Banche Dati: NCBI e BLAST. Progettazione primer per PCR mediante software on line: Primer3

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Banche Dati: NCBI e BLAST. Progettazione primer per PCR mediante software on line: Primer3"

Transcript

1 Banche Dati: NCBI e BLAST Progettazione primer per PCR mediante software on line: Primer3

2 Sorgenti di informazione Le banche dati di interesse biologico Le banche dati di sequenze nucleotidiche e proteiche L analisi delle sequenze Applicazioni I software per l analisi delle sequenze e il disegno di primer

3 Che cos è una banca dati biologica Una banca dati biologica (biological database) è un insieme organizzato di molti dati in formato elettronico associati a software specifici disegnati per permettere l aggiornamento, l interrogazione e il recupero dei dati immagazzinati nel sistema. Caratteristiche: - semplicità di accesso alle informazioni - metodo per estrarre solo le informazioni che rispondono ad un particolare quesito biologico

4 Che cos è la Bioinformatica La Bioinformatica può essere definita come una disciplina scientifica che fa uso delle tecnologie informatiche per organizzare, analizzare e rendere disponibili informazioni biologiche al fine di chiarire i problemi della biologia. Unisce le competenze nei campi dell informatica, delle tecnologie dell informazione e della biologia. Obiettivo E quello di permettere la scoperta di nuovi meccanismi biologici e di creare una visione globale e distinta dei processi biologici stessi.

5 Le banche dati di interesse biologico Elenco aggiornato di banche dati Molecular Biology Database Collection The BioToolKit

6 Classificazione delle banche dati Major Public Sequence Repositories Comparative Genomics Gene Expression Gene Identification and Structure Genetic and Physical Maps Genomic Databases Intermolecular Interactions Metabolic Pathways and Cellular Regulation Mutation Databases Pathology Protein Databases Protein Sequence Motifs Proteome Resources Retrieval Systems and Database Structure RNA Sequences Structure Transgenics Varied Biomedical Content

7 DNA sequence databases EMBL Nucleotide Sequence Database (European Molecular Biology Laboratory) GenBank DNA Data Bank of Japan (DDBJ)

8 Una sequenza nucleotidica... ACGGTGCCAGTGCATTGGACCACATGCGA... Una sequenza aminoacidica... TACYRSLIPPAADDNCAILQEVWMFHHT...

9 Nucleotide base codes (IUPAC) Code Base Description G Guanine A Adenine T Thymine in DNA (Uracil in RNA) C Cytosine R Purine (A or G) Y Pyrimidine (C or T or U) M Amino (A or C) K Ketone (G or T) S Strong interaction (C or G) W Weak interaction (A or T) H Not-G (A or C or T) H follows G in the alphabet B Not-A (C or G or T) B follows A V Not-T (not-u) (A or C or G) V follows U D Not-C (A or G or T) D follows C N Any (A or C or G or T) Authority Nomenclature Committee of the International Union of Biochemistry Reference Cornish-Bowden, A. Nucleic Acids Res. 13, (1985)

10 Amino acid abbreviations and codes Abbreviation Code Description Ala A Alanine Arg R Arginine Asn N Asparagine Asp D Aspartic acid (Aspartate) Cys C Cysteine Gln Q Glutamine Glu E Glutamic acid (Glutamate) Gly G Glycine His H Histidine Ile I Isoleucine Leu L Leucine Lys K Lysine Met M Methionine Phe F Phenylalanine Pro P Proline Ser S Serine Thr T Threonine Authority Trp W Tryptophan Reference Tyr Y Tyrosine Val V Valine IUPAC-IUB Joint Commission on Biochemical Nomenclature. IUPAC-IUB Joint Commission on Biochemical Nomenclature. Nomenclature and Symbolism for Amino Acids and Peptides. Eur. J. Biochem. 138: 9-37 (1984).

11

12

13 EMBL Divisions Division Code ESTs EST Bacteriophage PHG Fungi FUN Genome survey GSS High Throughput cdna HTC High Throughput Genome HTG Human HUM Invertebrates INV Mus musculus MUS Organelles ORG Other Mammals MAM Other Vertebrates VRT Plants PLN Prokaryotes PRO Rodents ROD STSs STS Synthetic SYN Unclassified UNC Viruses VRL

14 20 March 2002

15 GenBank Incorpora, organizza e distribuisce tutte le sequenze nucleotidiche disponibili pubblicamente. Localizzata e mantenuta presso il National Center for Biotechnology Information (NCBI), una divisione della National Library of Medicine (NLM), con sede presso il campus dell National Institutes of Health (NIH) a Bethesda, Mariland, USA. Collabora con EMBL e DDBJ con cui scambia dati giornalmente. Ricercatori, Genome Project Groups, US Office of Patents and Trademarks (USPTO) forniscono dati di sequenza. Immissione dei dati (submission): BankIt (web-based submission system) e procedure automatiche (large scale genome sequencing centers, fa2htgs). Accesso: gratuito via FTP, e WWW. Database release: bimestrale.

16 La sequenza in formato FASTA >embl:ssc AJ Sus scrofa partial ctsb gene for cathepsin B, exons 6-7, allele 1 aaagaagggcctggtgtccgggggcctctatgactcgcatgtgggtaagtggccgggtgg gttttataagcaggaagtgacactggtcattttcccctacaaagtggaggtgaagggttg tgggcgggaaggctgggctacacggtgcagcagcccggctacggcagaattagcagcacc aggaggaggcgtcagcgccacagacttgaggggaacttgccccttagctgggcccaattc ttctctctggcctggagggacctctgaggggcttgctgccgacactccccctttctccgg gccccccaggttgcaggccc Formati di sequenze 1. IG/Stanford 2. GenBank/GB 3. NBRF-PIR 4. EMBL/SWISS 5. GCG 6. DNAStrider 7. Fitch 8. Pearson/Fasta 9. Zuker 10. Olsen 11. Phylip Phylip 13. Plain/Raw (ASCII) 14. PIR-CODATA 15. GCG MSF 16. ASN PAUP/NEXUS 18. Pretty

17 La sequenza AJ in formato GenBank LOCUS SSC bp DNA linear MAM 03-JUN-2002 DEFINITION Sus scrofa partial ctsb gene for cathepsin B, exons 6-7, allele 1. ACCESSION AJ VERSION AJ GI: KEYWORDS cathepsin B; ctsb gene. SOURCE pig. ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Cetartiodactyla; Suina; Suidae; Sus. REFERENCE 1 AUTHORS Russo,V., Fontanesi,L., Davoli,R., Nanni Costa,L., Cagnazzo,M., Buttazzoni,L., Virgili,R. and Yerle,M. TITLE Investigation of candidate genes for meat quality in dry-cured ham production: the porcine cathepsin B (CTSB) and cystatin B (CSTB) genes JOURNAL Anim. Genet. 33 (2), (2002) PUBMED REFERENCE 2 (bases 1 to 320) AUTHORS Fontanesi,L. TITLE Direct Submission JOURNAL Submitted (30-MAY-2001) Fontanesi L., DIPROVAL, Sez Allevamenti Zootecnici, University of Bologna, Via F.lli Rosselli 107, Reggio Emilia, 42100, ITALY COMMENT PCR primer used to amplify the sequence Forward 5'-CTGGAGCCTGGAACTTCTGGAC-3' Reverse 5'-GCTCACAGGGAGGGATGGAGTA-3. Continua

