Codoni di STOP: UAA UAG UGA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Codoni di STOP: UAA UAG UGA"

Transcript

1 PARTECIPANO ALLA TRADUZIONE: trna e aminoacidi Aminoacil-tRNA sintetasi Ribosomi mrna, che contiene una Open Reading Frame (ORF) CODONE DI INIZIO CODONE DI STOP 5 Cap NNNNNN AUG AAA GCA AUU----(n codoni)----uga NNNNNAAAAAAAAA 3 ORF Sequenza codificante per una proteina Codoni di STOP: UAA UAG UGA

2 LUNGHEZZA: TRA 73 E 93 BASI CIRCA 30 TIPI DIVERSI Aggiunta post-trascrizionale STELO ACCETTORE ANSA VARIABILE

3 INOSINA

4 Aminoacil-AMP legame fosfo-anidridico ad alta energia (alto potenziale di trasferimento) AA sempre legato all enzima Legame acilico ad alta energia

5 Aminoacil trna sintetasi Sono 20 diversi isoenzimi (uno specifico per ogni AA) Non specifica per un singolo trna poiché per molti AA ci sono più trna (trna isoaccettori) Siti di riconoscimento principali: stelo accettore e ansa anticodone Sito di correzione (proof reading) Classe II e I

6

7 La AA-tRNA sintetasi è il vero traduttore Nella traduzione viene aggiunta Ala in corrispondenza dei codoni per Cys

8 INIZIO TRADUZIONE Nei procarioti Il ribosoma inizia la ricerca del primo AUG a partire da RBS (legame al ribosoma). Negli eucarioti Il ribosoma inizia la ricerca del primo AUG dal CAP legato al ribosoma. Seq. Di Kozaz per stabilizzare trna di inizio

9 16 S rrna mrna poli-cistronico (comune nei procarioti) Seq. Shine-Dalgarno RBS mrna mono-cistronico (eucarioti) Seq. Di Kozak Legame al ribosoma

10

11

12

13 Fasi della traduzione Attivazione e caricamento dell AA sul trna Inizio (un AA, codone AUG)) Allungamento (n 1 AA) Terminazione (codone di Stop) Targeting Modificazioni post-traduzionali

14 TRADUZIONE COTRASCRIZIONALE solo in procarioti Peptidil transferasi

15 Inizio della traduzione (procarioti) Gruppo formile

16 Inizio della traduzione (procarioti) IF2 Proteina G che lega il GTP (stato attivo) e lo idrolizza a GDP (stato inattivo) Prima si legano i fattori proteici e poi fmet-trnai e mrna

17 ALLUNGAMENTO Simile in tutti gli organismi Partecipano due fattori COMPLESSO DI INIZIO Caricamento del 2 AA-tRNA sul sito A Formazione del legame peptidico (peptidil transferasi) Il COOH del 1 AA si lega all NH2 del 2 AA-tRNA Traslocazione (per la lunghezza di un codone)

18 EF-Tu-GTP Proteina G attiva EF-Tu-GDP non attiva trna correttamente posizionato nel sito A ALLUNGAMENTO (EF-G)

19 EF-Tu SCAMBIO GDP/GTP mediato da EF-Ts EF-G è più affine al GTP che al GDP ricaricamento spontaneo

20 ELONGAZIONE PEPTIDIL-TRANSFERASI E rrna 23S Ribozima EF-G Induce la traslocazione mediante idrolisi di GTP E TRASLOCAZIONE

21 trna deacilato Nuovo legame peptidico

22 MIMETISMO MOLECOLARE Il rilascio di RF1/2 è mediato da RF3-GDP RF3-GTP trna RF1 anticodone peptidico di 3 aminoacidi RF1 e RF2 in procarioti erf1 in eucarioti riconoscono i codoni di stop e idrolizzano il legame tra polipeptide e trna RF3 / erf3 = proteina G

23 SPESA ENERGETICA della sintesi proteica ELONGAZIONE 1 ATP per il la formazione di AA-tRNA (ed anche del legame peptidico) 2 GTP per l elongazione (EF-Tu ed EF-G) 3 NUCLEOSIDI TRIFOSFATO per ogni AA aggiunto INIZIO 1 GTP (IF2) procarioti 2 GTP (eif2 e eif5b) eucarioti TERMINAZIONE 1 GTP (RF-3) 2 / 3 NUCLEOSIDI TRIFOSFATO per ogni polipeptide

24 ANTIBIOTICI TRADUZIONALI (ED ALCUNE TOSSINE!)

25 Codice genetico Ridondante (degenerato) Codoni sinonomi Non ambiguo Universale (quasi!) Letto in direzione 5 3 Produce polipeptide in direzione NH2 - COOH Senza punteggiatura Un mrna ha un solo frame di lettura (determinato da AUG) GCN GCY GCR Perche questo codice? Contenuti in GC possono cambiare Mut. in pos.1 = spesso AA simili. Mut in pos. 2: Pur = polare Pyr = idrof.

26 O R F C è ATG! 5 GCGTAATGAATCAGTCGTAGCAAGCTTTTGGCTTAAAGGCG divisione in triplette: un solo frame di lettura 5 GCGTA ATG AAT CAG TCG AAG CTA GCT TTT GGC TTA AAG GCG

27

28 Codice genetico Yanofsky, Brenner e Crick ( ) colinearita tra RNA proteina codone = tripletta Utilizzo di RNA sintetici La sequenza UUUUUUUUUUUU traduce un poli-phe La sequenza UAUAUAUAUAUA traduce Tyr-Leu-Tyr-Leu DECIFRAZIONE COMPLETATA NEL 1966

29 Mutazioni puntiformi N codoni/aa Met His Phe Thr Asn Arg Tyr Ser STOP AUG CAC UUU ACU AAC CGC UAU UCC UAA CAU silente ACC silente AUU missenso Phe/Ile AAG missenso Tyr/Lys UAG nonsenso Tyr/Stop

30 Beta-TALASSEMIE Sbilanciamento alfa/beta

31 MUTAZIONI SOPPRESSIVE RETROMUTAZIONE DI UNA MUTAZIONE PUNTIFORME MUTAZIONE NONSENSE DI UN GENE si crea un codone UAG MUTAZIONE DI UN trna diventa capace di leggere un codone di UAG (mutazione amber) SOPPRESSIONE DELLA MUTAZIONE DIFETTI NELLA TERMINAZIONE

32 Interferenza a RNA RNA interference Premi Nobel 2006 RNAi Fenomeno scoperto nelle piante e poi studiato in Arabidopsis thaliana e Caenorhabditis elegans Pianta erbacea Con genoma piccolo Nematode, circa 1000 cellule Con genoma piccolo Craig Mello Andew Fire

33 dsrna Esogeni (p.e. virus) Pre-miRNA sirna dsrna DICER sirna piccolissimi RNA associati a proteine con capacità idrolitica su RNA virali Difesa dall infezione

34 dsrna Trascritti dal Esogeni genoma (p.e. virus) Pre-miRNA sirna e mirna pri-mirna dsrna pre-mirna DICER mi-rna sirna piccolissimi RNA associati a proteine con capacità idrolitica su mrna cellulari su RNA virali Controllo posttrascrizionale Difesa dall infezione

35 Meccanismo antico (solo con sirna) che nasce come difesa da virus e da trasposoni. Nelle piante è una sorta di sistema immunitario endocellulare antivirale In seguito si è evoluto il processo dei mirna (sfrutta l esistenza di DICER e Argonauta) per la regolazione genica In alcuni organismi il processo è andato completamente perso (S.cerevisiae)

36 Somministrazione sperimentale di RNA Meccanismo antico (solo con sirna) che nasce come difesa da virus e da trasposoni. Nelle piante è una sorta di sistema immunitario endocellulare antivirale In seguito si è evoluto il processo dei mirna (sfrutta l esistenza di DICER e Argonauta) per la regolazione genica In alcuni organismi è andato completamente perso (S.cerevisiae) Poi sono arrivati i biotecnologi! possibilità di modulare a piacere l espressione di specifici geni

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

La sintesi delle proteine

La sintesi delle proteine La sintesi delle proteine Struttura del trna In che modo l informazione contenuta sotto forma di sequenze nucleotidiche nel DNA e nell RNA si traduce nella sequenza amminoacidica delle proteine? Esperimenti

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Trascrizione e maturazione degli RNA

Trascrizione e maturazione degli RNA Trascrizione e maturazione degli RNA Trascrizione e traduzione: espressione dell informazione genica L RNA veicola l informazione genica contenuta nel DNA (nucleo) in modo che possa esprimersi per dare

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Citosol Ribosomi Sintesi proteica

Citosol Ribosomi Sintesi proteica CITOSOL (1) Citosol Ribosomi Sintesi proteica Biotecnologie_2012 Tutta la porzione non strutturata che costituisce la parte liquida del citoplasma. In esso si trovano in soluzione tutte le molecole necessarie

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà Bioinformatica RNA non codificanti ed RNAi Dott. Alessandro Laganà Piccoli RNA non codificanti Struttura dell RNA RNA regolatore microrna RNAi e sirna 2 Bioinformatica: RNA non codificanti ed RNAi L RNA

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Compattamento del DNA nel cromosoma

Compattamento del DNA nel cromosoma Compattamento del DNA nel cromosoma DOMA CENTRALE DELLA BIOLOIA l'informazione genetica, contenuta nel nucleo nella molecola di DNA, si trasferisce al citoplasma. I geni del DNA vengono, nel nucleo, trascritti

Dettagli

Sintesi e degradazione delle proteine

Sintesi e degradazione delle proteine Prof. Giorgio Sartor Sintesi e degradazione delle proteine Copyright 2001- by Giorgio Sartor. All rights reserved. B15 - Versione 1.4.1 may Trasmissione dell informazione L informazione è contenuta nel

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

RNA interference e sue applicazioni

RNA interference e sue applicazioni RNA interference e sue applicazioni Cosa è l RNA interference Come funziona Funzione biologica nei diversi organismi Come può essere utilizzata per fini applicativi e di genetica funzionale Che cosa è

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

I mirna NEI MECCANISMI ANTIVIRALI

I mirna NEI MECCANISMI ANTIVIRALI Davide Schiavone Biochimica A.A. 2004-2005 I mirna NEI MECCANISMI ANTIVIRALI I processi di difesa antivirale operati da RNA sfruttano diversi meccanismi che sono raggruppati sotto il nome di RNA silencing.

Dettagli

RNA 29/10/2014. Struttura chimica del RNA

RNA 29/10/2014. Struttura chimica del RNA I Nucleotidi Hanno Tre Componenti Solo DNA Solo RNA Acidi nucleici RNA http://www.uic.edu/classes/phys/phys461/phys450/anjum04/ Struttura chimica del RNA http://www.ncbi.nlm.nih.gov/b ooks/nbk26887/figure/a978/?

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Elementi di genetica agraria

Elementi di genetica agraria Elementi di genetica agraria Obiettivo Il corso si pone l obiettivo di fornire agli studenti elementi di conoscenza della genetica di base e applicata ai fini del miglioramento genetico delle piante erbacee

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente 21) Il ph influenza l'attività enzimatica modificando la struttura del sito attivo con il cambiamento della distribuzione delle cariche coinvolte nei legami tra il substrato e il sito attivo. L'intervallo

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare Facoltà di Ingegneria dell Informazione Laurea Specialistica e Magistrale in Ingegneria Informatica Facoltà di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

La mutazione. Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica

La mutazione. Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica La mutazione Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica La mutazione 1. Crea variabilità sulla quale agisce

Dettagli

Classificazione. I complessi. Le pietre miliari della tassonomia. Tassonomia del genere Mycobacterium. Pietre miliari nella tassonomia dei micobatteri

Classificazione. I complessi. Le pietre miliari della tassonomia. Tassonomia del genere Mycobacterium. Pietre miliari nella tassonomia dei micobatteri Le pietre miliari della tassonomia Tassonomia del genere Mycobacterium Enrico Tortoli Centro Regionale di Riferimento per i Micobatteri Firenze Adamo è autorizzato da Dio a dare un nome a tutti gli esseri

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Differenze tra RNA e DNA

Differenze tra RNA e DNA Differenze tra RNA e DNA Acidi nucleici RNA TIPI PRINCIPALI DI RNA PRODOTTI NELLE CELLULE Funzione e struttura del RNA Tipo di RNA mrna rrna trna snrna snorna Altri RNA non codificanti Funzione RNA messaggeri,

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

2. SCOPO E STRATEGIE ADOTTATE

2. SCOPO E STRATEGIE ADOTTATE 2. SCOPO E STRATEGIE ADOTTATE Lo scopo del lavoro è la derivazione di fibroblasti bovini con modificazioni mirate, in modo da ottenere integrazioni di DNA esogeno in regioni specifiche del genoma. Questo

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario Il DN e la duplicazione cellulare Il DN, materiale ereditario Struttura del DN Replicazione del DN Dal DN alla proteina Il odice genetico iclo cellulare Mitosi Meiosi Da Figura 8-11 ampbell & Reece cidi

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati

Dettagli

IL RUOLO DELLE MOLECOLE DI RNA ANTISENSO NELLA REGOLAZIONE DELL ESPRESSIONE GENICA IN EUCARIOTI

IL RUOLO DELLE MOLECOLE DI RNA ANTISENSO NELLA REGOLAZIONE DELL ESPRESSIONE GENICA IN EUCARIOTI IL RUOLO DELLE MOLECOLE DI RNA ANTISENSO NELLA REGOLAZIONE DELL ESPRESSIONE GENICA IN EUCARIOTI Slide 9 I RIBOZIMI: La scoperta di RNA dotati di attività catalitica ha profondamente cambiato la visione

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

LA BIOINFORMATICA LEZIONI. Le principali banche dati biologiche sono: EMBL datalibrary (Europa); GenBank (USA); DDBJ (Giappone).

LA BIOINFORMATICA LEZIONI. Le principali banche dati biologiche sono: EMBL datalibrary (Europa); GenBank (USA); DDBJ (Giappone). NME... CLASSE... DATA................................... LA BIINFRMATICA Tutto cominciò attorno al 1990 quando si è assistito a una crescita parallela della ricerca genetica e delle potenzialità dei computer.

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili.

Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. La sensibilita delle vie di trasduzione dipende da 3 fattori: -l affinita

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

proteina gene G G T A A C T G

proteina gene G G T A A C T G Nozioni di base Ogni essere vivente è composto di cellule Gli esseri viventi sono molto diversi fra loro, ma tutti, batteri, tulipani, gatti o uomini, sono costituiti da cellule. Gli organismi unicellulari,

Dettagli

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione

Dettagli

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni Anomalie Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni 17 Transcrittasi inversa 18 Codice genetico mitocondriale 19 Codone

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica Gli aminoacidi NOMENCLATURA Aminoacido Abbr. tre lettere Abbr. una lettera Aminoacido Abbr. tre lettere Abbr. una lettera Alanina ALA A Lisina LYS K Arginina ARG R Metionina MET M Asparagina ASN N Fenilalanina

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna.

Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna. ( RNAi ) RNA Interference Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna. E un meccanismo naturale in piante, funghi, insetti e mammiferi. Cronologia:

Dettagli

Utilizzo di RNA in biologia sintetica

Utilizzo di RNA in biologia sintetica Corso di Bioingegneria Molecolare e Cellulare Utilizzo di RNA in biologia sintetica Presentato da Cinzia Nepa Matteo Amidei Enrico Altini Luca Monti Federica Canella 1 Le molecole di RNA giocano un ruolo

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE Nell ultima fase della sintesi proteica la catena polipeptidica neosintetizzata assume spontaneamente la sua conformazione nativa (massimo numero di legami

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte

Dettagli

Continua. Peptidasi H 2 O

Continua. Peptidasi H 2 O Continua Peptidasi H 2 O Classificazione delle peptidasi 1. Meccanismo catalitico 2. Tipo di reazione catalizzata 3. Struttura molecolare e omologia 1. Meccanismo catalitico (mostrato per la chimotripsina)

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli