Codoni di STOP: UAA UAG UGA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Codoni di STOP: UAA UAG UGA"

Transcript

1 PARTECIPANO ALLA TRADUZIONE: trna e aminoacidi Aminoacil-tRNA sintetasi Ribosomi mrna, che contiene una Open Reading Frame (ORF) CODONE DI INIZIO CODONE DI STOP 5 Cap NNNNNN AUG AAA GCA AUU----(n codoni)----uga NNNNNAAAAAAAAA 3 ORF Sequenza codificante per una proteina Codoni di STOP: UAA UAG UGA

2 LUNGHEZZA: TRA 73 E 93 BASI CIRCA 30 TIPI DIVERSI Aggiunta post-trascrizionale STELO ACCETTORE ANSA VARIABILE

3 INOSINA

4 Aminoacil-AMP legame fosfo-anidridico ad alta energia (alto potenziale di trasferimento) AA sempre legato all enzima Legame acilico ad alta energia

5 Aminoacil trna sintetasi Sono 20 diversi isoenzimi (uno specifico per ogni AA) Non specifica per un singolo trna poiché per molti AA ci sono più trna (trna isoaccettori) Siti di riconoscimento principali: stelo accettore e ansa anticodone Sito di correzione (proof reading) Classe II e I

6

7 La AA-tRNA sintetasi è il vero traduttore Nella traduzione viene aggiunta Ala in corrispondenza dei codoni per Cys

8 INIZIO TRADUZIONE Nei procarioti Il ribosoma inizia la ricerca del primo AUG a partire da RBS (legame al ribosoma). Negli eucarioti Il ribosoma inizia la ricerca del primo AUG dal CAP legato al ribosoma. Seq. Di Kozaz per stabilizzare trna di inizio

9 16 S rrna mrna poli-cistronico (comune nei procarioti) Seq. Shine-Dalgarno RBS mrna mono-cistronico (eucarioti) Seq. Di Kozak Legame al ribosoma

10

11

12

13 Fasi della traduzione Attivazione e caricamento dell AA sul trna Inizio (un AA, codone AUG)) Allungamento (n 1 AA) Terminazione (codone di Stop) Targeting Modificazioni post-traduzionali

14 TRADUZIONE COTRASCRIZIONALE solo in procarioti Peptidil transferasi

15 Inizio della traduzione (procarioti) Gruppo formile

16 Inizio della traduzione (procarioti) IF2 Proteina G che lega il GTP (stato attivo) e lo idrolizza a GDP (stato inattivo) Prima si legano i fattori proteici e poi fmet-trnai e mrna

17 ALLUNGAMENTO Simile in tutti gli organismi Partecipano due fattori COMPLESSO DI INIZIO Caricamento del 2 AA-tRNA sul sito A Formazione del legame peptidico (peptidil transferasi) Il COOH del 1 AA si lega all NH2 del 2 AA-tRNA Traslocazione (per la lunghezza di un codone)

18 EF-Tu-GTP Proteina G attiva EF-Tu-GDP non attiva trna correttamente posizionato nel sito A ALLUNGAMENTO (EF-G)

19 EF-Tu SCAMBIO GDP/GTP mediato da EF-Ts EF-G è più affine al GTP che al GDP ricaricamento spontaneo

20 ELONGAZIONE PEPTIDIL-TRANSFERASI E rrna 23S Ribozima EF-G Induce la traslocazione mediante idrolisi di GTP E TRASLOCAZIONE

21 trna deacilato Nuovo legame peptidico

22 MIMETISMO MOLECOLARE Il rilascio di RF1/2 è mediato da RF3-GDP RF3-GTP trna RF1 anticodone peptidico di 3 aminoacidi RF1 e RF2 in procarioti erf1 in eucarioti riconoscono i codoni di stop e idrolizzano il legame tra polipeptide e trna RF3 / erf3 = proteina G

23 SPESA ENERGETICA della sintesi proteica ELONGAZIONE 1 ATP per il la formazione di AA-tRNA (ed anche del legame peptidico) 2 GTP per l elongazione (EF-Tu ed EF-G) 3 NUCLEOSIDI TRIFOSFATO per ogni AA aggiunto INIZIO 1 GTP (IF2) procarioti 2 GTP (eif2 e eif5b) eucarioti TERMINAZIONE 1 GTP (RF-3) 2 / 3 NUCLEOSIDI TRIFOSFATO per ogni polipeptide

24 ANTIBIOTICI TRADUZIONALI (ED ALCUNE TOSSINE!)

25 Codice genetico Ridondante (degenerato) Codoni sinonomi Non ambiguo Universale (quasi!) Letto in direzione 5 3 Produce polipeptide in direzione NH2 - COOH Senza punteggiatura Un mrna ha un solo frame di lettura (determinato da AUG) GCN GCY GCR Perche questo codice? Contenuti in GC possono cambiare Mut. in pos.1 = spesso AA simili. Mut in pos. 2: Pur = polare Pyr = idrof.

26 O R F C è ATG! 5 GCGTAATGAATCAGTCGTAGCAAGCTTTTGGCTTAAAGGCG divisione in triplette: un solo frame di lettura 5 GCGTA ATG AAT CAG TCG AAG CTA GCT TTT GGC TTA AAG GCG

27

28 Codice genetico Yanofsky, Brenner e Crick ( ) colinearita tra RNA proteina codone = tripletta Utilizzo di RNA sintetici La sequenza UUUUUUUUUUUU traduce un poli-phe La sequenza UAUAUAUAUAUA traduce Tyr-Leu-Tyr-Leu DECIFRAZIONE COMPLETATA NEL 1966

29 Mutazioni puntiformi N codoni/aa Met His Phe Thr Asn Arg Tyr Ser STOP AUG CAC UUU ACU AAC CGC UAU UCC UAA CAU silente ACC silente AUU missenso Phe/Ile AAG missenso Tyr/Lys UAG nonsenso Tyr/Stop

30 Beta-TALASSEMIE Sbilanciamento alfa/beta

31 MUTAZIONI SOPPRESSIVE RETROMUTAZIONE DI UNA MUTAZIONE PUNTIFORME MUTAZIONE NONSENSE DI UN GENE si crea un codone UAG MUTAZIONE DI UN trna diventa capace di leggere un codone di UAG (mutazione amber) SOPPRESSIONE DELLA MUTAZIONE DIFETTI NELLA TERMINAZIONE

32 Interferenza a RNA RNA interference Premi Nobel 2006 RNAi Fenomeno scoperto nelle piante e poi studiato in Arabidopsis thaliana e Caenorhabditis elegans Pianta erbacea Con genoma piccolo Nematode, circa 1000 cellule Con genoma piccolo Craig Mello Andew Fire

33 dsrna Esogeni (p.e. virus) Pre-miRNA sirna dsrna DICER sirna piccolissimi RNA associati a proteine con capacità idrolitica su RNA virali Difesa dall infezione

34 dsrna Trascritti dal Esogeni genoma (p.e. virus) Pre-miRNA sirna e mirna pri-mirna dsrna pre-mirna DICER mi-rna sirna piccolissimi RNA associati a proteine con capacità idrolitica su mrna cellulari su RNA virali Controllo posttrascrizionale Difesa dall infezione

35 Meccanismo antico (solo con sirna) che nasce come difesa da virus e da trasposoni. Nelle piante è una sorta di sistema immunitario endocellulare antivirale In seguito si è evoluto il processo dei mirna (sfrutta l esistenza di DICER e Argonauta) per la regolazione genica In alcuni organismi il processo è andato completamente perso (S.cerevisiae)

36 Somministrazione sperimentale di RNA Meccanismo antico (solo con sirna) che nasce come difesa da virus e da trasposoni. Nelle piante è una sorta di sistema immunitario endocellulare antivirale In seguito si è evoluto il processo dei mirna (sfrutta l esistenza di DICER e Argonauta) per la regolazione genica In alcuni organismi è andato completamente perso (S.cerevisiae) Poi sono arrivati i biotecnologi! possibilità di modulare a piacere l espressione di specifici geni

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Acidi nucleici non codificanti

Acidi nucleici non codificanti Vol. Giacca 4bozza 17-02-2011 11:05 Pagina 19 Acidi nucleici non codificanti 19 maniera controllata in modo da non favorire la crescita di eventuali tumori presenti in sedi lontane da quella in cui sono

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali:

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali: Gli enzimi Nel metabolismo energetico le cellule producono notevoli quantità di CO 2 che deve essere eliminata con l apparato respiratorio. Il trasferimento della CO 2 dalle cellule al sangue e da esso

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli DAI GENI AI SEMI genetica e biotecnologie in agricoltura Simona Baima e Giorgio Morelli Copyright 2010 Editori: Simona Baima e Giorgio Morelli Copertina e disegni: Franco Marchiolli [www.francomarchiolli.com]

