Banche Dati: NCBI e BLAST. Progettazione primer per PCR mediante software on line: Primer3

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Banche Dati: NCBI e BLAST. Progettazione primer per PCR mediante software on line: Primer3"

Transcript

1 Banche Dati: NCBI e BLAST Progettazione primer per PCR mediante software on line: Primer3

2 Sorgenti di informazione Le banche dati di interesse biologico Le banche dati di sequenze nucleotidiche e proteiche L analisi delle sequenze Applicazioni I software per l analisi delle sequenze e il disegno di primer

3 Che cos è una banca dati biologica Una banca dati biologica (biological database) è un insieme organizzato di molti dati in formato elettronico associati a software specifici disegnati per permettere l aggiornamento, l interrogazione e il recupero dei dati immagazzinati nel sistema. Caratteristiche: - semplicità di accesso alle informazioni - metodo per estrarre solo le informazioni che rispondono ad un particolare quesito biologico

4 Che cos è la Bioinformatica La Bioinformatica può essere definita come una disciplina scientifica che fa uso delle tecnologie informatiche per organizzare, analizzare e rendere disponibili informazioni biologiche al fine di chiarire i problemi della biologia. Unisce le competenze nei campi dell informatica, delle tecnologie dell informazione e della biologia. Obiettivo E quello di permettere la scoperta di nuovi meccanismi biologici e di creare una visione globale e distinta dei processi biologici stessi.

5 Le banche dati di interesse biologico Elenco aggiornato di banche dati Molecular Biology Database Collection The BioToolKit

6 Classificazione delle banche dati Major Public Sequence Repositories Comparative Genomics Gene Expression Gene Identification and Structure Genetic and Physical Maps Genomic Databases Intermolecular Interactions Metabolic Pathways and Cellular Regulation Mutation Databases Pathology Protein Databases Protein Sequence Motifs Proteome Resources Retrieval Systems and Database Structure RNA Sequences Structure Transgenics Varied Biomedical Content

7 DNA sequence databases EMBL Nucleotide Sequence Database (European Molecular Biology Laboratory) GenBank DNA Data Bank of Japan (DDBJ)

8 Una sequenza nucleotidica... ACGGTGCCAGTGCATTGGACCACATGCGA... Una sequenza aminoacidica... TACYRSLIPPAADDNCAILQEVWMFHHT...

9 Nucleotide base codes (IUPAC) Code Base Description G Guanine A Adenine T Thymine in DNA (Uracil in RNA) C Cytosine R Purine (A or G) Y Pyrimidine (C or T or U) M Amino (A or C) K Ketone (G or T) S Strong interaction (C or G) W Weak interaction (A or T) H Not-G (A or C or T) H follows G in the alphabet B Not-A (C or G or T) B follows A V Not-T (not-u) (A or C or G) V follows U D Not-C (A or G or T) D follows C N Any (A or C or G or T) Authority Nomenclature Committee of the International Union of Biochemistry Reference Cornish-Bowden, A. Nucleic Acids Res. 13, (1985)

10 Amino acid abbreviations and codes Abbreviation Code Description Ala A Alanine Arg R Arginine Asn N Asparagine Asp D Aspartic acid (Aspartate) Cys C Cysteine Gln Q Glutamine Glu E Glutamic acid (Glutamate) Gly G Glycine His H Histidine Ile I Isoleucine Leu L Leucine Lys K Lysine Met M Methionine Phe F Phenylalanine Pro P Proline Ser S Serine Thr T Threonine Authority Trp W Tryptophan Reference Tyr Y Tyrosine Val V Valine IUPAC-IUB Joint Commission on Biochemical Nomenclature. IUPAC-IUB Joint Commission on Biochemical Nomenclature. Nomenclature and Symbolism for Amino Acids and Peptides. Eur. J. Biochem. 138: 9-37 (1984).

11

12

13 EMBL Divisions Division Code ESTs EST Bacteriophage PHG Fungi FUN Genome survey GSS High Throughput cdna HTC High Throughput Genome HTG Human HUM Invertebrates INV Mus musculus MUS Organelles ORG Other Mammals MAM Other Vertebrates VRT Plants PLN Prokaryotes PRO Rodents ROD STSs STS Synthetic SYN Unclassified UNC Viruses VRL

14 20 March 2002

15 GenBank Incorpora, organizza e distribuisce tutte le sequenze nucleotidiche disponibili pubblicamente. Localizzata e mantenuta presso il National Center for Biotechnology Information (NCBI), una divisione della National Library of Medicine (NLM), con sede presso il campus dell National Institutes of Health (NIH) a Bethesda, Mariland, USA. Collabora con EMBL e DDBJ con cui scambia dati giornalmente. Ricercatori, Genome Project Groups, US Office of Patents and Trademarks (USPTO) forniscono dati di sequenza. Immissione dei dati (submission): BankIt (web-based submission system) e procedure automatiche (large scale genome sequencing centers, fa2htgs). Accesso: gratuito via FTP, e WWW. Database release: bimestrale.

