La vita si basa su composti di carbonio immersi in acqua. Esso inoltre è capace di formare legami forti con gli altri atomi.

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La vita si basa su composti di carbonio immersi in acqua. Esso inoltre è capace di formare legami forti con gli altri atomi."

Transcript

1 Il carbonio La vita si basa su composti di carbonio immersi in acqua. Esso inoltre è capace di formare legami forti con gli altri atomi. Classi principali di molecole biologiche (Pag. 39). Carboidrati Lipidi Proteine Acidi nucleici Molecole complesse, (polimeri) sono formate da quelle di base, (monomeri) il glucosio è un monosaccaride, mettendo assieme più molecole di glucosio otteniamo un polisaccaride come l amido o la cellulosa. I carboidrati [C-H-O] Le unità base dei carboidrati sono i monosaccaridi, come il glucosio, per noi la più importante fonte di energia. Il glucosio può legarsi con altri monosaccaridi, formando carboidrati più complessi. I lipidi Sono insolubili in acqua e non risultano composti da monomeri. Una classe di lipidi molto comune sono i gliceridi. Le tre teste carbossiliche C-O-H del glicerolo si legano alle teste idrossile O-H di tre catene di idrocarburi, formando legami estere; si forma cosi un trigliceride (un grasso): GLICEROLO + 3ACIDI GRASSI =TRIGLICERIDE + 3H2O Nei fosfolipidi invece, una delle tre catene di acidi grassi è sostituita da un gruppo fosfato H-P, che a sua volta si lega ad una base azotata. (H-P -) + (N-H-O+) = TESTA POLARE (+/-) _ ACIDI GRASSI. Per questa doppia proprietà idrofoba e idrofila i fosfolipidi sono indispensabili per costituire le pareti dei componenti cellulari. Le proteine Sono molecole biologiche polifunzionali costituite da catene di amminoacidi. La classe di proteine più utilizzate dagli organismi viventi sono gli enzimi, responsabili di tutte le funzioni chimiche che avvengono in loro. Una catena di N amminoacidi si chiama polipeptide. Gli amminoacidi che formano le proteine sono 20 e sono classificati in base alla catena laterale R: NUCLEO (C-H) GRUPPO AMMINICO (NH2) GRUPPO CARBOSSILICO (COOH) CATENA LATERALE 1

2 Gli amminoacidi sono per le proteine come lettere dell alfabeto nelle parole. Il legame tra il gruppo carbossilico di un amminoacido e quello ammino dell altro si chiama legame peptidico: COOH + NH2 = (CO_NH) + (H2O) Per condensazione si perde una molecola d acqua. Quali forme possono assumere le proteine? Struttura primaria (sequenza di amminoacidi) Struttura secondaria (alfa elica, foglio spiegazzato) Struttura terziaria (catena polipeptidica ripiegata su se stessa) Struttura quaternaria (due o più catene polipeptidiche). Dalla forma assunta dalla proteina derivano le sue funzioni, ma può perdere la sua forma caratteristica (denaturata). Gli acidi nucleici (DNA _ RNA) Sono polimeri formati da nucleotidi, l unione dei nucleotidi forma il DNA (acido desossiribonucleico) che contiene le informazioni per fabbricare le proteine; una sequenza di nucleotidi che reca le istruzioni per la produzione di una certa proteina si chiama gene. L RNA (acido ribonucleico) trasporta le istruzioni codificate nel DNA ai siti della cellula dove avviene il montaggio delle proteine. La struttura dei nucleotidi è costituita da tre parti: Gruppo fosfato Desossiribosio /ribosio Base azotata I nucleotidi sono collegati tra loro secondo la struttura a doppia elica. La cellula Ogni cellula ha origine da una cellula preesistente, tutti gli esseri viventi derivano da una cellula primordiale sviluppatasi 3,5 miliardi di anni fa. Cellula procariote (batteri) Cellula eucariote (animali, vegetali, insetti, funghi). Il procariote è la cellula ancestrale che ha colonizzato tutti gli habitat. Le cellule procariote sono indipendenti e si possono aggregare tra loro come i cocchi. Al loro interno non sono divise in settori, vi è un unica membrana plasmatica costituita da un doppio strato lipidico che contiene DNA omogeneo e ribosomi (RNA + proteine). Il tutto avvolto da un ulteriore rivestimento o parete cellulare, costituito da una struttura rigida di polisaccaridi o proteine. Alcuni batteri hanno inoltre un ulteriore capsula. Sono organismi autotrofi capaci quindi di nutrirsi da se, hanno, infatti, la capacità di ottenere le sostanze utili da minerali, CO2, azoto ecc. ; per sintetizzare i suoi componenti partendo quasi da zero. Vi sono anche batteri in grado di utilizzare la fotosintesi (foto autotrofi). Tutti gli altri organismi sono eterotrofi. La cellula eucariotica Presenta un nucleo e altri componenti dotati tutti di membrane. Vi sono quindi diversi compartimenti che separano l esterno dall interno. Ciò consente una divisione del lavoro, tenendo le molecole da sintetizzare concentrate in determinate parti: 2

3 Nucleo Retticolo endoplasmatico Ribosomi Apparato del Golgi Mitocondri Lisosomi Il nucleo contiene il DNA e i nucleoli. La membrana nucleare protegge il nucleo e attraverso i suoi pori, il nucleo può interagire col citoplasma. Il retticolo endoplasmatico (R-E rugoso/liscio) si dipana dal nucleo e serve a sintetizzare le proteine attraverso i ribosomi del R-E rugoso (RNA + proteine). L apparato del Golgi seleziona le proteine prodotte, destinate anche alla sostituzione delle porzioni di membrana plasmatici perse durante i processi di endocitosi (ing. Sostanze) ed esocitosi (usc. Sostanze). I mitocondri sono costituiti da una membrana esterna e da una interna, contengono DNA mitocondriale e ribosomi (RNA + proteine). Producono ATP, la moneta energetica della cellula. Le cellule vegetali contengono anche i cloroplasti che sono come dei mitocondri ma hanno anche la clorofilla che consente la fotosintesi. I lisosomi contengono enzimi digestivi che demoliscono tutto ciò che entra nella cellula. Una teoria diffusa dice che mitocondri e cloroplasti sarebbero stati dei batteri indipendenti che nel corso dell evoluzione sono entrati in simbiosi con le cellule per mutuo vantaggio. Il batterio trova un ambiente protetto dove trova cibo mentre la cellula ottiene ATP. Con l evoluzione questa dipendenza è divenuta irreversibile; il batterio non è più indipendente, parte del suo DNA appartiene al genoma del nucleo. Accenni sul metabolismo Energia = capacità di produrre cambiamento; l energia non può essere ne creata ne distrutta Legami chimici Spostamento di sostanze Le trasformazioni dell energia sono in relazione ai cambiamenti della materia Luminosa Chimica Meccanica Energia cinetica/potenziale Energia potenziale/cinetica In natura si chiama metabolismo e viene messo in funzione da determinati enzimi Reazioni anaboliche/endoergoniche ( richiedono energia e da un certo numero di monomeri si ottiene un polimero Reazioni cataboliche/esoergoniche (liberano energia e demoliscono i polimeri ottenendo dei monomeri) 3

4 Prima legge della termodinamica in qualsiasi trasformazione di energia da una forma all altra l energia totale prima o dopo la trasformazione è sempre la stessa seconda legge della termodinamica energia tot =energia utilizzabile energia inutilizzabile (per mantenere l equilibrio è necessaria una fonte di energia costante) L ATP È la moneta energetica della cellula (adenosina trifosfato). Può compiere una reazione endoergonica cedendo il più esterno dei tre gruppi fosfato, rendendo cosi disponibile dell energia. A questo punto l ATP diviene ADP, quando si è stato aggiunto ad essa il terzo gruppo fosfato, immagazzina nuova energia ridivenendo ATP. L energia che acquista divenendo tale deriva dal cibo: [C6H12O6 + 6 O2] / ADP = [6CO2 + 6H2O] / ATP Ossidazione (il glucosio tramite l ossigeno cede energia utile all ADP Riduzione (l ADP tramite un gruppo fosfato immagazzina l energia, il glucosio è scomposto in anidride carbonica e acqua). Il passaggio dell energia dal glucosio all ATP avviene attraverso numerose reazioni chimiche catalizzate dagli enzimi e suddivise in tre tappe: Glicolisi Ciclo di Krebs Catena di trasporto degli elettroni La membrana plasmatica Forma compartimenti selettivi ed è semi impermeabile. Questo garantisce una selezione delle molecole; il doppio strato di fosfolipidi forma le membrane cellulari. Come fa una membrana idrofila a passare? Questo si spiega con la presenza di proteine specifiche e anche una certa quantità di colesterolo. Quali funzioni hanno queste proteine? Canali (porte di accesso per altre sostanze) Contatto (con altre proteine di matrice extracellulare che possono formare un ulteriore protezione, di solito polisaccaridi) Recettori (come l insulina, fanno entrare sostanze come proteine o altre molecole; cambiano la forma della proteina e quindi le sue funzioni. Ricevono quindi segnali dall esterno, come le sinapsi. 4

5 Enzimi (addetti alle funzioni chimiche) Questi componenti sono integrati all interno della membrana. Natura chimica del gene Come si mantengono costanti gli individui della stessa specie? Auto duplicazione Estrema stabilità Come ci spieghiamo l evoluzione? Con le mutazioni Come si è arrivati a capire che le istruzioni genetiche fossero contenute nel DNA? 1928, esperimento di Griffith sullo streptococcus preomonie, su due ceppi (2S/2R; 3S/3R), riesce a ottenere una mutazione dal ceppo 2R al ceppo 3S. Per Griffith esiste un principio trasformante. 1940, gli americani lavorano sugli stessi ceppi, 2R + lisato di 3S. La mutazione si ripete; l esperimento conferma le conclusioni di Griffith. In un secondo esperimento effettuano al ceppo 2R aggiunte di componenti del lisato in modo selettivo. All aggiunta di DNA avviene la mutazione. 1952, un altro gruppo americano effettua l esperimento decisivo utilizzando il virus T2 e un batterio. Il T2 venne nutrito con isotopi radioattivi del fosforo, il batterio invece fu nutrito con isotopi radioattivi dello zolfo. Dimostrarono cosi il ruolo di preminenza del DNA. Struttura del DNA Il monomero del DNA è il nucleotide: Gruppo fosfato Zucchero (desossiribosio) Base azotata Le basi azotate sono quattro divise in due gruppi di derivati: Purine (adenina / guanina) Pirimidine (timina /citosina / uracile) Secondo le regole di Chagaff in ogni DNA, indipendentemente dalla sorgente il n di purine è uguale a quello delle pirimidine, (A + G) = (T + C). C1 (si lega alla base azotata) C3 (si lega al gruppo fosfato anteriore C5 (si lega al gruppo fosfato posteriore) 5

6 Secondo il modello di Watson & Crick il DNA ha una struttura a doppia elica, come una scala a chiocciola, dove il legame fosfato / zucchero forma il corrimano; mentre purine e pirimidine formano gli scalini. Le due catene sono antiparallele [(3 _5 )/(5 _3 )]. Livelli di organizzazione del DNA Come fa una lunga sequenza di nucleotidi come il DNA a stare dentro il nucleo? Esso è ripiegato in se stesso a formare i cromosomi. Nei procarioti esiste un solo cromosoma e la molecola di DNA è chiusa. Degli enzimi specifici hanno il compito di compattare il DNA; un gruppo preciso di nucleotidi formano il gene, (polinucleotide). Il genoma è dunque l insieme dei geni presenti nel DNA. Struttura dei cromosomi eucarioti: Le proteine istoniche riunite in gruppi da 8 formano un istone attorno al quale si avvolge il DNA. Questo è dovuto al fatto che gli istoni sono basici mentre il DNA è acido. I listoni formano le fibre di cromatina detta a collana di perle ; l enzima H1 è importante per la struttura della cromatina che tende a formare il tessuto del cromosoma. Il locus è il luogo dove si trova un determinato gene nel cromosoma. Replicazione del DNA La complementarietà delle due eliche spiega come avviene la duplicazione. Questa è conservativa o semiconservativa? Esperimento dei gradienti dell azoto 15: Se ho una replicazione semiconservativa la densità di azoto sarà tra 14 e 15 Se ho una replicazione conservativa avrò una doppia banda 14; 15 Secondo questo esperimento è stata dimostrata la duplicazione semiconservativa. La polimerasi I nucleotidi trifosfati perdono, per azione della proteina polimerasi, due gruppi fosfati liberando l energia necessaria all inserimento del nucleotide nella catena di DNA. La polimerasi assembla i nucleotidi in direzione 5-3 a partire da uno stampo originario. Lega al 3 libero del nucleotide precedente. L origine di replicazione è un punto del genoma ricco di coppie A-T; avendo un solo legame idrogeno sono più facili da aprire. Lo svolgimento della doppia elica viene effettuato dall enzima elicasi. Mentre l elicasi avanza aprendo la doppia elica la primasi prepara lo stampo originario 5-3 ; ora con un 3 libero da cui cominciare la polimerasi avanza in direzione 5-3. Nella catena 3-5 la polimerasi non può cominciare la duplicazione, torna in gioco la primasi che in fondo alla catena continua a rilasciare degli stampi; in direzione contraria la polimerasi completa un tratto di catena per poi saltare allo stampo successivo. Frammenti Okazaki Si tratta delle sequenze di DNA prodotte nel filamento ritardato, dove gli stampi prodotti dalla primasi sono stati cancellati rimangono degli spazi vuoti. 6

7 Spazi vuoti (ligasi) Estremità del filamento più lunga (telomerasi) Comunque alle estremità esistono i telomeri (TTAGGG) che riducono le perdite di informazione. Espressione genetica I Come si esprimono le informazioni? Con la trascrizione: La molecola trasportatrice dell informazione dal nucleo al citoplasma, dove avviene la sintesi è l RNA: Ribosio più basi Prodotto dall RNA polimerasi A differenza della duplicazione, la trascrizione riguarda solo i singoli geni e non tutto il genoma. Solo una delle due eliche funge da stampo. Catena codificante (3-5 ) Catena stampo (5-3 ) Dove la sequenza del gene in 5-3 è il promotore dell RNA. Il fattore sigma dell RNA polimerasi riconosce la sequenza consenso * 3 -AACTGT-[ ]-ATATTA-5 5 -TTGACA-[ ]-TATAAT-3 * del promotore del gene. Ogni gene ha il suo promotore; le sequenze consenso differiscono di poco da un promotore all altro. Il gene si conclude con una sequenza palindromo detta terminatore 5 -AATCCTAA-3 del gene. Vi sono quattro tipi di RNA: m RNA r RNA t RNA sn RNA Come è possibile passare dall RNA ad una sequenza di amminoacidi? Il codice genetico 1. a triplette 2. non sovrapposto 3. universale 4. segnali di inizio / fine 5. degenerato non ambiguo 6. vacillamento della terza base (Wobble) [codice degenerato non ambiguo] RNA amminoacidi e ribosomi 7

8 Il t RNA collega l informazione dei codoni m RNA alla proteina corrispondente. Trasporta specifici amminoacidi e si lega a specifici codoni. All estremità 3 [ACC] è il punto di contatto con l amminoacido. L anticodone entra in contatto con l RNA. L enzima attivante t RNA sintetasi collega il t RNA con il corretto amminoacido 1. l enzima attiva l amminoacido catalizzando una reazione con l ATP per formare la molecola ad elevata energia AMP 2. l enzima catalizza la reazione tra l AMP e il t RNA corretto 3. la specificità dell enzima fa si che il corretto amminoacido reagisca con l appropriato t RNA I ribosomi come banchi di lavoro della traduzione Traducono il messaggio genetico in catene polipeptidiche. Sub unità minore (m RNA) Sub unità maggiore (t RNA) La sub unità maggiore si divide in quattro compartimenti 1. [T] la proteina T accompagna t RNA carico 2. [A] il t RNA si lega all m RNA tramite legame codone anticodone 3. [P] il t RNA cede l amminoacido caricato 4. [E] t RNA in uscita e il ciclo continua. Tutto RNA ha riconosciuto il codone di inizio AUG del t RNA (complesso di inizio). Il tutto è catalizzato da delle proteine chiamate fattori di inizio. A questo punto la sub unità maggiore catalizza due funzioni: rompe il legame t RNA con l amminoacido crea legame peptidico con quello successivo (attività polipeptidil transferasica) Il vero catalizzatore di questo legame è per la precisione l r RNA. Arrivati al codone di stop [UAA/UAG/UGA] viene legata la proteina fattore di rilascio che idrolizza il legame tra il polipeptide e il t RNA nel sito [P]. Una singola molecola di m RNA può essere tradotta contemporaneamente da più ribosomi. In questo modo vengono prodotti simultaneamente numerose catene polipeptidiche. Le mutazioni geniche Errori nella replicazione, trascrizione, traduzione del DNA danno origine alle mutazioni. Sono modificazioni ereditabili dell informazione genetica mutazioni somatiche germinali tutte le mutazioni sono alterazioni della sequenza nucleotidica del DNA mutazioni puntiformi (a singoli geni) mutazioni cromosomiche (dei gameti) 8

9 Mutazioni silenti [CCA/CCC/CCU/CCG] = PROLINA stampo DNA [GGC] = m RNA [CCG] MUTAZIONE [GGC _ GGA] = m RNA [CCU] Sia CCG che CCU sono i codoni che codificano la prolina. Mutazioni di senso [CTA] = [GAU] = ASP. MUTAZIONE [CTA _ CAA] = [GUU] = VAL. Mutazioni non senso Causano la comparsa di un codone di stop in anticipo. Il prodotto proteico sarà dunque incompleto. Frame shift mutations (mutazioni per spostamento della griglia di lettura) DNA [TAC][ACC][GAG][GGC][CTA][ATT] RNA [AUG][UGG][CUG][CCG][GAU][UAA] Seq. [met] [trp] [leu] [gli] [asp] [stop] MUTAZIONE DNA [TAC][ACC][TGA][GGG][CCT][AAT][T...] RNA [AUG][UGG][ACU][CCC][GGA][UUA][A...] Seq. [met] [trp] [thr] [pro] [gli] [leu] [ ] Per inserimento o rimozione, si verifica un interferenza nella decodificazione del messaggio genetico, in questo caso con la comparsa di T tra le basi 6 e 7 della sequenza polinucleotidica. Le mutazioni cromosomiche delezioni (perdita di parte del patrimonio genetico) duplicazioni (cromosomi omologhi si rompono in punti diversi e si riuniscono scambiando i segmenti cosi generati Elphrg01.wav inversioni (reinserimento di un segmento rotto in modo invertito) traslocazioni (scambio di frammenti tra cromosomi non omologhi) Mutazioni spontanee o indotte La citosina, mutata nella forma tautomerica rara lega con A causando la mutazione puntiforme G _ A. Di solito la C mutata (uracile) torna spontaneamente normale oppure grazie ai meccanismi di replicazione del DNA viene corretta; diversamente, superata la seconda duplicazione non c è più possibilità di correzione e la sequenza mutata permane. 9

10 Genetica dei virus e dei procarioti Importante per lo studio della struttura, funzione e trasmissione dei geni; lavorare con procarioti e virus presenta alcuni vantaggi. Piccoli genomi Si moltiplicano rapidamente Generalmente possiedono genomi apolidi I virus sono dei parassiti intracellulari obbligati, per riprodursi utilizzano il macchinario sintetico della cellula ospite. I batteriofagi o fagi si riproducono attraverso il ciclo litico o quello lisogeno. Ciclo litico Tipico dei virus virulenti. Il fago inietta il proprio acido nucleico all interno dell ospite 1. stadio precoce (la sequenza promotore del genoma virale attrae la RNA polimerasi che trascrive i geni virali che codificano proteine come la nucleasi che digerisce il DNA ospite al fine di ottenere basi ). 2. stadio tardivo ( queste basi servono per replicare il genoma virale e le capsidi, un altra proteina causa la lisi della cellula e i virus si propagano. Ciclo lisogeno Tipico dei virus temperati che possono utilizzare entrambe i cicli. Il DNA fagico si integra nel cromosoma batterico e diventa un profago non infettivo, il cromosoma contenente il profago integrato, si replica. In certi casi il profago può liberarsi dal cromosoma ospite e la cellula può entrare nel ciclo litico. Il ciclo riproduttivo dell HIV 1. L HIV si attacca alla cellula ospite a livello della proteina CD4. 2. il rivestimento virale si fonde con la membrana plasmatica, il capside si rompe e l RNA viene liberato. 3. l RNA virale utilizza la trascrittasi inversa per sintetizzare il DNA complementare (Cdna). 4. l RNA virale viene degradato. 5. la trascrittasi inversa sintetizza il secondo filamento di Cdna. 6. il cdna penetra nel nucleo e viene integrato nel cromosoma ospite, formando un provirus. 7. in seguito ad attivazione, il DNA provirale viene trascritto nell RNA virale che viene trasportato nel citoplasma. 8. nel citoplasma l RNA virale viene tradotto in proteine, utilizzando i ribosomi della cellula ospite. 9. proteine virali, nuovi capsidi, RNA e rivestimenti vengono assemblati. 10. un virus neo-formato gemma dalla membrana cellulare. Il genoma degli eucarioti e la sua espressione I genomi degli eucarioti sono più grandi, possiedono più punti di regolazione, gran parte del genoma non ha funzione codificante; inoltre sono presenti più cromosomi e i relativi omologhi. Trascrizione e traduzione sono fisicamente separate. 10

11 Le sequenze ripetute telomeri trasposoni Struttura dei geni che codificano proteine esoni + introni (pre-m.rna/m.rna maturo) famiglie di geni (gruppo di geni duplicati o strutturalmente correlati) RNA processing L m.rna maturo per uscire dal nucleo deve essere accettato da un determinato recettore. Il controllo dell espressione genetica a livello trascrizionale processo altamente selettivo (solo i geni domestici vengono tradotti) i promotori eucariotici sono più vari di quelli procariotici e non esistono gli operoni diversi promotori/diverse polimerasi. Fattori di trascrizione promotore/polimerasi TATA box/proteine Regioni regolatrici (attivo/non attivo la trascrizione) Sequenze intensificatici (ripeto/non ripeto la trascrizione) Le sequenze silenziatore (on/off) Struttura della cromatina 11

12 Regolazione post-trascrizionale Splicing alternativo Regolazione della stabilità degli m.rna RNA editing Controllo traduzionale e post-traduzionale Una cellula non continua la produzione di proteine inutili Molti prodotti genici vengono modificati dopo la traduzione Degrado della proteina inutile Le proteine non marcate per la distribuzione nel citoplasma vengono legate all ubiquitina che la trasporta al proteosoma. Il proteosoma riconosce il complesso ubiquitina/proteina e degrada la proteina inutile. I procarioti: riproduzione e ricombinazione Riproduzione: eucarioti (ricombinazione genomica tramite gameti ) procarioti (interazione con un singolo frammento tramite coniugazione tra simili o trasduzione mediata dai virus)[vedi i PLASMIDI] prodotto della duplicazione: eucariote (zigote) procariote (clone) La mitosi Distribuzione di copie esatte dell informazione genetica, i centrosomi determinano il piano della divisione cellulare: Attivazione della fase S il DNA si duplica il centrosoma pure ogni centriolo è una struttura cilindrica cava formata da nove triplette di microtubuli. Fase G2 / M I centrosomi si separano e raggiungono i poli opposti dell involucro nucleare. Il materiale intorno ai centrioli inizia a formare microtubuli, che consentono i movimenti dei cromosomi. Profase 12

13 La cromatina si spiralizza e si condensa, diventando sempre più compatta fino ad assumere la forma dei cromosomi. I cromosomi sono costituiti da cromatidi fratelli appaiati (fase S) e identici tra loro. La coesina che unisce i due prodotti della duplicazione del DNA si è degradata. Alla fine della profase i cinetocori, (strutture a tre strati) uno per cromatide svolgeranno un ruolo importante per i movimenti dei cromosomi. Ogni centrosoma funge da polo verso il quale migreranno i cromosomi. Dai poli si dirama il fuso dei microtubuli. Prometafase L involucro nucleare si dissolve (profase), i microtubuli del cinetocore iniziano a organizzarsi e collegano i cinetocori con i centri di organizzazione dei microtubuli; i cromosomi si dispongono lungo la piastra equatoriale e i loro cromatidi sono ancora uniti al centromero dalla coesina. Metafase I centromeri (regioni che connettono i cromatidi appaiati) si allineano sul piano equatoriale della cellula. Al termine della metafase tutte le coppie di cromatidi si separano contemporaneamente. La separasi (finora inibita dalla securina) degrada la coesina permettendo la separazione. Anafase La separazione dei cromatidi caratterizza questa fase, i cromosomi figli iniziano a migrare verso i poli opposti della cellula. Due fattori sembrano coinvolti nel movimento dei cromosomi Telofase dineina citoplasmatica (ATP _ ADP) 75% dell energia consumata accorciamento dei microtubuli del cinetocoro. I cromosomi figli raggiungono i poli della cellula e la cellula entra in interfase quando l involucro nucleare e i nucleoli si riorganizzano e la cromatina despiralizza. La divisione del citoplasma avviene per citodieresi ad opera di un anello contrattile che separa le due cellule. La riproduzione mediante mitosi da luogo alla continuità genetica; la riproduzione mediante meiosi da origine alla variabilità genetica. La riproduzione sessuata La meiosi è caratterizzata da due divisioni nucleari consecutive, che riducono il numero dei cromosomi da diploide ad aploide Profase I meiosi I (crossing over) meiosi II (quattro cellule aploidi). Nello stadio di interfase che precede la profase, (fase S) il DNA di ogni cromosoma parentale si duplica; di conseguenza, ogni cromosoma sarà formato da due cromatidi fratelli, reciprocamente uniti dalla coesina. Nella fase che segue l interfase la cromatina inizia a condensarsi. I cromosomi omologhi si appaiano in base alla sequenza di loci e si compattano. 13

14 Prometafase I Si formano i chiasmi, proteine sinaptiche che tengono assieme gli omologhi durante la separazione, dando origine al crossing over (processo di sinapsi). I cromosomi omologhi costituiscono infatti una tetrade che li intreccia permettendo la ricombinazione genetica. Metafase I I cromosomi omologhi si allineano lungo la piastra equatoriale. Anafase I I cromosomi omologhi (ciascuno composto da due cromatidi) migrano verso i poli opposti della cellula. Telofase I Il citoplasma si divide assieme ai rispettivi nuclei. In seguito a una breve interfase, nel corso della quale il DNA non è stato duplicato, i cromosomi si condensano nuovamente (intercinesi). Ha dunque luogo la meiosi II che da origine a quattro cellule aploidi, frutto della divisione delle prime due. Gli errori della meiosi non disgiunzione mancato appaiamento degli omologhi (aneuploidia). L aneuploidia è una condizione in cui uno o più cromosomi mancano o sono presenti in soprannumero. Può dare origine a gravi anomalie genetiche. I due omologhi non appaiati potrebbero allinearsi verso il medesimo polo cellulare. L aneuploidia ai cromosomi 21, 18 e 13 è vitale, in tutti gli altri casi provoca l aborto. Trisomia (21/sindrome di Dawn, 18/sindrome di Patau, 13/sindrome di Edwards) Monosomia (non è vitale) La trisomia ai cromosomi 21, 18 e 13 è vitale, in tutti gli altri casi provoca l aborto. 14

15 I gameti Omogoni _ O+ Spermatogoni _ O-> Spermatocita primario Spermatocita secondario. Spermatocita secondario spermatide spermatide spermatide spermatide 1. lo spermatocita primario 2. i due spermatociti secondari 3. hanno origine quattro spermatidi 4. gli spermatici si trasformano in spermatozoi questo ciclo nell uomo è continuo. Ovocita primario Globulo polare Ovocita secondario Cellula uovo matura Cellula degradata 1. l ovocita primario 15

16 2. hanno origine il globulo polare e l ovocita secondario 3. solo l ovocita secondario si duplica 4. delle due cellule generate solo una, la cellula uovo, sopravvive; l altra degrada. Questo ciclo nella donna dura 40 anni. Mutazioni cromosomiche durante il crossing over delezioni (perdo un pezzo di cromosoma) duplicazioni (doppia copia di un gene) crossing over ineguale inversioni (un frammento si rompe e viene reinserito al contrario) traslocazioni (formazione di un gene ibrido a causa dello spostamento di un frammento in loco errato) Le basi della genetica Mendel nella metà del XIX secolo condusse esperimenti sull ereditarietà. Arrivò a dedurre due aspetti importanti della biologia genetica che sarebbero stati scoperti un secolo dopo; l esistenza dei geni e la meiosi. I coltivatori di piante hanno dimostrato che entrambi i genitori contribuiscono in egual misura all ereditarietà Gli organismi vegetali rappresentano un eccellente materiale per gli studi di genetica. Mendel aveva studiato la progenie di incroci reciproci. Smentisce inoltre il concetto di eredità intermedia secondo cui i caratteri si fondono inscindibilmente. Utilizzò per molti dei suoi esperimenti piante di pisello odoroso, pisum sativum. Isolò linee pure di piselli secondo 7 caratteri dicotomici alternativi. Si assicurò che ogni potenziale genitore appartenesse a una linea pura per il carattere in questione. Mendel ipotizza l esistenza di un fattore particolato, noi sappiamo che si tratta di coppie di alleli. Un allele è dominante, l altro è recessivo (S s); (Y y). Prima legge (di segregazione) I due membri di una coppia (alleli) segregano durante la formazione dei gameti. La segregazione degli alleli è data dalla separazione dei cromosomi omologhi nella 1^ divisione meiotica. Seconda legge (assortimento indipendente dei caratteri) Alleli di geni diversi assortiscono in modo indipendente l uno all altro. Alleli di geni localizzati su cromosomi diversi si comportano indipendentemente durante la formazione dei gameti. La teoria cromosomica dell ereditarietà Sappiamo che per un singolo carattere possono esistere molti alleli differenti. Nuovi alleli si originano per mutazione. Gli alleli di un gene sono riferibili ad uno stesso locus. Gli alleli che codificano per caratteri diversi assortiscono sempre in modo indipendente? Due geni non assortiscono in modo indipendente se si trovano a distanza ravvicinata sullo stesso cromosoma; per quelli distanti entra invece in gioco il crossing over. Concetti chiave allele (dominante / recessivo) fenotipo (carattere espresso) 16

17 genotipo (informazione genetica) diploide (coppia di alleli per ogni gene) omozigote (una classe di geni per ogni loco) eterozigote (classi differenti per ogni loco) Ereditarietà legata al sesso I cromosomi X / Y svolgono funzioni diverse. XO _ femmine con moderate anomalie, nonché sterili (sindrome di Turner) XXY _ maschi di statura superiore alla media e sterili (sindrome di Kline Felter) Alcuni individui XY sono fenotipicamente femmine a causa della mancanza di una porzione del cromosoma Y Alcuni maschi sono geneticamente XX ma possiedono un segmento di Y in un altro cromosoma. Modalità di eredità Eredità nei cromosomi Autosomica recessiva (2 alleli recessivi uguali) Autosomica dominante (1 allele dominante) X recessivo (malati omozigoti) X dominante ( malati eterozigoti) Y (malati emizigoti) Mitocondriale (trasmissione materna) Esercitazioni Aa Bb (due loci, quattro alleli, cellula diploide) AB Ab ab ab (quattro tipi di gameti aploidi) Aa BB Cc DD Ee FF : Abbiamo sei loci 2 elevato il numero di loci eterozigoti (tot 3) =8 combinazioni diverse (2x2x2=8) le classi di gameti indicano il numero di gameti possibili [?]. 17

18 Esercizi di genetica Aneuplasie Mancata disgiunzione degli omologhi (I^ divisione meiotica) [1:2] 21_21/18_ / / /18 0/18 0/ / /18 0/18 0/18 trisomia 21 monosomia 21 mancata disgiunzione dei cromatidi fratelli (II^ divisione meiotica) [1:4] 21-21/ / /18 21/18 21/18 21/18 21/ /18 21/18 21/18 trisomia 21 monosomia 21 sani 18

19 Malattia autosomica recessiva Aa-AA AA aa AA aa portatore + sano = [1:2portatori/1:2sani] portatore + portatore = [1:4sani/1:4malati/1:2portatori] malato + sano = [100% portatori] malato + portatore = [1:2malati/1:2portatori] Autosomica dominante Aa-AA AA aa AA aa M + S = [1:2M/1:2S] M + M = [3:4M/1:4S] M + S [100%M] M + M [100%M] 19

20 Malattia al cromosoma X recessiva Xx -XY XX xx XY xy SOLO LE DONNE SI AMMALANO FP + MS = [1:2P/1:2S] FP + MP = [1:4M/1:4S/1:2P] FM + MS = [100%P] FM + MP = [1:2MP/1:2FM] Malattia al cromosoma X dominante Xx -XY XY xy XY xy 20

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente 21) Il ph influenza l'attività enzimatica modificando la struttura del sito attivo con il cambiamento della distribuzione delle cariche coinvolte nei legami tra il substrato e il sito attivo. L'intervallo

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario Il DN e la duplicazione cellulare Il DN, materiale ereditario Struttura del DN Replicazione del DN Dal DN alla proteina Il odice genetico iclo cellulare Mitosi Meiosi Da Figura 8-11 ampbell & Reece cidi

Dettagli

I Composti Organici. Le Biomolecole

I Composti Organici. Le Biomolecole I Composti Organici I composti organici sono molecole tutte contenenti carbonio. Essi comprendono. 1. composti di interesse energetico che sono gli Idrocarburi ( i derivati del petrolio), 2. composti a

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice

Dettagli

CELLULE EUCARIOTICHE

CELLULE EUCARIOTICHE CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica, citoplasma, DNA e ribosomi (comuni a

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015. Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed.

PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015. Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed. PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015 CHIMICA Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed. Tramontana S. Passannanti C. Sbriziolo Noi e la chimica agli atomi

Dettagli

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA.

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

Costituzione dei viventi

Costituzione dei viventi Costituzione dei viventi La materia e costituita da elementi chimici in forma pura o in combinazioni dette composti 25 dei 92 elementi naturali sono costituenti essenziali dei viventi 4 (C, O,, N) costituiscono

Dettagli

Livello di organizzazione degli esseri viventi

Livello di organizzazione degli esseri viventi Livello di organizzazione degli esseri viventi _Organismo; _Apparato; _Organo; _Tessuti; _Cellule; _Organelli cellulari; _Molecole. Atomo, elemento, molecola, composto, formula, legame, elettronegativita.

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino Strutture molecolari della cellula: Bio-macromolecole Prof. C. Guarino INTRO Ogni cellula vivente racchiude una pluralità di molecole diverse L acqua è l elemento dominante, nelle cellule vegetali e nei

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione

Dettagli

svolgimento del programma precedente M F totale

svolgimento del programma precedente M F totale PROGRAMMAZIONE ANNO SCOLASTICO 2009-2010 Docente:Cristina Marcon CLASSE 2A Materia: Biologia 1. Nel primo consiglio di classe sono stati definiti gli obiettivi educativo-cognitivi generali che sono stati

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE Tutti i tipi cellulari presenti sul nostro pianeta appartengono ad uno di due gruppi fondamentali: procarioti ed eucarioti. I termini procariota (dal greco pro

Dettagli

Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente.

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. CHE COS E LA CELLULA? La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. DA COSA SONO COSTITUITE LE CELLULE? Tutte le

Dettagli

Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

LA MOLTIPLICAZIONE DEI VIRUS

LA MOLTIPLICAZIONE DEI VIRUS LA MOLTIPLICAZIONE DEI VIRUS I virioni, rappresentano la fase biologicamente inattiva, dei singoli virus. Le diverse famiglie di virus utilizzano strategie replicative a causa della differente organizzazione

Dettagli

LA GENETICA. Dott.ssa Valentina Terio

LA GENETICA. Dott.ssa Valentina Terio LA GENETICA Dott.ssa Valentina Terio LLA GENETCA SCIENZA NATA CIRCA 150 ANNI FA GRAZIE AD UN STUDIOSO AUSTRIACO DI NOME MENDEL Pisello da giardino per la facilità di crescita e la possibilità di una impollinazione

Dettagli

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO GENERALITA A causa della natura di PARASSITA INTRACELLULARE OBBLIGATO, il virus può esprimere la sua attività biologica solo all interno di una CELLULA OSPITE che permetta la completa espressione del suo

Dettagli

PIANO DIDATTICO CLASSE II BIOLOGIA ANNO SCOLASTICO 2010 2011 PERCORSO FORMATIVO

PIANO DIDATTICO CLASSE II BIOLOGIA ANNO SCOLASTICO 2010 2011 PERCORSO FORMATIVO Liceo Scientifico Statale Vito Volterra - Ciampino PIANO DIDATTICO CLASSE II BIOLOGIA ANNO SCOLASTICO 2010 2011 Finalità - Comprensione del testo e sua utilizzazione come strumento conoscitivo - Sviluppo

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 ASSE DISCIPLINA SCIENTIFICO TECNOLOGICO BIOTECNOLOGIE AGRARIE DOCENTE DARMAN ELENA 2 BIENNIO CLASSE 3 CORSO E SEZIONE TECNICA

Dettagli

CAP. 3 Molecole organiche degli organismi: carboidrati, lipidi, amminoacidi, proteine, acidi nucleici.

CAP. 3 Molecole organiche degli organismi: carboidrati, lipidi, amminoacidi, proteine, acidi nucleici. CAP. 3 Molecole organiche degli organismi: carboidrati, lipidi, amminoacidi, proteine, acidi nucleici. 3.1 Molecole organiche degli organismi 3.1.1 I carboidrati CARBOIDRATI: comprendono zuccheri semplici

Dettagli

Adriana Giangrande. Paradigmi dell evoluzione biologica

Adriana Giangrande. Paradigmi dell evoluzione biologica Adriana Giangrande Paradigmi dell evoluzione biologica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 A/B 00173 Roma (06) 93781065 ISBN 978

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare V Scuola di Ingegneria dell Informazione Laurea Magistrale in Ingegneria Informatica II Scuola di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica e Informazione

Dettagli

LICEO SCIENTIFICO LEONARDO da VINCI REGGIO CALABRIA PROGRAMMA DI SCIENZE NATURALI CLASSE 1 a SEZ. Q a. s. 2013/2014

LICEO SCIENTIFICO LEONARDO da VINCI REGGIO CALABRIA PROGRAMMA DI SCIENZE NATURALI CLASSE 1 a SEZ. Q a. s. 2013/2014 CHIMICA LICEO SCIENTIFICO LEONARDO da VINCI REGGIO CALABRIA PROGRAMMA DI SCIENZE NATURALI CLASSE 1 a SEZ. Q a. s. 2013/2014 NUCLEO FONDANTE A : MISURE E GRANDEZZE TRASFORMAZIONI CHIMICO-FISICHE DELLA MATERIA

Dettagli

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884)

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884) La trasmissione dei caratteri ereditari Le leggi di Mendel (1882-1884) Le leggi di Mendel studiano la trasmissione di caratteri qualitativi prodotti da un singolo gene Procedimento sperimentale di Mendel

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

DI TESTA VITO MARIA STA/L-CS VITERBO

DI TESTA VITO MARIA STA/L-CS VITERBO DI TESTA VITO MARIA STA/L-CS VITERBO 1 Sommario - Capitolo 1 Natura materiale ereditario da pag.3 a pag.7 - Capitolo 2 Organizzazione materiale ereditario da pag. 8 a pag.15 - Capitolo 3 Trasmissione del

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

IL GENOMA UMANO. Ogni cromosoma è suddiviso in regioni d informazione dette GENI. L informazione espressa da ciascun gene è detta CARATTERE.

IL GENOMA UMANO. Ogni cromosoma è suddiviso in regioni d informazione dette GENI. L informazione espressa da ciascun gene è detta CARATTERE. IL GENOMA UMANO Ogni cellula contiene nel nucleo una molecola chiamata DNA (acido desossiribonucleico) Tale molecola ha la forma di una lunghissima scala a chiocciola. I gradini che compongono la scala

Dettagli

Programmazione annuale a.s. 2012/2013

Programmazione annuale a.s. 2012/2013 Programmazione annuale a.s. 2012/2013 Docente: Mendo Daniela Materia: biologia Classe: 4 B sociale Nel singolo consiglio di classe sono stati definiti i seguenti obiettivi educativo-cognitivi generali:

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

Elementi di genetica agraria

Elementi di genetica agraria Elementi di genetica agraria Obiettivo Il corso si pone l obiettivo di fornire agli studenti elementi di conoscenza della genetica di base e applicata ai fini del miglioramento genetico delle piante erbacee

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

La biologia molecolare del gene

La biologia molecolare del gene 1 La struttura del materiale genetico 1.1 lcuni esperimenti hanno dimostrato che il D è il materiale depositario dell informazione genetica 1.2 D e R sono polimeri di nucleotidi 1.3 Il D ha la struttura

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi Università degli Studi di Milano Polo Didattico e di Ricerca di Crema Facoltà di Scienze Matematiche, Fisiche e Naturali Corso di Geometria Computazionale Determinazione della struttura di una molecola

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti Le Biomolecole I parte Lezioni d'autore di Giorgio Benedetti LE BIOMOLECOLE Le biomolecole, presenti in tutti gli esseri viventi, sono molecole composte principalmente da carbonio, idrogeno, azoto e ossigeno.

Dettagli

LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione.

LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. Gregor Jhoann Mendel (1822-1884) Mendel viveva nel monastero di Brum, a Brno in Repubblica Ceca, studiò

Dettagli

ELETTRONICA ED ELETTROTECNICA

ELETTRONICA ED ELETTROTECNICA Istituto di Istruzione Secondaria Superiore Statale «Via Silvestri 301» Programma di BIOLOGIA Classe 2 a A Indirizzo ELETTRONICA ED ELETTROTECNICA n.1 Titolo La cellula La struttura della cellula La teoria

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli