e dei genotipi tossici

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "e dei genotipi tossici"

Transcript

1 Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle fioriture di cianobatteri nelle acque di balneazione: approccio per l applicazione del DL 30 maggio 2008 N.112 in recepimento della direttiva 2006/7EC - ISS, 19 maggio 2009

2 Identificazione di cianobatteri nella metodica tradizionale : analisi i morfologica osservazione al microscopio i Limiti: soggettività dell operatore nell interpretazione della morfologia delle cellule impossibilità di discriminare tra specie tossiche e non Necessita la combinazione con saggi chimici, biochimici o enzimatici sulle tossine L APPROCCIO GENETICO nel monitoraggio ambientale permette di seguire il fenomeno delle fioritureit sin dalle fasi più precoci attraverso identificazione tassonomica ed eventuale rilevazione di ceppi potenzialmente tossici.

3 APPROCCI MOLECOLARI COMUNI NELLA DETERMINAZIONE DI CIANOBATTERI. Campione ambientale Estrazione DNA/RNA Analisi quantitativa PCR DGGE Real-time PCR RFLP Analisi qualitativa Bioinformatica (Sequenziamento, Allineamento)

4 CARATTERIZZAZIONE MOLECOLARE DI CIANOBATTERI: 1. Definizione TASSONOMICA degli individui (genere, specie, ceppo) 2. Definizione di specifiche SONDE MOLECOLARI per l identificazione di specie tossiche

5 1. Definizione TASSONOMICA e analisi filogenetica di campioni ambientali (a livello di genere, specie, ceppo): Geni housekeeping come marker filogenetici: - Amplificazione dell INTERGENIC SPACER nell operone FICOCIANINA (regione potenzialmente ad alta variabilità) PC-IGS cpcb cpca cpcc cpcd cpce 2 biline α e β 3 peptidi linker cautela nella scelta del marcatore!! Il locus può accumulare mutazioni nel periodo di coltura Può essere inaffidabile

6 - Amplificazione all interno del gene per l rrna 16S: Ottima stabilità, affidabilità Primers universali PCR disegnati in regioni ben conservate Analisi RFLP Rischio: L analisi della sequenza 16S rrna può essere non sufficientemente sensibile nella discriminazione di specie strettamente correlate - Amplificazione di altri marcatori (geni nif, rpoc1, gyrb)

7 Es: Ricerca di Planktothrix mediante amplificazione del marker rdna 16S Campioni ambientali eterogenei DNA amplificazione della regione rdna 16S come marcatore genere-specfico di Planktothrix ELETTROFORESI SU GEL DI AGAROSIO Lane 1 = assenza di Planktothrix th Lane 2,3,4 = Planktothrix Lane 5 = bianco Lane 6 = ladder

8 2. Definizione di specifiche SONDE MOLECOLARI per la ricerca di specie tossiche all interno di un campione ambientale L identificazione di eventuali specie tossiche si realizza mediante la ricerca di specifici geni marker (mcy), raggruppati in cluster, che codificano per grandi complessi multienzimatici (NRPS o Peptide Sintetasi Non Ribosomali) coinvolti nella biosintesi delle Microcistine. Cluster mcy per la biosintesi delle microcistine (Planktothrix genera). Raggruppa 9 geni che codificano per diversi domini del complesso multienzimatico della MICROCISTINA SINTETASI. S kb mcyt mcyd mcye mcyg mcyh mcya mcyb mcyc mcyj = Peptide Sintetasi = Polichetide Sintasi = Modifica = Trasporto Ortologhi dei geni mcy sono stati trovati in altre specie di Cianobatteri tossici inclusi Microcystis, Nostoc, Anabaena, Nodularia.

9 Nel cluster mcy possono essere presenti delezioni anche estese in grado di alterare la funzionalità del prodotto proteico Es: Ricerca di microcistine in relazione alla presenza di marcatori mcy in colture di P. agardhii e P. rubescens (modified from S. Mbedi et al., 2005). Ceppo microcistina mcyt mcytd mcya mcyb mcye P. agardhii HUB076/A P. agardhii LAN P. agardhii Max P. agardhii Max P. agardhii Max P. rubescens BL P. rubescens BL P. rubescens HUB = falsi positivi - = falsi negativi

10 Es.: Ricerca e quantificazione di genotipi tossici di Planktothrix nelle acque del lago di Vico mediante Real time PCR (qpcr). Campione ambientale Cellule su filtro 0,2 µm; Conservazione a -20 C Estrazione DNA (kit commerciali) Taq Nuclease Assay (o saggio Taqman): Amplificazione ione all interno dei loci rdna 16S (per la definizione tassonomica) e mcyb (come marcatore di tossicità). Coppia di primers specifici + sonda fluorescente Emissione di fluorescenza (Ct) durante la reazione di PCR strettamente correlata numero di copie target presenti inizialmente.

11 Es. MONITORAGGIO LAGO DI GEROSA (1 anno di rilevamenti - ottobre 2006-ottobre 2007): novembre 2006: picco conc. cell. bassa conc. microcistine dicembre 2006: bassa conc. cell. picco conc. microcistine November (surface) December (surface) Microcystins ELISA 1,28 2,04 (µg/l) LC/MS 0, ,4 Cells n. (10 6 ) mcyb vs Pc (%) qpcr 44 3,7 31% 63,7% Lo sfasamento tra il numero degli individui e la produzione della microcistina può essere parzialmente spiegato con una variazione della percentuale degli individui tossici rispetto a quelli non tossici.

12 La bioinformatica come potente strumento nella identificazione di popolazioni p in campioni ambientali PCR Sequenziamento Programmi di allineamento di sequenze (BLAST, CLUSTALW) Confronto con banche dati; Ricerca del best match Si risale all organismo; Si ipotizzano relazioni filogenetiche

13 Basic Local Alignment Search Tool BLAST è un algoritmo ottimizzato i t per ricercare regioni di locale omologia tra sequenze presenti nel database. 1. Identificazione i di cianobatteri i attraverso il confronto con banche dati Ricerca del best-match t

14

15

16

17 Basic Local Alignment Search Tool (BLAST) 2. Valutazione della capacità discriminante di primers per l identificazione di specie di cianobatteri

18

19

20 ClustalW Allineamento multiplo di sequenze Disegno di primers per la discriminazione Disegno di primers per la discriminazione molecolare di specie di cianobatteri

21

22 Planktothrix Rubescens (seq.1-15) vs Planktothrix Agardhii (seq.16-30) C-phycocyanin alpha subunit (cpca) gene, partial cds CLUSTAL W (1.81) Multiple Sequence Alignments Sequence type explicitly set to DNA Sequence format is Pearson Sequence 1: gi gb EU _Pl Sequence 2: gi gb EU g _ Pl Sequence 3: gi gb EU _Pl Sequence 4: gi gb EU _Pl Sequence 5: gi gb EU _Pl Sequence 6: gi gb EU _Pl Sequence 7: gi gb EU g _ Pl Sequence 8: gi gb EU _Pl Sequence 9: gi gb EU _Pl Sequence 10: gi gb EU _Pl Sequence 11: gi gb EU _Pl Sequence 12: gi gb EU g _ Pl Sequence 13: gi gb EU _Pl Sequence 14: gi gb EU _Pl Sequence 15: gi gb EU _Pl Sequence 16: gi gb EU _Pl Sequence 17: gi gb EU g _ Pl Sequence 18: gi gb EU _Pl Sequence 19: gi gb EU _Pl Sequence 20: gi gb EU _Pl Sequence 21: gi gb EU _Pl Sequence 22: gi gb EU g _ Pl Sequence 23: gi gb EU _Pl Sequence 24: gi gb EU _Pl Sequence 25: gi gb EU _Pl Sequence 26: gi gb EU _Pl Sequence 27: gi gb EU g _ Pl Sequence 28: gi gb EU _Pl Sequence 29: gi gb EU _Pl Sequence 30: gi gb EU _Pl Start of Pairwise alignments

23 clustalw.aln CLUSTAL W (1.81) multiple sequence alignment Sequences (1:2) Aligned. Score: Sequences (1:3) Aligned. Score: Sequences (1:4) Aligned. Score: Sequences (2:2) Aligned. Score: Sequences (2:3) Aligned. Score: Sequences (2:4) Aligned. Score: Sequences (30:29) Aligned. Score: Sequences (30:30) Aligned. Score: CLUSTAL-Alignment file created [clustalw.aln] clustalw.aln gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU g _ Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl 1 CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAACTGCAAGTGGCTTTCGGACGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAACTGCAAGTGGCTTTCGGACGT ***************************** * *********** ** ***

24 USO DI METODOLOGIE MOLECOLARI NELLA CARATTERIZZAZIONE DI CIANOBATTERI: VANTAGGI Rapidi e relativamente economici Alta specificità e sensibilità Permettono di discriminare tra ceppi morfologicamente identici Consentono il diretto utilizzo del campione ambientale, senza dover necessariamente allestire una coltura cellulare Saggi qualitativi / quantitativi / di espressione (PCR) (qpcr) (RT-PCR) Permettono di risalire all organismo produttore della tossina Non richiedono processamento immediato del campione, che può essere conservato nel tempo

25 USO DI METODOLOGIE MOLECOLARI NELLA CARATTERIZZAZIONE DI CIANOBATTERI: LIMITI Database di sequenza talvolta lacunosi per alcune specie: difficoltà nel disegno di primers efficaci Variabilità di sequenza intra-specie rischio di sottostimare la popolazione se i primers scelti non sono disegnati entro regioni ben conservate Possono dare falsi negativi o falsi positivi se i geni marker non sono opportunamente scelti Danno una stima del DNA totale, non permettono discriminare tra cellule vive e morte

METODI GENETICI NELLA IDENTIFICAZIONE DI

METODI GENETICI NELLA IDENTIFICAZIONE DI METODI GENETICI NELLA IDENTIFICAZIONE DI CIANOBATTERI Susanna Vichi, Simonetta Gemma, Emanuela Testai Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Convegno Cianobatteri

Dettagli

1 CORSO DI AGGIORNAMENTO SU PROBLEMATICHE DEGLI ORGANISMI ACQUATICI. Tri 17 Dicebre 2013. Sala Conferenze IZSPLVA Via Bologna 148Torino

1 CORSO DI AGGIORNAMENTO SU PROBLEMATICHE DEGLI ORGANISMI ACQUATICI. Tri 17 Dicebre 2013. Sala Conferenze IZSPLVA Via Bologna 148Torino 1 CORSO DI AGGIORNAMENTO SU PROBLEMATICHE DEGLI ORGANISMI ACQUATICI Tri 17 Dicebre 2013 Sala Conferenze IZSPLVA Via Bologna 148Torino cianobatteri o alghe verdi-azzurre costituiscono uno dei principali

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Estrazione delle microcistine: metodi a confronto

Estrazione delle microcistine: metodi a confronto Applicazione in Italia della direttiva 2006/7/CE in materia di balneazione: quale il ruolo dei cianobatteri nel giudizio di balneabilità. Estrazione delle microcistine: metodi a confronto Tavola Elena

Dettagli

Metodi di identificazione e quantificazione: Metodi immunoenzimatici

Metodi di identificazione e quantificazione: Metodi immunoenzimatici Metodi di identificazione e quantificazione: Metodi immunoenzimatici Daniela Mattei Mara Stefanelli I CIANOBATTERI POTENZIALMENTE TOSSICI: IMPLICAZIONI SANITARIE E GESTIONE DEL RISCHIO Istituto Superiore

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Istituto Superiore di Sanità Roma 30 ottobre 2007 Rossella Briancesco Metodi tradizionali spesso poco sensibili Metodi

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Centro Interdipartimentale di Ricerca per l Innovazione in Viticoltura ed Enologia

Centro Interdipartimentale di Ricerca per l Innovazione in Viticoltura ed Enologia Il DNA come Elemento Tracciante in Spumantizzazione Centro Interdipartimentale di Ricerca per l Innovazione in Viticoltura ed Enologia Dr. Ileana Vigentini IL VINO SPUMANTE METODO CLASSICO (CHAMPENOISE

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine Università degli Studi del Piemonte Orientale A. Avogadro CORSO DI ALTA FORMAZIONE IN LEGISLAZIONE ALIMENTARE Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi

Dettagli

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA CLM Biotecnologie per l Alimentazione CLM in Biotecnologie Sanitarie Corso di Chimica e certificazione degli alimenti DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA VIRUS ENTERICI virus escreti tramite

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini Università di Bologna Dipartimento di Medicina Clinica Specialistica e Sperimentale Sezione di Microbiologia RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI

Dettagli

ZytoLight SPEC ALK/EML4 TriCheck Probe

ZytoLight SPEC ALK/EML4 TriCheck Probe ZytoLight SPEC ALK/EML4 TriCheck Probe Z-2117-200 Z-2117-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del riarrangiamento dei geni ALK- EML4 mediante ibridazione in situ fluorescente (FISH).... Dispositivo

Dettagli

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche I T A L B I O F O R M A i n c o l l a b o r a z i o n e c o n O R D I N E N A Z I O N A L E D E I B I O L O G I o r g a n i z z a i l c o r s o d i a g g i o r n a m e n t o BIOLOGIA MOLECOLARE: introduzione

Dettagli

Unità tecnica UTAGRI Laboratori INN e GEN

Unità tecnica UTAGRI Laboratori INN e GEN Unità tecnica UTAGRI Laboratori INN e GEN FOODFLAVOUR PL 77.2 Metodologie diagnostiche innovative per la caratterizzazione delle comunità microbiche Responsabile: Annamaria Bevivino Partecipanti: Patrizia

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica Silvio Pascucci 1 Anamnesi Sintomi Lesioni Esami : Istologici Virologici Sierologici Diagnosi Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica 2

Dettagli

ABI-7700 User Bulletin #5

ABI-7700 User Bulletin #5 ABI-7700 User Bulletin #5 1. halogen tungsten lamp 2b. emission filters 3. intensifier 5. ccd detector 350,000 pixels 2a. excitation filters 4. sample plate www.biorad.com 3 Real-time qpcr - La fluorescenza

Dettagli

ZytoLight SPEC ALK Dual Color Break Apart Probe

ZytoLight SPEC ALK Dual Color Break Apart Probe ZytoLight SPEC ALK Dual Color Break Apart Probe Z-2124-200 20 (0.2 ml) Z-2124-50 5 (0.05 ml) Per la rilevazione della traslocazione che coinvolge il gene ALK a 2p23 mediante ibridazione in situ fluorescente

Dettagli

The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail: orgabiohuman@fastwebnet.it

Dettagli

Analisi della Malattia Minima Residua

Analisi della Malattia Minima Residua XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Analisi della Malattia Minima Residua Dr.ssa Anna Gazzola Laboratorio di Patologia Molecolare, Sezione di Emolinfopatologia,

Dettagli

Metodi: CEN/TC275/WG6/TAG4

Metodi: CEN/TC275/WG6/TAG4 Determinazione di HAV e Norovirus in molluschi bivalvi mediante Real time PCR Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Ancona

Dettagli

Viaggio al centro della Biodiversità

Viaggio al centro della Biodiversità Liceo G.M. Colombini - Piacenza - indirizzo scientifico-tecnologico Biodiversità all interno di ogni specie e varietà dovute all azione dell uomo in ambito genetico Viaggio al centro della Biodiversità

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

ZytoLight SPEC HER2/CEN 17 Dual Color Probe

ZytoLight SPEC HER2/CEN 17 Dual Color Probe ZytoLight SPEC HER2/CEN 17 Dual Color Probe Z-2015-200 Z-2015-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del gene umano HER2 e degli alfa-satelliti del cromosoma 17 mediante ibridazione in situ fluorescente

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici

Dettagli

LA RIASSOCIAZIONE MOLECOLARE DNA/DNA

LA RIASSOCIAZIONE MOLECOLARE DNA/DNA LA RIASSOCIAZIONE MOLECOLARE DNA/DNA Il grado di riassociazione o ibridazione molecolare DNA/DNA rappresenta uno dei cardini su cui si basa la definizione di specie batterica. Allo scopo ricordiamo cosa