16 La sequenza in formato FASTA >embl:ssc AJ Sus scrofa partial ctsb gene for cathepsin B, exons 6-7, allele 1 aaagaagggcctggtgtccgggggcctctatgactcgcatgtgggtaagtggccgggtgg gttttataagcaggaagtgacactggtcattttcccctacaaagtggaggtgaagggttg tgggcgggaaggctgggctacacggtgcagcagcccggctacggcagaattagcagcacc aggaggaggcgtcagcgccacagacttgaggggaacttgccccttagctgggcccaattc ttctctctggcctggagggacctctgaggggcttgctgccgacactccccctttctccgg gccccccaggttgcaggccc Formati di sequenze 1. IG/Stanford 2. GenBank/GB 3. NBRF-PIR 4. EMBL/SWISS 5. GCG 6. DNAStrider 7. Fitch 8. Pearson/Fasta 9. Zuker 10. Olsen 11. Phylip Phylip 13. Plain/Raw (ASCII) 14. PIR-CODATA 15. GCG MSF 16. ASN PAUP/NEXUS 18. Pretty

17 La sequenza AJ in formato GenBank LOCUS SSC bp DNA linear MAM 03-JUN-2002 DEFINITION Sus scrofa partial ctsb gene for cathepsin B, exons 6-7, allele 1. ACCESSION AJ VERSION AJ GI: KEYWORDS cathepsin B; ctsb gene. SOURCE pig. ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Cetartiodactyla; Suina; Suidae; Sus. REFERENCE 1 AUTHORS Russo,V., Fontanesi,L., Davoli,R., Nanni Costa,L., Cagnazzo,M., Buttazzoni,L., Virgili,R. and Yerle,M. TITLE Investigation of candidate genes for meat quality in dry-cured ham production: the porcine cathepsin B (CTSB) and cystatin B (CSTB) genes JOURNAL Anim. Genet. 33 (2), (2002) PUBMED REFERENCE 2 (bases 1 to 320) AUTHORS Fontanesi,L. TITLE Direct Submission JOURNAL Submitted (30-MAY-2001) Fontanesi L., DIPROVAL, Sez Allevamenti Zootecnici, University of Bologna, Via F.lli Rosselli 107, Reggio Emilia, 42100, ITALY COMMENT PCR primer used to amplify the sequence Forward 5'-CTGGAGCCTGGAACTTCTGGAC-3' Reverse 5'-GCTCACAGGGAGGGATGGAGTA-3. Continua

18 FEATURES Location/Qualifiers source /organism="sus scrofa" /db_xref="taxon:9823" /chromosome="14" gene /gene="ctsb" CDS join(<1..44,309..>320) /gene="ctsb" /note="allele 1" /codon_start=2 /product="cathepsin B" /protein_id="cac " /db_xref="gi: " /db_xref="sptrembl:q95j72" /translation="kkglvsgglydshvglqa" exon <1..44 /gene="ctsb" /number=6 intron /gene="ctsb" /number=6 exon 309..>320 /gene="ctsb" /number=7 BASE COUNT 59 a 87 c 110 g 64 t ORIGIN 1 aaagaagggc ctggtgtccg ggggcctcta tgactcgcat gtgggtaagt ggccgggtgg 61 gttttataag caggaagtga cactggtcat tttcccctac aaagtggagg tgaagggttg 121 tgggcgggaa ggctgggcta cacggtgcag cagcccggct acggcagaat tagcagcacc 181 aggaggaggc gtcagcgcca cagacttgag gggaacttgc cccttagctg ggcccaattc 241 ttctctctgg cctggaggga cctctgaggg gcttgctgcc gacactcccc ctttctccgg 301 gccccccagg ttgcaggccc //

19 Protein Databases SWISS-PROT Database Protein Information Resource

20 ENTRY S20421 #type complete iproclass View of S20421 TITLE stefin B bovine ORGANISM #formal_name Bos primigenius taurus #common_name cattle #cross-references taxon:9913 DATE 22-Nov-1993 #sequence_revision 05-May-1995 #text_change 16-Jul-1999 ACCESSIONS S20421; S23958 REFERENCE S20421 #authors Krizaj, I.; Turk, B.; Turk, V. #journal FEBS Lett. (1992) 298: #title The complete primary structure of bovine stefin B. #cross-references MUID: ; PMID: #accession S20421 ##molecule_type protein ##residues 1-98 ##label KRI REFERENCE S23958 #authors Turk, B.; Krizaj, I.; Turk, V. #journal Biol. Chem. Hoppe-Seyler (1992) 373: #title Isolation and characterization of bovine stefin B. #cross-references MUID: ; PMID: #contents annotation CLASSIFICATION SF #superfamily cystatin; cystatin homology KEYWORDS acetylated amino end; cysteine proteinase inhibitor FEATURE 2-98 #domain cystatin homology #label CYS\ 1 #modified_site acetylated amino end (Met) #status experimental SUMMARY #length 98 #molecular_weight SEQUENCE M M C G G T S A T Q P A T A E T Q A I A D K V K S Q L E E K 31 E N K K F P V F K A L E F K S Q L V A G K N Y F I K V Q V D 61 E D D F V H I R V F E S L P H E N K P V A L T S Y Q T N K G 91 R H D E L T Y F

21 Analisi delle sequenze Sequence similarity searching tools BLAST FASTA Genomic sequence analysis tools Exon prediction programs RepeatMasker Restriction analysis tools Webcutter NEBcutter Rebase

22 Introduzione: Similarity analysis Una sequenza di per se non è informativa: deve essere analizzata utilizzando metodi comparativi contro banche dati per poter avanzare ipotesi sulla funzione, classe, ecc Identity: la misura in cui 2 sequenze (nucleotidiche o aminoacidiche) sono uguali. Similarity: la misura in cui 2 sequenze (nucleotidiche o aminoacidiche) hanno qualcosa in comune. Si esprime in percentuale di identità di sequenza (percent sequence identity). Homology: Similarity attribuita alla discendenza da un antenato comune (si deduce dalla misura di similarità della struttura, della funzione, della sequenza). L approccio generale dell analisi prevede l utilizzo di una serie di algoritmi per confrontare una sequenza (query sequence) con tutte le sequenze presenti in una particolare banca dati. Continua

23 Ad ogni confronto viene assegnato un punteggio (score) che riflette il grado di similarità (degree of similarity) fra la query sequence e le sequenze confrontate. La similarity viene misurata e mostrata graficamente per mezzo di allineamenti tra due sequenze (la query sequence e una della banca dati). Gli allineamenti possono essere globali (global) o locali (local). Un allineamento globale è un allineamento ottimale (optimal alignment) che include tutti i caratteri di ciascuna sequenza. Un allineamento locale è un allineamento ottimale che include solo la regione o le regioni più simili. Optimal alignment: un allineamento di due sequenze con lo score più alto possibile. Per discriminare fra match reali o artefatti viene utilizzata la probabilità (probability) che il match avvenga per caso.

24 Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) "Basic local alignment search tool. J. Mol. Biol. 215: Basic Local Alignment Search Tools I programmi BLAST sono costituiti da una serie di algoritmi di confronto fra sequenze e sono utilizzati per identificare optimal local alignments tra una query sequence ed una banca dati di sequenze. BLAST mantiene sia una buona velocità di analisi che una buona sensibilità (caratteristiche importanti con la crescita esponenziale delle banche dati). BLAST frammenta la query sequence e le sequenze nella banca dati in frammenti ( Words ) cercando inizialmente match fra i frammenti. La ricerca iniziale è effettuata per Word di lunghezza W che danno uno score di almeno T quando confrontate con la query sequence usando una particolare matrice di sostituzione (substitution matrix). Questi match vengono estesi da entrambe le direzioni nel tentativo di generare un allineamento con uno score che supera la soglia S. Il parametro T regola la velocità e la sensibilità della ricerca. Continua

25 La qualità di ciascun allineamento è rappresentata da uno score e gli score sono ordinati dal più alto al più basso (ranked) Matrici di punteggio (scoring matrices) sono usate per calcolare di un allineamento base per base (DNA) o aminoacido per aminoacido (proteine). Una matrice unitaria (unitary matrix) è utilizzata per il DNA perché ciascuna posizione può assumere uno score di +1 se crea un match oppure uno score di 0 se non produce un match. Continua

26 Gaps: posizioni in cui una lettera è appaiata ad uno spazio vuoto sono indicate come gaps. I punteggi per i gap sono negativi. La significatività di ciascun allineamento è calcolata come P value (la probabilità di un allineamento di avere uno score come quello in esame o migliore) oppure come E value (Expectation value: il numero di differenti allineamenti con score equivalenti o migliori di S che ci si può aspettare di osservare in una ricerca in una banca dati per caso). Più bassi sono più significativi sono gli score. Ogni allineamento, tuttavia deve essere valutato criticamente prima di essere accettato. Ad esempio, allineamenti originati da una serie di sequenze ripetute possono ottenere alti score ma non riflettere similarità fra le due sequenze. Filtri che mascherano low complexity regions possono essere utilizzati per alleviare questi problemi. Es.: SEG program

27 BLAST Programs BLAST 2.0 (Gapped BLAST) blastn: confronta una sequenza nucleotidica contro una banca dati di sequenze nucleotidiche. bastp: confronta una sequenza aminoacidica contro una banca dati di sequenze proteiche. blastx: confronta una sequenza nucleotidica (che viene tradotta in tutti i reading frames) contro una banca dati di sequenze proteiche. tblastn: confronta una sequenza proteica contro una banca dati di sequenze nucleotidiche dinamicamente tradotte in tutti i reading frames. tblastx: confronta i 6 reading frames di una sequenza nucleotidica contro i 6 reading frames delle sequenze nucleotidiche presenti in una banca dati.

28 Nucleotide Sequence Databases nr All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences). No longer "non-redundant". month All new or revised GenBank+EMBL+DDBJ+PDB sequences released in the last 30 days. Drosophila genome Drosophila genome provided by Celera and Berkeley Drosophila Genome Project (BDGP). dbest Database of GenBank+EMBL+DDBJ sequences from EST Divisions dbsts Database of GenBank+EMBL+DDBJ sequences from STS Divisions htgs Unfinished High Throughput Genomic Sequences: phases 0, 1 and 2 (finished, phase 3 HTG sequences are in nr) gss Genome Survey Sequence, includes single-pass genomic data, exon-trapped sequences, and Alu PCR sequences. yeast Yeast (Saccharomyces cerevisiae) genomic nucleotide sequences E. coli Escherichia coli genomic nucleotide sequences pdb Sequences derived from the 3-dimensional structure from Brookhaven Protein Data Bank kabat [kabatnuc] Kabat's database of sequences of immunological interest vector Vector subset of GenBank(R), NCBI, in ftp://ncbi.nlm.nih.gov/blast/db/ mito Database of mitochondrial sequences alu Select Alu repeats from REPBASE, suitable for masking Alu repeats from query sequences. It is available by anonymous FTP from ncbi.nlm.nih.gov (under the /pub/jmc/alu directory). See "Alu alert" by Claverie and Makalowski, Nature vol. 371, page 752 (1994). epd Eukaryotic Promotor Database found on the web at

29 BLASTN [Apr ] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: RID: Query= gi emb X SSMYHCS Sus scrofa mrna for skeletal myosin heavy chain (pazmy4) (798 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) 1,301,425 sequences; 5,790,534,584 total letters If you have any problems or questions with the results of this search please refer to the BLAST FAQs Taxonomy reports Distribution of 182 Blast Hits on the Query Sequence

30 Score E Sequences producing significant alignments: (bits) Value gi emb X SSMYHCS Sus scrofa mrna for skeleta gi dbj AB AB Sus scrofa mrna for myos gi ref XM_ Homo sapiens myosin, heavy pol gi ref NM_ Homo sapiens myosin, heavy pol gi gb AF AF Homo sapiens myosin heavy gi dbj AB AB Bos taurus MyHC-2x mrna gi ref XM_ Homo sapiens myosin, heavy pol gi dbj AB AB Sus scrofa mrna for myos gi ref NM_ Homo sapiens myosin, heavy poly gi gb AF AF Homo sapiens myosin heavy gi emb X HSMYH1R Human skeletal mrna for myosi gi gb U OCU32574 Oryctolagus cuniculus myosin gi 1622 emb X OCMHCR Rabbit mrna for fast skeletal m gi gb BC Mus musculus, clone IMAGE: gi gb S S68736 Rattus sp. myosin heavy chain gi ref XM_ Mus musculus myosin, heavy pol gi emb AJ MMU Mus musculus partial mr gi emb AJ MMU Mus musculus partial mr gi dbj AB AB Sus scrofa mrna for myos gi ref XM_ Mus musculus similar to Myosin gi dbj AB AB Bos taurus MyHC-2a mrna gi gb S S73840 Homo sapiens type IIA myosin h gi ref XM_ Homo sapiens myosin, heavy pol gi ref NM_ Homo sapiens myosin, heavy poly gi gb AF AF Homo sapiens myosin heavy gi gb AF AF Rattus norvegicus type 2X gi gb L RATMYH Rattus norvegicus myosin heavy gi emb Z OCHEAMYO2 O.cuniculus (OCCDNA32) mrn e-155 gi ref XM_ Mus musculus similar to Myosin e-151 gi gb BC BC Mus musculus, Similar to e-151 gi gb L RATMYHM Rattus norvegicus skeletal mu e-149 gi gb K RATMYHC Rat embryonic myosin heavy ch e-147 gi ref XM_ Homo sapiens myosin, heavy pol e-144 gi emb X HSBMHCF Human MHC mrna for fetal-myos e-144 gi ref NM_ Homo sapiens myosin, heavy poly e-142 gi gb M HUMMYOHP Homo sapiens perinatal myosi e-142 gi emb Z HSMYOSIN H.sapiens mrna for myosin e-142 gi gb M CHKMYOSIND Gallus gallus fast myosin e-134 gi gb J CHKMYHE Chicken embryonic myosin heav e

31 >gi ref XM_ Homo sapiens myosin, heavy polypeptide 4, skeletal muscle (MYH4), mrna Length = 6015 Score = 955 bits (482), Expect = 0.0 Identities = 656/713 (92%), Gaps = 2/713 (0%) Strand = Plus / Plus Query: 1 caccagcctgatcaacaccaagaagaagctggagacagacatctcccaaatccagggaga 60 Sbjct: 5282 caccagcctgatcaacaccaagaagaagctggaaacagacatttcccaaatccagggaga 5341 Query: 61 gatggaggacattgtccaggaagctcgcaacgcagaagagaaggccaagaaggccatcac 120 Sbjct: 5342 gatggaggacatcgtccaggaagcccgcaatgcagaggagaaggccaagaaggccatcac 5401 Query: 121 tgatgcagccatgatggccgaggagctgaagaaggagcaggacaccagcgcccacctgga 180 Sbjct: 5402 tgatgctgccatgatggctgaggagctgaagaaggaacaggacaccagcgcccacctgga 5461 Query: 181 gcggatgaagaagaatatggaacagacggtaaaggacctgcagcaccgcctggacgaggc 240 Sbjct: 5462 gcggatgaagaagaacatggagcagaccgtgaaggatctgcagctccgtctggatgaggc 5521 Query: 241 agaacagttggccctgaagggcgggaagaagcagatccagaagctggaggccagggtgag 300 Sbjct: 5522 tgagcagctggcgctgaagggtgggaagaagcagatccagaaactggaggccagggtgag 5581 Query: 301 ggagcttgaaaatgaggttgaaaatgaacagaagcgcaatgttgaggctgtcaagggtct 360 Sbjct: 5582 agagcttgaaagtgaggtggaaagtgaacagaagcacaatgttgaggctgtcaagggtct 5641 Query: 361 tcggaaacatgagagaagagtgaaggaactcacttaccagactgaggaggaccgaaagaa 420 Sbjct: 5642 tcgcaaacatgagagaagagtgaaggaactcacttaccagactgaggaggaccgcaagaa 5701 Query: 421 tgttctcaggctgcaggacttggtggacaaactacaatccaaagttaaagcttacaagag 480 Sbjct: 5702 tattctcaggctgcaggacttggtggacaaattgcaaaccaaagtcaaagcttacaagag 5761 Query: 481 acaagcggaagaggcggaggaacaatccaacgtcaacctctccaagttccgcaagctcca 540 Sbjct: 5762 acaagctgaagaggctgaggaacaatccaatgtcaaccttgccaagttccgcaagctcca 5821

32 Collegarsi al sito Cliccate: Search Nucleotide for: digitate APOSTART Scegliete la versione genomica del gene Visualizzatela in formato FASTA

33 WWW Restriction analysis tools NEBcutter v Webcutter 2.0 Restriction Maps

34 Progettazione primers per PCR PCR Primer design I primers devono essere ottimizzati per: Specificità Temperatura di fusione Strutture secondarie e formazione di dimeri Stabilità dell appaiamento con la sequenza target Software Primer3 Ci sono molti altri software per progettare primers, sia gratis che non

35 Come è strutturato Primer3? Essenzialmente in 2 parti : La prima permette di agire sulla SEQUENZA da amplificare, indicando DOVE vanno disegnati i nostri primers Nella seconda abbiamo la possibilità di indicare le CARATTERISTICHE che devono avere i primers

36 I campi da riempire nella pagina di input di Primer3

37 Campo Sequence Id Immettere il vostro nome + APOSTART Es: Stefano-APOSTART Ma si può anche usare il formato FASTA Campo Targets atggtagat ctgagggtaa atttctagtt tttctccttc attttcttgg ttaggaccct tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt gtctatgatg atgatgatag ttacagaacc gacgactcgt ccgtcctgta gaaaccccaa cccgtgaaat caaaaaactc[gacggcctgt gggcattcag] tctggatcgc gaaaactgtg gaattgatca gcgttggtgg gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag gcagttttaa cgatcagttc gccgatgcagatattcgtaa ttatgcgggc aacgtctggt atcagcgcga agtctttata ccgaaaggtt gggcaggccagcgtatcgtg ctgcgtttcg I target sono le parti della sequenza che devono essere presenti nell amplificato (amplicone). Per definirli si utilizzano le parentesi [ ] o si immettono nell apposita casella i valori di start e length

38 Campi Excluded Regions O Included Region atggtagat ctgagggtaa atttctagtt{tttctccttc attttcttgg ttaggaccct tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt gtctatgatg atgatgatag ttacagaacc gacgactcgt ccgtcctgta gaaaccccaa cccgtgaaat}caaaaaactc gacggcctgt gggcattcag tctggatcgc gaaaactgtg gaattgatca gcgttggtgg gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag gcagttttaa cgatcagttc gccgatgcag atattcgtaa ttatgcgggc aacgtctggt atcagcgcga agtctttata ccgaaaggtt gggcaggcca gcgtatcgtg ctgcgtttcg Si possono definire le regioni che non interessano o che invece interessano per la progettazione del primer con i valori start e length, cioè la prima base e il numero di basi della regione Si possono usare anche i simboli < > per Excluded Regions. Campo Product size e Product size Range

39 Seconda parte Le caratteristiche dei primers Campo Number To Return Si può scegliere quante coppie di primer si desidera che il programma ci fornisca Campo Max 3 Stability Più alto è il valore più il primer è stabile all estremità 3 Non si desidera una eccessiva stabilità: APPAIAMENTO CORRETTO 5 TACTGGTACTAATGCCCCC 3 3 ATGACCATGATTACGGGGGAGCTACCTATCATGGTATAGGTA 5 APPAIAMENTO NON CORRETTO, ma funzionante 5 TACTGGTACTAATGCCCCC 3 3 CCGGGGATCCTTACGGGGGGACCTATGCAA 5

40 Campo Max Mispriming e Pair Max Mispriming E un parametro che stabilisce la massima similarità di uno o di entrambi i primerspermessa con sequenze contenute nelle Mispriming Libraries, che contengono sequenze ripetute di vari organismi Campo Primer size Campi Primer Tm e Max Tm Difference La temperatura di annealing dipende dalla percentuale di G+C e dalla lunghezza del primer. Siccome non vogliamo una % G+C troppo alta la Tm richiesta per un primer deve tener conto della lunghezza desiderata (se la richiediamo)

41 Campo Primer GC% E ottimale una frequenza di G+C (e A+T) del 50% Campi Max (Self) Complementarity e Max 3 (Self) Complementarity 5' ATGCCCTAGCTTCCGGATG 3' 3' AAGTCCTACATTTAGCCTAGT 5 Evitare la formazione di dimeri 5' ATGCGCTTATA A 3 TACGCCTTAGA e di strutture secondarie!!!

42 Campo Max #N s Il numero massimo di N che consentiamo nei primer Nel caso si disegnino primer su sequenze di bassa qualità, con tenenti basi incerte (N) Campo Max poly-x Il numero massimo di ripetizioni mononucleotidiche (es. AAAAAA) rendono il primer troppo stabile (G/C) o troppo instabile (A/T) Campo GC Clamp Il numero di G o C richiesto all estremità 3 Non più di una! Quando è tutto deciso, click su pick primers

43 Output di Primer 3 Primer3 Output WARNING: Numbers in input sequence were deleted. PRIMER PICKING RESULTS FOR Stefano No mispriming library specified Using 1-based sequence positions OLIGO start len tm gc% any 3' seq LEFT PRIMER cccttacgctgaagagatgc RIGHT PRIMER ggcacagcacatcaaagaga SEQUENCE SIZE: 2053 INCLUDED REGION SIZE: 2053 PRODUCT SIZE: 401, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: gcattacccttacgctgaagagatgctcgactgggcagatgaacatggcatcgtggtgat >>>>>>>>>>>>>>>>>>>> 1261 tgatgaaactgctgctgtcggctttcagctgtctttaggcattggtttcgaagcgggcaa 1321 caagccgaaagaactgtacagcgaagaggcagtcaacggggaaactcagcaagcgcactt 1381 acaggcgattaaagagctgatagcgcgtgacaaaaaccacccaagcgtggtgatgtggag 1441 tattgccaacgaaccggatacccgtccgcaaggtgcacgggaatatttcgcgccactggc 1501 ggaagcaacgcgtaaactcgacccgacgcgtccgatcacctgcgtcaatgtaatgttctg 1561 cgacgctcacaccgataccatcagcgatctctttgatgtgctgtgcctgaaccgttatta <<<<<<<<<<<<<<<<<<<<

44 Output di Primer 3

45 Esercizio Cercare nella banca dati NCBI sequenze di Poa pratensis. Selezionare tra di esse il gene SERK isolato da Albertini E, e Marconi G. Eseguire un BLAST sulla sequenza e disegnare dei primer specifici per la individuazione di tale gene (utilizzando quindi parti peculiari della sequenza.) Il prodotto di amplificazione deve essere compreso tra 150 e 300 pb La temperatura di fusione dei primers deve essere superiore a 60 C

46 Sequenza codificante del gene NptII dal plasmide pcambia-2301 tca gaagaactcg tcaagaaggc gatagaaggc 9001 gatgcgctgc gaatcgggag cggcgatacc gtaaagcacg aggaagcggt cagcccattc 9061 gccgccaagc tcttcagcaa tatcacgggt agccaacgct atgtcctgat agcggtccgc 9121 cacacccagc cggccacagt cgatgaatcc agaaaagcgg ccattttcca ccatgatatt 9181 cggcaagcag gcatcgccat gtgtcacgac gagatcctcg ccgtcgggca tgcgcgcctt 9241 gagcctggcg aacagttcgg ctggcgcgag cccctgatgc tcttcgtcca gatcatcctg 9301 atcgacaaga ccggcttcca tccgagtacg tgctcgctcg atgcgatgtt tcgcttggtg 9361 gtcgaatggg caggtagccg gatcaagcgt atgcagccgc cgcattgcat cagccatgat 9421 ggatactttc tcggcaggag caaggtgaga tgacaggaga tcctgccccg gcacttcgcc 9481 caatagcagc cagtcccttc ccgcttcagt gacaacgtcg agcacagctg cgcaaggaac 9541 gcccgtcgtg gccagccacg atagccgcgc tgcctcgtcc tggagttcat tcagggcacc 9601 ggacaggtcg gtcttgacaa aaagaaccgg gcgcccctgc gctgacagcc ggaacacggc 9661 ggcatcagag cagccgattg tctgttgtgc ccagtcatag ccgaatagcc tctccaccca 9721 agcggccgga gaacctgcgt gcaatccatc ttgttcaatc cccat

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Allineamento locale: BLAST

Allineamento locale: BLAST Allineamento locale: BLAST BLAST (Basic Local Alignment Search Tool) è il più diffuso programma di allineamento locale delle sequenze. Per vari anni il metodo FASTA (da non confondere con l omonimo formato)

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

Ogni tipo ha il suo alfabeto di riferimento, e metodi specifici, nonché metodi per la conversione da un tipo all altro (trascrizione, traduzione)

Ogni tipo ha il suo alfabeto di riferimento, e metodi specifici, nonché metodi per la conversione da un tipo all altro (trascrizione, traduzione) BioPython Descrizione Il progetto BioPython è un associazione di sviluppatori di codice Python liberamente disponibile per bioinformatica La homepage del progetto è http://www.biopython.org Il codice viene

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Bioinformatica: Allineamento di Sequenze di Aminoacidi di Bandiera Roberto

Bioinformatica: Allineamento di Sequenze di Aminoacidi di Bandiera Roberto Bioinformatica: Allineamento di Sequenze di Aminoacidi di Bandiera Roberto La Bioinformatica è una disciplina che si occupa dell applicazione dell informatica nell ambito biologico per consentire lo studio

Dettagli

Riconoscimento e recupero dell informazione per bioinformatica

Riconoscimento e recupero dell informazione per bioinformatica Riconoscimento e recupero dell informazione per bioinformatica Clustering: similarità Manuele Bicego Corso di Laurea in Bioinformatica Dipartimento di Informatica - Università di Verona Definizioni preliminari

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Basi di dati biologici

Basi di dati biologici Basi di dati biologici Materiale da: The GenBank Sequence Database, A. D. Baxevanis. In Bioinformatics A practical Guide to the Analysis of Genes and Proteins Wiley-Liss 1998 Introduzione alla Bioinformatica

Dettagli

STUDIO E SPERIMENTAZIONE DI METODOLOGIE

STUDIO E SPERIMENTAZIONE DI METODOLOGIE UNIVERSITÀ DEGLI STUDI DI CAGLIARI DOTTORATO DI RICERCA IN INGEGNERIA ELETTRONICA ED INFORMATICA XVII CICLO STUDIO E SPERIMENTAZIONE DI METODOLOGIE INNOVATIVE PER L ANALISI DI SEQUENZE BIOLOGICHE Relatore:

Dettagli

Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione

Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione Informatica Lezione VIII Visualizzazione 3D di proteine Visualizzazioni 3D Rappresentazione di strutture/oggetti tridimensionali Risultato di un esperimento modello teorico dati fisici astrazione 1 Lezione

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance

Dettagli

1. Le banche dati biologiche

1. Le banche dati biologiche 1. Le banche dati biologiche NCBI, ENTREZ, MEDLINE, PUBMED Il National Center for Biotechnology Information (NCBI), un ente governativo americano, gestisce un sito web (www.ncbi.nlm.nih.gov) attraverso

Dettagli

ANALISI BIOINFORMATICA DELLE PROTEINE. Matteo Ramazzotti matteo.ramazzotti@unifi.it

ANALISI BIOINFORMATICA DELLE PROTEINE. Matteo Ramazzotti matteo.ramazzotti@unifi.it ANALISI BIOINFORMATICA DELLE PROTEINE Matteo Ramazzotti matteo.ramazzotti@unifi.it Programma Banche dati proteiche. Interrogazione delle banche dati. Allineamento di sequenze proteiche. Matrici di sostituzione.

Dettagli

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche.

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche. I due centri maggiori, EBI e NCBI hanno sviluppato sistemi dedicati di RETRIEVAL allo scopo di ottenere il massimo delle informazioni con il minimo sforzo da parte dell utente SRS (Sequence Retrieval System)

Dettagli

Le proteine. Polimeri composto da 20 diversi aminoacidi

Le proteine. Polimeri composto da 20 diversi aminoacidi Le proteine Polimeri composto da 20 diversi aminoacidi (D. Voet, J.G. Voet, Biochemistry, 3 ed., John Wiley & Sons, 2004) PROTEINE come ATTUATORI nella cellula Trasporto elettronico Trasporto di ioni e

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Basi di dati biologiche

Basi di dati biologiche Basi di dati biologiche Seminario per il corso di Basi di Dati II Luana Rinaldi luana.rinaldi@gmail.com AGENDA: Introduzione alla bioinformatica; Concetti Biologici; Banche dati biologiche; Collaborazioni

Dettagli

BIOINFORMATICA: Cosa è?

BIOINFORMATICA: Cosa è? BIOINFORMATICA: Cosa è? THE DEFINITIONS OF BIOINFORMATICS Bioinformatics is an integration of mathematical, statistical and computer methods to analyse biological, biochemical and biophysical data (Georgia

Dettagli

Lezione 4. Il sequenziamento del DNA, Sanger

Lezione 4. Il sequenziamento del DNA, Sanger Lezione 4 Il sequenziamento del DNA, Sanger Schema della lezione Polymerase chain reaction (PCR) Dal prodotto di PCR al sequenziamento di Sanger Lettura dei prodotti di sequenziamento con sequenziatori

Dettagli

3.3. UMAMI NEGLI ALIMENTI

3.3. UMAMI NEGLI ALIMENTI 3.3. UMAMI NEGLI ALIMENTI In questo capitolo saranno esaminati i vari cibi, ad esclusione di quelli ittici che verranno presi in considerazione successivamente, allo scopo di scoprire se in essi è presente,

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Caccia al gene della Fibrosi Cistica

Caccia al gene della Fibrosi Cistica Caccia al gene della Fibrosi Cistica Scenario e simulazione di consulenza genetica Siete un genetista medico e lavorate in un consultorio genetico. Si presenta da voi una coppia che richiede consulenza

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

DNA Memory. Approfondimento del corso di Bioinformatica. prof.ssa Cocco. Sebastiano Vascon

DNA Memory. Approfondimento del corso di Bioinformatica. prof.ssa Cocco. Sebastiano Vascon DNA Memory Approfondimento del corso di Bioinformatica prof.ssa Cocco DNA Memory (Outline) Nested PCR NPMM (Nested Primer Molecular Memory) Gerarchie di memoria Accesso ai dati Spazio di memoria Vincoli

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione in campo medico e biotecnologico Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione delle sequenze di acido nucleico Elena Comoglio Jacobacci & Partners S.p.A. Brevetti

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

4. Ricerca di sequenze in banche dati e allineamento multiplo

4. Ricerca di sequenze in banche dati e allineamento multiplo 4. Ricerca di sequenze in banche dati e allineamento multiplo Collegatevi al sito www.ncbi.nlm.nih.gov/blast. Apparirà una pagina nella quale le versioni di BLAST disponibili sono organizzate in base al

Dettagli

AMMINOACIDI E PROTEINE

AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE Vengono chiamate amminoacidi quelle molecole organiche in cui sono contemporaneamente presenti sia un gruppo acido carbossilico -COO che un gruppo amminico -N2. Una molecola appartenente

Dettagli

Mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione

Mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Mutazioni Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Le mutazioni possono essere spontanee oppure causate da agenti fisici, chimici

Dettagli

3. Confronto tra due sequenze

3. Confronto tra due sequenze 3. Confronto tra due sequenze Esercizio 1: uso di DotLet Il programma DotLet è accessibile dal sito http://myhits.isb-sib.ch/cgi-bin/dotlet, dove può essere utilizzato attraverso un interfaccia utente

Dettagli

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica Gli aminoacidi NOMENCLATURA Aminoacido Abbr. tre lettere Abbr. una lettera Aminoacido Abbr. tre lettere Abbr. una lettera Alanina ALA A Lisina LYS K Arginina ARG R Metionina MET M Asparagina ASN N Fenilalanina

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

DIEGO POGGIOLI Soft Computing

DIEGO POGGIOLI Soft Computing Primer design using genetic algorithm DIEGO POGGIOLI Soft Computing Bologna, 18 Maggio 2007 PCR Polymerase Chain Reaction Tecnica di biologia molecolare, fu ideata nel 1983 da Kary B. Mullis, che consente

Dettagli

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente Gli amminoacidi naturali sono α-amminoacidi : il gruppo amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente formula generale: gruppo funzionale carbossilico

Dettagli

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Docente: Dr. Nicola Vitulo Dipartimento di Biologia, CRIBI Viale G.Colombo3, 35131 Padova

Dettagli

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance in Man EntrezGene curated sequence and descriptive information about genetic loci GenCards HGMD dbsnp database of human genes,

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences Il DNA e la cellula Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia

Dettagli

Formati di scambio dati

Formati di scambio dati Formati di scambio dati Genbank È il genetic sequence DataBase del NIH (National Institute of Health) Contiene sequenze (primarie) annotate di nucleotidi e di proteine I files sono ragguppati in divisioni

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633

Dettagli

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma.

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma. PROTEOMA Si definisce proteoma il complemento tempo- e cellulo- specifico del genoma. Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse nello stesso momento in

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization Università degli Studi di Genova Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica Anno Accademico 2009/2010 Tesi di Laurea Specialistica Elaborazione di dati

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?

Dettagli

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R unità 1. La funzione del DN negli organismi La funzione del DN L acido desossiribonucleico o DN (dall inglese deoxyribonucleic acid) è la molecola informazionale delle cellule. Essa contiene e trasmette

Dettagli

e dei genotipi tossici

e dei genotipi tossici Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle

Dettagli

Lezione 4. Il sequenziamento del DNA, Sanger e il progetto genoma umano

Lezione 4. Il sequenziamento del DNA, Sanger e il progetto genoma umano Lezione 4 Il sequenziamento del DNA, Sanger e il progetto genoma umano Stranneheim and Lundeberg 2012 Un po di storia 25 Aprile 1953 James D. Watson e Francis Crick pubblicano la struttura del DNA (Watson

Dettagli

e-science Bioinformatics

e-science Bioinformatics Luciano Milanesi Luciano Milanesi Institute of Biomedical Technology CNR ABSTRACT. The Bioinformatics community was an early adopter of the Internet and contributed to the e-science development by publishing

Dettagli

26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale

26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale 26. Bioinformatica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Lo sviluppo delle Biotecnologie ha consentito di elevare

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale

Dettagli

INTRODUZIONE ALLA PROTEINE BCP 1-2

INTRODUZIONE ALLA PROTEINE BCP 1-2 INTRODUZIONE ALLA BIOCHIMICA DELLE PROTEINE BCP 1-2 Pietre miliari Lehninger 1973 Biochemistry Proteine ricombinanti Protein engineering Cristallografia, NMR, EM, MS, spettroscopie... Computing Bioinformaticai

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

10. Previsione della struttura tridimensionale di una proteina

10. Previsione della struttura tridimensionale di una proteina 10. Previsione della struttura tridimensionale di una proteina Lo scopo di questa esercitazione è di comprendere la logica alla base della modellizzazione per omologia attraverso la previsione della struttura

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

LOGIN: please, go to webpage https://studiare.unife.it and login using Your user id and password (the same as the first registration).

LOGIN: please, go to webpage https://studiare.unife.it and login using Your user id and password (the same as the first registration). Università degli studi di Ferrara IMMATRICOLAZIONE online ai corsi di DOTTORATO PhD: Instructions for ENROLMENT of the winners English version below 1) EFFETTUARE IL LOGIN: collegarsi da qualsiasi postazione

Dettagli

Analisi della sequenza nucleotidica AP001519 (gene BH3701) Davide Cittaro Valerio Reguzzi Marco Stefani

Analisi della sequenza nucleotidica AP001519 (gene BH3701) Davide Cittaro Valerio Reguzzi Marco Stefani Analisi della sequenza nucleotidica AP001519 (gene BH3701) Davide Cittaro Valerio Reguzzi Marco Stefani Informazioni di base Sequenza estratta dal batterio Bacillus halodurans Codice di accesso sequenza

Dettagli

Siti Web utili per la conoscenza della Biologia

Siti Web utili per la conoscenza della Biologia Siti Web utili per la conoscenza della Biologia Aggiornamento: marzo 2010: Per avere una animazione della sintesi proteica visitare il sito: http://www.abdn.ac.uk/~clt011/flash/samples/protein.swf prodotta

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata Ammino acidi Composto che contiene una funziome acida e amminica. Usualmente però con amminoacidi si intendono gli alfa- amminoacidi. Tra questi composti ve ne sono 20 che vengono definiti geneticamente

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

WELCOME. Go to the link of the official University of Palermo web site www.unipa.it; Click on the box on the right side Login unico

WELCOME. Go to the link of the official University of Palermo web site www.unipa.it; Click on the box on the right side Login unico WELCOME This is a Step by Step Guide that will help you to register as an Exchange for study student to the University of Palermo. Please, read carefully this guide and prepare all required data and documents.

Dettagli

Progetto Genoma Umano

Progetto Genoma Umano Progetto Genoma Umano Perché il Progetto Genoma? La determinazione e la conoscenza dell intera sequenza genomica sembrano essere la condizione necessaria per comprendere la completa biologia di un determinato

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

LA BIOINFORMATICA LEZIONI. Le principali banche dati biologiche sono: EMBL datalibrary (Europa); GenBank (USA); DDBJ (Giappone).

LA BIOINFORMATICA LEZIONI. Le principali banche dati biologiche sono: EMBL datalibrary (Europa); GenBank (USA); DDBJ (Giappone). NME... CLASSE... DATA................................... LA BIINFRMATICA Tutto cominciò attorno al 1990 quando si è assistito a una crescita parallela della ricerca genetica e delle potenzialità dei computer.

Dettagli

AMINOACIDI - 1 AMINOACIDI - 2

AMINOACIDI - 1 AMINOACIDI - 2 AMINOAIDI - 1 Proteine (gr. pròtos = primo) 50-80% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida o alcalina α-aminoacidi proteasi Struttura generale degli α-aminoacidi primari

Dettagli

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 21/02/2011 Progetto di ricerca: Utilizzo di oligonucleotidi antisenso per correggere l effetto di mutazioni di splicing in pazienti

Dettagli

AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali):

AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali): AMINOAIDI. Proteine (gr. pròtos = primo) > 50% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida (o alcalina) α-aminoacidi Struttura generale degli α-aminoacidi primari (standard,

Dettagli