Banche Dati: NCBI e BLAST. Progettazione primer per PCR mediante software on line: Primer3

Transcript

1 Banche Dati: NCBI e BLAST Progettazione primer per PCR mediante software on line: Primer3

2 Sorgenti di informazione Le banche dati di interesse biologico Le banche dati di sequenze nucleotidiche e proteiche L analisi delle sequenze Applicazioni I software per l analisi delle sequenze e il disegno di primer

3 Che cos è una banca dati biologica Una banca dati biologica (biological database) è un insieme organizzato di molti dati in formato elettronico associati a software specifici disegnati per permettere l aggiornamento, l interrogazione e il recupero dei dati immagazzinati nel sistema. Caratteristiche: - semplicità di accesso alle informazioni - metodo per estrarre solo le informazioni che rispondono ad un particolare quesito biologico

4 Che cos è la Bioinformatica La Bioinformatica può essere definita come una disciplina scientifica che fa uso delle tecnologie informatiche per organizzare, analizzare e rendere disponibili informazioni biologiche al fine di chiarire i problemi della biologia. Unisce le competenze nei campi dell informatica, delle tecnologie dell informazione e della biologia. Obiettivo E quello di permettere la scoperta di nuovi meccanismi biologici e di creare una visione globale e distinta dei processi biologici stessi.

5 Le banche dati di interesse biologico Elenco aggiornato di banche dati Molecular Biology Database Collection The BioToolKit

6 Classificazione delle banche dati Major Public Sequence Repositories Comparative Genomics Gene Expression Gene Identification and Structure Genetic and Physical Maps Genomic Databases Intermolecular Interactions Metabolic Pathways and Cellular Regulation Mutation Databases Pathology Protein Databases Protein Sequence Motifs Proteome Resources Retrieval Systems and Database Structure RNA Sequences Structure Transgenics Varied Biomedical Content

7 DNA sequence databases EMBL Nucleotide Sequence Database (European Molecular Biology Laboratory) GenBank DNA Data Bank of Japan (DDBJ)

8 Una sequenza nucleotidica... ACGGTGCCAGTGCATTGGACCACATGCGA... Una sequenza aminoacidica... TACYRSLIPPAADDNCAILQEVWMFHHT...

9 Nucleotide base codes (IUPAC) Code Base Description G Guanine A Adenine T Thymine in DNA (Uracil in RNA) C Cytosine R Purine (A or G) Y Pyrimidine (C or T or U) M Amino (A or C) K Ketone (G or T) S Strong interaction (C or G) W Weak interaction (A or T) H Not-G (A or C or T) H follows G in the alphabet B Not-A (C or G or T) B follows A V Not-T (not-u) (A or C or G) V follows U D Not-C (A or G or T) D follows C N Any (A or C or G or T) Authority Nomenclature Committee of the International Union of Biochemistry Reference Cornish-Bowden, A. Nucleic Acids Res. 13, (1985)

10 Amino acid abbreviations and codes Abbreviation Code Description Ala A Alanine Arg R Arginine Asn N Asparagine Asp D Aspartic acid (Aspartate) Cys C Cysteine Gln Q Glutamine Glu E Glutamic acid (Glutamate) Gly G Glycine His H Histidine Ile I Isoleucine Leu L Leucine Lys K Lysine Met M Methionine Phe F Phenylalanine Pro P Proline Ser S Serine Thr T Threonine Authority Trp W Tryptophan Reference Tyr Y Tyrosine Val V Valine IUPAC-IUB Joint Commission on Biochemical Nomenclature. IUPAC-IUB Joint Commission on Biochemical Nomenclature. Nomenclature and Symbolism for Amino Acids and Peptides. Eur. J. Biochem. 138: 9-37 (1984).

11

12

13 EMBL Divisions Division Code ESTs EST Bacteriophage PHG Fungi FUN Genome survey GSS High Throughput cdna HTC High Throughput Genome HTG Human HUM Invertebrates INV Mus musculus MUS Organelles ORG Other Mammals MAM Other Vertebrates VRT Plants PLN Prokaryotes PRO Rodents ROD STSs STS Synthetic SYN Unclassified UNC Viruses VRL

14 20 March 2002

15 GenBank Incorpora, organizza e distribuisce tutte le sequenze nucleotidiche disponibili pubblicamente. Localizzata e mantenuta presso il National Center for Biotechnology Information (NCBI), una divisione della National Library of Medicine (NLM), con sede presso il campus dell National Institutes of Health (NIH) a Bethesda, Mariland, USA. Collabora con EMBL e DDBJ con cui scambia dati giornalmente. Ricercatori, Genome Project Groups, US Office of Patents and Trademarks (USPTO) forniscono dati di sequenza. Immissione dei dati (submission): BankIt (web-based submission system) e procedure automatiche (large scale genome sequencing centers, fa2htgs). Accesso: gratuito via FTP, e WWW. Database release: bimestrale.

16 La sequenza in formato FASTA >embl:ssc AJ Sus scrofa partial ctsb gene for cathepsin B, exons 6-7, allele 1 aaagaagggcctggtgtccgggggcctctatgactcgcatgtgggtaagtggccgggtgg gttttataagcaggaagtgacactggtcattttcccctacaaagtggaggtgaagggttg tgggcgggaaggctgggctacacggtgcagcagcccggctacggcagaattagcagcacc aggaggaggcgtcagcgccacagacttgaggggaacttgccccttagctgggcccaattc ttctctctggcctggagggacctctgaggggcttgctgccgacactccccctttctccgg gccccccaggttgcaggccc Formati di sequenze 1. IG/Stanford 2. GenBank/GB 3. NBRF-PIR 4. EMBL/SWISS 5. GCG 6. DNAStrider 7. Fitch 8. Pearson/Fasta 9. Zuker 10. Olsen 11. Phylip Phylip 13. Plain/Raw (ASCII) 14. PIR-CODATA 15. GCG MSF 16. ASN PAUP/NEXUS 18. Pretty

17 La sequenza AJ in formato GenBank LOCUS SSC bp DNA linear MAM 03-JUN-2002 DEFINITION Sus scrofa partial ctsb gene for cathepsin B, exons 6-7, allele 1. ACCESSION AJ VERSION AJ GI: KEYWORDS cathepsin B; ctsb gene. SOURCE pig. ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Cetartiodactyla; Suina; Suidae; Sus. REFERENCE 1 AUTHORS Russo,V., Fontanesi,L., Davoli,R., Nanni Costa,L., Cagnazzo,M., Buttazzoni,L., Virgili,R. and Yerle,M. TITLE Investigation of candidate genes for meat quality in dry-cured ham production: the porcine cathepsin B (CTSB) and cystatin B (CSTB) genes JOURNAL Anim. Genet. 33 (2), (2002) PUBMED REFERENCE 2 (bases 1 to 320) AUTHORS Fontanesi,L. TITLE Direct Submission JOURNAL Submitted (30-MAY-2001) Fontanesi L., DIPROVAL, Sez Allevamenti Zootecnici, University of Bologna, Via F.lli Rosselli 107, Reggio Emilia, 42100, ITALY COMMENT PCR primer used to amplify the sequence Forward 5'-CTGGAGCCTGGAACTTCTGGAC-3' Reverse 5'-GCTCACAGGGAGGGATGGAGTA-3. Continua

18 FEATURES Location/Qualifiers source /organism="sus scrofa" /db_xref="taxon:9823" /chromosome="14" gene /gene="ctsb" CDS join(<1..44,309..>320) /gene="ctsb" /note="allele 1" /codon_start=2 /product="cathepsin B" /protein_id="cac " /db_xref="gi: " /db_xref="sptrembl:q95j72" /translation="kkglvsgglydshvglqa" exon <1..44 /gene="ctsb" /number=6 intron /gene="ctsb" /number=6 exon 309..>320 /gene="ctsb" /number=7 BASE COUNT 59 a 87 c 110 g 64 t ORIGIN 1 aaagaagggc ctggtgtccg ggggcctcta tgactcgcat gtgggtaagt ggccgggtgg 61 gttttataag caggaagtga cactggtcat tttcccctac aaagtggagg tgaagggttg 121 tgggcgggaa ggctgggcta cacggtgcag cagcccggct acggcagaat tagcagcacc 181 aggaggaggc gtcagcgcca cagacttgag gggaacttgc cccttagctg ggcccaattc 241 ttctctctgg cctggaggga cctctgaggg gcttgctgcc gacactcccc ctttctccgg 301 gccccccagg ttgcaggccc //

19 Protein Databases SWISS-PROT Database Protein Information Resource

20 ENTRY S20421 #type complete iproclass View of S20421 TITLE stefin B bovine ORGANISM #formal_name Bos primigenius taurus #common_name cattle #cross-references taxon:9913 DATE 22-Nov-1993 #sequence_revision 05-May-1995 #text_change 16-Jul-1999 ACCESSIONS S20421; S23958 REFERENCE S20421 #authors Krizaj, I.; Turk, B.; Turk, V. #journal FEBS Lett. (1992) 298: #title The complete primary structure of bovine stefin B. #cross-references MUID: ; PMID: #accession S20421 ##molecule_type protein ##residues 1-98 ##label KRI REFERENCE S23958 #authors Turk, B.; Krizaj, I.; Turk, V. #journal Biol. Chem. Hoppe-Seyler (1992) 373: #title Isolation and characterization of bovine stefin B. #cross-references MUID: ; PMID: #contents annotation CLASSIFICATION SF #superfamily cystatin; cystatin homology KEYWORDS acetylated amino end; cysteine proteinase inhibitor FEATURE 2-98 #domain cystatin homology #label CYS\ 1 #modified_site acetylated amino end (Met) #status experimental SUMMARY #length 98 #molecular_weight SEQUENCE M M C G G T S A T Q P A T A E T Q A I A D K V K S Q L E E K 31 E N K K F P V F K A L E F K S Q L V A G K N Y F I K V Q V D 61 E D D F V H I R V F E S L P H E N K P V A L T S Y Q T N K G 91 R H D E L T Y F

21 Analisi delle sequenze Sequence similarity searching tools BLAST FASTA Genomic sequence analysis tools Exon prediction programs RepeatMasker Restriction analysis tools Webcutter NEBcutter Rebase

22 Introduzione: Similarity analysis Una sequenza di per se non è informativa: deve essere analizzata utilizzando metodi comparativi contro banche dati per poter avanzare ipotesi sulla funzione, classe, ecc Identity: la misura in cui 2 sequenze (nucleotidiche o aminoacidiche) sono uguali. Similarity: la misura in cui 2 sequenze (nucleotidiche o aminoacidiche) hanno qualcosa in comune. Si esprime in percentuale di identità di sequenza (percent sequence identity). Homology: Similarity attribuita alla discendenza da un antenato comune (si deduce dalla misura di similarità della struttura, della funzione, della sequenza). L approccio generale dell analisi prevede l utilizzo di una serie di algoritmi per confrontare una sequenza (query sequence) con tutte le sequenze presenti in una particolare banca dati. Continua

23 Ad ogni confronto viene assegnato un punteggio (score) che riflette il grado di similarità (degree of similarity) fra la query sequence e le sequenze confrontate. La similarity viene misurata e mostrata graficamente per mezzo di allineamenti tra due sequenze (la query sequence e una della banca dati). Gli allineamenti possono essere globali (global) o locali (local). Un allineamento globale è un allineamento ottimale (optimal alignment) che include tutti i caratteri di ciascuna sequenza. Un allineamento locale è un allineamento ottimale che include solo la regione o le regioni più simili. Optimal alignment: un allineamento di due sequenze con lo score più alto possibile. Per discriminare fra match reali o artefatti viene utilizzata la probabilità (probability) che il match avvenga per caso.

24 Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) "Basic local alignment search tool. J. Mol. Biol. 215: Basic Local Alignment Search Tools I programmi BLAST sono costituiti da una serie di algoritmi di confronto fra sequenze e sono utilizzati per identificare optimal local alignments tra una query sequence ed una banca dati di sequenze. BLAST mantiene sia una buona velocità di analisi che una buona sensibilità (caratteristiche importanti con la crescita esponenziale delle banche dati). BLAST frammenta la query sequence e le sequenze nella banca dati in frammenti ( Words ) cercando inizialmente match fra i frammenti. La ricerca iniziale è effettuata per Word di lunghezza W che danno uno score di almeno T quando confrontate con la query sequence usando una particolare matrice di sostituzione (substitution matrix). Questi match vengono estesi da entrambe le direzioni nel tentativo di generare un allineamento con uno score che supera la soglia S. Il parametro T regola la velocità e la sensibilità della ricerca. Continua

25 La qualità di ciascun allineamento è rappresentata da uno score e gli score sono ordinati dal più alto al più basso (ranked) Matrici di punteggio (scoring matrices) sono usate per calcolare di un allineamento base per base (DNA) o aminoacido per aminoacido (proteine). Una matrice unitaria (unitary matrix) è utilizzata per il DNA perché ciascuna posizione può assumere uno score di +1 se crea un match oppure uno score di 0 se non produce un match. Continua

26 Gaps: posizioni in cui una lettera è appaiata ad uno spazio vuoto sono indicate come gaps. I punteggi per i gap sono negativi. La significatività di ciascun allineamento è calcolata come P value (la probabilità di un allineamento di avere uno score come quello in esame o migliore) oppure come E value (Expectation value: il numero di differenti allineamenti con score equivalenti o migliori di S che ci si può aspettare di osservare in una ricerca in una banca dati per caso). Più bassi sono più significativi sono gli score. Ogni allineamento, tuttavia deve essere valutato criticamente prima di essere accettato. Ad esempio, allineamenti originati da una serie di sequenze ripetute possono ottenere alti score ma non riflettere similarità fra le due sequenze. Filtri che mascherano low complexity regions possono essere utilizzati per alleviare questi problemi. Es.: SEG program

27 BLAST Programs BLAST 2.0 (Gapped BLAST) blastn: confronta una sequenza nucleotidica contro una banca dati di sequenze nucleotidiche. bastp: confronta una sequenza aminoacidica contro una banca dati di sequenze proteiche. blastx: confronta una sequenza nucleotidica (che viene tradotta in tutti i reading frames) contro una banca dati di sequenze proteiche. tblastn: confronta una sequenza proteica contro una banca dati di sequenze nucleotidiche dinamicamente tradotte in tutti i reading frames. tblastx: confronta i 6 reading frames di una sequenza nucleotidica contro i 6 reading frames delle sequenze nucleotidiche presenti in una banca dati.

28 Nucleotide Sequence Databases nr All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences). No longer "non-redundant". month All new or revised GenBank+EMBL+DDBJ+PDB sequences released in the last 30 days. Drosophila genome Drosophila genome provided by Celera and Berkeley Drosophila Genome Project (BDGP). dbest Database of GenBank+EMBL+DDBJ sequences from EST Divisions dbsts Database of GenBank+EMBL+DDBJ sequences from STS Divisions htgs Unfinished High Throughput Genomic Sequences: phases 0, 1 and 2 (finished, phase 3 HTG sequences are in nr) gss Genome Survey Sequence, includes single-pass genomic data, exon-trapped sequences, and Alu PCR sequences. yeast Yeast (Saccharomyces cerevisiae) genomic nucleotide sequences E. coli Escherichia coli genomic nucleotide sequences pdb Sequences derived from the 3-dimensional structure from Brookhaven Protein Data Bank kabat [kabatnuc] Kabat's database of sequences of immunological interest vector Vector subset of GenBank(R), NCBI, in ftp://ncbi.nlm.nih.gov/blast/db/ mito Database of mitochondrial sequences alu Select Alu repeats from REPBASE, suitable for masking Alu repeats from query sequences. It is available by anonymous FTP from ncbi.nlm.nih.gov (under the /pub/jmc/alu directory). See "Alu alert" by Claverie and Makalowski, Nature vol. 371, page 752 (1994). epd Eukaryotic Promotor Database found on the web at

29 BLASTN [Apr ] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: RID: Query= gi emb X SSMYHCS Sus scrofa mrna for skeletal myosin heavy chain (pazmy4) (798 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) 1,301,425 sequences; 5,790,534,584 total letters If you have any problems or questions with the results of this search please refer to the BLAST FAQs Taxonomy reports Distribution of 182 Blast Hits on the Query Sequence

30 Score E Sequences producing significant alignments: (bits) Value gi emb X SSMYHCS Sus scrofa mrna for skeleta gi dbj AB AB Sus scrofa mrna for myos gi ref XM_ Homo sapiens myosin, heavy pol gi ref NM_ Homo sapiens myosin, heavy pol gi gb AF AF Homo sapiens myosin heavy gi dbj AB AB Bos taurus MyHC-2x mrna gi ref XM_ Homo sapiens myosin, heavy pol gi dbj AB AB Sus scrofa mrna for myos gi ref NM_ Homo sapiens myosin, heavy poly gi gb AF AF Homo sapiens myosin heavy gi emb X HSMYH1R Human skeletal mrna for myosi gi gb U OCU32574 Oryctolagus cuniculus myosin gi 1622 emb X OCMHCR Rabbit mrna for fast skeletal m gi gb BC Mus musculus, clone IMAGE: gi gb S S68736 Rattus sp. myosin heavy chain gi ref XM_ Mus musculus myosin, heavy pol gi emb AJ MMU Mus musculus partial mr gi emb AJ MMU Mus musculus partial mr gi dbj AB AB Sus scrofa mrna for myos gi ref XM_ Mus musculus similar to Myosin gi dbj AB AB Bos taurus MyHC-2a mrna gi gb S S73840 Homo sapiens type IIA myosin h gi ref XM_ Homo sapiens myosin, heavy pol gi ref NM_ Homo sapiens myosin, heavy poly gi gb AF AF Homo sapiens myosin heavy gi gb AF AF Rattus norvegicus type 2X gi gb L RATMYH Rattus norvegicus myosin heavy gi emb Z OCHEAMYO2 O.cuniculus (OCCDNA32) mrn e-155 gi ref XM_ Mus musculus similar to Myosin e-151 gi gb BC BC Mus musculus, Similar to e-151 gi gb L RATMYHM Rattus norvegicus skeletal mu e-149 gi gb K RATMYHC Rat embryonic myosin heavy ch e-147 gi ref XM_ Homo sapiens myosin, heavy pol e-144 gi emb X HSBMHCF Human MHC mrna for fetal-myos e-144 gi ref NM_ Homo sapiens myosin, heavy poly e-142 gi gb M HUMMYOHP Homo sapiens perinatal myosi e-142 gi emb Z HSMYOSIN H.sapiens mrna for myosin e-142 gi gb M CHKMYOSIND Gallus gallus fast myosin e-134 gi gb J CHKMYHE Chicken embryonic myosin heav e

31 >gi ref XM_ Homo sapiens myosin, heavy polypeptide 4, skeletal muscle (MYH4), mrna Length = 6015 Score = 955 bits (482), Expect = 0.0 Identities = 656/713 (92%), Gaps = 2/713 (0%) Strand = Plus / Plus Query: 1 caccagcctgatcaacaccaagaagaagctggagacagacatctcccaaatccagggaga 60 Sbjct: 5282 caccagcctgatcaacaccaagaagaagctggaaacagacatttcccaaatccagggaga 5341 Query: 61 gatggaggacattgtccaggaagctcgcaacgcagaagagaaggccaagaaggccatcac 120 Sbjct: 5342 gatggaggacatcgtccaggaagcccgcaatgcagaggagaaggccaagaaggccatcac 5401 Query: 121 tgatgcagccatgatggccgaggagctgaagaaggagcaggacaccagcgcccacctgga 180 Sbjct: 5402 tgatgctgccatgatggctgaggagctgaagaaggaacaggacaccagcgcccacctgga 5461 Query: 181 gcggatgaagaagaatatggaacagacggtaaaggacctgcagcaccgcctggacgaggc 240 Sbjct: 5462 gcggatgaagaagaacatggagcagaccgtgaaggatctgcagctccgtctggatgaggc 5521 Query: 241 agaacagttggccctgaagggcgggaagaagcagatccagaagctggaggccagggtgag 300 Sbjct: 5522 tgagcagctggcgctgaagggtgggaagaagcagatccagaaactggaggccagggtgag 5581 Query: 301 ggagcttgaaaatgaggttgaaaatgaacagaagcgcaatgttgaggctgtcaagggtct 360 Sbjct: 5582 agagcttgaaagtgaggtggaaagtgaacagaagcacaatgttgaggctgtcaagggtct 5641 Query: 361 tcggaaacatgagagaagagtgaaggaactcacttaccagactgaggaggaccgaaagaa 420 Sbjct: 5642 tcgcaaacatgagagaagagtgaaggaactcacttaccagactgaggaggaccgcaagaa 5701 Query: 421 tgttctcaggctgcaggacttggtggacaaactacaatccaaagttaaagcttacaagag 480 Sbjct: 5702 tattctcaggctgcaggacttggtggacaaattgcaaaccaaagtcaaagcttacaagag 5761 Query: 481 acaagcggaagaggcggaggaacaatccaacgtcaacctctccaagttccgcaagctcca 540 Sbjct: 5762 acaagctgaagaggctgaggaacaatccaatgtcaaccttgccaagttccgcaagctcca 5821