Dettagli

ZytoLight SPEC ERG Dual Color Break Apart Probe

ZytoLight SPEC ERG Dual Color Break Apart Probe ZytoLight SPEC ERG Dual Color Break Apart Probe IVD Dispositivo medico-diagnostico in vitro Produttore: ZytoVision GmbH Codice: Z-2138-200 (0.2ml).. Per l identificazione della traslocazione che coinvolge

Dettagli

ISOLAMENTO DI CELLULE STAMINALI PLURIPOTENTI DALLA PLACENTA E LIQUIDO AMNIOTICO PER LA CURA DELLA FIBROSI CISTICA

ISOLAMENTO DI CELLULE STAMINALI PLURIPOTENTI DALLA PLACENTA E LIQUIDO AMNIOTICO PER LA CURA DELLA FIBROSI CISTICA ISOLAMENTO DI CELLULE STAMINALI PLURIPOTENTI DALLA PLACENTA E LIQUIDO AMNIOTICO PER LA CURA DELLA FIBROSI CISTICA Dott.ssa Annalucia Carbone Laboratorio di Genetica Molecolare Fondazione IRCCS Policlinico,

Dettagli

PROGRAMMA OPERATIVO NAZIONALE RICERCA E COMPETITIVITÀ 2007-2013 AZIONE II - INTERVENTI DI SOSTEGNO ALLA RICERCA INDUSTRIALE

PROGRAMMA OPERATIVO NAZIONALE RICERCA E COMPETITIVITÀ 2007-2013 AZIONE II - INTERVENTI DI SOSTEGNO ALLA RICERCA INDUSTRIALE Progetto di Ricerca PON 01_02400/2 dal titolo IDEN.Pr.E.P.T- Identificazione del prodotto e della sua provenienza territoriale CUP B38I3000540005 Avviso finalizzato alla formazione di elenchi da utilizzare

Dettagli

Metodiche tradizionali

Metodiche tradizionali Diagnostica microbiologica innovativa INTRODUZIONE Attualmente, per la rilevazione dei microrganismi patogeni accanto alle metodiche tradizionali rappresentate: dall esame colturale, l esame diretto al

Dettagli

HPV & Cervico-carcinoma

HPV & Cervico-carcinoma Infezione HPV & Cervico-carcinoma Infezione HPV HPV ad alto rischio Età all infezione 80% 20% Fattori mmunologici Transitoria Infezione persistente Infezione da C. trachomatis Displasia basso grado CIN

Dettagli

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello

Dettagli

Ruolo dei test di clonalità nei disordini linfoproliferativi

Ruolo dei test di clonalità nei disordini linfoproliferativi XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Ruolo dei test di clonalità nei disordini linfoproliferativi Dr.ssa Claudia Mannu Laboratorio di Patologia Molecolare,

Dettagli

AlphaReal BREAST Scheda Tecnica

AlphaReal BREAST Scheda Tecnica AlphaReal BREAST Scheda Tecnica A3 DS RT 607 ARBreast_01_2015.doc Pag. 1 di 5 Rev. 01 del Gennaio 2015 Prodotto: AlphaReal BREAST Codice prodotto: RT-607.05.20 / RT-607.10.20 N Tests: 5/10 tests Destinazione

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Genotipizzazione virale

Genotipizzazione virale Genotipizzazione virale Typing Separazione basata su maggiori differenze genetiche tra i membri di una singola specie virale Subtyping Individuazione di differenze stabili all interno di un gruppo di virus

Dettagli

Servizio fitosanitario regionale

Servizio fitosanitario regionale Regione Toscana Servizio fitosanitario regionale Il laboratorio di diagnostica fitopatologica e biologia molecolare Direzione generale Competitività del sistema regionale e sviluppo delle competenze Sviluppo

Dettagli

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità RELAZIONE TECNICA Indagini Biologico-Molecolari per Accertamento di Paternità PROSPETTO RIASSUNTIVO DELL'ANALISI ANALISI INDAGINE DI PATERNITA' PERSONE SOTTOPOSTE AL TEST QUESITO Campione Biologico Tampone

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Metodi di analisi di OGM

Metodi di analisi di OGM Metodi di analisi di OGM Roberta Onori Istituto Superiore di Sanità Centro Nazionale per la Qualità degli Alimenti e per i Rischi Alimentari Quadro normativo Attività Pre-marketing Indag ini sulla esposizione

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

Analisi mutazionale di K-RAS metodiche a confronto

Analisi mutazionale di K-RAS metodiche a confronto Analisi mutazionale di K-RAS metodiche a confronto Aula Magna Villa Sironi Gallarate 16 ottobre Dott. Carmelo Lupo Coordinatore Tecnico Anatomia Patologica e Patologia Molecolare Oncologica PERCHÉ K-RAS

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

Analisi qualitativa con Agilent BioAnalyzer. cdna, RNA Totale e Messaggero e small RNA

Analisi qualitativa con Agilent BioAnalyzer. cdna, RNA Totale e Messaggero e small RNA Il Servizio di Biologia Molecolare si è di recente dotato di uno strumento per l analisi qualitativa e quantitativa degli acidi nucleici Agilent Bioanalyzer 2100 e ha implementato tale tecnologia nell

Dettagli

Sperimenta il BioLab

Sperimenta il BioLab Progetto Sperimenta il BioLab Centro Università di Milano - Scuola per le Bioscienze e le Biotecnologie http://www.cusmibio.unimi.it/ I laboratori del Cus-Mi-Bio dedicati a "SPERIMENTA IL BIOLAB" si trovano

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Polymerase Chain Reaction - PCR

Polymerase Chain Reaction - PCR Polymerase Chain Reaction - PCR Real-Time PCR Saggio Saggio di PCR monitorato di continuo Tubi Tubi chiusi Nessuna analisi post PCR Nessuna elettroforesi Caratterizzazione del prodotto Possibilità di quantificare

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

Biosintesi non ribosomiale di metaboliti peptidici bioattivi

Biosintesi non ribosomiale di metaboliti peptidici bioattivi Biosintesi non ribosomiale di metaboliti peptidici bioattivi Principali bersagli degli antibiotici Gli antibiotici derivano per la maggior parte da composti naturali Strutture di alcuni peptidi bioattivi

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

F O R M ATO E U R O P E O

F O R M ATO E U R O P E O F O R M ATO E U R O P E O P E R I L C U R R I C U L U M V I T AE INFORMAZIONI PERSONALI Nome CABBRI RICCARDO Indirizzo VIA VENTURE 3/2 40010 BENTIVOGLIO (BO) Telefono +393338543133 E-mail rcabbri@gmx.com

Dettagli

Università degli Studi di Urbino Carlo Bo. DIPARTIMENTO DI SCIENZE DELLA TERRA, DELLA VITA E DELL AMBIENTE (DiSTeVA) TARIFFARIO

Università degli Studi di Urbino Carlo Bo. DIPARTIMENTO DI SCIENZE DELLA TERRA, DELLA VITA E DELL AMBIENTE (DiSTeVA) TARIFFARIO Università degli Studi di Urbino Carlo Bo DIPARTIMENTO DI SCIENZE DELLA TERRA, DELLA VITA E DELL AMBIENTE (DiSTeVA) TARIFFARIO In vigore dal 21 aprile 2011 1 ANALISI QUALITATIVE-QUANTITATIVE SU CAMPIONI

Dettagli

Elementi di genetica di base e marcatori molecolari. Dott.ssa Marica Soattin

Elementi di genetica di base e marcatori molecolari. Dott.ssa Marica Soattin Elementi di genetica di base e marcatori molecolari Dott.ssa Marica Soattin Organismi animali costituiti da cellule di tipo eucariote Cellule con nucleo differenziato delimitato da membrana e organelli

Dettagli

Controllo e monitoraggio della sicurezza e qualità

Controllo e monitoraggio della sicurezza e qualità Strategie innovative rispondenti ai bisogni delle imprese nel comparto degli ortofrutticoli della IV gamma STAYFRESH Controllo e monitoraggio della sicurezza e qualità Chiara Gorni, Donatella Allemand,

Dettagli

Gli animali quali indicatori biologici dell inquinamento ambientale, strategie di monitoraggio

Gli animali quali indicatori biologici dell inquinamento ambientale, strategie di monitoraggio S.I.Ve.M.P. Comune Calvello Società Italiana di Medicina Veterinaria Preventiva Gli animali quali indicatori biologici dell inquinamento ambientale, strategie di monitoraggio Monitoraggio della contaminazione

Dettagli

Un nuovo approccio: la VEQ in biologia molecolare

Un nuovo approccio: la VEQ in biologia molecolare Un nuovo approccio: la VEQ in biologia molecolare Il crescente interesse nella biologia molecolare applicata alla diagnostica è il risultato dei profondi progressi ottenuti nelle conoscenze scientifiche

Dettagli

Apoptosi. Geni espressi Proteine correlate Apoptosi. Induzione. Attività delle Caspasi Identificazione dell apoptosi. Induzione. Kit INDUTTORI CHIMICI

Apoptosi. Geni espressi Proteine correlate Apoptosi. Induzione. Attività delle Caspasi Identificazione dell apoptosi. Induzione. Kit INDUTTORI CHIMICI LINEA BIOTECH Apoptosi Geni espressi Proteine correlate Apoptosi Induzione Attività delle Caspasi Identificazione dell apoptosi Induzione INDUTTORI CHIMICI Actinomycin D, Anisomycin, Antibiotic A23187,

Dettagli

Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B

Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B Diagnosi e tipizzazione di IPD in biologia molecolare direttamente da campione clinico in pazienti con terapia antibiotica in atto Cristina Massai Clinica Pediatrica II Ospedale Meyer Università di Firenze

Dettagli

Biosensori 3: Biosensori a DNA e Bio- Gene Chip

Biosensori 3: Biosensori a DNA e Bio- Gene Chip Biosensori 3: Biosensori a DNA e Bio- Gene Chip mazzei@di.unipi.it (materiale parzialmente tratto da: http://nestor.med.unibo.it/shared_files/seminari/sartini_21-10-2004.ppt) Biosensori ad affinità basati

Dettagli

Aspetti analitici nel Controllo ambientale di Legionella. D.ssa Leonarda Chetti Arpa Sezione di Bologna

Aspetti analitici nel Controllo ambientale di Legionella. D.ssa Leonarda Chetti Arpa Sezione di Bologna Aspetti analitici nel Controllo ambientale di Legionella D.ssa Leonarda Chetti Arpa Sezione di Bologna Procedure analitiche La ricerca di Legionella è tecnicamente difficile. Richiede Laboratori specialistici

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

Meccanismo tio-templato delle NRPS

Meccanismo tio-templato delle NRPS Meccanismo tio-templato delle NRPS Meccanismo tio-templato delle NRPS Per l attività delle NRPS è necessaria l aggiunta della 4- fosfopanteteina sulla serina del sito attivo del dominio di tiolazione.

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

Istituto Superiore di Sanità - Roma 1

Istituto Superiore di Sanità - Roma 1 Metodi analitici per la ricerca dei virus enterici negli alimenti Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Tor Vergata 15.04.2014

Dettagli

Scienze Biologiche. Attività di Laboratorio. Dipartimento di Scienze della Terra, dell Ambiente e della Vita. Università degli Studi di Genova

Scienze Biologiche. Attività di Laboratorio. Dipartimento di Scienze della Terra, dell Ambiente e della Vita. Università degli Studi di Genova Corso di Laurea triennale in Scienze Biologiche Attività di Laboratorio A.A. 2015 2016 Corsi con attività pratiche: 1 anno: 2 anno: 3 anno: Misure fisiche, Citologia e Istologia, Zoologia, Chimica generale

Dettagli

Caratterizzazione della comunità microbica

Caratterizzazione della comunità microbica Caratterizzazione della comunità microbica Monitoraggio biologico annuale dell impianto Dipartimento di Biologia Università di Pisa Monitoraggio biologico del reattore Monitoraggio biologico del prototipo

Dettagli

..Curriculum Vitae di: LUCA GHISLANZONI gennaio 2012..

..Curriculum Vitae di: LUCA GHISLANZONI gennaio 2012.. ..Curriculum Vitae di: LUCA GHISLANZONI gennaio 2012.. INFORMAZIONI PERSONALI Nominativo: Luca GHISLANZONI Nato a: In data: Residente in: Domicilio: Telefono: Cellulare: E-mail ghislanzoni@irsa.cnr.it

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli