e dei genotipi tossici

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "e dei genotipi tossici"

Transcript

1 Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle fioriture di cianobatteri nelle acque di balneazione: approccio per l applicazione del DL 30 maggio 2008 N.112 in recepimento della direttiva 2006/7EC - ISS, 19 maggio 2009

2 Identificazione di cianobatteri nella metodica tradizionale : analisi i morfologica osservazione al microscopio i Limiti: soggettività dell operatore nell interpretazione della morfologia delle cellule impossibilità di discriminare tra specie tossiche e non Necessita la combinazione con saggi chimici, biochimici o enzimatici sulle tossine L APPROCCIO GENETICO nel monitoraggio ambientale permette di seguire il fenomeno delle fioritureit sin dalle fasi più precoci attraverso identificazione tassonomica ed eventuale rilevazione di ceppi potenzialmente tossici.

3 APPROCCI MOLECOLARI COMUNI NELLA DETERMINAZIONE DI CIANOBATTERI. Campione ambientale Estrazione DNA/RNA Analisi quantitativa PCR DGGE Real-time PCR RFLP Analisi qualitativa Bioinformatica (Sequenziamento, Allineamento)

4 CARATTERIZZAZIONE MOLECOLARE DI CIANOBATTERI: 1. Definizione TASSONOMICA degli individui (genere, specie, ceppo) 2. Definizione di specifiche SONDE MOLECOLARI per l identificazione di specie tossiche

5 1. Definizione TASSONOMICA e analisi filogenetica di campioni ambientali (a livello di genere, specie, ceppo): Geni housekeeping come marker filogenetici: - Amplificazione dell INTERGENIC SPACER nell operone FICOCIANINA (regione potenzialmente ad alta variabilità) PC-IGS cpcb cpca cpcc cpcd cpce 2 biline α e β 3 peptidi linker cautela nella scelta del marcatore!! Il locus può accumulare mutazioni nel periodo di coltura Può essere inaffidabile

6 - Amplificazione all interno del gene per l rrna 16S: Ottima stabilità, affidabilità Primers universali PCR disegnati in regioni ben conservate Analisi RFLP Rischio: L analisi della sequenza 16S rrna può essere non sufficientemente sensibile nella discriminazione di specie strettamente correlate - Amplificazione di altri marcatori (geni nif, rpoc1, gyrb)

7 Es: Ricerca di Planktothrix mediante amplificazione del marker rdna 16S Campioni ambientali eterogenei DNA amplificazione della regione rdna 16S come marcatore genere-specfico di Planktothrix ELETTROFORESI SU GEL DI AGAROSIO Lane 1 = assenza di Planktothrix th Lane 2,3,4 = Planktothrix Lane 5 = bianco Lane 6 = ladder

8 2. Definizione di specifiche SONDE MOLECOLARI per la ricerca di specie tossiche all interno di un campione ambientale L identificazione di eventuali specie tossiche si realizza mediante la ricerca di specifici geni marker (mcy), raggruppati in cluster, che codificano per grandi complessi multienzimatici (NRPS o Peptide Sintetasi Non Ribosomali) coinvolti nella biosintesi delle Microcistine. Cluster mcy per la biosintesi delle microcistine (Planktothrix genera). Raggruppa 9 geni che codificano per diversi domini del complesso multienzimatico della MICROCISTINA SINTETASI. S kb mcyt mcyd mcye mcyg mcyh mcya mcyb mcyc mcyj = Peptide Sintetasi = Polichetide Sintasi = Modifica = Trasporto Ortologhi dei geni mcy sono stati trovati in altre specie di Cianobatteri tossici inclusi Microcystis, Nostoc, Anabaena, Nodularia.

9 Nel cluster mcy possono essere presenti delezioni anche estese in grado di alterare la funzionalità del prodotto proteico Es: Ricerca di microcistine in relazione alla presenza di marcatori mcy in colture di P. agardhii e P. rubescens (modified from S. Mbedi et al., 2005). Ceppo microcistina mcyt mcytd mcya mcyb mcye P. agardhii HUB076/A P. agardhii LAN P. agardhii Max P. agardhii Max P. agardhii Max P. rubescens BL P. rubescens BL P. rubescens HUB = falsi positivi - = falsi negativi

10 Es.: Ricerca e quantificazione di genotipi tossici di Planktothrix nelle acque del lago di Vico mediante Real time PCR (qpcr). Campione ambientale Cellule su filtro 0,2 µm; Conservazione a -20 C Estrazione DNA (kit commerciali) Taq Nuclease Assay (o saggio Taqman): Amplificazione ione all interno dei loci rdna 16S (per la definizione tassonomica) e mcyb (come marcatore di tossicità). Coppia di primers specifici + sonda fluorescente Emissione di fluorescenza (Ct) durante la reazione di PCR strettamente correlata numero di copie target presenti inizialmente.

11 Es. MONITORAGGIO LAGO DI GEROSA (1 anno di rilevamenti - ottobre 2006-ottobre 2007): novembre 2006: picco conc. cell. bassa conc. microcistine dicembre 2006: bassa conc. cell. picco conc. microcistine November (surface) December (surface) Microcystins ELISA 1,28 2,04 (µg/l) LC/MS 0, ,4 Cells n. (10 6 ) mcyb vs Pc (%) qpcr 44 3,7 31% 63,7% Lo sfasamento tra il numero degli individui e la produzione della microcistina può essere parzialmente spiegato con una variazione della percentuale degli individui tossici rispetto a quelli non tossici.

12 La bioinformatica come potente strumento nella identificazione di popolazioni p in campioni ambientali PCR Sequenziamento Programmi di allineamento di sequenze (BLAST, CLUSTALW) Confronto con banche dati; Ricerca del best match Si risale all organismo; Si ipotizzano relazioni filogenetiche

13 Basic Local Alignment Search Tool BLAST è un algoritmo ottimizzato i t per ricercare regioni di locale omologia tra sequenze presenti nel database. 1. Identificazione i di cianobatteri i attraverso il confronto con banche dati Ricerca del best-match t

14

15

16

17 Basic Local Alignment Search Tool (BLAST) 2. Valutazione della capacità discriminante di primers per l identificazione di specie di cianobatteri

18

19

20 ClustalW Allineamento multiplo di sequenze Disegno di primers per la discriminazione Disegno di primers per la discriminazione molecolare di specie di cianobatteri

21

22 Planktothrix Rubescens (seq.1-15) vs Planktothrix Agardhii (seq.16-30) C-phycocyanin alpha subunit (cpca) gene, partial cds CLUSTAL W (1.81) Multiple Sequence Alignments Sequence type explicitly set to DNA Sequence format is Pearson Sequence 1: gi gb EU _Pl Sequence 2: gi gb EU g _ Pl Sequence 3: gi gb EU _Pl Sequence 4: gi gb EU _Pl Sequence 5: gi gb EU _Pl Sequence 6: gi gb EU _Pl Sequence 7: gi gb EU g _ Pl Sequence 8: gi gb EU _Pl Sequence 9: gi gb EU _Pl Sequence 10: gi gb EU _Pl Sequence 11: gi gb EU _Pl Sequence 12: gi gb EU g _ Pl Sequence 13: gi gb EU _Pl Sequence 14: gi gb EU _Pl Sequence 15: gi gb EU _Pl Sequence 16: gi gb EU _Pl Sequence 17: gi gb EU g _ Pl Sequence 18: gi gb EU _Pl Sequence 19: gi gb EU _Pl Sequence 20: gi gb EU _Pl Sequence 21: gi gb EU _Pl Sequence 22: gi gb EU g _ Pl Sequence 23: gi gb EU _Pl Sequence 24: gi gb EU _Pl Sequence 25: gi gb EU _Pl Sequence 26: gi gb EU _Pl Sequence 27: gi gb EU g _ Pl Sequence 28: gi gb EU _Pl Sequence 29: gi gb EU _Pl Sequence 30: gi gb EU _Pl Start of Pairwise alignments

23 clustalw.aln CLUSTAL W (1.81) multiple sequence alignment Sequences (1:2) Aligned. Score: Sequences (1:3) Aligned. Score: Sequences (1:4) Aligned. Score: Sequences (2:2) Aligned. Score: Sequences (2:3) Aligned. Score: Sequences (2:4) Aligned. Score: Sequences (30:29) Aligned. Score: Sequences (30:30) Aligned. Score: CLUSTAL-Alignment file created [clustalw.aln] clustalw.aln gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU g _ Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl 1 CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAAATCCAAGTGGCTTTTGGTCGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAACTGCAAGTGGCTTTCGGACGT gi gb EU _Pl CTCAAGGCCGTTTCCTGAGCAGCACTGAACTGCAAGTGGCTTTCGGACGT ***************************** * *********** ** ***

24 USO DI METODOLOGIE MOLECOLARI NELLA CARATTERIZZAZIONE DI CIANOBATTERI: VANTAGGI Rapidi e relativamente economici Alta specificità e sensibilità Permettono di discriminare tra ceppi morfologicamente identici Consentono il diretto utilizzo del campione ambientale, senza dover necessariamente allestire una coltura cellulare Saggi qualitativi / quantitativi / di espressione (PCR) (qpcr) (RT-PCR) Permettono di risalire all organismo produttore della tossina Non richiedono processamento immediato del campione, che può essere conservato nel tempo

25 USO DI METODOLOGIE MOLECOLARI NELLA CARATTERIZZAZIONE DI CIANOBATTERI: LIMITI Database di sequenza talvolta lacunosi per alcune specie: difficoltà nel disegno di primers efficaci Variabilità di sequenza intra-specie rischio di sottostimare la popolazione se i primers scelti non sono disegnati entro regioni ben conservate Possono dare falsi negativi o falsi positivi se i geni marker non sono opportunamente scelti Danno una stima del DNA totale, non permettono discriminare tra cellule vive e morte

METODI GENETICI NELLA IDENTIFICAZIONE DI

METODI GENETICI NELLA IDENTIFICAZIONE DI METODI GENETICI NELLA IDENTIFICAZIONE DI CIANOBATTERI Susanna Vichi, Simonetta Gemma, Emanuela Testai Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Convegno Cianobatteri

Dettagli

CARATTERIZZAZIONE MOLECOLARE DI CIANOBATTERI:

CARATTERIZZAZIONE MOLECOLARE DI CIANOBATTERI: Susanna Vichi PRESENTAZIONE DELLE NUOVE LINEE GUIDA PER LA GESTIONE DELLE FIORITURE DI OSTREOPSIS OVATA E DI CIANOBATTERI NELLE ACQUE DI BALNEAZIONE 20-21 Aprile 2015 CARATTERIZZAZIONE MOLECOLARE DI CIANOBATTERI:

Dettagli

1 CORSO DI AGGIORNAMENTO SU PROBLEMATICHE DEGLI ORGANISMI ACQUATICI. Tri 17 Dicebre 2013. Sala Conferenze IZSPLVA Via Bologna 148Torino

1 CORSO DI AGGIORNAMENTO SU PROBLEMATICHE DEGLI ORGANISMI ACQUATICI. Tri 17 Dicebre 2013. Sala Conferenze IZSPLVA Via Bologna 148Torino 1 CORSO DI AGGIORNAMENTO SU PROBLEMATICHE DEGLI ORGANISMI ACQUATICI Tri 17 Dicebre 2013 Sala Conferenze IZSPLVA Via Bologna 148Torino cianobatteri o alghe verdi-azzurre costituiscono uno dei principali

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

Metodi Molecolari per la Ricerca, Identificazione e tipizzazione di Francisella tularensis

Metodi Molecolari per la Ricerca, Identificazione e tipizzazione di Francisella tularensis Roma, ottobre 204 Metodi Molecolari per la Ricerca, Identificazione e tipizzazione di Francisella tularensis IZSLER Sezione di Pavia Nadia Vicari Metodi molecolari Rilevare Identificare Tipizzare Sub-tipizzare

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI)

Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Dott.ssa G. Scalet Sezione Microbiologia-Dipartimento Di Patologia e Diagnostica Università

Dettagli

Metodi di identificazione e quantificazione: Metodi immunoenzimatici

Metodi di identificazione e quantificazione: Metodi immunoenzimatici Metodi di identificazione e quantificazione: Metodi immunoenzimatici Daniela Mattei Mara Stefanelli I CIANOBATTERI POTENZIALMENTE TOSSICI: IMPLICAZIONI SANITARIE E GESTIONE DEL RISCHIO Istituto Superiore

Dettagli

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Istituto Superiore di Sanità Roma 30 ottobre 2007 Rossella Briancesco Metodi tradizionali spesso poco sensibili Metodi

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

Estrazione delle microcistine: metodi a confronto

Estrazione delle microcistine: metodi a confronto Applicazione in Italia della direttiva 2006/7/CE in materia di balneazione: quale il ruolo dei cianobatteri nel giudizio di balneabilità. Estrazione delle microcistine: metodi a confronto Tavola Elena

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

Banche Dati Secondarie. geni trascritti proteine profili strutture

Banche Dati Secondarie. geni trascritti proteine profili strutture Banche Dati Secondarie geni trascritti proteine profili strutture definizione Banca dati il cui contenuto deriva da una banca dati primaria DB sec DB primario informazione PROSITE SWISS Prot patterns Profiles

Dettagli

Centro Interdipartimentale di Ricerca per l Innovazione in Viticoltura ed Enologia

Centro Interdipartimentale di Ricerca per l Innovazione in Viticoltura ed Enologia Il DNA come Elemento Tracciante in Spumantizzazione Centro Interdipartimentale di Ricerca per l Innovazione in Viticoltura ed Enologia Dr. Ileana Vigentini IL VINO SPUMANTE METODO CLASSICO (CHAMPENOISE

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA CLM Biotecnologie per l Alimentazione CLM in Biotecnologie Sanitarie Corso di Chimica e certificazione degli alimenti DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA VIRUS ENTERICI virus escreti tramite

Dettagli

Fisiologia dell emostasi

Fisiologia dell emostasi 1 STRATEGIE DIAGNOSTICHE PER L EMOFILIA A DEL CANE Marco Caldin DVM, PhD, ECVCP Diplomate 2 Fisiologia dell emostasi 1 3 Fisiologia dell emostasi 4 Attivazione emostatica 2 5 Emostasi primaria 6 Emostasi

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche I T A L B I O F O R M A i n c o l l a b o r a z i o n e c o n O R D I N E N A Z I O N A L E D E I B I O L O G I o r g a n i z z a i l c o r s o d i a g g i o r n a m e n t o BIOLOGIA MOLECOLARE: introduzione

Dettagli

I MICRORGANISMI E GLI ALIMENTI

I MICRORGANISMI E GLI ALIMENTI Le applicazioni attuali delle biotecnologie NON OGM nel settore alimentare diego.mora@unimi.it www.distam.unimi.it I MICRORGANISMI E GLI ALIMENTI Quanti microrganismi ingeriamo con gli alimenti? Si ingeriscono

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

Analisi della Malattia Minima Residua

Analisi della Malattia Minima Residua XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Analisi della Malattia Minima Residua Dr.ssa Anna Gazzola Laboratorio di Patologia Molecolare, Sezione di Emolinfopatologia,

Dettagli

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine Università degli Studi del Piemonte Orientale A. Avogadro CORSO DI ALTA FORMAZIONE IN LEGISLAZIONE ALIMENTARE Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

METODI ALTERNATIVI. PCR digitale per la rilevazione e quantificazione. assoluta del DNA

METODI ALTERNATIVI. PCR digitale per la rilevazione e quantificazione. assoluta del DNA METODI ALTERNATIVI PCR digitale per la rilevazione e quantificazione assoluta del DNA Roma, 25 settembre 2013 Giuseppina Buonincontro IZS PLV- S.S. Controllo Alimenti La prima generazione di PCR consente

Dettagli

ABI-7700 User Bulletin #5

ABI-7700 User Bulletin #5 ABI-7700 User Bulletin #5 1. halogen tungsten lamp 2b. emission filters 3. intensifier 5. ccd detector 350,000 pixels 2a. excitation filters 4. sample plate www.biorad.com 3 Real-time qpcr - La fluorescenza

Dettagli

Controllo ufficiale degli OGM nel settore agroalimentare

Controllo ufficiale degli OGM nel settore agroalimentare Controllo ufficiale degli OGM nel settore agroalimentare Ugo Marchesi Istituto Zooprofilattico Sperimentale Lazio e Toscana Centro di Referenza Nazionale per la ricerca di OGM ugo.marchesi@izslt.it ORGANISMI

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

F O R M A T O E U R O P E O

F O R M A T O E U R O P E O F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome QUARANTA NICOLA Indirizzo VIA CORTICELLI N.29/A BARI - CEGLIE DEL CAMPO 70129 (BA) Telefono 3494336740 0805031217

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini Università di Bologna Dipartimento di Medicina Clinica Specialistica e Sperimentale Sezione di Microbiologia RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI

Dettagli

The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione

Dettagli

Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario

Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario Istituto di Biologia e Biotecnologia Agraria (IBBA) Tuesday, October

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Real Time PCR. La PCR Real Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico.

Real Time PCR. La PCR Real Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico. eal Time PC La PC eal Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico. Gli strumenti per PC eal Time, oltre a fungere da termociclatori,

Dettagli

Analisi dei marcatori molecolari della pluripotenza e del differenziamento delle cellule embrionali staminali (ES) murine

Analisi dei marcatori molecolari della pluripotenza e del differenziamento delle cellule embrionali staminali (ES) murine Training Course 2010 Stem Cell Differentiation Napoli, 9-12 Novembre Analisi dei marcatori molecolari della pluripotenza e del differenziamento delle cellule embrionali staminali (ES) murine Cristina D

Dettagli

CAPITOLATO TECNICO PER DIAGNOSTICI PER TIPIZZAZIONE MOLECOLARE DA DESTINARSI AL LABORATORIO DI GENETICA MOLECOLARE-MEDICINA LEGALE P.O.

CAPITOLATO TECNICO PER DIAGNOSTICI PER TIPIZZAZIONE MOLECOLARE DA DESTINARSI AL LABORATORIO DI GENETICA MOLECOLARE-MEDICINA LEGALE P.O. ALLEGATO A CAPITOLATO TECNICO PER DIAGNOSTICI PER TIPIZZAZIONE MOLECOLARE DA DESTINARSI AL LABORATORIO DI GENETICA MOLECOLARE-MEDICINA LEGALE P.O. MONSERRATO Durata della fornitura: 1 anno + 1 rinnovabile

Dettagli

Unità tecnica UTAGRI Laboratori INN e GEN

Unità tecnica UTAGRI Laboratori INN e GEN Unità tecnica UTAGRI Laboratori INN e GEN FOODFLAVOUR PL 77.2 Metodologie diagnostiche innovative per la caratterizzazione delle comunità microbiche Responsabile: Annamaria Bevivino Partecipanti: Patrizia

Dettagli

ZytoLight SPEC ALK/EML4 TriCheck Probe

ZytoLight SPEC ALK/EML4 TriCheck Probe ZytoLight SPEC ALK/EML4 TriCheck Probe Z-2117-200 Z-2117-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del riarrangiamento dei geni ALK- EML4 mediante ibridazione in situ fluorescente (FISH).... Dispositivo

Dettagli

INTRODUZIONE OBIETTIVI DEL PROGETTO. i) controllare la diffusione del virus nelle coltivazioni piemontesi

INTRODUZIONE OBIETTIVI DEL PROGETTO. i) controllare la diffusione del virus nelle coltivazioni piemontesi Prosecuzione ed ampliamento studio epidemiologico per la caratterizzazione dello stato sanitario delle colture di Mirtillo del Piemonte, con particolare attenzione alla presenza del Carlavirus Blueberry

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello

Dettagli

AlphaReal BREAST Scheda Tecnica

AlphaReal BREAST Scheda Tecnica AlphaReal BREAST Scheda Tecnica A3 DS RT 607 ARBreast_01_2015.doc Pag. 1 di 5 Rev. 01 del Gennaio 2015 Prodotto: AlphaReal BREAST Codice prodotto: RT-607.05.20 / RT-607.10.20 N Tests: 5/10 tests Destinazione

Dettagli

Ruolo dei test di clonalità nei disordini linfoproliferativi

Ruolo dei test di clonalità nei disordini linfoproliferativi XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Ruolo dei test di clonalità nei disordini linfoproliferativi Dr.ssa Claudia Mannu Laboratorio di Patologia Molecolare,

Dettagli

EPIDEMIOLOGIA MOLECOLARE DELLE INFEZIONI NOSOCOMIALI

EPIDEMIOLOGIA MOLECOLARE DELLE INFEZIONI NOSOCOMIALI MANI PULITE E QUALITÀ NELL ASSISTENZA SANITARIA Governare il rischio infettivo. 2 a parte Pescara 28 marzo 2008 EPIDEMIOLOGIA MOLECOLARE DELLE INFEZIONI NOSOCOMIALI PRINCIPI ED APPLICAZIONI A SUPPORTO

Dettagli

Bioinformatica (modulo bioinf. dei genomi moderni )

Bioinformatica (modulo bioinf. dei genomi moderni ) Bioinformatica (modulo bioinf. dei genomi moderni ) Dr. Marco Fondi Lezione # 5 Corso di Laurea in Scienze Biologiche, AA 2011-2012 giovedì 3 novembre 2011 1 Sequenziamento ed analisi di genomi: la genomica

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica Silvio Pascucci 1 Anamnesi Sintomi Lesioni Esami : Istologici Virologici Sierologici Diagnosi Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica 2

Dettagli

Strategie per lo sviluppo di antivirali

Strategie per lo sviluppo di antivirali Strategie per lo sviluppo di antivirali Attacco del virus al recettore Ingresso Spoliazione Trascrizione e traduzione Modifiche post-traduzionali Replicazione del genoma virale Assemblaggio/maturazione

Dettagli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli ANALISI OGM SOYA Il progetto si proponeva di verificare le caratteristiche qualitative di diversi lotti di soya rispetto alla contaminazione accidentale da OGM per avere una valutazione indicativa della

Dettagli

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Metodi: CEN/TC275/WG6/TAG4

Metodi: CEN/TC275/WG6/TAG4 Determinazione di HAV e Norovirus in molluschi bivalvi mediante Real time PCR Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Ancona

Dettagli

I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE

I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE Un marcatore genetico è un qualsiasi fattore ereditario (quindi trasmissibile alla progenie) di cui esistano più varianti genotipiche. Essi consentono

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail: orgabiohuman@fastwebnet.it

Dettagli

Sperimenta il BIOLAB

Sperimenta il BIOLAB Sperimenta il BIOLAB I numeri del BIOLAB Il Maserati porta annualmente al CusMiBio circa 200 alunni dalla 2^ alla 5^ Liceo Scientifico tecnologico per fare 2-3 laboratori di Genetica, Citologia e Biologia

Dettagli

Servizio fitosanitario regionale

Servizio fitosanitario regionale Regione Toscana Servizio fitosanitario regionale Il laboratorio di diagnostica fitopatologica e biologia molecolare Direzione generale Competitività del sistema regionale e sviluppo delle competenze Sviluppo

Dettagli

Viaggio al centro della Biodiversità

Viaggio al centro della Biodiversità Liceo G.M. Colombini - Piacenza - indirizzo scientifico-tecnologico Biodiversità all interno di ogni specie e varietà dovute all azione dell uomo in ambito genetico Viaggio al centro della Biodiversità

Dettagli

Allineamento locale: BLAST

Allineamento locale: BLAST Allineamento locale: BLAST BLAST (Basic Local Alignment Search Tool) è il più diffuso programma di allineamento locale delle sequenze. Per vari anni il metodo FASTA (da non confondere con l omonimo formato)

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

Effetti della tecnica di allevamento sul microbismo intestinale del pollo

Effetti della tecnica di allevamento sul microbismo intestinale del pollo Effetti della tecnica di allevamento sul microbismo intestinale del pollo Gerardo Manfreda Dipartimento di Scienze degli Alimenti Alma Mater Studiorum - Università degli Studi di Bologna Forlì - 7 Aprile

Dettagli

ZytoLight SPEC ALK Dual Color Break Apart Probe

ZytoLight SPEC ALK Dual Color Break Apart Probe ZytoLight SPEC ALK Dual Color Break Apart Probe Z-2124-200 20 (0.2 ml) Z-2124-50 5 (0.05 ml) Per la rilevazione della traslocazione che coinvolge il gene ALK a 2p23 mediante ibridazione in situ fluorescente

Dettagli

RIAPERTURA TERMINI ELENCO PROPOSTE INSERIMENTI MEDIANTE TIROCINIO. (durata 12 mesi) Dipartimento di Architettura

RIAPERTURA TERMINI ELENCO PROPOSTE INSERIMENTI MEDIANTE TIROCINIO. (durata 12 mesi) Dipartimento di Architettura ALLEGATO 1 RIAPERTURA TERMINI ELENCO PROPOSTE INSERIMENTI MEDIANTE TIROCINIO (durata 12 mesi) CODICE SELEZIONE TIR02 Dipartimento di Architettura Profilo : Specialista con competenze di base utili per

Dettagli

Dott. M. Stella Grando, Christian Cainelli, Claudia Bisognin Redazione Dott. Wolfgang Jarausch Dott. Claudio Ioriatti. Foto: Mauro Varner

Dott. M. Stella Grando, Christian Cainelli, Claudia Bisognin Redazione Dott. Wolfgang Jarausch Dott. Claudio Ioriatti. Foto: Mauro Varner S MAP Notizie Scopazzi del melo - Apple proliferation Anno 2 Numero 1 Gennaio 2007 Sommario Istituto Agrario di San Michele Centro Sperimentale Via E. Mach 1 38010 San Michele all Adige (TN) Applicazioni

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

ISOLAMENTO DI CELLULE STAMINALI PLURIPOTENTI DALLA PLACENTA E LIQUIDO AMNIOTICO PER LA CURA DELLA FIBROSI CISTICA

ISOLAMENTO DI CELLULE STAMINALI PLURIPOTENTI DALLA PLACENTA E LIQUIDO AMNIOTICO PER LA CURA DELLA FIBROSI CISTICA ISOLAMENTO DI CELLULE STAMINALI PLURIPOTENTI DALLA PLACENTA E LIQUIDO AMNIOTICO PER LA CURA DELLA FIBROSI CISTICA Dott.ssa Annalucia Carbone Laboratorio di Genetica Molecolare Fondazione IRCCS Policlinico,

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

Metodiche tradizionali

Metodiche tradizionali Diagnostica microbiologica innovativa INTRODUZIONE Attualmente, per la rilevazione dei microrganismi patogeni accanto alle metodiche tradizionali rappresentate: dall esame colturale, l esame diretto al

Dettagli

Metodi di analisi di OGM

Metodi di analisi di OGM Metodi di analisi di OGM Roberta Onori Istituto Superiore di Sanità Centro Nazionale per la Qualità degli Alimenti e per i Rischi Alimentari Quadro normativo Attività Pre-marketing Indag ini sulla esposizione

Dettagli

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici

Dettagli

Relazione attività svolta dalla U0-04 nel secondo anno

Relazione attività svolta dalla U0-04 nel secondo anno Relazione attività svolta dalla U0-04 nel secondo anno I Ministeri dell Economia e delle Finanze, dell Istruzione, Università e Ricerca, dell Ambiente della Tutela del Territorio, delle Politiche Agricole

Dettagli

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie TEST GENETICI INDIRETTI per la diagnosi di patologie genetiche ereditarie Diagnosi molecolare indiretta Quando non è nota la mutazione malattia, la diagnosi molecolare di quella malattia in una data famiglia

Dettagli

HPV & Cervico-carcinoma

HPV & Cervico-carcinoma Infezione HPV & Cervico-carcinoma Infezione HPV HPV ad alto rischio Età all infezione 80% 20% Fattori mmunologici Transitoria Infezione persistente Infezione da C. trachomatis Displasia basso grado CIN

Dettagli