32 Collegarsi al sito Cliccate: Search Nucleotide for: digitate APOSTART Scegliete la versione genomica del gene Visualizzatela in formato FASTA

33 WWW Restriction analysis tools NEBcutter v Webcutter Restriction Maps

34 Progettazione primers per PCR PCR Primer design I primers devono essere ottimizzati per: Specificità Temperatura di fusione Strutture secondarie e formazione di dimeri Stabilità dell appaiamento con la sequenza target Software Primer3 Ci sono molti altri software per progettare primers, sia gratis che non

35 Come è strutturato Primer3? Essenzialmente in 2 parti : La prima permette di agire sulla SEQUENZA da amplificare, indicando DOVE vanno disegnati i nostri primers Nella seconda abbiamo la possibilità di indicare le CARATTERISTICHE che devono avere i primers

36 I campi da riempire nella pagina di input di Primer3

37 Campo Sequence Id Immettere il vostro nome + APOSTART Es: Stefano-APOSTART Ma si può anche usare il formato FASTA Campo Targets atggtagat ctgagggtaa atttctagtt tttctccttc attttcttgg ttaggaccct tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt gtctatgatg atgatgatag ttacagaacc gacgactcgt ccgtcctgta gaaaccccaa cccgtgaaat caaaaaactc[gacggcctgt gggcattcag] tctggatcgc gaaaactgtg gaattgatca gcgttggtgg gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag gcagttttaa cgatcagttc gccgatgcagatattcgtaa ttatgcgggc aacgtctggt atcagcgcga agtctttata ccgaaaggtt gggcaggccagcgtatcgtg ctgcgtttcg I target sono le parti della sequenza che devono essere presenti nell amplificato (amplicone). Per definirli si utilizzano le parentesi [ ] o si immettono nell apposita casella i valori di start e length

38 Campi Excluded Regions O Included Region atggtagat ctgagggtaa atttctagtt{tttctccttc attttcttgg ttaggaccct tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt gtctatgatg atgatgatag ttacagaacc gacgactcgt ccgtcctgta gaaaccccaa cccgtgaaat}caaaaaactc gacggcctgt gggcattcag tctggatcgc gaaaactgtg gaattgatca gcgttggtgg gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag gcagttttaa cgatcagttc gccgatgcag atattcgtaa ttatgcgggc aacgtctggt atcagcgcga agtctttata ccgaaaggtt gggcaggcca gcgtatcgtg ctgcgtttcg Si possono definire le regioni che non interessano o che invece interessano per la progettazione del primer con i valori start e length, cioè la prima base e il numero di basi della regione Si possono usare anche i simboli < > per Excluded Regions. Campo Product size e Product size Range

39 Seconda parte Le caratteristiche dei primers Campo Number To Return Si può scegliere quante coppie di primer si desidera che il programma ci fornisca Campo Max 3 Stability Più alto è il valore più il primer è stabile all estremità 3 Non si desidera una eccessiva stabilità: APPAIAMENTO CORRETTO 5 TACTGGTACTAATGCCCCC 3 3 ATGACCATGATTACGGGGGAGCTACCTATCATGGTATAGGTA 5 APPAIAMENTO NON CORRETTO, ma funzionante 5 TACTGGTACTAATGCCCCC 3 3 CCGGGGATCCTTACGGGGGGACCTATGCAA 5

40 Campo Max Mispriming e Pair Max Mispriming E un parametro che stabilisce la massima similarità di uno o di entrambi i primerspermessa con sequenze contenute nelle Mispriming Libraries, che contengono sequenze ripetute di vari organismi Campo Primer size Campi Primer Tm e Max Tm Difference La temperatura di annealing dipende dalla percentuale di G+C e dalla lunghezza del primer. Siccome non vogliamo una % G+C troppo alta la Tm richiesta per un primer deve tener conto della lunghezza desiderata (se la richiediamo)

41 Campo Primer GC% E ottimale una frequenza di G+C (e A+T) del 50% Campi Max (Self) Complementarity e Max 3 (Self) Complementarity 5' ATGCCCTAGCTTCCGGATG 3' 3' AAGTCCTACATTTAGCCTAGT 5 Evitare la formazione di dimeri 5' ATGCGCTTATA A 3 TACGCCTTAGA e di strutture secondarie!!!

42 Campo Max #N s Il numero massimo di N che consentiamo nei primer Nel caso si disegnino primer su sequenze di bassa qualità, con tenenti basi incerte (N) Campo Max poly-x Il numero massimo di ripetizioni mononucleotidiche (es. AAAAAA) rendono il primer troppo stabile (G/C) o troppo instabile (A/T) Campo GC Clamp Il numero di G o C richiesto all estremità 3 Non più di una! Quando è tutto deciso, click su pick primers

43 Output di Primer 3 Primer3 Output WARNING: Numbers in input sequence were deleted. PRIMER PICKING RESULTS FOR Stefano No mispriming library specified Using 1-based sequence positions OLIGO start len tm gc% any 3' seq LEFT PRIMER cccttacgctgaagagatgc RIGHT PRIMER ggcacagcacatcaaagaga SEQUENCE SIZE: 2053 INCLUDED REGION SIZE: 2053 PRODUCT SIZE: 401, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: gcattacccttacgctgaagagatgctcgactgggcagatgaacatggcatcgtggtgat >>>>>>>>>>>>>>>>>>>> 1261 tgatgaaactgctgctgtcggctttcagctgtctttaggcattggtttcgaagcgggcaa 1321 caagccgaaagaactgtacagcgaagaggcagtcaacggggaaactcagcaagcgcactt 1381 acaggcgattaaagagctgatagcgcgtgacaaaaaccacccaagcgtggtgatgtggag 1441 tattgccaacgaaccggatacccgtccgcaaggtgcacgggaatatttcgcgccactggc 1501 ggaagcaacgcgtaaactcgacccgacgcgtccgatcacctgcgtcaatgtaatgttctg 1561 cgacgctcacaccgataccatcagcgatctctttgatgtgctgtgcctgaaccgttatta <<<<<<<<<<<<<<<<<<<<

44 Output di Primer 3

45 Esercizio Cercare nella banca dati NCBI sequenze di Poa pratensis. Selezionare tra di esse il gene SERK isolato da Albertini E, e Marconi G. Eseguire un BLAST sulla sequenza e disegnare dei primer specifici per la individuazione di tale gene (utilizzando quindi parti peculiari della sequenza.) Il prodotto di amplificazione deve essere compreso tra 150 e 300 pb La temperatura di fusione dei primers deve essere superiore a 60 C

46 Sequenza codificante del gene NptII dal plasmide pcambia-2301 tca gaagaactcg tcaagaaggc gatagaaggc 9001 gatgcgctgc gaatcgggag cggcgatacc gtaaagcacg aggaagcggt cagcccattc 9061 gccgccaagc tcttcagcaa tatcacgggt agccaacgct atgtcctgat agcggtccgc 9121 cacacccagc cggccacagt cgatgaatcc agaaaagcgg ccattttcca ccatgatatt 9181 cggcaagcag gcatcgccat gtgtcacgac gagatcctcg ccgtcgggca tgcgcgcctt 9241 gagcctggcg aacagttcgg ctggcgcgag cccctgatgc tcttcgtcca gatcatcctg 9301 atcgacaaga ccggcttcca tccgagtacg tgctcgctcg atgcgatgtt tcgcttggtg 9361 gtcgaatggg caggtagccg gatcaagcgt atgcagccgc cgcattgcat cagccatgat 9421 ggatactttc tcggcaggag caaggtgaga tgacaggaga tcctgccccg gcacttcgcc 9481 caatagcagc cagtcccttc ccgcttcagt gacaacgtcg agcacagctg cgcaaggaac 9541 gcccgtcgtg gccagccacg atagccgcgc tgcctcgtcc tggagttcat tcagggcacc 9601 ggacaggtcg gtcttgacaa aaagaaccgg gcgcccctgc gctgacagcc ggaacacggc 9661 ggcatcagag cagccgattg tctgttgtgc ccagtcatag ccgaatagcc tctccaccca 9721 agcggccgga gaacctgcgt gcaatccatc ttgttcaatc cccat