bari, 18 Febbraio 2011 La Biodiversità Per biodiversità

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

Bioinformatica NGS Next Generation Sequencing

Bioinformatica NGS Next Generation Sequencing NGS Next Generation Sequencing NGS Le tecnologie di sequenziamento di DNA rappresentano uno strumento fondamentale per la ricerca nel campo della genetica e della biologia molecolare; Dal 2005, piattaforme

Dettagli

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

COSA FARE APPENA ACQUISTATA UNA SMARTBOARD TM

COSA FARE APPENA ACQUISTATA UNA SMARTBOARD TM COSA FARE APPENA ACQUISTATA UNA SMARTBOARD TM Una volta acquistata una Lavagna Interattiva Multimediale SMARTBoard TM, è necessario effettuare una procedura di registrazione al fine di:. Estendere la garanzia

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

13-03-2013. Introduzione al Semantic Web Linguaggi per la rappresentazione di ontologie. L idea del Semantic Web.

13-03-2013. Introduzione al Semantic Web Linguaggi per la rappresentazione di ontologie. L idea del Semantic Web. Corso di Ontologie e Semantic Web Linguaggi per la rappresentazione di ontologie Prof. Alfio Ferrara, Prof. Stefano Montanelli Definizioni di Semantic Web Rilievi critici Un esempio Tecnologie e linguaggi

Dettagli

Jazz e DNA. Paolo Vineis Imperial College London. con Paolo Fresu e Luca Carra

Jazz e DNA. Paolo Vineis Imperial College London. con Paolo Fresu e Luca Carra Jazz e DNA Paolo Vineis Imperial College London con Paolo Fresu e Luca Carra Charlie Parker Qualche notizia sugli avanzamenti della genetica molecolare: - il dogma un gene-una proteina non e piu vero:

Dettagli

(Agro)Biodiversità e miglioramento genetico delle piante: : la rivoluzione genomica. M. Enrico Pè. Scuola Superiore Sant Anna.

(Agro)Biodiversità e miglioramento genetico delle piante: : la rivoluzione genomica. M. Enrico Pè. Scuola Superiore Sant Anna. (Agro)Biodiversità e miglioramento genetico delle piante: : la rivoluzione genomica M. Enrico Pè Scuola Superiore Sant Anna di Pisa Variazione e Somiglianza Tra Specie Risultato di centinaia di milioni

Dettagli

COMPARATIVE ANALYSIS OF mrna TARGETS FOR HUMAN PUF-FAMILY RNA-BINDING PROTEINS

COMPARATIVE ANALYSIS OF mrna TARGETS FOR HUMAN PUF-FAMILY RNA-BINDING PROTEINS DISS. ETH NO. 18803 COMPARATIVE ANALYSIS OF mrna TARGETS FOR HUMAN PUF-FAMILY RNA-BINDING PROTEINS A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented by ALESSIA GALGANO

Dettagli

La tecnologia dei microarray

La tecnologia dei microarray La tecnologia dei microarray Introduzione per l analisi dell espressione genica: Affymetrix GeneChip spotted arrays L analisi dei dati Campi di applicazione dei microarray Introduzione I progetti di sequenziamento

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

Sequence Alignment Algorithms

Sequence Alignment Algorithms Sequence Alignment Algorithms Algoritmi per l Allineamento di Sequenze Relatore: Prof. Giancarlo Mauri Correlatore: Prof. Gianluca Della Vedova Tesi di Laurea di: Mauro Baluda Matricola 038208 Part of

Dettagli

CONFIGURATION MANUAL

CONFIGURATION MANUAL RELAY PROTOCOL CONFIGURATION TYPE CONFIGURATION MANUAL Copyright 2010 Data 18.06.2013 Rev. 1 Pag. 1 of 15 1. ENG General connection information for the IEC 61850 board 3 2. ENG Steps to retrieve and connect

Dettagli

ANALISI DELLE ALTERAZIONI DI EGFR, HER2 E PIK3CA NEL CARCINOMA MAMMARIO MASCHILE

ANALISI DELLE ALTERAZIONI DI EGFR, HER2 E PIK3CA NEL CARCINOMA MAMMARIO MASCHILE Modena 18-19 novembre 2010 ANALISI DELLE ALTERAZIONI DI EGFR, HER2 E PIK3CA NEL CARCINOMA MAMMARIO MASCHILE Piera Rizzolo IL CARCINOMA MAMMARIO MASCHILE (CMM)» Il CMM è una neoplasia rara:» circa 0.6%

Dettagli

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle

Dettagli

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica Corso postcongressuale XV congresso SIGU Come refertare e comunicare varianti genomiche Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla

Dettagli

Analisi di dati RNA-Seq. Alberto Ferrarini

Analisi di dati RNA-Seq. Alberto Ferrarini Analisi di dati RNA-Seq Alberto Ferrarini Il dogma centrale della biologia molecolare DNA Replicazione RNA Trascrizione Traduzione PROTEIN Geni sono trascritti da DNA ad mrnache lascia il nucleo e viene

Dettagli

Docente Prof. Agata Gadaleta email: agata.gadaleta@uniba.it - Tel. 080 544 2993

Docente Prof. Agata Gadaleta email: agata.gadaleta@uniba.it - Tel. 080 544 2993 Corso di Laurea: Scienze e tecnologie alimentari Corso Integrato: Biotecnologie per la qualità degli alimenti Modulo: Metodologie geneticomolecolari (6 CFU) (4 CFU Lezioni + 2 CFU Esercitazioni) Docente

Dettagli

U Corso di italiano, Lezione Due

U Corso di italiano, Lezione Due 1 U Corso di italiano, Lezione Due U Ciao, mi chiamo Osman, sono somalo. Tu, come ti chiami? M Hi, my name is Osman. What s your name? U Ciao, mi chiamo Osman, sono somalo. Tu, come ti chiami? D Ciao,

Dettagli

Unità tecnica UTAGRI Laboratori INN e GEN

Unità tecnica UTAGRI Laboratori INN e GEN Unità tecnica UTAGRI Laboratori INN e GEN FOODFLAVOUR PL 77.2 Metodologie diagnostiche innovative per la caratterizzazione delle comunità microbiche Responsabile: Annamaria Bevivino Partecipanti: Patrizia

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

API e socket per lo sviluppo di applicazioni Web Based

API e socket per lo sviluppo di applicazioni Web Based API e socket per lo sviluppo di applicazioni Web Based Cosa sono le API? Consideriamo il problema di un programmatore che voglia sviluppare un applicativo che faccia uso dei servizi messi a disposizione

Dettagli

Sinossi dei disegni di studio

Sinossi dei disegni di studio Sinossi dei disegni di studio di intervento osservazionali serie di casi trasversale ecologici individuali quasisperimentali sperimentali (RCT) coorte caso-controllo Studi caso-controllo Il punto di partenza

Dettagli

M/S CERAMICA SCARABEO Località Pian del Trullo 01034 Fabrica di Roma (VT), ITALY. 01034 Fabrica di Roma (VT), ITALY. C. A. Sig.

M/S CERAMICA SCARABEO Località Pian del Trullo 01034 Fabrica di Roma (VT), ITALY. 01034 Fabrica di Roma (VT), ITALY. C. A. Sig. M/S C. A. Sig. Calisti Giampaolo RAPPORTO DI PROVA del LABORATORIO TECNOLOGICO N 65d/2013 in accordo con la norma UNI EN 14688 sul lavabo LUNA TECHNOLOGIAL LABORATORY TEST REPORT N 65d/2013 in compliance

Dettagli

M/S AMARU' GIOVANNI VIA S. ERASMO snc 02010 VASCHE DI CASTEL S. ANGELO (RI) ITALY

M/S AMARU' GIOVANNI VIA S. ERASMO snc 02010 VASCHE DI CASTEL S. ANGELO (RI) ITALY M/S 02010 VASCHE DI CASTEL S. ANGELO (RI) ITALY RAPPORTO DI PROVA del LABORATORIO TECNOLOGICO N 49/2012 in accordo con la norma UNI EN 14688 TECHNOLOGIAL LABORATORY TEST REPORT N 49/2012 In compliance

Dettagli

Regional Center on Endocrine Hereditary Tumors, AOUC, Department of Internal Medicine, University of Firenze

Regional Center on Endocrine Hereditary Tumors, AOUC, Department of Internal Medicine, University of Firenze Approccio ribonomico allo studio di una malattia genetica rara e complessa che predispone al cancro: la sindrome MEN1 come modello E Luzi Regional Center on Endocrine Hereditary Tumors, AOUC, Department

Dettagli

Utilizzare il NetBeans GUI Builder. Dott. Ing. M. Banci, PhD

Utilizzare il NetBeans GUI Builder. Dott. Ing. M. Banci, PhD Utilizzare il NetBeans GUI Builder Dott. Ing. M. Banci, PhD Lavorare con i Beans Queste slide ci guidano nel processo di creazione di un bean pattern nel progetto NetBeans 15 Giugno 2007 Esercitazione

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

Progetto CIMDL. Analisi genetica di pazienti affetti da lesioni distruttive della linea mediana indotte da Cocaina (CIMDL) tramite exome sequencing

Progetto CIMDL. Analisi genetica di pazienti affetti da lesioni distruttive della linea mediana indotte da Cocaina (CIMDL) tramite exome sequencing Progetto CIMDL Analisi genetica di pazienti affetti da lesioni distruttive della linea mediana indotte da Cocaina (CIMDL) tramite exome sequencing Centro Collaborativo DPA IRCCS Ospedale San Raffaele -

Dettagli

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA

Dettagli

PMBOK Guide 3 rd Edition 2004

PMBOK Guide 3 rd Edition 2004 PMBOK Guide 3 rd Edition 2004 Un modello di riferimento per la gestione progetti a cura di Tiziano Villa, PMP febbraio 2006 PMI, PMP, CAPM, PMBOK, PgMP SM, OPM3 are either marks or registered marks of

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

Retrospective, Stand-Up Meeting e Daily Journal Raccogliere feedback dal team

Retrospective, Stand-Up Meeting e Daily Journal Raccogliere feedback dal team Retrospective, Stand-Up Meeting e Daily Journal Raccogliere feedback dal team Pietro Di Bello & Jacopo Franzoi { p.dibello, j.franzoi } @sourcesense.com Chi siamo Pietro Di Bello, sviluppatore dal 1999,

Dettagli

CORSO DI PATOLOGIA MOLECOLARE. Prof. Andrea Cabibbo

CORSO DI PATOLOGIA MOLECOLARE. Prof. Andrea Cabibbo CORSO DI PATOLOGIA MOLECOLARE Prof. Andrea Cabibbo The central role of p53 in cellular and genetic stability p21 Bax p53 pathway: In a normal cell p53 is inactivated by its negative regulator, mdm2. Upon

Dettagli

Il sequenziamento del genoma umano

Il sequenziamento del genoma umano Il sequenziamento del genoma umano 1. storia e risultati dei due progetti: HGP e Celera. 2. innovazioni e problematiche di ricerca connesse al progetto genoma umano: (a) sequenziamento su larga scala (b)

Dettagli

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling

Dettagli

Lezione 5. Next Generation Sequencing

Lezione 5. Next Generation Sequencing Lezione 5 Next Generation Sequencing Perchè Next Generation Sequencing Si possono generare centinaia di milioni di corte sequenze (35bp-250bp) in una sola corsa in un tempo breve con un basso prezzo per

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

e dei genotipi tossici

e dei genotipi tossici Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle

Dettagli

Carta dei Servizi (v.1.4)

Carta dei Servizi (v.1.4) Carta dei Servizi (v.1.4) Cancer Genetic Test Laboratory (CGT Lab) Gentili Signori, Il Laboratorio Cancer Genetic Test (CGT Lab), Servizio di medicina di laboratorio specializzato senza punto di prelievo,

Dettagli

Studi genomici nei microorganismi

Studi genomici nei microorganismi Studi genomici nei microorganismi Edoardo Puglisi Istituto di Microbiologia Facoltà di Agraria Università Cattolica del Sacro Cuore Piacenza, Italy BioDNA Workshop La genomica al servizio dell agricoltura

Dettagli

Test e collaudo del software Continuous Integration and Testing

Test e collaudo del software Continuous Integration and Testing Test e collaudo del software Continuous Integration and Testing Relatore Felice Del Mauro Roma, Cosa è la Continuous Integration A software development practice where members of a team integrate their

Dettagli

Examples of chemical equivalence

Examples of chemical equivalence hemical equivalence Two spins are chemically equivalent if: There is a symmetry operation that exchange their positions, or There is a dynamic process between two or more energetically equivalent conformations

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

U Corso di italiano, Lezione Diciassette

U Corso di italiano, Lezione Diciassette 1 U Corso di italiano, Lezione Diciassette U Oggi, facciamo un esercizio M Today we do an exercise U Oggi, facciamo un esercizio D Noi diremo una frase in inglese e tu cerca di pensare a come dirla in

Dettagli

ESERCITAZIONE. Francesco Poggi fpoggi@cs.unibo.it A.A. 2014-2015

ESERCITAZIONE. Francesco Poggi fpoggi@cs.unibo.it A.A. 2014-2015 ESERCITAZIONE Francesco Poggi fpoggi@cs.unibo.it A.A. 2014-2015 Premessa As always, there is never a correct solution to any modelling problem. It s more that some models are more precise, and more informative,

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA per l assegnazione di una borsa di studio a favore di candidati in possesso del Diploma di laurea specialistica o magistrale

Dettagli

The VIGNA Project: Genomic Platforms Implementation in Italy

The VIGNA Project: Genomic Platforms Implementation in Italy The VIGNA Project: Genomic Platforms Implementation in Italy The French-Italian Public Consortium for the Sequencing of the Grapevine Nuclear Genome M. Enrico Pè Scuola Superiore di Studi Universitari

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione

Dettagli

L invenzione delle razze. Guido Barbujani Dipartimento di Biologia ed Evoluzione, Università di Ferrara g.barbujani@unife.it Mestre, 26 marzo 2011

L invenzione delle razze. Guido Barbujani Dipartimento di Biologia ed Evoluzione, Università di Ferrara g.barbujani@unife.it Mestre, 26 marzo 2011 L invenzione delle razze Guido Barbujani Dipartimento di Biologia ed Evoluzione, Università di Ferrara g.barbujani@unife.it Mestre, 26 marzo 2011 Razzismo scientifico: Il decalogo del Manifesto 1. Le

Dettagli

Learning session: costruiamo insieme un modello per una campagna di marketing

Learning session: costruiamo insieme un modello per una campagna di marketing Learning session: costruiamo insieme un modello per una campagna di marketing Roberto Butinar Cristiano Dal Farra Danilo Selva 1 Agenda Panoramica sulla metodologia CRISP-DM (CRoss-Industry Standard Process

Dettagli

scaricato da www.sunhope.it LA TECNOLOGIA DEI MICROARRAYS

scaricato da www.sunhope.it LA TECNOLOGIA DEI MICROARRAYS LA TECNOLOGIA DEI MICROARRAYS 1 8 anni dopo: 4162 riferimenti bibliografici sui microarrays I microarrays misurano il livello di espressione degli mrna trascritti dai geni del sistema biologico di interesse

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli