e dei genotipi tossici

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "e dei genotipi tossici"

Transcript

1 Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle fioriture di cianobatteri nelle acque di balneazione: approccio per l applicazione del DL 30 maggio 2008 N.112 in recepimento della direttiva 2006/7EC - ISS, 19 maggio 2009

2 Identificazione di cianobatteri nella metodica tradizionale : analisi i morfologica osservazione al microscopio i Limiti: soggettività dell operatore nell interpretazione della morfologia delle cellule impossibilità di discriminare tra specie tossiche e non Necessita la combinazione con saggi chimici, biochimici o enzimatici sulle tossine L APPROCCIO GENETICO nel monitoraggio ambientale permette di seguire il fenomeno delle fioritureit sin dalle fasi più precoci attraverso identificazione tassonomica ed eventuale rilevazione di ceppi potenzialmente tossici.

3 APPROCCI MOLECOLARI COMUNI NELLA DETERMINAZIONE DI CIANOBATTERI. Campione ambientale Estrazione DNA/RNA Analisi quantitativa PCR DGGE Real-time PCR RFLP Analisi qualitativa Bioinformatica (Sequenziamento, Allineamento)

4 CARATTERIZZAZIONE MOLECOLARE DI CIANOBATTERI: 1. Definizione TASSONOMICA degli individui (genere, specie, ceppo) 2. Definizione di specifiche SONDE MOLECOLARI per l identificazione di specie tossiche

5 1. Definizione TASSONOMICA e analisi filogenetica di campioni ambientali (a livello di genere, specie, ceppo): Geni housekeeping come marker filogenetici: - Amplificazione dell INTERGENIC SPACER nell operone FICOCIANINA (regione potenzialmente ad alta variabilità) PC-IGS cpcb cpca cpcc cpcd cpce 2 biline α e β 3 peptidi linker cautela nella scelta del marcatore!! Il locus può accumulare mutazioni nel periodo di coltura Può essere inaffidabile

6 - Amplificazione all interno del gene per l rrna 16S: Ottima stabilità, affidabilità Primers universali PCR disegnati in regioni ben conservate Analisi RFLP Rischio: L analisi della sequenza 16S rrna può essere non sufficientemente sensibile nella discriminazione di specie strettamente correlate - Amplificazione di altri marcatori (geni nif, rpoc1, gyrb)

7 Es: Ricerca di Planktothrix mediante amplificazione del marker rdna 16S Campioni ambientali eterogenei DNA amplificazione della regione rdna 16S come marcatore genere-specfico di Planktothrix ELETTROFORESI SU GEL DI AGAROSIO Lane 1 = assenza di Planktothrix th Lane 2,3,4 = Planktothrix Lane 5 = bianco Lane 6 = ladder

8 2. Definizione di specifiche SONDE MOLECOLARI per la ricerca di specie tossiche all interno di un campione ambientale L identificazione di eventuali specie tossiche si realizza mediante la ricerca di specifici geni marker (mcy), raggruppati in cluster, che codificano per grandi complessi multienzimatici (NRPS o Peptide Sintetasi Non Ribosomali) coinvolti nella biosintesi delle Microcistine. Cluster mcy per la biosintesi delle microcistine (Planktothrix genera). Raggruppa 9 geni che codificano per diversi domini del complesso multienzimatico della MICROCISTINA SINTETASI. S kb mcyt mcyd mcye mcyg mcyh mcya mcyb mcyc mcyj = Peptide Sintetasi = Polichetide Sintasi = Modifica = Trasporto Ortologhi dei geni mcy sono stati trovati in altre specie di Cianobatteri tossici inclusi Microcystis, Nostoc, Anabaena, Nodularia.

9 Nel cluster mcy possono essere presenti delezioni anche estese in grado di alterare la funzionalità del prodotto proteico Es: Ricerca di microcistine in relazione alla presenza di marcatori mcy in colture di P. agardhii e P. rubescens (modified from S. Mbedi et al., 2005). Ceppo microcistina mcyt mcytd mcya mcyb mcye P. agardhii HUB076/A P. agardhii LAN P. agardhii Max P. agardhii Max P. agardhii Max P. rubescens BL P. rubescens BL P. rubescens HUB = falsi positivi - = falsi negativi

10 Es.: Ricerca e quantificazione di genotipi tossici di Planktothrix nelle acque del lago di Vico mediante Real time PCR (qpcr). Campione ambientale Cellule su filtro 0,2 µm; Conservazione a -20 C Estrazione DNA (kit commerciali) Taq Nuclease Assay (o saggio Taqman): Amplificazione ione all interno dei loci rdna 16S (per la definizione tassonomica) e mcyb (come marcatore di tossicità). Coppia di primers specifici + sonda fluorescente Emissione di fluorescenza (Ct) durante la reazione di PCR strettamente correlata numero di copie target presenti inizialmente.

11 Es. MONITORAGGIO LAGO DI GEROSA (1 anno di rilevamenti - ottobre 2006-ottobre 2007): novembre 2006: picco conc. cell. bassa conc. microcistine dicembre 2006: bassa conc. cell. picco conc. microcistine November (surface) December (surface) Microcystins ELISA 1,28 2,04 (µg/l) LC/MS 0, ,4 Cells n. (10 6 ) mcyb vs Pc (%) qpcr 44 3,7 31% 63,7% Lo sfasamento tra il numero degli individui e la produzione della microcistina può essere parzialmente spiegato con una variazione della percentuale degli individui tossici rispetto a quelli non tossici.

12 La bioinformatica come potente strumento nella identificazione di popolazioni p in campioni ambientali PCR Sequenziamento Programmi di allineamento di sequenze (BLAST, CLUSTALW) Confronto con banche dati; Ricerca del best match Si risale all organismo; Si ipotizzano relazioni filogenetiche

13 Basic Local Alignment Search Tool BLAST è un algoritmo ottimizzato i t per ricercare regioni di locale omologia tra sequenze presenti nel database. 1. Identificazione i di cianobatteri i attraverso il confronto con banche dati Ricerca del best-match t

14

15

16

17 Basic Local Alignment Search Tool (BLAST) 2. Valutazione della capacità discriminante di primers per l identificazione di specie di cianobatteri

18

19

20 ClustalW Allineamento multiplo di sequenze Disegno di primers per la discriminazione Disegno di primers per la discriminazione molecolare di specie di cianobatteri

21

22 Planktothrix Rubescens (seq.1-15) vs Planktothrix Agardhii (seq.16-30) C-phycocyanin alpha subunit (cpca) gene, partial cds CLUSTAL W (1.81) Multiple Sequence Alignments Sequence type explicitly set to DNA Sequence format is Pearson Sequence 1: gi gb EU _Pl Sequence 2: gi gb EU g _ Pl Sequence 3: gi gb EU _Pl Sequence 4: gi gb EU _Pl Sequence 5: gi gb EU _Pl Sequence 6: gi gb EU _Pl Sequence 7: gi gb EU g _ Pl Sequence 8: gi gb EU _Pl Sequence 9: gi gb EU _Pl Sequence 10: gi gb EU _Pl Sequence 11: gi gb EU _Pl Sequence 12: gi gb EU g _ Pl Sequence 13: gi gb EU _Pl Sequence 14: gi gb EU _Pl Sequence 15: gi gb EU _Pl Sequence 16: gi gb EU _Pl Sequence 17: gi gb EU g _ Pl Sequence 18: gi gb EU _Pl Sequence 19: gi gb EU _Pl Sequence 20: gi gb EU _Pl Sequence 21: gi gb EU _Pl Sequence 22: gi gb EU g _ Pl Sequence 23: gi gb EU _Pl Sequence 24: gi gb EU _Pl Sequence 25: gi gb EU _Pl Sequence 26: gi gb EU _Pl Sequence 27: gi gb EU g _ Pl Sequence 28: gi gb EU _Pl Sequence 29: gi gb EU _Pl Sequence 30: gi gb EU _Pl Start of Pairwise alignments

23 clustalw.aln CLUSTAL W (1.81) multiple sequence alignment Sequences (1:2) Aligned. Score: Sequences (1:3) Aligned. Score: Sequences (1:4) Aligned. Score: Sequences (2:2) Aligned. Score: Sequences (2:3) Aligned. Score: Sequences (2:4) Aligned. Score: Sequences (30:29) Aligned. Score: Sequences (30:30) Aligned. Score: CLUSTAL-Alignment file created [clustalw.aln] clustalw.aln gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU g _ Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl 1 CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAACTGCAAGTGGCTTTCGGACGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAACTGCAAGTGGCTTTCGGACGT ***************************** * *********** ** ***

24 USO DI METODOLOGIE MOLECOLARI NELLA CARATTERIZZAZIONE DI CIANOBATTERI: VANTAGGI Rapidi e relativamente economici Alta specificità e sensibilità Permettono di discriminare tra ceppi morfologicamente identici Consentono il diretto utilizzo del campione ambientale, senza dover necessariamente allestire una coltura cellulare Saggi qualitativi / quantitativi / di espressione (PCR) (qpcr) (RT-PCR) Permettono di risalire all organismo produttore della tossina Non richiedono processamento immediato del campione, che può essere conservato nel tempo

25 USO DI METODOLOGIE MOLECOLARI NELLA CARATTERIZZAZIONE DI CIANOBATTERI: LIMITI Database di sequenza talvolta lacunosi per alcune specie: difficoltà nel disegno di primers efficaci Variabilità di sequenza intra-specie rischio di sottostimare la popolazione se i primers scelti non sono disegnati entro regioni ben conservate Possono dare falsi negativi o falsi positivi se i geni marker non sono opportunamente scelti Danno una stima del DNA totale, non permettono discriminare tra cellule vive e morte

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp.

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. RECENSIONI&REPORTS recensione Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. 154, 12 «Il vasto e importante e molto

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali:

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali: Gli enzimi Nel metabolismo energetico le cellule producono notevoli quantità di CO 2 che deve essere eliminata con l apparato respiratorio. Il trasferimento della CO 2 dalle cellule al sangue e da esso

Dettagli

Business Process Management applicato ai flussi della PA

Business Process Management applicato ai flussi della PA tecnologie vicine Business Process Management applicato ai flussi della PA Antonio Palummieri Resp. Area Mercato Luciano Sulis - BPM Solution Specialist Milano, 24 novembre 2011 Popolazione comuni: Italia

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Le telecamere Installate verranno connesse ad Unità di elaborazione multiplexer per la gestione e la verifica di gruppi omogenei di 4-8-16-32-48-64

Le telecamere Installate verranno connesse ad Unità di elaborazione multiplexer per la gestione e la verifica di gruppi omogenei di 4-8-16-32-48-64 Le telecamere Installate verranno connesse ad Unità di elaborazione multiplexer per la gestione e la verifica di gruppi omogenei di 4-8-16-32-48-64 telecamere. I sistemi di acquisizione ed archiviazione

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

PCB NEI MOLLUSCHI BIVALVI

PCB NEI MOLLUSCHI BIVALVI PCB NEI MOLLUSCHI BIVALVI I. SCARONI, G. CASTELLARI, D. PANNIELLO, A. SANTOLINI, D. FOSCOLI, E. RONCARATI, P. CASALI ARPA EMILIA-ROMAGNA SEZ. RAVENNA Il destino e gli effetti dei PCB nell ambiente sono

Dettagli

Analisi di massima: L utente dovrà inserire un numero limite, e tramite vari calcoli verrà stampato a video la sequenza.

Analisi di massima: L utente dovrà inserire un numero limite, e tramite vari calcoli verrà stampato a video la sequenza. Relazione tecnica Fibonacci ANDENA GIANMARCO Traccia: Creare un algoritmo che permetta, dato un valore intero e positivo, di stabilire la sequenza utilizzando la regola di fibonacci dei numeri fino al

Dettagli

Progetto VirtualCED Clustered

Progetto VirtualCED Clustered Progetto VirtualCED Clustered Un passo indietro Il progetto VirtualCED, descritto in un precedente articolo 1, è ormai stato implementato con successo. Riassumendo brevemente, si tratta di un progetto

Dettagli

Proposta di un set di indicatori per valutare i risultati del PAN

Proposta di un set di indicatori per valutare i risultati del PAN Proposta di un set di indicatori per valutare i risultati del PAN Alessandra Galosi - Stefano Lucci Luca Segazzi ISPRA Istituto Superiore per la Protezione e Ricerca Ambientale 1.Premessa 2. L attività

Dettagli

Altre novità della nostra ampia gamma di strumenti!

Altre novità della nostra ampia gamma di strumenti! L innovazione ad un prezzo interessante Altre novità della nostra ampia gamma di strumenti! Exacta+Optech Labcenter SpA Via Bosco n.21 41030 San Prospero (MO) Italia Tel: 059-808101 Fax: 059-908556 Mail:

Dettagli

DIPARTIMENTO TUTELA DELLA SALUTE E POLITICHE SANITARIE Allegato 8.6 8.6. Requisiti Specifici per l accreditamento delle Strutture di Genetica Medica

DIPARTIMENTO TUTELA DELLA SALUTE E POLITICHE SANITARIE Allegato 8.6 8.6. Requisiti Specifici per l accreditamento delle Strutture di Genetica Medica 8.6 Requisiti Specifici per l accreditamento delle Strutture di Genetica Medica 1 Premessa Qualità e sostenibilità economica sono le principali esigenze cui cerca di rispondere la concentrazione delle

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

A seguito di specifica richiesta questo Istituto ha emanato il seguente parere in merito alla classificazione dei rifiuti contenenti idrocarburi:

A seguito di specifica richiesta questo Istituto ha emanato il seguente parere in merito alla classificazione dei rifiuti contenenti idrocarburi: A seguito di specifica richiesta questo Istituto ha emanato il seguente parere in merito alla classificazione dei rifiuti contenenti idrocarburi: Riferimenti ISS: Protocollo N. 32074-23/06/2009 Criteri

Dettagli

REALIZZAZIONE DI UNA BANCA DATI AMBIENTALE

REALIZZAZIONE DI UNA BANCA DATI AMBIENTALE REALIZZAZIONE DI UNA BANCA DATI AMBIENTALE Arch. Alverio Camin Progetto Speciale Recupero Ambientale e Urbanistico delle aree Industriali - PAT REALIZZAZIONE DI UNA BANCA DATI AMBIENTALE 1. Esperienza

Dettagli

di4g: Uno strumento di clustering per l analisi integrata di dati geologici

di4g: Uno strumento di clustering per l analisi integrata di dati geologici di4g: Uno strumento di clustering per l analisi integrata di dati geologici Alice Piva 1, Giacomo Gamberoni 1, Denis Ferraretti 1, Evelina Lamma 2 1 intelliware snc, via J.F.Kennedy 15, 44122 Ferrara,

Dettagli

IL DIRETTORE. VISTO lo Statuto dell Università degli Studi di Napoli Federico II;

IL DIRETTORE. VISTO lo Statuto dell Università degli Studi di Napoli Federico II; AVVISO PUBBLICO PER L ASSEGNAZIONE DI INCARICHI PER LO SVOLGIMENTO DI ATTIVITÀ DI DOCENZA NELL AMBITO DEL PRECORSO FORMATIVO DAL TITOLO FORMAZIONE DI ESPERTI NELL'IDENTIFICAZIONE E NELLO SVILUPPO DI NUOVI

Dettagli

LINEE GUIDA E DI COORDINAMENTO ATTUATIVE DEL REGOLAMENTO PER L AGGIORNAMENTO E SVILUPPO PROFESSIONALE CONTINUO

LINEE GUIDA E DI COORDINAMENTO ATTUATIVE DEL REGOLAMENTO PER L AGGIORNAMENTO E SVILUPPO PROFESSIONALE CONTINUO LINEE GUIDA E DI COORDINAMENTO ATTUATIVE DEL REGOLAMENTO PER L AGGIORNAMENTO E SVILUPPO PROFESSIONALE CONTINUO nota tecnica ACCREDITAMENTO DELLE INIZIATIVE DI FORMAZIONE A DISTANZA Sommario 1. Iniziative

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Preprocessamento dei Dati

Preprocessamento dei Dati Preprocessamento dei Dati Raramente i dati sperimentali sono pronti per essere utilizzati immediatamente per le fasi successive del processo di identificazione, a causa di: Offset e disturbi a bassa frequenza

Dettagli

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 Cisteina di 3 gruppo (176) Unità ripetute ricche di leucina Cisteine di 2 gruppo

Dettagli

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la INFIAMMAZIONE Risposta protettiva che ha lo scopo di eliminare sia la causa iniziale del danno cellulare (es. microbi, tossine etc), sia i detriti cellulari e le cellule necrotiche che compaiono a seguito

Dettagli

European Energy Manager

European Energy Manager Diventare Energy Manager in Europa oggi EUREM NET V: programma di formazione e specializzazione per European Energy Manager Durata del corso: 110 ore in 14 giorni, di cui 38 ore di workshop ed esame di

Dettagli

1 LEZIONE CHE COS E L ALLENAMENTO

1 LEZIONE CHE COS E L ALLENAMENTO 1 LEZIONE CHE COS E L ALLENAMENTO Sono molte le definizioni di allenamento: Definizione generale: E un processo che produce nell organismo un cambiamento di stato che può essere fisico, motorio, psicologico.

Dettagli

Vivere bene entro i limiti del nostro pianeta

Vivere bene entro i limiti del nostro pianeta isstock Vivere bene entro i limiti del nostro pianeta 7 PAA Programma generale di azione dell Unione in materia di ambiente fino al 2020 A partire dalla metà degli anni 70 del secolo scorso, la politica

Dettagli

UNIVERSITA DEGLI STUDI MAGNA GRAECIA DI CATANZARO DIPARTIMENTO DI SCIENZE DELLA SALUTE. Programmazione didattica a.a. 2014/2015

UNIVERSITA DEGLI STUDI MAGNA GRAECIA DI CATANZARO DIPARTIMENTO DI SCIENZE DELLA SALUTE. Programmazione didattica a.a. 2014/2015 UNIVERSITA DEGLI STUDI MAGNA GRAECIA DI CATANZARO DIPARTIMENTO DI SCIENZE DELLA SALUTE CORSO DI LAUREA IN BIOTECNOLOGIE Classe L2 Programmazione didattica a.a. 2014/2015 Per l anno accademico 2014-2015

Dettagli

Esercizio 1 Soluzione Esercizio 2 Soluzione

Esercizio 1 Soluzione Esercizio 2 Soluzione Esercizio 1 Si specifichi, mediante una formula del prim ordine un apparato che funziona nel modo seguente: All istante 0 esso emette un segnale s, che può essere uno 0 o un 1. Se, dopo l emissione di

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

Logistica digitale delle Operazioni a premio

Logistica digitale delle Operazioni a premio Logistica digitale delle Operazioni a premio La piattaforma logistica delle operazioni a premio digitali BITGIFT è la nuova piattaforma dedicata alla logistica digitale delle vostre operazioni a premio.

Dettagli

Tipologie di pianificatori. Pianificazione. Partial Order Planning. E compiti diversi. Pianificazione gerarchica. Approcci integrati

Tipologie di pianificatori. Pianificazione. Partial Order Planning. E compiti diversi. Pianificazione gerarchica. Approcci integrati Tipologie di pianificatori Pianificazione Intelligenza Artificiale e Agenti II modulo Pianificazione a ordinamento parziale (POP) (HTN) pianificazione logica (SatPlan) Pianificazione come ricerca su grafi

Dettagli

Compressori serie P Dispositivi elettrici (PA-05-02-I)

Compressori serie P Dispositivi elettrici (PA-05-02-I) Compressori serie P Dispositivi elettrici (PA-05-02-I) 5. MOTORE ELETTRICO 2 Generalità 2 CONFIGURAZIONE PART-WINDING 2 CONFIGURAZIONE STELLA-TRIANGOLO 3 Isolamento del motore elettrico 5 Dispositivi di

Dettagli

Istituto per l Energia Rinnovabile. Autori: David Moser, PhD; Daniele Vettorato, PhD. Bolzano, Gennaio 2013

Istituto per l Energia Rinnovabile. Autori: David Moser, PhD; Daniele Vettorato, PhD. Bolzano, Gennaio 2013 Istituto per l Energia Rinnovabile Catasto Solare Alta Val di Non Relazione Versione: 2.0 Autori: David Moser, PhD; Daniele Vettorato, PhD. Coordinamento e Revisione: dott. Daniele Vettorato, PhD (daniele.vettorato@eurac.edu)

Dettagli

CAPITOLO I CORRENTE ELETTRICA. Copyright ISHTAR - Ottobre 2003 1

CAPITOLO I CORRENTE ELETTRICA. Copyright ISHTAR - Ottobre 2003 1 CAPITOLO I CORRENTE ELETTRICA Copyright ISHTAR - Ottobre 2003 1 INDICE CORRENTE ELETTRICA...3 INTENSITÀ DI CORRENTE...4 Carica elettrica...4 LE CORRENTI CONTINUE O STAZIONARIE...5 CARICA ELETTRICA ELEMENTARE...6

Dettagli

L identificazione e la denominazione delle sostanze chimiche in ambito REACH

L identificazione e la denominazione delle sostanze chimiche in ambito REACH I DETERGENTI: COME CONIUGARE PRESTAZIONI ELEVATE E RISPETTO PER L AMBIENTE L identificazione e la denominazione delle sostanze chimiche in ambito REACH Resana, 5 ottobre 2007 FEDERICA CECCARELLI Ist. Sup.

Dettagli

VALUTAZIONE DI RISULTATO E DI IMPATTO del progetto Diesis

VALUTAZIONE DI RISULTATO E DI IMPATTO del progetto Diesis Obiettivo Competitività Regionale e Occupazione Programma Operativo Nazionale Azioni di Sistema (FSE) 2007-2013 [IT052PO017] Obiettivo Convergenza Programma Operativo Nazionale Governance e Azioni di Sistema

Dettagli

Contenuti dello studio di impatto ambientale (SIA)

Contenuti dello studio di impatto ambientale (SIA) Contenuti dello studio di impatto ambientale (SIA) Ai progetti sottoposti alla procedura di impatto ambientale ai sensi degli articoli 52 e seguenti, è allegato uno studio di impatto ambientale, redatto

Dettagli

www.bistrategy.it In un momento di crisi perché scegliere di investire sulla Business Intelligence?

www.bistrategy.it In un momento di crisi perché scegliere di investire sulla Business Intelligence? In un momento di crisi perché scegliere di investire sulla Business Intelligence? Cos è? Per definizione, la Business Intelligence è: la trasformazione dei dati in INFORMAZIONI messe a supporto delle decisioni

Dettagli

Relazione specialistica

Relazione specialistica Relazione specialistica Dipl.-Ing. Hardy Ernst Dipl.-Wirtschaftsing. (FH), Dipl.-Informationswirt (FH) Markus Tuffner, Bosch Industriekessel GmbH Basi di progettazione per una generazione ottimale di vapore

Dettagli

I METALLI PESANTI NEL LATTE

I METALLI PESANTI NEL LATTE I METALLI PESANTI NEL LATTE di Serraino Andrea Dipartimento di Sanità Pubblica Veterinaria e Patologia Animale - Facoltà Medicina Veterinaria - Università di Bologna - Alma Mater Studiorum. I metalli sono

Dettagli

Recuperare energia dai

Recuperare energia dai Recuperare energia dai rifiuti del tabacco Riduzione dell impatto ambientale e sanitario delle cicche di sigaretta e produzione di energia mediante pirogassificazione Raffaella Uccelli- Ricercatore ENEA

Dettagli

Capitolo 12 La regressione lineare semplice

Capitolo 12 La regressione lineare semplice Levine, Krehbiel, Berenson Statistica II ed. 2006 Apogeo Capitolo 12 La regressione lineare semplice Insegnamento: Statistica Corso di Laurea Triennale in Economia Facoltà di Economia, Università di Ferrara

Dettagli

Ricerca, Qualità, Sicurezza e Salute

Ricerca, Qualità, Sicurezza e Salute Ricerca, Qualità, Sicurezza e Salute Chi Siamo Hygeia Lab S.r.l. nasce nel 2011 dalla passione e dal desiderio di giovani laureati di continuare la crescita e la formazione scientifica. E una Start-Up

Dettagli

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office Gestione delle Architetture e dei Servizi IT con ADOit Un Prodotto della Suite BOC Management Office Controllo Globale e Permanente delle Architetture IT Aziendali e dei Processi IT: IT-Governance Definire

Dettagli

DIAGNOSTICA CLINICA E STRUMENTALE. Dr.ssa Michela Marcon CDC NEUROLOGIA DIPARTIMENTO NEUROSCIENZE OSPEDALE SAN BORTOLO VICENZA

DIAGNOSTICA CLINICA E STRUMENTALE. Dr.ssa Michela Marcon CDC NEUROLOGIA DIPARTIMENTO NEUROSCIENZE OSPEDALE SAN BORTOLO VICENZA DIAGNOSTICA CLINICA E STRUMENTALE Dr.ssa Michela Marcon CDC NEUROLOGIA DIPARTIMENTO NEUROSCIENZE OSPEDALE SAN BORTOLO VICENZA 1984 I criteri NINCDS-ADRDA regole La diagnosi di AD è clinico-patologico:

Dettagli

Oscilloscopi serie WaveAce

Oscilloscopi serie WaveAce Oscilloscopi serie WaveAce 60 MHz 300 MHz Il collaudo facile, intelligente ed efficiente GLI STRUMENTI E LE FUNZIONI PER TUTTE LE TUE ESIGENZE DI COLLAUDO CARATTERISTICHE PRINCIPALI Banda analogica da

Dettagli

SPAI di Puclini Carlo

SPAI di Puclini Carlo CARTA DELLA QUALITÀ DELL OFFERTA FORMATIVA INDICE 1. LIVELLO STRATEGICO 1.1 Politica della Qualità 2. LIVELLO ORGANIZZATIVO 2.1 Servizi formativi offerti 2.2 Dotazione di risorse professionali e logistico

Dettagli

Di seguito sono mostrati alcuni esempi della prova scritta riguardante il I Parziale.

Di seguito sono mostrati alcuni esempi della prova scritta riguardante il I Parziale. L esame di Chimica Farmaceutica e Tossicologica I, a.a. 2014-2015, consiste in una prova scritta ed una orale. La prova scritta viene effettuata nei giorni, luoghi ed orari che sono presenti on-line (sito

Dettagli

unità B3. Le teorie sull evoluzione

unità B3. Le teorie sull evoluzione documentazione fossile è provata da embriologia comparata anatomia comparata biologia molecolare L evoluzione avviene per selezione naturale microevoluzione può essere macroevoluzione speciazione allopatrica

Dettagli

ED.FISICA Il doping. STORIA Gli anni 20 negli Usa

ED.FISICA Il doping. STORIA Gli anni 20 negli Usa SCIENZE La genetica ED.FISICA Il doping TECNOLOGIA L automobile e la Ford ED.ARTIST. Il cubismo e Braque STORIA Gli anni 20 negli Usa GEOGRAFIA Gli Usa ITALIANO Il Decadentis mo e Svevo INGLESE ED.MUSICA

Dettagli

La nuova direttiva UE sulle sostanze radioattive nell acqua potabile

La nuova direttiva UE sulle sostanze radioattive nell acqua potabile Abteilung 29 Landesagentur für Umwelt Amt 29.8 Labor für physikalische Chemie Ripartizione 29 Agenzia provinciale per l ambiente Ufficio 29.8 Laboratorio di chimica fisica La nuova direttiva UE sulle sostanze

Dettagli

NASCITA: DATA DI NASCITA: 11/08/'63 RESIDENZA: via Ugo Foscolo n 18-00040 Castel Gandolfo - (Rm) STATO CIVILE: Separato SERVIZIO

NASCITA: DATA DI NASCITA: 11/08/'63 RESIDENZA: via Ugo Foscolo n 18-00040 Castel Gandolfo - (Rm) STATO CIVILE: Separato SERVIZIO Via Ugo Foscolo 18 Castel Gandolfo - Marino - Roma Tel.: 3351572723 e-mail fbusico@inwind.it CURRICULUM VITAE DATI PERSONALI NOME: Fabio COGNOME: Busico LUOGO DI Roma NASCITA: DATA DI NASCITA: 11/08/'63

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

White Paper. Operational DashBoard. per una Business Intelligence. in real-time

White Paper. Operational DashBoard. per una Business Intelligence. in real-time White Paper Operational DashBoard per una Business Intelligence in real-time Settembre 2011 www.axiante.com A Paper Published by Axiante CAMBIARE LE TRADIZIONI C'è stato un tempo in cui la Business Intelligence

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

A. Barra Caracciolo, A. B. Petrangeli, P. Grenni, G. De Donato, F. Falconi, S. Santoro

A. Barra Caracciolo, A. B. Petrangeli, P. Grenni, G. De Donato, F. Falconi, S. Santoro 2 DESC Versione 2010 Guida alla consultazione del sito web Realizzato da IRSA-CNR A. Barra Caracciolo, A. B. Petrangeli, P. Grenni, G. De Donato, F. Falconi, S. Santoro Indice GUIDA ALLA CONSULTAZIONE

Dettagli

Sistemi di supporto alle decisioni Ing. Valerio Lacagnina

Sistemi di supporto alle decisioni Ing. Valerio Lacagnina Cosa è il DSS L elevato sviluppo dei personal computer, delle reti di calcolatori, dei sistemi database di grandi dimensioni, e la forte espansione di modelli basati sui calcolatori rappresentano gli sviluppi

Dettagli

ATTIVITA DELLA REGIONE LIGURIA NELL AMBITO DEGLI STUDI E INDAGINI SULLA MICROZONAZIONE SISMICA

ATTIVITA DELLA REGIONE LIGURIA NELL AMBITO DEGLI STUDI E INDAGINI SULLA MICROZONAZIONE SISMICA STUDI DI MICROZONAZIONE SISMICA: TEORIA ED APPLICAZIONI AOSTA, Loc. Amérique Quart (AO), 18-19 Ottobre 2011 Assessorato OO.PP., Difesa Suolo e Edilizia Residenziale Pubblica - Servizio Geologico ATTIVITA

Dettagli

www.sipcamitalia.it Questo contenuto ti è offerto da: Articolo tratto da: Edizioni L Informatore Agrario

www.sipcamitalia.it Questo contenuto ti è offerto da: Articolo tratto da: Edizioni L Informatore Agrario Questo contenuto ti è offerto da: www.sipcamitalia.it Articolo tratto da: Edizioni L Informatore Agrario Tutti i diritti riservati, a norma della Legge sul Diritto d Autore e le sue successive modificazioni.

Dettagli

IT-BOOK. Domini Hosting Web marketing E-mail e PEC

IT-BOOK. Domini Hosting Web marketing E-mail e PEC 5 giugno 09 IT-BOOK Configurazioni e cartatteristiche tecniche possono essere soggette a variazioni senza preavviso. Tutti i marchi citati sono registrati dai rispettivi proprietari. Non gettare per terra:

Dettagli

The Future Starts Now. Termometri portatili

The Future Starts Now. Termometri portatili Termometri portatili Temp 70 RTD Professional Datalogger, per sonde Pt100 RTD 0,01 C da -99,99 a +99,99 C 0,1 C da -200,0 a +999,9 C Temp 7 RTD Basic Per sonde Pt100 RTD 0,1 C da -99,9 a +199,9 C 1 C da

Dettagli

Che cos'è il radon? Il gas radon è rilevabile con i sensi?

Che cos'è il radon? Il gas radon è rilevabile con i sensi? Che cos'è il radon? Il Radon è un gas inodore e incolore presente in natura. Il suo isotopo (atomo di uno stesso elemento chimico con numero di protoni fisso e numero di neutroni variabile) 222Rn è radioattivo

Dettagli

Verifica della corretta applicazione del Regolamento Import-Export

Verifica della corretta applicazione del Regolamento Import-Export Verifica della corretta applicazione del Regolamento Import-Export Dott.ssa Luigia Scimonelli ISS - Min. del lavoro, della salute e delle politiche sociali Roma, 26 novembre 2008 Indice Convenzione di

Dettagli

STUDIO DI SETTORE UG40U ATTIVITÀ 41.10.00 ATTIVITÀ 42.99.01 ATTIVITÀ 68.10.00 ATTIVITÀ 68.20.02 SVILUPPO DI PROGETTI IMMOBILIARI SENZA COSTRUZIONE

STUDIO DI SETTORE UG40U ATTIVITÀ 41.10.00 ATTIVITÀ 42.99.01 ATTIVITÀ 68.10.00 ATTIVITÀ 68.20.02 SVILUPPO DI PROGETTI IMMOBILIARI SENZA COSTRUZIONE STUDIO DI SETTORE UG40U ATTIVITÀ 41.10.00 SVILUPPO DI PROGETTI IMMOBILIARI SENZA COSTRUZIONE ATTIVITÀ 42.99.01 LOTTIZZAZIONE DEI TERRENI CONNESSA CON L URBANIZZAZIONE ATTIVITÀ 68.10.00 COMPRAVENDITA DI

Dettagli

Seconda Prova di Ricerca Operativa. Cognome Nome Numero Matricola A 1/12 A 2/12

Seconda Prova di Ricerca Operativa. Cognome Nome Numero Matricola A 1/12 A 2/12 A / A / Seconda Prova di Ricerca Operativa Cognome Nome Numero Matricola Nota: LA RISOLUZIONE CORRETTA DEGLI ESERCIZI CONTRADDISTINTI DA UN ASTERISCO È CONDIZIONE NECESSARIA PER IL RAGGIUNGIMENTO DELLA

Dettagli

IL SEGRETO DI UN BUON RIPARTITORE

IL SEGRETO DI UN BUON RIPARTITORE FOCUS TECNICO IL SEGRETO DI UN BUON RIPARTITORE ADEGUAMENTO ALLE NORMATIVE DETRAZIONI FISCALI SUDDIVISIONE PIÙ EQUA DELLE SPESE RISPARMIO IN BOLLETTA MINOR CONSUMO GLOBALE DI TUTTO IL CONDOMINIO COSTO

Dettagli

Bollettino ECEPA. In questo numero 1 VERIFICA ISPETTIVA DI CAMPIONAMENTO 2 ETICHETTATURA DEI PRODOTTI DOP. 3 DIRITTI E LIMITAZIONI NELL USO DEL

Bollettino ECEPA. In questo numero 1 VERIFICA ISPETTIVA DI CAMPIONAMENTO 2 ETICHETTATURA DEI PRODOTTI DOP. 3 DIRITTI E LIMITAZIONI NELL USO DEL Bollettino ECEPA In questo numero N 6 1 VERIFICA ISPETTIVA DI CAMPIONAMENTO ED ANALISI DEI PRODOTTI DOP 2 ETICHETTATURA DEI PRODOTTI DOP. 2.1. Marchi di conformità ECEPA 2.2. Marchio Comunitario DOP 2.3.

Dettagli

Alimentazione e salute dell intestino: siamo quello che mangiamo

Alimentazione e salute dell intestino: siamo quello che mangiamo Alimentazione e salute dell intestino: siamo quello che mangiamo La dieta, il microbiota intestinale e la salute digestiva sono intrecciati fra loro. Questi legami e il potenziale benefico dei probiotici

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

Guida rapida all uso di ECM Titanium

Guida rapida all uso di ECM Titanium Guida rapida all uso di ECM Titanium Introduzione Questa guida contiene una spiegazione semplificata del funzionamento del software per Chiputilizzare al meglio il Tuning ECM Titanium ed include tutte

Dettagli

voce dei cittadini in tempo reale OpinionMeter Chieda la sua prova personalizzata senza impegno entro il 15 ottobre 2010

voce dei cittadini in tempo reale OpinionMeter Chieda la sua prova personalizzata senza impegno entro il 15 ottobre 2010 Grazie per il suo interesse alla nuova tecnologia voce dei cittadini in tempo reale OpinionMeter Chieda la sua prova personalizzata senza impegno entro il 15 ottobre 2010 Cristina Brambilla Telefono 348.9897.337,

Dettagli

Accademia Beauty and Hair

Accademia Beauty and Hair INDICE CARTA DELLA QUALITÀ DELL OFFERTA FORMATIVA 1. LIVELLO STRATEGICO 1.1 Politica della Qualità 2. LIVELLO ORGANIZZATIVO 2.1 Servizi formativi offerti 2.2 Dotazione di risorse professionali e logistico

Dettagli

Esperienze e soluzioni realizzate nell ambito del Progetto S.I.MO.NE

Esperienze e soluzioni realizzate nell ambito del Progetto S.I.MO.NE Programma Enti Locali Innovazione di Sistema Esperienze e soluzioni realizzate nell ambito del Progetto S.I.MO.NE 1 Premessa Il presente documento ha lo scopo di facilitare la disseminazione e il riuso

Dettagli

il materiale contenuto nel presente documento non può essere utilizzato o riprodotto senza autorizzazione

il materiale contenuto nel presente documento non può essere utilizzato o riprodotto senza autorizzazione Reliability Management La gestione del processo di Sviluppo Prodotto Ing. Andrea Calisti www.indcons.eu Chi sono... Andrea CALISTI Ingegnere meccanico dal 1995 al 2009 nel Gruppo Fiat Assistenza Clienti

Dettagli

EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi

EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi ENDNOTE WEB EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi EndNote Web consente di: importare informazioni

Dettagli

RELAZIONE TRA VARIABILI QUANTITATIVE. Lezione 7 a. Accade spesso nella ricerca in campo biomedico, così come in altri campi della

RELAZIONE TRA VARIABILI QUANTITATIVE. Lezione 7 a. Accade spesso nella ricerca in campo biomedico, così come in altri campi della RELAZIONE TRA VARIABILI QUANTITATIVE Lezione 7 a Accade spesso nella ricerca in campo biomedico, così come in altri campi della scienza, di voler studiare come il variare di una o più variabili (variabili

Dettagli

L applicazione delle tassonomie XBRL alle società italiane

L applicazione delle tassonomie XBRL alle società italiane CIRCOLARE N. 12 DEL 20 APRILE 2015 DIRITTO SOCIETARIO MERCATO DEI CAPITALI E SOCIETA QUOTATE L applicazione delle tassonomie XBRL alle società italiane www.assonime.it ABSTRACT Nel corso del 2014 si è

Dettagli

CRITERI PER L ASSEGNAZIONE DI CREDITI ALLE ATTIVITA ECM

CRITERI PER L ASSEGNAZIONE DI CREDITI ALLE ATTIVITA ECM CRITERI PER L ASSEGNAZIONE DI CREDITI ALLE ATTIVITA ECM 1. Introduzione 2. Pianificazione dell attività formativa ECM 3. Criteri per l assegnazione dei crediti nelle diverse tipologie di formazione ECM

Dettagli

Camera di combustione Struttura chiusa dentro cui un combustibile viene bruciato per riscaldare aria o altro.

Camera di combustione Struttura chiusa dentro cui un combustibile viene bruciato per riscaldare aria o altro. C Caldaia L'unità centrale scambiatore termico-bruciatore destinata a trasmettere all'acqua il calore prodotto dalla combustione. v. Camera di combustione, Centrali termiche, Efficienza di un impianto

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Bus di sistema. Bus di sistema

Bus di sistema. Bus di sistema Bus di sistema Permette la comunicazione (scambio di dati) tra i diversi dispositivi che costituiscono il calcolatore E costituito da un insieme di fili metallici che danno luogo ad un collegamento aperto

Dettagli