Codoni di STOP: UAA UAG UGA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Codoni di STOP: UAA UAG UGA"

Transcript

1 PARTECIPANO ALLA TRADUZIONE: trna e aminoacidi Aminoacil-tRNA sintetasi Ribosomi mrna, che contiene una Open Reading Frame (ORF) CODONE DI INIZIO CODONE DI STOP 5 Cap NNNNNN AUG AAA GCA AUU----(n codoni)----uga NNNNNAAAAAAAAA 3 ORF Sequenza codificante per una proteina Codoni di STOP: UAA UAG UGA

2 LUNGHEZZA: TRA 73 E 93 BASI CIRCA 30 TIPI DIVERSI Aggiunta post-trascrizionale STELO ACCETTORE ANSA VARIABILE

3 INOSINA

4 Aminoacil-AMP legame fosfo-anidridico ad alta energia (alto potenziale di trasferimento) AA sempre legato all enzima Legame acilico ad alta energia

5 Aminoacil trna sintetasi Sono 20 diversi isoenzimi (uno specifico per ogni AA) Non specifica per un singolo trna poiché per molti AA ci sono più trna (trna isoaccettori) Siti di riconoscimento principali: stelo accettore e ansa anticodone Sito di correzione (proof reading) Classe II e I

6

7 La AA-tRNA sintetasi è il vero traduttore Nella traduzione viene aggiunta Ala in corrispondenza dei codoni per Cys

8 INIZIO TRADUZIONE Nei procarioti Il ribosoma inizia la ricerca del primo AUG a partire da RBS (legame al ribosoma). Negli eucarioti Il ribosoma inizia la ricerca del primo AUG dal CAP legato al ribosoma. Seq. Di Kozaz per stabilizzare trna di inizio

9 16 S rrna mrna poli-cistronico (comune nei procarioti) Seq. Shine-Dalgarno RBS mrna mono-cistronico (eucarioti) Seq. Di Kozak Legame al ribosoma

10

11

12

13 Fasi della traduzione Attivazione e caricamento dell AA sul trna Inizio (un AA, codone AUG)) Allungamento (n 1 AA) Terminazione (codone di Stop) Targeting Modificazioni post-traduzionali

14 TRADUZIONE COTRASCRIZIONALE solo in procarioti Peptidil transferasi

15 Inizio della traduzione (procarioti) Gruppo formile

16 Inizio della traduzione (procarioti) IF2 Proteina G che lega il GTP (stato attivo) e lo idrolizza a GDP (stato inattivo) Prima si legano i fattori proteici e poi fmet-trnai e mrna

17 ALLUNGAMENTO Simile in tutti gli organismi Partecipano due fattori COMPLESSO DI INIZIO Caricamento del 2 AA-tRNA sul sito A Formazione del legame peptidico (peptidil transferasi) Il COOH del 1 AA si lega all NH2 del 2 AA-tRNA Traslocazione (per la lunghezza di un codone)

18 EF-Tu-GTP Proteina G attiva EF-Tu-GDP non attiva trna correttamente posizionato nel sito A ALLUNGAMENTO (EF-G)

19 EF-Tu SCAMBIO GDP/GTP mediato da EF-Ts EF-G è più affine al GTP che al GDP ricaricamento spontaneo

20 ELONGAZIONE PEPTIDIL-TRANSFERASI E rrna 23S Ribozima EF-G Induce la traslocazione mediante idrolisi di GTP E TRASLOCAZIONE

21 trna deacilato Nuovo legame peptidico

22 MIMETISMO MOLECOLARE Il rilascio di RF1/2 è mediato da RF3-GDP RF3-GTP trna RF1 anticodone peptidico di 3 aminoacidi RF1 e RF2 in procarioti erf1 in eucarioti riconoscono i codoni di stop e idrolizzano il legame tra polipeptide e trna RF3 / erf3 = proteina G

23 SPESA ENERGETICA della sintesi proteica ELONGAZIONE 1 ATP per il la formazione di AA-tRNA (ed anche del legame peptidico) 2 GTP per l elongazione (EF-Tu ed EF-G) 3 NUCLEOSIDI TRIFOSFATO per ogni AA aggiunto INIZIO 1 GTP (IF2) procarioti 2 GTP (eif2 e eif5b) eucarioti TERMINAZIONE 1 GTP (RF-3) 2 / 3 NUCLEOSIDI TRIFOSFATO per ogni polipeptide

24 ANTIBIOTICI TRADUZIONALI (ED ALCUNE TOSSINE!)

25 Codice genetico Ridondante (degenerato) Codoni sinonomi Non ambiguo Universale (quasi!) Letto in direzione 5 3 Produce polipeptide in direzione NH2 - COOH Senza punteggiatura Un mrna ha un solo frame di lettura (determinato da AUG) GCN GCY GCR Perche questo codice? Contenuti in GC possono cambiare Mut. in pos.1 = spesso AA simili. Mut in pos. 2: Pur = polare Pyr = idrof.

26 O R F C è ATG! 5 GCGTAATGAATCAGTCGTAGCAAGCTTTTGGCTTAAAGGCG divisione in triplette: un solo frame di lettura 5 GCGTA ATG AAT CAG TCG AAG CTA GCT TTT GGC TTA AAG GCG

27

28 Codice genetico Yanofsky, Brenner e Crick ( ) colinearita tra RNA proteina codone = tripletta Utilizzo di RNA sintetici La sequenza UUUUUUUUUUUU traduce un poli-phe La sequenza UAUAUAUAUAUA traduce Tyr-Leu-Tyr-Leu DECIFRAZIONE COMPLETATA NEL 1966

29 Mutazioni puntiformi N codoni/aa Met His Phe Thr Asn Arg Tyr Ser STOP AUG CAC UUU ACU AAC CGC UAU UCC UAA CAU silente ACC silente AUU missenso Phe/Ile AAG missenso Tyr/Lys UAG nonsenso Tyr/Stop

30 Beta-TALASSEMIE Sbilanciamento alfa/beta

31 MUTAZIONI SOPPRESSIVE RETROMUTAZIONE DI UNA MUTAZIONE PUNTIFORME MUTAZIONE NONSENSE DI UN GENE si crea un codone UAG MUTAZIONE DI UN trna diventa capace di leggere un codone di UAG (mutazione amber) SOPPRESSIONE DELLA MUTAZIONE DIFETTI NELLA TERMINAZIONE

32 Interferenza a RNA RNA interference Premi Nobel 2006 RNAi Fenomeno scoperto nelle piante e poi studiato in Arabidopsis thaliana e Caenorhabditis elegans Pianta erbacea Con genoma piccolo Nematode, circa 1000 cellule Con genoma piccolo Craig Mello Andew Fire

33 dsrna Esogeni (p.e. virus) Pre-miRNA sirna dsrna DICER sirna piccolissimi RNA associati a proteine con capacità idrolitica su RNA virali Difesa dall infezione

34 dsrna Trascritti dal Esogeni genoma (p.e. virus) Pre-miRNA sirna e mirna pri-mirna dsrna pre-mirna DICER mi-rna sirna piccolissimi RNA associati a proteine con capacità idrolitica su mrna cellulari su RNA virali Controllo posttrascrizionale Difesa dall infezione

35 Meccanismo antico (solo con sirna) che nasce come difesa da virus e da trasposoni. Nelle piante è una sorta di sistema immunitario endocellulare antivirale In seguito si è evoluto il processo dei mirna (sfrutta l esistenza di DICER e Argonauta) per la regolazione genica In alcuni organismi il processo è andato completamente perso (S.cerevisiae)

36 Somministrazione sperimentale di RNA Meccanismo antico (solo con sirna) che nasce come difesa da virus e da trasposoni. Nelle piante è una sorta di sistema immunitario endocellulare antivirale In seguito si è evoluto il processo dei mirna (sfrutta l esistenza di DICER e Argonauta) per la regolazione genica In alcuni organismi è andato completamente perso (S.cerevisiae) Poi sono arrivati i biotecnologi! possibilità di modulare a piacere l espressione di specifici geni

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

La sintesi delle proteine

La sintesi delle proteine La sintesi delle proteine Struttura del trna In che modo l informazione contenuta sotto forma di sequenze nucleotidiche nel DNA e nell RNA si traduce nella sequenza amminoacidica delle proteine? Esperimenti

Dettagli

SAGGIO DI LEGAME AI RIBOSOMI: SE L AMMINOACIL-tRNA RICONOSCE LA TRIPLETTA, VI SI LEGA E NON RIESCE A PASSARE IL FILTRO CHE, COSì, DIVIENE RADIOATTIVO.

SAGGIO DI LEGAME AI RIBOSOMI: SE L AMMINOACIL-tRNA RICONOSCE LA TRIPLETTA, VI SI LEGA E NON RIESCE A PASSARE IL FILTRO CHE, COSì, DIVIENE RADIOATTIVO. TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

TRADUZIONE. 2. Transfer (legato agli aminoacidi) 3. Ribosomale (associato a proteine nei ribosomi)

TRADUZIONE. 2. Transfer (legato agli aminoacidi) 3. Ribosomale (associato a proteine nei ribosomi) enhancer promotore regione trascritta TATA trascrizione 5 3 splicing mrna 5 3 traduzione Proteina NH2 COOH Funzione biologica TRADUZIONE I tre ruoli svolti dall RNA: 1. Messaggero 2. Transfer (legato agli

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la

Dettagli

Trascrizione e maturazione degli RNA

Trascrizione e maturazione degli RNA Trascrizione e maturazione degli RNA Trascrizione e traduzione: espressione dell informazione genica L RNA veicola l informazione genica contenuta nel DNA (nucleo) in modo che possa esprimersi per dare

Dettagli

mrna + 20 aminoacidi In vitro nulla

mrna + 20 aminoacidi In vitro nulla La sintesi proteica mrna + 20 aminoacidi In vitro nulla Il codice genetico I geni controllano la struttura delle proteine: in che modo? 4 nucleotidi A, T, C, G 20 aminoacidi Esiste un codice che converte

Dettagli

Stop codons & Readthrough. 15 novembre 2013 Alessio Branchini

Stop codons & Readthrough. 15 novembre 2013 Alessio Branchini Stop codons & Readthrough 15 novembre 2013 Alessio Branchini Fedeltà nel trasferimento dell informazione genetica Discriminazione tra basi complementari (Watson-Crick e wobble base pairs) e non complementari

Dettagli

Biologia Molecolare. CDLM in CTF La riparazione del DNA

Biologia Molecolare. CDLM in CTF La riparazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La riparazione del DNA I tipi di mutazione e le conseguenze Le classi di danno al DNA Meccanismi di riparazione La necessità di codificare l informazione L informazione

Dettagli

IL FLUSSO DELL INFORMAZIONE GENETICA. DNA à RNA. RNA à PROTEINA. DNA à RNA à PROTEINA. Dogma centrale della biologia molecolare di Francis Crick, 1957

IL FLUSSO DELL INFORMAZIONE GENETICA. DNA à RNA. RNA à PROTEINA. DNA à RNA à PROTEINA. Dogma centrale della biologia molecolare di Francis Crick, 1957 IL FLUSSO DELL INFORMAZIONE GENETICA DNA à RNA à PROTEINA Dogma centrale della biologia molecolare di Francis Crick, 1957 DNA/RNA (seq polinucleotidica) DNA à RNA mrna trna rrna RNA à PROTEINA Proteina

Dettagli

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1)

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1) CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi http://hyperphysics.phy astr.gsu.edu/hbase/biology/ribosome.html http://www.accessexcellence.org/rc/vl/gg/ecb/ecb_images/01_24_organelles.jpg

Dettagli

SUBUNITA MAGGIORE = 60S (rrna 28S, 5.8S e 5S + 45 proteine) SUBUNITA MAGGIORE = 50S (rrna 23S e 5S + 34 proteine)

SUBUNITA MAGGIORE = 60S (rrna 28S, 5.8S e 5S + 45 proteine) SUBUNITA MAGGIORE = 50S (rrna 23S e 5S + 34 proteine) TRADUZIONE I RIBOSOMI I Ribosomi hanno un diametro di circa 15-30 nm, sono costituiti da proteine ed rrna e sia nei Procarioti che negli Eucarioti, sono costituiti da una subunità maggiore e da una subunità

Dettagli

07/01/2015. Inizio della sintesi proteica-i. Inizio della sintesi proteica-ii. Inizio della sintesi proteica-iii

07/01/2015. Inizio della sintesi proteica-i. Inizio della sintesi proteica-ii. Inizio della sintesi proteica-iii Inizio della sintesi proteica-i Coinvolge le subunità ribosomali trna d inizio Fattori di inizio (IFs) Inizio della sintesi proteica-ii Il trna iniziatore è caricato con formil-metionina Nei Bacteria vi

Dettagli

SINTESI DELLE PROTEINE

SINTESI DELLE PROTEINE SINTESI DELLE PROTEINE IN UN GIORNO DI UN INDIVIDUO ADULTO NORMALE: -100 grammi vengono introdotti con la dieta -400 grammi vengono degradati -400 grammi vengono sintetizzati -100 grammi vengono consumati

Dettagli

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE?

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE? DNA E PROTEINE NUMEROSI DATI SUGGERISCONO CHE IL DNA SVOLGA IL SUO RUOLO GENETICO CONTROLLANDO LA SINTESI DELLE PROTEINE, IN PARTICOLARE DETERMINANDONE LA SEQUENZA IN AMINOACIDI E NECESSARIO RISPONDERE

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

Definizione TRADUZIONE

Definizione TRADUZIONE Sintesi proteica Definizione La sintesi proteica è costituita da una sequenza di eventi che portano alla formazione di un polimero di amminoacidi (proteina o polipeptide) ad opera dei ribosomi a partire

Dettagli

Prof. Giorgio Sartor. Sintesi proteica. Trasmissione dell informazione

Prof. Giorgio Sartor. Sintesi proteica. Trasmissione dell informazione rof. Giorgio Sartor Sintesi proteica Copyright 2001-2013 by Giorgio Sartor. All rights reserved. B15 -Versione 1.0 nov2013 Trasmissione dell informazione L informazione è contenuta nel DA ed è trasferita

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una

Dettagli

Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica

Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica Il Codice Genetico La decodifica della sequenza nucleotidica in sequenza aminoacidica La sequenza del mrna viene letta a gruppi di 3 nucleotidi, senza interruzioni e senza sovrapposizioni; 4 3 = 64 ---------64

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

Il flusso dell informazione genica Le proteine natura ed informazione Il codice genetico La traduzione (sintesi proteica) Cenni sul folding delle

Il flusso dell informazione genica Le proteine natura ed informazione Il codice genetico La traduzione (sintesi proteica) Cenni sul folding delle Il flusso dell informazione genica Le proteine natura ed informazione Il codice genetico La traduzione (sintesi proteica) Cenni sul folding delle proteine Genotipo e fenotipo Mutazioni e polimorfismi Il

Dettagli

Produzione di proteine eterologhe. Cosa occorre per l espressione l livello di una proteina nella cellula? Trascrizione/traduzione/stabilità

Produzione di proteine eterologhe. Cosa occorre per l espressione l livello di una proteina nella cellula? Trascrizione/traduzione/stabilità Cosa occorre per l espressione l ad alto livello di una proteina nella cellula? Trascrizione/traduzione/stabilità Promotore forte (trascrizione) Presenza di segnali per il riconoscimento dell mrna da parte

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO http://www.atdbio.com/img/articles/rna wobble base pairs large.png CODICE GENETICO Codice mediante il quale la sequenza nucleotidica

Dettagli

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente)

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente) Come si ferma una macchina in corsa? Il terminatore Terminazione intrinseca (rho-indipendente) Terminazione dipendente dal fattore Rho (r) 1 Operoni: gruppi di geni parte di una unica unità trascrizionale

Dettagli

Allineamento dei 2 RNA

Allineamento dei 2 RNA La traduzione 2 codone Allineamento dei 2 RNA anticodone Studi Molecolari hanno dimostrato che: 3 residui nucleotidici del mrna sono necessari per codificare ciascun amminoacido Il linguaggio contenuto

Dettagli

1) Un gene-un enzima 2) Un gene- una catena polipeptidica

1) Un gene-un enzima 2) Un gene- una catena polipeptidica 1) Un gene-un enzima 2) Un gene- una catena polipeptidica 3) Un gene è una unità funzionale di DNA che codifica per la sequenza amminoacidica di uno o più polipeptidi o alternativamente per uno o più tipi

Dettagli

Citosol Ribosomi Sintesi proteica

Citosol Ribosomi Sintesi proteica CITOSOL (1) Citosol Ribosomi Sintesi proteica Biotecnologie_2012 Tutta la porzione non strutturata che costituisce la parte liquida del citoplasma. In esso si trovano in soluzione tutte le molecole necessarie

Dettagli

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:

Dettagli

IL DOGMA CENTRALE DELLA BIOLOGIA RNA

IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA

all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA Il Codice Genetico The genetic code consists of 64 triplet codons (A, G, C, U) 4 3 = 64 all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA AUG (methionine)

Dettagli

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti Dall RNA alle proteine La traduzione nei procarioti e negli eucarioti Codice genetico La sequenza dell mrna viene decodificata a gruppi di tre nucleotidi, e tradotta in una sequenza di amminoacidi 4 x

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

INTERAZIONE TRA mrna, trna e RIBOSOMI

INTERAZIONE TRA mrna, trna e RIBOSOMI INTERAZIONE TRA mrna, trna e RIBOSOMI mrna: porta l'informazione della sequenza degli aminoacidi di una determinata proteina. trna: ogni trna è specifico per il trasporto di un determinato aminoacido Ribosoma:

Dettagli

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- odice genetico- Traduzione dl Infermieristica aa. 2011/12 Prof.ssa Frabetti ESPRESSIONE

Dettagli

Codice Genetico (segue)

Codice Genetico (segue) CODICE GENETICO Nucleotidi, acidi nucleici CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. Consiste

Dettagli

Codice Genetico (segue) 29/10/2014 CODICE GENETICO

Codice Genetico (segue) 29/10/2014 CODICE GENETICO CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. CODICE GENETICO Consiste di codoni a tre nucleotidi

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza di aminoacidi. Come le mutazioni

Dettagli

L mrna ED IL CODICE GENETICO

L mrna ED IL CODICE GENETICO L mrna ED IL CODICE GENETICO LA SEQ. NUCLEOTIDICA DI UN GENE, PER MEZZO DELL mrna, E TRADOTTA NELLA SEQ. AMINOACIDICA DI UN PEPTIDE SEGUENDO REGOLE NOTE COME CODICE GENETICO. LA SUCCESSIONE CONSECUTIVA

Dettagli

La traduzione avviene nella cellula in strutture chiamate ribosomi

La traduzione avviene nella cellula in strutture chiamate ribosomi La traduzione avviene nella cellula in strutture chiamate ribosomi L informazione genetica viene scritta sotto forma di codoni e tradotta in sequenze di amminoacidi Le «parole» del linguaggio chimico del

Dettagli

trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano

trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano Struttura Acidi Nucleici RNA, DNA acidi nucleici = polinucleotidi (polimeri di nucleotidi) in cui

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

L mrna ED IL CODICE GENETICO

L mrna ED IL CODICE GENETICO L mrna ED IL CODICE GENETICO LA SEQ. NUCLEOTIDICA DI UN GENE, PER MEZZO DELL mrna, E TRADOTTA NELLA SEQ. AMINOACIDICA DI UN PEPTIDE SEGUENDO REGOLE NOTE COME CODICE GENETICO. LA SUCCESSIONE CONSECUTIVA

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

20. La traduzione 10/05/16

20. La traduzione 10/05/16 20. La traduzione contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale 1 L RNA transfer è l adattatore 2 La struttura secondaria

Dettagli

Codice genetico CODICE GENETICO [1]

Codice genetico CODICE GENETICO [1] Codice genetico CODICE GENETICO [1] Codice mediante il quale la sequenza nucleotidica di una molecola di DNA, tramite un mrna, specifica la sequenza amminoacidica di un polipeptide. Consiste di codoni

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Corso di Genetica -Lezione 12- Cenci

Corso di Genetica -Lezione 12- Cenci Corso di Genetica -Lezione 12- Cenci Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza

Dettagli

C1. Il codone di inizio parte dal quinto nucleotide. La sequenza aminoacidica sarà Met Gly Asn Lys Pro Gly Gln STOP.

C1. Il codone di inizio parte dal quinto nucleotide. La sequenza aminoacidica sarà Met Gly Asn Lys Pro Gly Gln STOP. Soluzioni ai problemi del Capitolo 13 Domande concettuali C1. Il codone di inizio parte dal quinto nucleotide. La sequenza aminoacidica sarà Met Gly Asn Lys Pro Gly Gln STOP. C2. Quando si dice che il

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 23

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 23 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 23 Il codice genetico Concetti chiave: Il codice genetico è basato su insiemi di codoni formati da tre nucleotidi che sono

Dettagli

LE AUGURO BUON LAVORO!

LE AUGURO BUON LAVORO! Nome:. Cognome:...... Pt./137 Nota ESAME DI SCIENZE SPERIMENTALI: BIOLOGIA Indicazioni: 1. Risponda sempre negli spazi indicati; non separi né scriva sul retro dei fogli. 2. Scriva, o, laddove richiesto,

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Evoluzione del concetto di gene. Da Mendel ai giorni nostri passando per diverse definizioni

Evoluzione del concetto di gene. Da Mendel ai giorni nostri passando per diverse definizioni Evoluzione del concetto di gene Da Mendel ai giorni nostri passando per diverse definizioni Fino al 1940 Teoria perle di una collana, considerate come unità indivisibili Gene = Unita dell informazione

Dettagli

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà Bioinformatica RNA non codificanti ed RNAi Dott. Alessandro Laganà Piccoli RNA non codificanti Struttura dell RNA RNA regolatore microrna RNAi e sirna 2 Bioinformatica: RNA non codificanti ed RNAi L RNA

Dettagli

LEZIONE IX SINTESI PROTEICA. Dott. Paolo Cascio

LEZIONE IX SINTESI PROTEICA. Dott. Paolo Cascio LEZIONE IX SINTESI PROTEICA Dott. Paolo Cascio L ESTREMITA 3 DEL trna SI LEA AD UN DETERMINATO AMINOACIDO CON UN LEAME COVALENTE AD ALTA ENERIA. IL PRODOTTO DI QUESTA REAZIONE E UNA MOLECOLA DI AMINOACILtRNA.

Dettagli

Compattamento del DNA nel cromosoma

Compattamento del DNA nel cromosoma Compattamento del DNA nel cromosoma DOMA CENTRALE DELLA BIOLOIA l'informazione genetica, contenuta nel nucleo nella molecola di DNA, si trasferisce al citoplasma. I geni del DNA vengono, nel nucleo, trascritti

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Definizione Composti quaternari: C H O N S P Fe Mg I

Definizione Composti quaternari: C H O N S P Fe Mg I PROTIDI Definizione Composti quaternari: C H O N S P Fe Mg I ORIGINE cellulare ogni cellula sintetizza le sue prote CARATTERISTICHE insolubili in acqua sensibili a variazioni di ph coagulano in presenza

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

dall mrna alle proteine 17. Sintesi Proteica e Codice Genetico

dall mrna alle proteine 17. Sintesi Proteica e Codice Genetico 17. Sintesi Proteica e Codice enetico contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale dall mrn alle proteine 1 L RN messaggero

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Sintesi e degradazione delle proteine

Sintesi e degradazione delle proteine Prof. Giorgio Sartor Sintesi e degradazione delle proteine Copyright 2001- by Giorgio Sartor. All rights reserved. B15 - Versione 1.4.1 may Trasmissione dell informazione L informazione è contenuta nel

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

MFN0366-A1 (I. Perroteau) -traduzione e indirizzamento delle proteine. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) -traduzione e indirizzamento delle proteine. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) -traduzione e indirizzamento delle proteine MFN0366-A1 (I. Perroteau) -traduzione delle proteine trna Traduzione: mrna -------> proteine mrna MFN0366-A1 (I. Perroteau) -traduzione

Dettagli

E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute

Dettagli

Trascrizione e maturazione degli RNA

Trascrizione e maturazione degli RNA Trascrizione e maturazione degli RNA L RNA è sisntetizzato a partire dal DNA nel processo della trascrizione L RNA veicola l informazione genica contenuta nel DNA (nucleo) in modo che possa esprimersi

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

Tripletta di nucleotidi che codifica un dato amminoacido

Tripletta di nucleotidi che codifica un dato amminoacido La sintesi proteica Amminoacido Sito di legame dell amminoacido Adattatore Tripletta di nucleotidi che codifica un dato amminoacido Inserzione Delezione Inserzione e delezione Cornice di lettura ripristinata

Dettagli