18 FEATURES Location/Qualifiers source /organism="sus scrofa" /db_xref="taxon:9823" /chromosome="14" gene /gene="ctsb" CDS join(<1..44,309..>320) /gene="ctsb" /note="allele 1" /codon_start=2 /product="cathepsin B" /protein_id="cac " /db_xref="gi: " /db_xref="sptrembl:q95j72" /translation="kkglvsgglydshvglqa" exon <1..44 /gene="ctsb" /number=6 intron /gene="ctsb" /number=6 exon 309..>320 /gene="ctsb" /number=7 BASE COUNT 59 a 87 c 110 g 64 t ORIGIN 1 aaagaagggc ctggtgtccg ggggcctcta tgactcgcat gtgggtaagt ggccgggtgg 61 gttttataag caggaagtga cactggtcat tttcccctac aaagtggagg tgaagggttg 121 tgggcgggaa ggctgggcta cacggtgcag cagcccggct acggcagaat tagcagcacc 181 aggaggaggc gtcagcgcca cagacttgag gggaacttgc cccttagctg ggcccaattc 241 ttctctctgg cctggaggga cctctgaggg gcttgctgcc gacactcccc ctttctccgg 301 gccccccagg ttgcaggccc //

19 Protein Databases SWISS-PROT Database Protein Information Resource

20 ENTRY S20421 #type complete iproclass View of S20421 TITLE stefin B bovine ORGANISM #formal_name Bos primigenius taurus #common_name cattle #cross-references taxon:9913 DATE 22-Nov-1993 #sequence_revision 05-May-1995 #text_change 16-Jul-1999 ACCESSIONS S20421; S23958 REFERENCE S20421 #authors Krizaj, I.; Turk, B.; Turk, V. #journal FEBS Lett. (1992) 298: #title The complete primary structure of bovine stefin B. #cross-references MUID: ; PMID: #accession S20421 ##molecule_type protein ##residues 1-98 ##label KRI REFERENCE S23958 #authors Turk, B.; Krizaj, I.; Turk, V. #journal Biol. Chem. Hoppe-Seyler (1992) 373: #title Isolation and characterization of bovine stefin B. #cross-references MUID: ; PMID: #contents annotation CLASSIFICATION SF #superfamily cystatin; cystatin homology KEYWORDS acetylated amino end; cysteine proteinase inhibitor FEATURE 2-98 #domain cystatin homology #label CYS\ 1 #modified_site acetylated amino end (Met) #status experimental SUMMARY #length 98 #molecular_weight SEQUENCE M M C G G T S A T Q P A T A E T Q A I A D K V K S Q L E E K 31 E N K K F P V F K A L E F K S Q L V A G K N Y F I K V Q V D 61 E D D F V H I R V F E S L P H E N K P V A L T S Y Q T N K G 91 R H D E L T Y F

21 Analisi delle sequenze Sequence similarity searching tools BLAST FASTA Genomic sequence analysis tools Exon prediction programs RepeatMasker Restriction analysis tools Webcutter NEBcutter Rebase

22 Introduzione: Similarity analysis Una sequenza di per se non è informativa: deve essere analizzata utilizzando metodi comparativi contro banche dati per poter avanzare ipotesi sulla funzione, classe, ecc Identity: la misura in cui 2 sequenze (nucleotidiche o aminoacidiche) sono uguali. Similarity: la misura in cui 2 sequenze (nucleotidiche o aminoacidiche) hanno qualcosa in comune. Si esprime in percentuale di identità di sequenza (percent sequence identity). Homology: Similarity attribuita alla discendenza da un antenato comune (si deduce dalla misura di similarità della struttura, della funzione, della sequenza). L approccio generale dell analisi prevede l utilizzo di una serie di algoritmi per confrontare una sequenza (query sequence) con tutte le sequenze presenti in una particolare banca dati. Continua

23 Ad ogni confronto viene assegnato un punteggio (score) che riflette il grado di similarità (degree of similarity) fra la query sequence e le sequenze confrontate. La similarity viene misurata e mostrata graficamente per mezzo di allineamenti tra due sequenze (la query sequence e una della banca dati). Gli allineamenti possono essere globali (global) o locali (local). Un allineamento globale è un allineamento ottimale (optimal alignment) che include tutti i caratteri di ciascuna sequenza. Un allineamento locale è un allineamento ottimale che include solo la regione o le regioni più simili. Optimal alignment: un allineamento di due sequenze con lo score più alto possibile. Per discriminare fra match reali o artefatti viene utilizzata la probabilità (probability) che il match avvenga per caso.

24 Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) "Basic local alignment search tool. J. Mol. Biol. 215: Basic Local Alignment Search Tools I programmi BLAST sono costituiti da una serie di algoritmi di confronto fra sequenze e sono utilizzati per identificare optimal local alignments tra una query sequence ed una banca dati di sequenze. BLAST mantiene sia una buona velocità di analisi che una buona sensibilità (caratteristiche importanti con la crescita esponenziale delle banche dati). BLAST frammenta la query sequence e le sequenze nella banca dati in frammenti ( Words ) cercando inizialmente match fra i frammenti. La ricerca iniziale è effettuata per Word di lunghezza W che danno uno score di almeno T quando confrontate con la query sequence usando una particolare matrice di sostituzione (substitution matrix). Questi match vengono estesi da entrambe le direzioni nel tentativo di generare un allineamento con uno score che supera la soglia S. Il parametro T regola la velocità e la sensibilità della ricerca. Continua

25 La qualità di ciascun allineamento è rappresentata da uno score e gli score sono ordinati dal più alto al più basso (ranked) Matrici di punteggio (scoring matrices) sono usate per calcolare di un allineamento base per base (DNA) o aminoacido per aminoacido (proteine). Una matrice unitaria (unitary matrix) è utilizzata per il DNA perché ciascuna posizione può assumere uno score di +1 se crea un match oppure uno score di 0 se non produce un match. Continua

26 Gaps: posizioni in cui una lettera è appaiata ad uno spazio vuoto sono indicate come gaps. I punteggi per i gap sono negativi. La significatività di ciascun allineamento è calcolata come P value (la probabilità di un allineamento di avere uno score come quello in esame o migliore) oppure come E value (Expectation value: il numero di differenti allineamenti con score equivalenti o migliori di S che ci si può aspettare di osservare in una ricerca in una banca dati per caso). Più bassi sono più significativi sono gli score. Ogni allineamento, tuttavia deve essere valutato criticamente prima di essere accettato. Ad esempio, allineamenti originati da una serie di sequenze ripetute possono ottenere alti score ma non riflettere similarità fra le due sequenze. Filtri che mascherano low complexity regions possono essere utilizzati per alleviare questi problemi. Es.: SEG program

27 BLAST Programs BLAST 2.0 (Gapped BLAST) blastn: confronta una sequenza nucleotidica contro una banca dati di sequenze nucleotidiche. bastp: confronta una sequenza aminoacidica contro una banca dati di sequenze proteiche. blastx: confronta una sequenza nucleotidica (che viene tradotta in tutti i reading frames) contro una banca dati di sequenze proteiche. tblastn: confronta una sequenza proteica contro una banca dati di sequenze nucleotidiche dinamicamente tradotte in tutti i reading frames. tblastx: confronta i 6 reading frames di una sequenza nucleotidica contro i 6 reading frames delle sequenze nucleotidiche presenti in una banca dati.

28 Nucleotide Sequence Databases nr All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences). No longer "non-redundant". month All new or revised GenBank+EMBL+DDBJ+PDB sequences released in the last 30 days. Drosophila genome Drosophila genome provided by Celera and Berkeley Drosophila Genome Project (BDGP). dbest Database of GenBank+EMBL+DDBJ sequences from EST Divisions dbsts Database of GenBank+EMBL+DDBJ sequences from STS Divisions htgs Unfinished High Throughput Genomic Sequences: phases 0, 1 and 2 (finished, phase 3 HTG sequences are in nr) gss Genome Survey Sequence, includes single-pass genomic data, exon-trapped sequences, and Alu PCR sequences. yeast Yeast (Saccharomyces cerevisiae) genomic nucleotide sequences E. coli Escherichia coli genomic nucleotide sequences pdb Sequences derived from the 3-dimensional structure from Brookhaven Protein Data Bank kabat [kabatnuc] Kabat's database of sequences of immunological interest vector Vector subset of GenBank(R), NCBI, in ftp://ncbi.nlm.nih.gov/blast/db/ mito Database of mitochondrial sequences alu Select Alu repeats from REPBASE, suitable for masking Alu repeats from query sequences. It is available by anonymous FTP from ncbi.nlm.nih.gov (under the /pub/jmc/alu directory). See "Alu alert" by Claverie and Makalowski, Nature vol. 371, page 752 (1994). epd Eukaryotic Promotor Database found on the web at

29 BLASTN [Apr ] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: RID: Query= gi emb X SSMYHCS Sus scrofa mrna for skeletal myosin heavy chain (pazmy4) (798 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) 1,301,425 sequences; 5,790,534,584 total letters If you have any problems or questions with the results of this search please refer to the BLAST FAQs Taxonomy reports Distribution of 182 Blast Hits on the Query Sequence

30 Score E Sequences producing significant alignments: (bits) Value gi emb X SSMYHCS Sus scrofa mrna for skeleta gi dbj AB AB Sus scrofa mrna for myos gi ref XM_ Homo sapiens myosin, heavy pol gi ref NM_ Homo sapiens myosin, heavy pol gi gb AF AF Homo sapiens myosin heavy gi dbj AB AB Bos taurus MyHC-2x mrna gi ref XM_ Homo sapiens myosin, heavy pol gi dbj AB AB Sus scrofa mrna for myos gi ref NM_ Homo sapiens myosin, heavy poly gi gb AF AF Homo sapiens myosin heavy gi emb X HSMYH1R Human skeletal mrna for myosi gi gb U OCU32574 Oryctolagus cuniculus myosin gi 1622 emb X OCMHCR Rabbit mrna for fast skeletal m gi gb BC Mus musculus, clone IMAGE: gi gb S S68736 Rattus sp. myosin heavy chain gi ref XM_ Mus musculus myosin, heavy pol gi emb AJ MMU Mus musculus partial mr gi emb AJ MMU Mus musculus partial mr gi dbj AB AB Sus scrofa mrna for myos gi ref XM_ Mus musculus similar to Myosin gi dbj AB AB Bos taurus MyHC-2a mrna gi gb S S73840 Homo sapiens type IIA myosin h gi ref XM_ Homo sapiens myosin, heavy pol gi ref NM_ Homo sapiens myosin, heavy poly gi gb AF AF Homo sapiens myosin heavy gi gb AF AF Rattus norvegicus type 2X gi gb L RATMYH Rattus norvegicus myosin heavy gi emb Z OCHEAMYO2 O.cuniculus (OCCDNA32) mrn e-155 gi ref XM_ Mus musculus similar to Myosin e-151 gi gb BC BC Mus musculus, Similar to e-151 gi gb L RATMYHM Rattus norvegicus skeletal mu e-149 gi gb K RATMYHC Rat embryonic myosin heavy ch e-147 gi ref XM_ Homo sapiens myosin, heavy pol e-144 gi emb X HSBMHCF Human MHC mrna for fetal-myos e-144 gi ref NM_ Homo sapiens myosin, heavy poly e-142 gi gb M HUMMYOHP Homo sapiens perinatal myosi e-142 gi emb Z HSMYOSIN H.sapiens mrna for myosin e-142 gi gb M CHKMYOSIND Gallus gallus fast myosin e-134 gi gb J CHKMYHE Chicken embryonic myosin heav e

31 >gi ref XM_ Homo sapiens myosin, heavy polypeptide 4, skeletal muscle (MYH4), mrna Length = 6015 Score = 955 bits (482), Expect = 0.0 Identities = 656/713 (92%), Gaps = 2/713 (0%) Strand = Plus / Plus Query: 1 caccagcctgatcaacaccaagaagaagctggagacagacatctcccaaatccagggaga 60 Sbjct: 5282 caccagcctgatcaacaccaagaagaagctggaaacagacatttcccaaatccagggaga 5341 Query: 61 gatggaggacattgtccaggaagctcgcaacgcagaagagaaggccaagaaggccatcac 120 Sbjct: 5342 gatggaggacatcgtccaggaagcccgcaatgcagaggagaaggccaagaaggccatcac 5401 Query: 121 tgatgcagccatgatggccgaggagctgaagaaggagcaggacaccagcgcccacctgga 180 Sbjct: 5402 tgatgctgccatgatggctgaggagctgaagaaggaacaggacaccagcgcccacctgga 5461 Query: 181 gcggatgaagaagaatatggaacagacggtaaaggacctgcagcaccgcctggacgaggc 240 Sbjct: 5462 gcggatgaagaagaacatggagcagaccgtgaaggatctgcagctccgtctggatgaggc 5521 Query: 241 agaacagttggccctgaagggcgggaagaagcagatccagaagctggaggccagggtgag 300 Sbjct: 5522 tgagcagctggcgctgaagggtgggaagaagcagatccagaaactggaggccagggtgag 5581 Query: 301 ggagcttgaaaatgaggttgaaaatgaacagaagcgcaatgttgaggctgtcaagggtct 360 Sbjct: 5582 agagcttgaaagtgaggtggaaagtgaacagaagcacaatgttgaggctgtcaagggtct 5641 Query: 361 tcggaaacatgagagaagagtgaaggaactcacttaccagactgaggaggaccgaaagaa 420 Sbjct: 5642 tcgcaaacatgagagaagagtgaaggaactcacttaccagactgaggaggaccgcaagaa 5701 Query: 421 tgttctcaggctgcaggacttggtggacaaactacaatccaaagttaaagcttacaagag 480 Sbjct: 5702 tattctcaggctgcaggacttggtggacaaattgcaaaccaaagtcaaagcttacaagag 5761 Query: 481 acaagcggaagaggcggaggaacaatccaacgtcaacctctccaagttccgcaagctcca 540 Sbjct: 5762 acaagctgaagaggctgaggaacaatccaatgtcaaccttgccaagttccgcaagctcca 5821

32 Collegarsi al sito Cliccate: Search Nucleotide for: digitate APOSTART Scegliete la versione genomica del gene Visualizzatela in formato FASTA

33 WWW Restriction analysis tools NEBcutter v Webcutter 2.0 Restriction Maps

34 Progettazione primers per PCR PCR Primer design I primers devono essere ottimizzati per: Specificità Temperatura di fusione Strutture secondarie e formazione di dimeri Stabilità dell appaiamento con la sequenza target Software Primer3 Ci sono molti altri software per progettare primers, sia gratis che non

35 Come è strutturato Primer3? Essenzialmente in 2 parti : La prima permette di agire sulla SEQUENZA da amplificare, indicando DOVE vanno disegnati i nostri primers Nella seconda abbiamo la possibilità di indicare le CARATTERISTICHE che devono avere i primers

36 I campi da riempire nella pagina di input di Primer3

37 Campo Sequence Id Immettere il vostro nome + APOSTART Es: Stefano-APOSTART Ma si può anche usare il formato FASTA Campo Targets atggtagat ctgagggtaa atttctagtt tttctccttc attttcttgg ttaggaccct tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt gtctatgatg atgatgatag ttacagaacc gacgactcgt ccgtcctgta gaaaccccaa cccgtgaaat caaaaaactc[gacggcctgt gggcattcag] tctggatcgc gaaaactgtg gaattgatca gcgttggtgg gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag gcagttttaa cgatcagttc gccgatgcagatattcgtaa ttatgcgggc aacgtctggt atcagcgcga agtctttata ccgaaaggtt gggcaggccagcgtatcgtg ctgcgtttcg I target sono le parti della sequenza che devono essere presenti nell amplificato (amplicone). Per definirli si utilizzano le parentesi [ ] o si immettono nell apposita casella i valori di start e length

38 Campi Excluded Regions O Included Region atggtagat ctgagggtaa atttctagtt{tttctccttc attttcttgg ttaggaccct tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt gtctatgatg atgatgatag ttacagaacc gacgactcgt ccgtcctgta gaaaccccaa cccgtgaaat}caaaaaactc gacggcctgt gggcattcag tctggatcgc gaaaactgtg gaattgatca gcgttggtgg gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag gcagttttaa cgatcagttc gccgatgcag atattcgtaa ttatgcgggc aacgtctggt atcagcgcga agtctttata ccgaaaggtt gggcaggcca gcgtatcgtg ctgcgtttcg Si possono definire le regioni che non interessano o che invece interessano per la progettazione del primer con i valori start e length, cioè la prima base e il numero di basi della regione Si possono usare anche i simboli < > per Excluded Regions. Campo Product size e Product size Range

39 Seconda parte Le caratteristiche dei primers Campo Number To Return Si può scegliere quante coppie di primer si desidera che il programma ci fornisca Campo Max 3 Stability Più alto è il valore più il primer è stabile all estremità 3 Non si desidera una eccessiva stabilità: APPAIAMENTO CORRETTO 5 TACTGGTACTAATGCCCCC 3 3 ATGACCATGATTACGGGGGAGCTACCTATCATGGTATAGGTA 5 APPAIAMENTO NON CORRETTO, ma funzionante 5 TACTGGTACTAATGCCCCC 3 3 CCGGGGATCCTTACGGGGGGACCTATGCAA 5

40 Campo Max Mispriming e Pair Max Mispriming E un parametro che stabilisce la massima similarità di uno o di entrambi i primerspermessa con sequenze contenute nelle Mispriming Libraries, che contengono sequenze ripetute di vari organismi Campo Primer size Campi Primer Tm e Max Tm Difference La temperatura di annealing dipende dalla percentuale di G+C e dalla lunghezza del primer. Siccome non vogliamo una % G+C troppo alta la Tm richiesta per un primer deve tener conto della lunghezza desiderata (se la richiediamo)

41 Campo Primer GC% E ottimale una frequenza di G+C (e A+T) del 50% Campi Max (Self) Complementarity e Max 3 (Self) Complementarity 5' ATGCCCTAGCTTCCGGATG 3' 3' AAGTCCTACATTTAGCCTAGT 5 Evitare la formazione di dimeri 5' ATGCGCTTATA A 3 TACGCCTTAGA e di strutture secondarie!!!

42 Campo Max #N s Il numero massimo di N che consentiamo nei primer Nel caso si disegnino primer su sequenze di bassa qualità, con tenenti basi incerte (N) Campo Max poly-x Il numero massimo di ripetizioni mononucleotidiche (es. AAAAAA) rendono il primer troppo stabile (G/C) o troppo instabile (A/T) Campo GC Clamp Il numero di G o C richiesto all estremità 3 Non più di una! Quando è tutto deciso, click su pick primers

43 Output di Primer 3 Primer3 Output WARNING: Numbers in input sequence were deleted. PRIMER PICKING RESULTS FOR Stefano No mispriming library specified Using 1-based sequence positions OLIGO start len tm gc% any 3' seq LEFT PRIMER cccttacgctgaagagatgc RIGHT PRIMER ggcacagcacatcaaagaga SEQUENCE SIZE: 2053 INCLUDED REGION SIZE: 2053 PRODUCT SIZE: 401, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: gcattacccttacgctgaagagatgctcgactgggcagatgaacatggcatcgtggtgat >>>>>>>>>>>>>>>>>>>> 1261 tgatgaaactgctgctgtcggctttcagctgtctttaggcattggtttcgaagcgggcaa 1321 caagccgaaagaactgtacagcgaagaggcagtcaacggggaaactcagcaagcgcactt 1381 acaggcgattaaagagctgatagcgcgtgacaaaaaccacccaagcgtggtgatgtggag 1441 tattgccaacgaaccggatacccgtccgcaaggtgcacgggaatatttcgcgccactggc 1501 ggaagcaacgcgtaaactcgacccgacgcgtccgatcacctgcgtcaatgtaatgttctg 1561 cgacgctcacaccgataccatcagcgatctctttgatgtgctgtgcctgaaccgttatta <<<<<<<<<<<<<<<<<<<<

44 Output di Primer 3

45 Esercizio Cercare nella banca dati NCBI sequenze di Poa pratensis. Selezionare tra di esse il gene SERK isolato da Albertini E, e Marconi G. Eseguire un BLAST sulla sequenza e disegnare dei primer specifici per la individuazione di tale gene (utilizzando quindi parti peculiari della sequenza.) Il prodotto di amplificazione deve essere compreso tra 150 e 300 pb La temperatura di fusione dei primers deve essere superiore a 60 C

46 Sequenza codificante del gene NptII dal plasmide pcambia-2301 tca gaagaactcg tcaagaaggc gatagaaggc 9001 gatgcgctgc gaatcgggag cggcgatacc gtaaagcacg aggaagcggt cagcccattc 9061 gccgccaagc tcttcagcaa tatcacgggt agccaacgct atgtcctgat agcggtccgc 9121 cacacccagc cggccacagt cgatgaatcc agaaaagcgg ccattttcca ccatgatatt 9181 cggcaagcag gcatcgccat gtgtcacgac gagatcctcg ccgtcgggca tgcgcgcctt 9241 gagcctggcg aacagttcgg ctggcgcgag cccctgatgc tcttcgtcca gatcatcctg 9301 atcgacaaga ccggcttcca tccgagtacg tgctcgctcg atgcgatgtt tcgcttggtg 9361 gtcgaatggg caggtagccg gatcaagcgt atgcagccgc cgcattgcat cagccatgat 9421 ggatactttc tcggcaggag caaggtgaga tgacaggaga tcctgccccg gcacttcgcc 9481 caatagcagc cagtcccttc ccgcttcagt gacaacgtcg agcacagctg cgcaaggaac 9541 gcccgtcgtg gccagccacg atagccgcgc tgcctcgtcc tggagttcat tcagggcacc 9601 ggacaggtcg gtcttgacaa aaagaaccgg gcgcccctgc gctgacagcc ggaacacggc 9661 ggcatcagag cagccgattg tctgttgtgc ccagtcatag ccgaatagcc tctccaccca 9721 agcggccgga gaacctgcgt gcaatccatc ttgttcaatc cccat

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

RefWorks Guida all utente Versione 4.0

RefWorks Guida all utente Versione 4.0 Accesso a RefWorks per utenti registrati RefWorks Guida all utente Versione 4.0 Dalla pagina web www.refworks.com/refworks Inserire il proprio username (indirizzo e-mail) e password NB: Agli utenti remoti

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

Il Form C cartaceo ed elettronico

Il Form C cartaceo ed elettronico Il Form C cartaceo ed elettronico Giusy Lo Grasso Roma, 9 luglio 2012 Reporting DURANTE IL PROGETTO VENGONO RICHIESTI PERIODIC REPORT entro 60 giorni dalla fine del periodo indicato all Art 4 del GA DELIVERABLES

Dettagli

Windows Compatibilità

Windows Compatibilità Che novità? Windows Compatibilità CODESOFT 2014 é compatibile con Windows 8.1 e Windows Server 2012 R2 CODESOFT 2014 Compatibilità sistemi operativi: Windows 8 / Windows 8.1 Windows Server 2012 / Windows

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

Web of Science SM QUICK REFERENCE GUIDE IN COSA CONSISTE WEB OF SCIENCE? General Search

Web of Science SM QUICK REFERENCE GUIDE IN COSA CONSISTE WEB OF SCIENCE? General Search T TMTMTt QUICK REFERENCE GUIDE Web of Science SM IN COSA CONSISTE WEB OF SCIENCE? Consente di effettuare ricerche in oltre 12.000 riviste e 148.000 atti di convegni nel campo delle scienze, delle scienze

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx. Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.com Avvertenza di Rischio: Il Margin Trading su forex e/o CFD comporta

Dettagli

UNITA DI MISURA E TIPO DI IMBALLO

UNITA DI MISURA E TIPO DI IMBALLO Poste ALL. 15 Informazioni relative a FDA (Food and Drug Administration) FDA: e un ente che regolamenta, esamina, e autorizza l importazione negli Stati Uniti d America d articoli che possono avere effetti

Dettagli

Analisi di massima: L utente dovrà inserire un numero limite, e tramite vari calcoli verrà stampato a video la sequenza.

Analisi di massima: L utente dovrà inserire un numero limite, e tramite vari calcoli verrà stampato a video la sequenza. Relazione tecnica Fibonacci ANDENA GIANMARCO Traccia: Creare un algoritmo che permetta, dato un valore intero e positivo, di stabilire la sequenza utilizzando la regola di fibonacci dei numeri fino al

Dettagli

RefWorks: un gestore di bibliografie su web

RefWorks: un gestore di bibliografie su web RefWorks: un gestore di bibliografie su web Un applicativo avanzato e innovativo per l import di citazioni da database online, la creazione di archivi personali e la generazione di bibliografie in vari

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Inidirizzi IP e Nomi di Dominio. Domain Name System. Spazio dei Nomi Piatto. Gestione dello Spazio dei Nomi

Inidirizzi IP e Nomi di Dominio. Domain Name System. Spazio dei Nomi Piatto. Gestione dello Spazio dei Nomi I semestre 03/04 Inidirizzi IP e Nomi di Dominio Domain Name System Prof. Vincenzo Auletta auletta@dia.unisa.it http://www.dia.unisa.it/professori/auletta/ Università degli studi di Salerno Laurea in Informatica

Dettagli

Introduzione a MySQL

Introduzione a MySQL Introduzione a MySQL Cinzia Cappiello Alessandro Raffio Politecnico di Milano Prima di iniziare qualche dettaglio su MySQL MySQL è un sistema di gestione di basi di dati relazionali (RDBMS) composto da

Dettagli

Proposition for a case-study identification process. 6/7 May 2008 Helsinki

Proposition for a case-study identification process. 6/7 May 2008 Helsinki Conférence des Régions Périphériques Maritimes d Europe Conference of Peripheral Maritime Regions of Europe ANALYSIS PARTICIPATION TO THE FP THROUGH A TERRITORIAL AND REGIONAL PERSPECTIVE MEETING WITH

Dettagli

e-spare Parts User Manual Peg Perego Service Site Peg Perego [Dicembre 2011]

e-spare Parts User Manual Peg Perego Service Site Peg Perego [Dicembre 2011] Peg Perego Service Site Peg Perego [Dicembre 2011] 2 Esegui il login: ecco la nuova Home page per il portale servizi. Log in: welcome to the new Peg Perego Service site. Scegli il servizio selezionando

Dettagli

Virtualizzazione con Microsoft Tecnologie e Licensing

Virtualizzazione con Microsoft Tecnologie e Licensing Microsoft Virtualizzazione con Microsoft Tecnologie e Licensing Profile Redirezione dei documenti Offline files Server Presentation Management Desktop Windows Vista Enterprise Centralized Desktop Application

Dettagli

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM ALLEGATO 2 FULL PROJECT FORM FORM 1 FORM 1 General information about the project PROJECT SCIENTIFIC COORDINATOR TITLE OF THE PROJECT (max 90 characters) TOTAL BUDGET OF THE PROJECT FUNDING REQUIRED TO

Dettagli

Prodotto Isi Web Knowledge

Prodotto Isi Web Knowledge Guida pratica all uso di: Web of Science Prodotto Isi Web Knowledge acura di Liana Taverniti Biblioteca ISG INMP INMP I prodotti ISI Web of Knowledge sono basi di dati di alta qualità di ricerca alle quali

Dettagli

Pila.h versione 6. class Pila { private: int marker; int * contenuto; public:

Pila.h versione 6. class Pila { private: int marker; int * contenuto; public: 1 Pila.h versione 6 struct Pila { private: int size; int defaultgrowthsize; int marker; int * contenuto; void cresci(int increment); public: Pila(int initialsize) ; Pila(); ~Pila() ; void copy(pila * to)

Dettagli

Domini nelle Proteine

Domini nelle Proteine Struttura secondaria, Motivi e Domini nelle Proteine Proprietà generali Le forme ioniche degli aminoacidi, senza considerare alcuna ionizzazione delle catene laterali. Proprietà generali Tutti gli aminoacidi

Dettagli

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office Gestione delle Architetture e dei Servizi IT con ADOit Un Prodotto della Suite BOC Management Office Controllo Globale e Permanente delle Architetture IT Aziendali e dei Processi IT: IT-Governance Definire

Dettagli

Mod. VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES

Mod. VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES Mod VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES Mod VS/AM 65 1 2 VS/AM 65 STANDARD VS/AM 65 CON RACCORDI VS/AM 65

Dettagli

8. L'USO DEL PROGRAMMA DI POSTA ELETTRONICA INSIEME ALLA GESTIONE PROFESSIONALE DI DOCUMENTI IN FORMATO E-MAIL

8. L'USO DEL PROGRAMMA DI POSTA ELETTRONICA INSIEME ALLA GESTIONE PROFESSIONALE DI DOCUMENTI IN FORMATO E-MAIL This project funded by Leonardo da Vinci has been carried out with the support of the European Community. The content of this project does not necessarily reflect the position of the European Community

Dettagli

Introduzione ad Access

Introduzione ad Access Introduzione ad Access Luca Bortolussi Dipartimento di Matematica e Informatica Università degli studi di Trieste Access E un programma di gestione di database (DBMS) Access offre: un supporto transazionale

Dettagli

MODBUS-RTU per. Specifiche protocollo di comunicazione MODBUS-RTU per controllo in rete dispositivi serie. Expert NANO 2ZN

MODBUS-RTU per. Specifiche protocollo di comunicazione MODBUS-RTU per controllo in rete dispositivi serie. Expert NANO 2ZN per Expert NANO 2ZN Specifiche protocollo di comunicazione MODBUS-RTU per controllo in rete dispositivi serie Expert NANO 2ZN Nome documento: MODBUS-RTU_NANO_2ZN_01-12_ITA Software installato: NANO_2ZN.hex

Dettagli

Dati importati/esportati

Dati importati/esportati Dati importati/esportati Dati importati Al workspace MATLAB script Dati esportati file 1 File di testo (.txt) Spreadsheet Database Altro Elaborazione dati Grafici File di testo Relazioni Codice Database

Dettagli

Estensione di un servizo di messaggistica per telefonia mobile (per una società di agenti TuCSoN)

Estensione di un servizo di messaggistica per telefonia mobile (per una società di agenti TuCSoN) Estensione di un servizo di messaggistica per telefonia mobile (per una società di agenti TuCSoN) System Overview di Mattia Bargellini 1 CAPITOLO 1 1.1 Introduzione Il seguente progetto intende estendere

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

Import Dati Release 4.0

Import Dati Release 4.0 Piattaforma Applicativa Gestionale Import Dati Release 4.0 COPYRIGHT 2000-2005 by ZUCCHETTI S.p.A. Tutti i diritti sono riservati.questa pubblicazione contiene informazioni protette da copyright. Nessuna

Dettagli

DNS (Domain Name System) Gruppo Linux

DNS (Domain Name System) Gruppo Linux DNS (Domain Name System) Gruppo Linux Luca Sozio Matteo Giordano Vincenzo Sgaramella Enrico Palmerini DNS (Domain Name System) Ci sono due modi per identificare un host nella rete: - Attraverso un hostname

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Informazioni su questo libro

Informazioni su questo libro Informazioni su questo libro Si tratta della copia digitale di un libro che per generazioni è stato conservata negli scaffali di una biblioteca prima di essere digitalizzato da Google nell ambito del progetto

Dettagli

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07.

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07. Istruzione N 62 Data creazione 18/ 12/2009 Versione N 00 Ultima modifica TIPO ISTRUZIONE ASSEMBLAGGIO COLLAUDO TRAINING MODIFICA TEST FUNZIONALE RIPARAZIONE/SOSTITUZIONE IMBALLO TITOLO DELL ISTRUZIONE

Dettagli

Come scrivere un articolo scientifico La bibliografia: citare da Internet

Come scrivere un articolo scientifico La bibliografia: citare da Internet scrivere in medicina Come scrivere un articolo scientifico La bibliografia: citare da Internet L emergere di Internet come fonte preziosa di informazioni, ha reso necessaria la definizione di alcune regole

Dettagli

Il business risk reporting: lo. gestione continua dei rischi

Il business risk reporting: lo. gestione continua dei rischi 18 ottobre 2012 Il business risk reporting: lo strumento essenziale per la gestione continua dei rischi Stefano Oddone, EPM Sales Consulting Senior Manager di Oracle 1 AGENDA L importanza di misurare Business

Dettagli

Modulo. Programmiamo in Pascal. Unità didattiche COSA IMPAREREMO...

Modulo. Programmiamo in Pascal. Unità didattiche COSA IMPAREREMO... Modulo A Programmiamo in Pascal Unità didattiche 1. Installiamo il Dev-Pascal 2. Il programma e le variabili 3. Input dei dati 4. Utilizziamo gli operatori matematici e commentiamo il codice COSA IMPAREREMO...

Dettagli

Indicizzazione terza parte e modello booleano

Indicizzazione terza parte e modello booleano Reperimento dell informazione (IR) - aa 2014-2015 Indicizzazione terza parte e modello booleano Gruppo di ricerca su Sistemi di Gestione delle Informazioni (IMS) Dipartimento di Ingegneria dell Informazione

Dettagli

EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi

EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi ENDNOTE WEB EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi EndNote Web consente di: importare informazioni

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009

Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009 Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009 Introduzione generale Autenticazione dell operatore https://sebina1.unife.it/sebinatest Al primo accesso ai servizi di Back Office, utilizzando

Dettagli

Smobilizzo pro-soluto di Lettere di Credito Import

Smobilizzo pro-soluto di Lettere di Credito Import definizione L operazione presuppone l emissione di una lettera di credito IMPORT in favore dell esportatore estero, con termine di pagamento differito (es. 180 gg dalla data di spedizione con documenti

Dettagli

24 TIRANTI - PULL STUDS - ANZUGSBOLZEN - TIRETTES

24 TIRANTI - PULL STUDS - ANZUGSBOLZEN - TIRETTES Pag. 339 DIN 69872 340 ISO 7388/2 A 341 ISO 7388/2 B 342 CAT - METRIC 343 MAS 403 BT 344 JS - B 6339 345 347 OTT - HURCO MITSUI - KITAMURA C.B. FERRARI CHIRON - CINCINNATI etc. etc. 348 CHIAVE DINAMOMETRICA

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

I.Stat Guida utente Versione 1.7 Dicembre 2010

I.Stat Guida utente Versione 1.7 Dicembre 2010 I.Stat Guida utente Versione 1.7 Dicembre 2010 1 Sommario INTRODUZIONE 3 I concetti principali di I.Stat 4 Organizzazione dei dati 4 Ricerca 5 GUIDA UTENTE 6 Per iniziare 6 Selezione della lingua 7 Individuazione

Dettagli

DBMS (Data Base Management System)

DBMS (Data Base Management System) Cos'è un Database I database o banche dati o base dati sono collezioni di dati, tra loro correlati, utilizzati per rappresentare una porzione del mondo reale. Sono strutturati in modo tale da consentire

Dettagli

Primi passi con ChemGes

Primi passi con ChemGes Descrizione Primi passi con ChemGes DR Software Version 40.0 Sommario Introduzione... 1 Start del programma... 1 Ricercare e visualizzare delle sostanze... 1 Immissione di materie prime... 4 Immissione

Dettagli

INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam.

INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam. Laurea in INFORMATICA INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 Dynamic Host Configuration Protocol fausto.marcantoni@unicam.it Prima di iniziare... Gli indirizzi IP privati possono essere

Dettagli

Traduzione di TeamLab in altre lingue

Traduzione di TeamLab in altre lingue Lingue disponibili TeamLab è disponibile nelle seguenti lingue nel mese di gennaio 2012: Traduzioni complete Lingue tradotte parzialmente Inglese Tedesco Francese Spagnolo Russo Lettone Italiano Cinese

Dettagli

Lezione n 1! Introduzione"

Lezione n 1! Introduzione Lezione n 1! Introduzione" Corso sui linguaggi del web" Fondamentali del web" Fondamentali di una gestione FTP" Nomenclatura di base del linguaggio del web" Come funziona la rete internet?" Connessione"

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Programmazione Funzionale

Programmazione Funzionale Programmazione Funzionale LP imperativi: apparenza simile modello di progettazione = macchina fisica Famiglia dei LP imperativi = progressivo miglioramento del FORTRAN Obiezione: pesante aderenza dei LP

Dettagli

ENERGY-EFFICIENT HOME VENTILATION SYSTEMS

ENERGY-EFFICIENT HOME VENTILATION SYSTEMS SISTEMI DI RECUPERO RESIDENZIALE HOME RECOVERY SYSTEMS RECUPERO DI CALORE AD ALTA EFFICIENZA HIGH EFFICIENCY HEAT RECOVERY VENTILAZIONE A BASSO CONSUMO LOW ENERGY VENTILATION SISTEMI DI RICAMBIO CONTROLLATO

Dettagli

Descrizione tecnica Indice

Descrizione tecnica Indice Descrizione tecnica Indice 1. Vantaggi del sistema Vertical Booking... 2 2. SISTEMA DI PRENOTAZIONE ON LINE... 3 2.1. Caratteristiche... 3 I EXTRANET (Interfaccia per la gestione del programma)... 3 II

Dettagli

Analisi dei requisiti e casi d uso

Analisi dei requisiti e casi d uso Analisi dei requisiti e casi d uso Indice 1 Introduzione 2 1.1 Terminologia........................... 2 2 Modello del sistema 4 2.1 Requisiti hardware........................ 4 2.2 Requisiti software.........................

Dettagli

Ambienti di sviluppo integrato

Ambienti di sviluppo integrato Ambienti di sviluppo integrato Un ambiente di sviluppo integrato (IDE - Integrated Development Environment) è un ambiente software che assiste i programmatori nello sviluppo di programmi Esso è normalmente

Dettagli

TIRANTI - PULL STUDS ANZUGSBOLZEN - TIRETTES

TIRANTI - PULL STUDS ANZUGSBOLZEN - TIRETTES INDICE INDEX INHALT SOMMAIRE 24 TIRANTI - PULL STUDS ANZUGSBOLZEN - TIRETTES DIN 69872 2 ISO 7388/2A 3 ISO 7388/2B 4 OTT System - DIN 69871 5 CAT METRIC 6 MAS 403 BT 7 8 JS-B 6339 9 OTT System - MAS 403

Dettagli

Sistemi avanzati di gestione dei Sistemi Informativi

Sistemi avanzati di gestione dei Sistemi Informativi Esperti nella gestione dei sistemi informativi e tecnologie informatiche Sistemi avanzati di gestione dei Sistemi Informativi Docente: Email: Sito: Eduard Roccatello eduard@roccatello.it http://www.roccatello.it/teaching/gsi/

Dettagli

Data warehouse.stat Guida utente

Data warehouse.stat Guida utente Data warehouse.stat Guida utente Versione 3.0 Giugno 2013 1 Sommario INTRODUZIONE 3 I concetti principali 4 Organizzazione dei dati 4 Ricerca 5 Il browser 5 GUIDA UTENTE 6 Per iniziare 6 Selezione della

Dettagli

EndNote Web. Quick Reference Card THOMSON SCIENTIFIC

EndNote Web. Quick Reference Card THOMSON SCIENTIFIC THOMSON SCIENTIFIC EndNote Web Quick Reference Card Web è un servizio online ideato per aiutare studenti e ricercatori nel processo di scrittura di un documento di ricerca. ISI Web of Knowledge, EndNote

Dettagli

group HIGH CURRENT MULTIPLEX NODE

group HIGH CURRENT MULTIPLEX NODE HIGH CURRENT MULTIPLEX NODE edizione/edition 04-2010 HIGH CURRENT MULTIPLEX NODE DESCRIZIONE GENERALE GENERAL DESCRIPTION L'unità di controllo COBO è una centralina elettronica Multiplex Slave ; la sua

Dettagli

IT-BOOK. Domini Hosting Web marketing E-mail e PEC

IT-BOOK. Domini Hosting Web marketing E-mail e PEC 5 giugno 09 IT-BOOK Configurazioni e cartatteristiche tecniche possono essere soggette a variazioni senza preavviso. Tutti i marchi citati sono registrati dai rispettivi proprietari. Non gettare per terra:

Dettagli

LA TECHNOLOGY TRANSFER PRESENTA SUZANNE ROBERTSON MASTERING THE REQUIREMENTS PROCESS COME COSTRUIRE IL SISTEMA CHE IL VOSTRO UTENTE DESIDERA

LA TECHNOLOGY TRANSFER PRESENTA SUZANNE ROBERTSON MASTERING THE REQUIREMENTS PROCESS COME COSTRUIRE IL SISTEMA CHE IL VOSTRO UTENTE DESIDERA LA TECHNOLOGY TRANSFER PRESENTA SUZANNE ROBERTSON MASTERING THE REQUIREMENTS PROCESS COME COSTRUIRE IL SISTEMA CHE IL VOSTRO UTENTE DESIDERA ROMA 20-22 OTTOBRE 2014 RESIDENZA DI RIPETTA - VIA DI RIPETTA,

Dettagli

LABORATORIO di RICERCA BIBLIOGRAFICA SUI TEST

LABORATORIO di RICERCA BIBLIOGRAFICA SUI TEST LABORATORIO di RICERCA BIBLIOGRAFICA SUI TEST emanuela.canepa@unipd.it Biblioteca di psicologia Fabio Metelli Università degli Studi di Padova Materiale didattico: guida corso Casella della biblioteca

Dettagli

Teoria della misurazione e misurabilità di grandezze non fisiche

Teoria della misurazione e misurabilità di grandezze non fisiche Teoria della misurazione e misurabilità di grandezze non fisiche Versione 12.6.05 Teoria della misurazione e misurabilità di grandezze non fisiche 1 Il contesto del discorso (dalla lezione introduttiva)

Dettagli

Routing (instradamento) in Internet. Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi:

Routing (instradamento) in Internet. Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi: Routing (instradamento) in Internet Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi: Stub AS: istituzione piccola Multihomed AS: grande istituzione (nessun ( transito Transit AS: provider

Dettagli

Algebra Relazionale. algebra relazionale

Algebra Relazionale. algebra relazionale Algebra Relazionale algebra relazionale Linguaggi di Interrogazione linguaggi formali Algebra relazionale Calcolo relazionale Programmazione logica linguaggi programmativi SQL: Structured Query Language

Dettagli

[HOSTING] Shared (S) Entry (S) Professional (S) VPS (S) [CF] Cold Fusion9 9,00 39,00 79,00

[HOSTING] Shared (S) Entry (S) Professional (S) VPS (S) [CF] Cold Fusion9 9,00 39,00 79,00 [HOSTING] Shared (S) Entry (S) Professional (S) VPS (S) [CF] Cold Fusion9 9,00 39,00 79,00 [CF] Domain & Space - Dominio di 2 Liv. (.IT,.COM) 1 1 1 - Dominio di 3 Liv. (mapping IIS/Apache) 1 10 100 - Disk

Dettagli

Test di comunicazione tra due LOGO! 0BA7: Master - Master

Test di comunicazione tra due LOGO! 0BA7: Master - Master Industry Test di comunicazione tra due LOGO! 0BA7: Master - Master Dispositivi utilizzati: - 2 LOGO! 0BA7 (6ED1 052-1MD00-0AB7) - Scalance X-208 LOGO! 0BA7 Client IP: 192.168.0.1 LOGO! 0BA7 Server IP:

Dettagli

Configuration Management

Configuration Management Configuration Management Obiettivi Obiettivo del Configuration Management è di fornire un modello logico dell infrastruttura informatica identificando, controllando, mantenendo e verificando le versioni

Dettagli

Calc è il programma per la gestione di fogli di calcolo della suite OpenOffice.org.

Calc è il programma per la gestione di fogli di calcolo della suite OpenOffice.org. Calc è il programma per la gestione di fogli di calcolo della suite OpenOffice.org. Nuovo documento Anteprima di stampa Annulla Galleria Apri Controllo ortografico Ripristina Sorgente dati Salva Controllo

Dettagli

Il test valuta la capacità di pensare?

Il test valuta la capacità di pensare? Il test valuta la capacità di pensare? Per favore compili il seguente questionario senza farsi aiutare da altri. Cognome e Nome Data di Nascita / / Quanti anni scolastici ha frequentato? Maschio Femmina

Dettagli

Esercitazione su SQL

Esercitazione su SQL Esercizio 1. Esercitazione su SQL Si consideri la base di dati relazionale composta dalle seguenti relazioni: impiegato Matricola Cognome Stipendio Dipartimento 101 Sili 60 NO 102 Rossi 40 NO 103 Neri

Dettagli

Ricerca non informata in uno spazio di stati

Ricerca non informata in uno spazio di stati Università di Bergamo Facoltà di Ingegneria Intelligenza Artificiale Paolo Salvaneschi A5_2 V2.4 Ricerca non informata in uno spazio di stati Il contenuto del documento è liberamente utilizzabile dagli

Dettagli

24V DC ±10% 0.5... 1 W. Fluido Fluid. 15 Nl/min

24V DC ±10% 0.5... 1 W. Fluido Fluid. 15 Nl/min elettropiloti 0 mm 0 mm solenoids Elettropilota Solenoid valve 0 mm 00.44.0 ACCESSORI - ACCESSORIES 07.049.0 Connettore per elettropilota 0 mm con cavetto rosso/nero, lunghezza 400 mm - connector for 0

Dettagli

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine VITAMINA D: SINTESI, METABOLISMO E CARENZA Il 40-50% della

Dettagli

Software Emeris Communication Manager

Software Emeris Communication Manager ecm Software Emeris Communication Manager Manuale operativo Fantini Cosmi S.p.A. Via dell Osio 6 20090 Caleppio di Settala MI Tel 02.956821 - Fax 02.95307006 e-mail: info@fantinicosmi.it http://www.fantinicosmi.it

Dettagli

Sistemi Operativi. Interfaccia del File System FILE SYSTEM : INTERFACCIA. Concetto di File. Metodi di Accesso. Struttura delle Directory

Sistemi Operativi. Interfaccia del File System FILE SYSTEM : INTERFACCIA. Concetto di File. Metodi di Accesso. Struttura delle Directory FILE SYSTEM : INTERFACCIA 8.1 Interfaccia del File System Concetto di File Metodi di Accesso Struttura delle Directory Montaggio del File System Condivisione di File Protezione 8.2 Concetto di File File

Dettagli

Narrare i gruppi. Rivista semestrale pubblicata on-line dal 2006 Indirizzo web: www.narrareigruppi.it - Direttore responsabile: Giuseppe Licari

Narrare i gruppi. Rivista semestrale pubblicata on-line dal 2006 Indirizzo web: www.narrareigruppi.it - Direttore responsabile: Giuseppe Licari Narrare i gruppi Etnografia dell interazione quotidiana Prospettive cliniche e sociali ISSN: 2281-8960 Narrare i gruppi. Etnografia dell'interazione quotidiana. Prospettive cliniche e sociali è una Rivista

Dettagli

Lavoro Occasionale Accessorio. Manuale Utente Internet

Lavoro Occasionale Accessorio. Manuale Utente Internet Lavoro Occasionale Accessorio Internet 1. Introduzione... 3 1.1 Obiettivo del documento... 3 1.2 Normativa... 3 1.3 Attori del Processo... 4 1.4 Accesso Internet... 5 1.4.1 Accesso Internet da Informazioni...

Dettagli

Come recuperare il Citation Index di un articolo o di un autore: breve guida

Come recuperare il Citation Index di un articolo o di un autore: breve guida Come recuperare il Citation Index di un articolo o di un autore: breve guida A cura del Gruppo Informazione e comunicazione della Biblioteca Biomedica Redazione: Tessa Piazzini Premessa: Solitamente parlando

Dettagli

Basi di Dati. S Q L Lezione 5

Basi di Dati. S Q L Lezione 5 Basi di Dati S Q L Lezione 5 Antonio Virdis a.virdis@iet.unipi.it Sommario Gestione eventi Gestione dei privilegi Query Complesse 2 Esercizio 9 (lezione 4) Indicare nome e cognome, spesa e reddito annuali

Dettagli

Metabolismo dell azoto

Metabolismo dell azoto rof. Giorgio Sartor Metabolismo dell azoto Copyright 2001-2012 by Giorgio Sartor. All rights reserved. Versione 1.4.2 may 2012 AD i RTEIE LISACCARIDI LIIDI AD i Aminoacidi Esosi; entosi Ac. Grassi; Glicerolo

Dettagli

Condivisione delle risorse e Document Delivery Internazionale: Principi e linee guida per le procedure.

Condivisione delle risorse e Document Delivery Internazionale: Principi e linee guida per le procedure. Condivisione delle risorse e Document Delivery Internazionale: Principi e linee guida per le procedure. TRADUZIONE A CURA DI ASSUNTA ARTE E ROCCO CAIVANO Prima versione dell IFLA 1954 Revisioni principali

Dettagli

INSTALLAZIONE E UTILIZZO DEL COMPILATORE Code::Blocks 8.02

INSTALLAZIONE E UTILIZZO DEL COMPILATORE Code::Blocks 8.02 INSTALLAZIONE E UTILIZZO DEL COMPILATORE Code::Blocks 8.02 Download Si può scaricare gratuitamente la versione per il proprio sistema operativo (Windows, MacOS, Linux) dal sito: http://www.codeblocks.org

Dettagli

Studente: SANTORO MC. Matricola : 528

Studente: SANTORO MC. Matricola : 528 CORSO di LAUREA in INFORMATICA Corso di CALCOLO NUMERICO a.a. 2004-05 Studente: SANTORO MC. Matricola : 528 PROGETTO PER L ESAME 1. Sviluppare una versione dell algoritmo di Gauss per sistemi con matrice

Dettagli

PerformAzioni International Workshop Festival 22nd February 3rd May 2013 LIV Performing Arts Centre Bologna, Italy APPLICATION FORM AND BANK DETAILS

PerformAzioni International Workshop Festival 22nd February 3rd May 2013 LIV Performing Arts Centre Bologna, Italy APPLICATION FORM AND BANK DETAILS PerformAzioni International Workshop Festival 22nd February 3rd May 2013 LIV Performing Arts Centre Bologna, Italy APPLICATION FORM AND BANK DETAILS La domanda di partecipazione deve essere compilata e

Dettagli

1. Che cos è. 2. A che cosa serve

1. Che cos è. 2. A che cosa serve 1. Che cos è Il Supplemento al diploma è una certificazione integrativa del titolo ufficiale conseguito al termine di un corso di studi in una università o in un istituto di istruzione superiore corrisponde

Dettagli

Cos'é Code::Blocks? Come Creare un progetto Come eseguire un programma Risoluzione problemi istallazione Code::Blocks Che cos è il Debug e come si usa

Cos'é Code::Blocks? Come Creare un progetto Come eseguire un programma Risoluzione problemi istallazione Code::Blocks Che cos è il Debug e come si usa di Ilaria Lorenzo e Alessandra Palma Cos'é Code::Blocks? Come Creare un progetto Come eseguire un programma Risoluzione problemi istallazione Code::Blocks Che cos è il Debug e come si usa Code::Blocks

Dettagli

PRESENTAZIONE DI UN SMS AL GATEWAY

PRESENTAZIONE DI UN SMS AL GATEWAY Interfaccia Full Ascii Con questa interfaccia è possibile inviare i dati al Server utilizzando solo caratteri Ascii rappresentabili e solo i valori che cambiano tra un sms e l altro, mantenendo la connessione

Dettagli

Modulo 2 - Appendice 3 L'editor vi e cenni su sed

Modulo 2 - Appendice 3 L'editor vi e cenni su sed 1 Modulo 2 - Appendice 3 L'editor vi e cenni su sed Laboratorio di Sistemi Operativi I Anno Accademico 2008-2009 Copyright 2005-2007 Francesco Pedullà, Massimo Verola Copyright 2001-2005 Renzo Davoli,

Dettagli

CALDO SGUARDO GRECO PDF

CALDO SGUARDO GRECO PDF CALDO SGUARDO GRECO PDF ==> Download: CALDO SGUARDO GRECO PDF CALDO SGUARDO GRECO PDF - Are you searching for Caldo Sguardo Greco Books? Now, you will be happy that at this time Caldo Sguardo Greco PDF

Dettagli

Presentazioni multimediali relative al senso del tatto DIMENSIONI LIVELLO INIZIALE LIVELLO INTERMEDIO LIVELLO AVANZATO

Presentazioni multimediali relative al senso del tatto DIMENSIONI LIVELLO INIZIALE LIVELLO INTERMEDIO LIVELLO AVANZATO PERCORSO DI INSEGNAMENTO/APPRENDIMENTO TIPO DI UdP: SEMPLICE (monodisciplinare) ARTICOLATO (pluridisciplinare) Progetto didattico N. 1 Titolo : Let s investigate the world with our touch! Durata: Annuale

Dettagli