Dettagli

Citochine dell immunità specifica

Citochine dell immunità specifica Citochine dell immunità specifica Proprietà biologiche delle citochine Sono proteine prodotte e secrete dalle cellule in risposta agli antigeni Attivano le risposte difensive: - infiammazione (immunità

Dettagli

-uno o più IONI INORGANICI

-uno o più IONI INORGANICI Coenzimi e vitamine Alcuni enzimi, per svolgere la loro funzione, hanno bisogno di componenti chimici addizionali, i COFATTORI APOENZIMA + COFATTORE = OLOENZIMA = enzima cataliticamente attivo Il cofattore

Dettagli

Test di logica e cultura generale. 6. Quale di queste parole è estranea alle altre?

Test di logica e cultura generale. 6. Quale di queste parole è estranea alle altre? Test di logica e cultura generale 1. Tre amici Carlo, Piero e Nicola acquistano della frutta al mercato. Ognuno di loro sceglie un diverso tipo di frutta e spende una somma differente. Sapendo che: - Carlo

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è Emofilia Malattia ereditaria X cromosomica recessiva A deficit del fatt VIII B deficit del fatt IX Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000

Dettagli

Cos'è esattamente la gelatina

Cos'è esattamente la gelatina Cos'è esattamente la gelatina LA GELATINA È PURA E NATURALE La gelatina attualmente in commercio viene prodotta in moderni stabilimenti operanti in conformità ai più rigorosi standard di igiene e sicurezza.

Dettagli

METABOLISMO LIPIDICO. Gli ac. grassi sono ossidati o incorporati in trigliceridi di riserva. Lipidi introdotti con gli alimenti.

METABOLISMO LIPIDICO. Gli ac. grassi sono ossidati o incorporati in trigliceridi di riserva. Lipidi introdotti con gli alimenti. METABOLISMO LIPIDICO cistifellea Lipidi introdotti con gli alimenti Gli ac. grassi sono ossidati o incorporati in trigliceridi di riserva inestino I lipidi sono emulsionati dai sali biliari e resi accessibili

Dettagli

Domini nelle Proteine

Domini nelle Proteine Struttura secondaria, Motivi e Domini nelle Proteine Proprietà generali Le forme ioniche degli aminoacidi, senza considerare alcuna ionizzazione delle catene laterali. Proprietà generali Tutti gli aminoacidi

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

Ministero dell'istruzione, dell'università e della Ricerca

Ministero dell'istruzione, dell'università e della Ricerca PROVA DI AMMISSIONE AL CORSO DI LAUREA IN MEDICINA VETERINARIA Anno Accademico 2010/2011 Test di Biologia 1. Quale dei seguenti composti NON è di natura lipidica? A) Chitina B) Tripalmitina C) Vitamina

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione

Dettagli

Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier

Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier RICERCA APPLICATA / Stress ossidativo, invecchiamento e malattie degenerative Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier A cura del Dipartimento Scientifico

Dettagli

LA MEMBRANA PLASMATICA

LA MEMBRANA PLASMATICA LA MEMBRANA PLASMATICA 1. LE FUNZIONI DELLA MEMBRANA PLASMATICA La membrana plasmatica svolge le seguenti funzioni: 1. tenere concentrate tutte le sostanze indispensabili alla vita: è proprio la membrana

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Teorie dell invecchiamento

Teorie dell invecchiamento G GERONTOL 2005;53:57-74 Società Italiana di Gerontologia e Geriatria EDITORIALE EDITORIAL Teorie dell invecchiamento The aging theories N. FERRARA * **, G. CORBI ** ***, D. SCARPA ****, G. RENGO **, G.

Dettagli

Metabolismo dell azoto

Metabolismo dell azoto rof. Giorgio Sartor Metabolismo dell azoto Copyright 2001-2012 by Giorgio Sartor. All rights reserved. Versione 1.4.2 may 2012 AD i RTEIE LISACCARIDI LIIDI AD i Aminoacidi Esosi; entosi Ac. Grassi; Glicerolo

Dettagli

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria?

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria? DOMANDE E RISPOSTE 1. Che cos è un vaccino? Un vaccino è un prodotto la cui somministrazione è in grado di indurre una risposta immunitaria specifica contro un determinato microrganismo (virus, batterio

Dettagli

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale?

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Questo vecchio slogan pubblicitario riconduce ad una parziale verità scientifica, oggi più che attuale. E risaputo che parlare di zucchero

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Prof.ssa Silvia Recchia GLI ENZIMI DISPENSA BASATA SUI MATERIALI DEL PROF. F. GURZONI

Prof.ssa Silvia Recchia GLI ENZIMI DISPENSA BASATA SUI MATERIALI DEL PROF. F. GURZONI I T I S G. F E R R A R I S Prof.ssa Silvia Recchia GLI ENZIMI DISPENSA BASATA SUI MATERIALI DEL PROF. F. GURZONI 1 Indice 1. La struttura! 2 2. Le prestazioni: l efficienza e la specificità! 7 3. L influenza

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

PROGRAMMAZIONE. Anno Scolastico 2009-10 IGIENE ED EDUCAZIONE SANITARIA

PROGRAMMAZIONE. Anno Scolastico 2009-10 IGIENE ED EDUCAZIONE SANITARIA PROGRAMMAZIONE Anno Scolastico 2009-10 IGIENE ED EDUCAZIONE SANITARIA Classe: 4^ LTS/A - SALUTE Insegnante: Claudio Furioso Ore preventivo: 132 SCANSIONE MODULI N TITOLO MODULO set ott nov dic gen feb

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

BIOCHIMICA DEL COBALTO

BIOCHIMICA DEL COBALTO BIOCHIMICA DEL COBALTO 1. Chimica del Co di interesse in bioinorganica 2. Funzioni del Co nei mezzi biologici 3. Vitamina B 12 4. Derivati della vitamina B 12 nella catalisi enzimatica 5. Complessi modello

Dettagli

4. Quali possono essere le complicazioni dell influenza e quali sono le persone a rischio?

4. Quali possono essere le complicazioni dell influenza e quali sono le persone a rischio? Dipartimento federale dell'interno DFI Ufficio federale della sanità pubblica UFSP Malattie trasmissibili Stato al 05.10.2010 FAQ Influenza stagionale 1. Cos è l influenza? 2. Come si trasmette l influenza?

Dettagli

EPATITE B. 50 domande e risposte. Dr. med. Eric Odenheimer, Prof. Dr. med. Beat Müllhaupt e Prof. Dr. med. Andreas Cerny

EPATITE B. 50 domande e risposte. Dr. med. Eric Odenheimer, Prof. Dr. med. Beat Müllhaupt e Prof. Dr. med. Andreas Cerny EPATITE B 50 domande e risposte Dr. med. Eric Odenheimer, Prof. Dr. med. Beat Müllhaupt e Prof. Dr. med. Andreas Cerny 2012 by SEVHep; 2 a edizione c/o Centro di Epatologia Clinica Luganese Moncucco Via

Dettagli

L identificazione e la denominazione delle sostanze chimiche in ambito REACH

L identificazione e la denominazione delle sostanze chimiche in ambito REACH I DETERGENTI: COME CONIUGARE PRESTAZIONI ELEVATE E RISPETTO PER L AMBIENTE L identificazione e la denominazione delle sostanze chimiche in ambito REACH Resana, 5 ottobre 2007 FEDERICA CECCARELLI Ist. Sup.

Dettagli

COMUNICAZIONE TRA CELLULE E AMBIENTE

COMUNICAZIONE TRA CELLULE E AMBIENTE COMUNICAZIONE TRA CELLULE E AMBIENTE 1. LE CELLULE COMUNICANO TRA LORO Le cellule vegetali comunicano attraverso i plasmodesmi. Dato lo spessore della parete cellulare, come possono interagire tra loro

Dettagli

CIN 2 3: CHE FARE? P Cattani. Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona

CIN 2 3: CHE FARE? P Cattani. Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona CIN 2 3: CHE FARE? P Cattani Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona Istologia: diagnosi e gradi della CIN biopsia cervicale o escissione maturazione cell stratificazione cell anormalità

Dettagli

Gli organismi viventi

Gli organismi viventi Gli organismi viventi Gli organismi viventi Quali caratteristiche contraddistinguono i viventi? È facile distinguere un organismo vivente da un oggetto non vivente? Gli organismi viventi Tutti gli organismi

Dettagli

Il fabbisogno alimentare e il ruolo dei nutrienti

Il fabbisogno alimentare e il ruolo dei nutrienti Il fabbisogno alimentare e il ruolo dei nutrienti Le necessità del nostro corpo Cibo e bevande sono i mezzi con cui il nostro organismo si procura le sostanze di cui ha bisogno per le sue attività vitali.

Dettagli

SOLUZIONI DEGLI ESERCIZI

SOLUZIONI DEGLI ESERCIZI Valitutti, Taddei, Kreuzer, Massey, Sadava, Hillis, Heller, Berenbaum Dal carbonio agli OGM PLUS Chimica organica, biochimica e biotecnologie SOLUZIONI DEGLI ESERCIZI Capitolo 1 Dal carbonio agli idrocarburi

Dettagli

Monossido d azoto NO (Nitric Oxide) Messaggero del segnale cellulare. Molecola regolatoria nel sistema nervoso centrale e periferico

Monossido d azoto NO (Nitric Oxide) Messaggero del segnale cellulare. Molecola regolatoria nel sistema nervoso centrale e periferico Monossido d azoto NO (Nitric Oxide) Ruolo biologico: Messaggero del segnale cellulare Molecola regolatoria nel sistema cardiovascolare Molecola regolatoria nel sistema nervoso centrale e periferico Componente

Dettagli

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp.

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. RECENSIONI&REPORTS recensione Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. 154, 12 «Il vasto e importante e molto

Dettagli

CAMPO DI ESPERIENZA: IL SE E L ALTRO

CAMPO DI ESPERIENZA: IL SE E L ALTRO CAMPO DI ESPERIENZA: IL SE E L ALTRO I. Il bambino gioca in modo costruttivo e creativo con gli altri, sa argomentare, confrontarsi, sostenere le proprie ragioni con adulti e bambini. I I. Sviluppa il

Dettagli

Ministero dell'istruzione, dell'università e della Ricerca

Ministero dell'istruzione, dell'università e della Ricerca PROVA DI AMMISSIONE AL CORSO DI LAUREA IN MEDICINA VETERINARIA Anno Accademico 2009/2010 Test di Cultura generale e Ragionamento logico 1. Il Patto Molotov-Ribbentrop del 1939 fra l Unione Sovietica e

Dettagli

CINQUE DOMANDE SU CUI RIFLETTERE

CINQUE DOMANDE SU CUI RIFLETTERE L ORIGINE DELLA VITA CINQUE DOMANDE SU CUI RIFLETTERE L ORIGINE DELLA VITA CINQUE DOMANDE SU CUI RIFLETTERE DOMANDA DOMANDA DOMANDA DOMANDA 1 Come 2 Esistono 3 Da 4 Tutte ha avuto origine la vita? PAGINA

Dettagli

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la INFIAMMAZIONE Risposta protettiva che ha lo scopo di eliminare sia la causa iniziale del danno cellulare (es. microbi, tossine etc), sia i detriti cellulari e le cellule necrotiche che compaiono a seguito

Dettagli

L analisi dei villi coriali

L analisi dei villi coriali 12 L analisi dei villi coriali Testo modificato dagli opuscoli prodotti dal Royal College of Obstetricians and Gynaecologists dell Ospedale Guy s and St Thomas di Londra. www.rcog.org.uk/index.asp?pageid=625

Dettagli

CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE. un atomo compie all atto di formazione di un composto al fine di formare un maggior

CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE. un atomo compie all atto di formazione di un composto al fine di formare un maggior CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE L ibridizzazione o ibridazione è una ricombinazione dei propri orbitali atomici che un atomo compie all atto di formazione di un composto al fine

Dettagli

CONVEGNO FAI L UNIVERSO APE IN PERICOLO. Resoconto preliminare

CONVEGNO FAI L UNIVERSO APE IN PERICOLO. Resoconto preliminare CONVEGNO FAI L UNIVERSO APE IN PERICOLO ---------------------------- Resoconto preliminare L importanza di una rete di monitoraggio Al fine di avere idee precise sulla natura e sull entità degli spopolamenti

Dettagli

Energia e Lavoro. In pratica, si determina la dipendenza dallo spazio invece che dal tempo

Energia e Lavoro. In pratica, si determina la dipendenza dallo spazio invece che dal tempo Energia e Lavoro Finora abbiamo descritto il moto dei corpi (puntiformi) usando le leggi di Newton, tramite le forze; abbiamo scritto l equazione del moto, determinato spostamento e velocità in funzione

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Orario provvisorio delle lezioni Scuola di Specializzazione AIPSAC a.a. 2010-2011

Orario provvisorio delle lezioni Scuola di Specializzazione AIPSAC a.a. 2010-2011 Orario provvisorio delle lezioni Scuola di Specializzazione AIPSAC a.a. 2010-2011 I Anno Novembre 2010 Fasce orarie Venerdì 19 novembre Sabato 20 novembre Seminario di inaugurazione Laboratorio analisi

Dettagli

13. Anticorpi. (vedi singoli sottocapitoli) I edizione. 13. Anticorpi...1

13. Anticorpi. (vedi singoli sottocapitoli) I edizione. 13. Anticorpi...1 1 13. Anticorpi I edizione (vedi singoli sottocapitoli) 13. Anticorpi...1 13.1. STRUTTURA DEGLI ANTICORPI ED I GENI DELLE IMMUNOGLOBULINE...3 13.1.1. Struttura/funzione degli anticorpi...4 13.1.2. Dominii

Dettagli

DIFFERENZE TRA SPIRULINA E KLAMATH

DIFFERENZE TRA SPIRULINA E KLAMATH DIFFERENZE TRA SPIRULINA E KLAMATH La Klamath è da preferire ad altre verdi-azzurre per la sua ricchezza di nutrienti completamente naturali e perfettamente bilanciati. Inoltre svolge un'azione stimolante

Dettagli

Cos è un analisi genetica (test genetico)?

Cos è un analisi genetica (test genetico)? 12 Cos è un analisi genetica (test genetico)? Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra Luglio 2008 Questo lavoro è sponsorizzato dal Consorzio EU-FP6 EuroGentest,

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

APPUNTI DI BIOCHIMICA E BIOCHIMICA NUTRIZIONALE. aa 2008/2009 Giordano Perin

APPUNTI DI BIOCHIMICA E BIOCHIMICA NUTRIZIONALE. aa 2008/2009 Giordano Perin APPUNTI DI BIOCHIMICA E BIOCHIMICA NUTRIZIONALE aa 2008/2009 Giordano Perin 1 BIOCHIMICA NUTRIZIONALE Giordano Perin; biochimica9: metabolismo degli amminoacidi METABOLISMO DEGLI AMMINOACIDI GLI AMMINOACIDI

Dettagli

FATTORI DELLA COAGULAZIONE

FATTORI DELLA COAGULAZIONE FATTORI DELLA COAGULAZIONE I Fattori della Coagulazione sono un insieme eterogeneo di molecole che prende parte alla cascata coagulativa, in quella che viene chiamata FASE COAGULATIVA del processo emostatico.

Dettagli

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD)

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Pædiatric Rheumatology InterNational Trials Organisation Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Che cos è? Il deficit di mevalonato chinasi è una malattia genetica. E un errore congenito

Dettagli

A.I.S.F. ASSOCIAZIONE ITALIANA PER LO STUDIO DEL FEGATO TRATTAMENTO DELLA EPATITE DA HCV

A.I.S.F. ASSOCIAZIONE ITALIANA PER LO STUDIO DEL FEGATO TRATTAMENTO DELLA EPATITE DA HCV A.I.S.F. ASSOCIAZIONE ITALIANA PER LO STUDIO DEL FEGATO TRATTAMENTO DELLA EPATITE DA HCV A cura della Commissione Terapia Antivirale dell Associazione Italiana per lo Studio del Fegato (A.I.S.F.) Finito

Dettagli

Versione A Libretto Test

Versione A Libretto Test LINGUAGGIO MATEMATICO DI BASE 2 Linguaggio Matematico di Base LINGUAGGIO MATEMATICO DI BASE 1. La media aritmetica di due numeri s e t è 2 3. Allora t è uguale a A. B. C. D. E. 4 2s 3 3 2s 2 4 3s 2 4 3s

Dettagli

L ACQUA : STRUTTURA E PROPRIETA

L ACQUA : STRUTTURA E PROPRIETA L ACQUA : STRUTTURA E PROPRIETA 1. Sostanza più abbondante in tutti gli esseri viventi 2. Più del 70% del peso di tutti gli esseri viventi 3. Influenza la struttura e la proprietà di tutte le molecole

Dettagli

Teoria del campo cristallino (CFT)

Teoria del campo cristallino (CFT) Teoria del campo cristallino (CFT) Interazione elettrostatica (non covalente) tra: - leganti anionici cariche elettriche puntiformi - leganti neutri dipoli elettrici con la parte negativa verso il centro

Dettagli

2. Stress ossidativo & bilancio nutrizionale

2. Stress ossidativo & bilancio nutrizionale 2.1 Vitamine & antiossidanti 2.2 Elementi in traccia ed enzimi STRESS OSSIDATIVO & BILANCIO NUTRIZIONALE R Alimentazione : vitamine e carotenoidi, Antiossidanti : lipofilici Vitamine & antiossidanti ZVIT

Dettagli

1 LEZIONE CHE COS E L ALLENAMENTO

1 LEZIONE CHE COS E L ALLENAMENTO 1 LEZIONE CHE COS E L ALLENAMENTO Sono molte le definizioni di allenamento: Definizione generale: E un processo che produce nell organismo un cambiamento di stato che può essere fisico, motorio, psicologico.

Dettagli

ALLEGATO N. 2 STANDARD TECNICI DELL ARCHIVIO UNICO INFORMATICO

ALLEGATO N. 2 STANDARD TECNICI DELL ARCHIVIO UNICO INFORMATICO ALLEGATO N. 2 STANDARD TECNICI DELL ARCHIVIO UNICO INFORMATICO 1 INDICE 1) ASPETTI GENERALI 2) CONTENUTO DELL ARCHIVIO UNICO INFORMATICO 2.1) OPERAZIONI 2.2) RAPPORTI 2.3) LEGAMI TRA SOGGETTI 3) CRITERI

Dettagli

Le malattie genetiche

Le malattie genetiche Le malattie genetiche Anderlini Beatrice Classe 3^ - Sez. C Liceo Scientifico R. Casimiri Introduzione alle malattie genetiche Tutti gli esseri viventi sono formati da cellule in ogni cellula è presente

Dettagli

Gli Omega-3 e la Vitamina D contro l Alzheimer - Le nuove prospettive per il terzo millennio -

Gli Omega-3 e la Vitamina D contro l Alzheimer - Le nuove prospettive per il terzo millennio - nutrizione & composizione corporea fisioterapia & recupero funzionale medicina d alta quota piani di allenamento articoli, studi, ricerche dal mondo della Nutrizione, delle Terapie Fisiche, delle Neuroscienze

Dettagli

CARATTERIZZAZIONE DI DUE ANTICORPI MONOCLONALI UMANI CROSS-NEUTRALIZZANTI DIRETTI CONTRO LA GLICOPROTEINA E2 DEL VIRUS DELL EPATITE C

CARATTERIZZAZIONE DI DUE ANTICORPI MONOCLONALI UMANI CROSS-NEUTRALIZZANTI DIRETTI CONTRO LA GLICOPROTEINA E2 DEL VIRUS DELL EPATITE C UNIVERSITA POLITECNICA DELLE MARCHE FACOLTA DI MEDICINA E CHIRURGIA Dottorato di Ricerca in Patologie Immunometaboliche, degenerative e infettive CARATTERIZZAZIONE DI DUE ANTICORPI MONOCLONALI UMANI CROSS-NEUTRALIZZANTI

Dettagli

Rappresentazione dei numeri in un calcolatore

Rappresentazione dei numeri in un calcolatore Corso di Calcolatori Elettronici I A.A. 2010-2011 Rappresentazione dei numeri in un calcolatore Lezione 2 Università degli Studi di Napoli Federico II Facoltà di Ingegneria Rappresentazione dei numeri

Dettagli

PREVENZIONE E SALUTE GLOBALE

PREVENZIONE E SALUTE GLOBALE PREVENZIONE E SALUTE GLOBALE SI PARTE DALLA VITAMINA D Relatore dr Donata Soppelsa Medico di medicina generale Associato alla Società Italiana di Nutriceutica Quali domande? E sufficiente l integrazione

Dettagli

unità B3. Le teorie sull evoluzione

unità B3. Le teorie sull evoluzione documentazione fossile è provata da embriologia comparata anatomia comparata biologia molecolare L evoluzione avviene per selezione naturale microevoluzione può essere macroevoluzione speciazione allopatrica

Dettagli

LA SALUTE VIEN MANGIANDO

LA SALUTE VIEN MANGIANDO LA SALUTE VIEN MANGIANDO PERCHÉ MANGIAMO? Il nostro organismo per sopravvivere e stare in buona salute, per crescere, per svolgere attività fisica, per riparare le parti del corpo danneggiate e sostituire

Dettagli

I I SEGNALI COSTIMOLATORI DEI LINFOCITI T FEDERICA COLLINO

I I SEGNALI COSTIMOLATORI DEI LINFOCITI T FEDERICA COLLINO I I SEGNALI COSTIMOLATORI DEI LINFOCITI T FEDERICA COLLINO ATTIVAZIONE DEI LINFOCITI T L attivazione dei linfociti T vergini richiede la presenza di una particolare regione di contatto tra le cellule T

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Manipolazione di testi: espressioni regolari

Manipolazione di testi: espressioni regolari Manipolazione di testi: espressioni regolari Un meccanismo per specificare un pattern, che, di fatto, è la rappresentazione sintetica di un insieme (eventualmente infinito) di stringhe: il pattern viene

Dettagli

Con la vaccinazione l influenza si allontana. La prevenzione dell influenza

Con la vaccinazione l influenza si allontana. La prevenzione dell influenza Con la vaccinazione l influenza si allontana La prevenzione dell influenza La vaccinazione antinfluenzale è il mezzo più efficace di protezione dalla malattia e di riduzione delle sue complicanze per le

Dettagli

SCALA DEI PESI ATOMICI RELATIVI E MEDI

SCALA DEI PESI ATOMICI RELATIVI E MEDI SCALA DEI PESI ATOMICI RELATIVI E MEDI La massa dei singoli atomi ha un ordine di grandezza compreso tra 10-22 e 10-24 g. Per evitare di utilizzare numeri così piccoli, essa è espressa relativamente a

Dettagli

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS)

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) Pædiatric Rheumatology InterNational Trials Organisation Che cos é? Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) La sindrome di Blau è una malattia genetica. I pazienti affetti presentano rash

Dettagli

A S S O C I A Z I O N E - A S S O C I AT I O N - ONLUS. P R E S I D E N T E Associazione La Nostra Famiglia. Consiglio di Amministrazione

A S S O C I A Z I O N E - A S S O C I AT I O N - ONLUS. P R E S I D E N T E Associazione La Nostra Famiglia. Consiglio di Amministrazione P R E S I D E N T E Associazione La Nostra Famiglia Consiglio di Amministrazione D i re t t o re Generale SEZIONE DI RICERCA ISTITUTO SCIENTIFICO E. MEDEA RESEARCH SECTION E.MEDEA Comitato Etico P residente

Dettagli

IL SISTEMA DELL INTERFERON: CENNI GENERALI.

IL SISTEMA DELL INTERFERON: CENNI GENERALI. IL SISTEMA DELL INTERFERON: CENNI GENERALI. Marco De Andrea, Raffaella Ravera, Daniela Gioia, Marisa Gariglio e Santo Landolfo Torino, Novara - Italia Riassunto Gli interferoni sono una famiglia di proteine

Dettagli

Ereditarietà legata al cromosoma X

Ereditarietà legata al cromosoma X 16 Ereditarietà legata al cromosoma X Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle

Dettagli

Fenomeni di trasporto. Fenomeni di trasporto

Fenomeni di trasporto. Fenomeni di trasporto La comprensione dei processi fisici, chimici e biologici che governano il trasporto di materia e la trasmissione delle forze è di fondamentale importanza per lo studio della fisiologia cellulare e l ingegnerizzazione

Dettagli

Aferesi terapeutica. Vivere con un elevato livello di colesterolo Quando dieta e farmaci non bastano

Aferesi terapeutica. Vivere con un elevato livello di colesterolo Quando dieta e farmaci non bastano Aferesi terapeutica Vivere con un elevato livello di colesterolo Quando dieta e farmaci non bastano Sommario: breve e dolce Parte 1: i dati 1 Parte 3: la lipidoaferesi 3 Colesterolo buono e colesterolo

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

Istituto Superiore Vincenzo Cardarelli Istituto Tecnico per Geometri Liceo Artistico A.S. 2014 2015

Istituto Superiore Vincenzo Cardarelli Istituto Tecnico per Geometri Liceo Artistico A.S. 2014 2015 Istituto Superiore Vincenzo Cardarelli Istituto Tecnico per Geometri Liceo Artistico A.S. 2014 2015 Piano di lavoro annuale Materia : Fisica Classi Quinte Blocchi tematici Competenze Traguardi formativi

Dettagli

Sostituzioni sull anello aromatico

Sostituzioni sull anello aromatico Sostituzioni sull anello aromatico Criteri per stabilire l esistenza di carattere aromatico 1. Il composto deve essere ciclico, planare e deve avere una nuvola ininterrotta di elettroni π sopra e sotto

Dettagli