Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica"

Transcript

1 Il laboratorio di Biologia Molecolare: introduzione alle tecniche e alla loro applicazione Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica Elisabetta Pagani Direttrice reggente Laboratorio Aziendale di Microbiologia e Virologia Comprensorio Sanitario di Bolzano 1 Trento, 26 novembre 2011

2 Biologia molecolare: le metodiche in uso presso il Laboratorio Aziendale di Microbiologia e Virologia PCR end point (nested-pcr, reverse transcriptase PCR) Parvovirus B19 Toxoplasma HIV Provirus Norovirus Sequenziamento HCV genotipo HBV genotipo Resistenze HBV Identificazione microbica (16S) MTC + rif res Tipizzazione Enterovirus Identificazione miceti Tipizzazione neuroaminidasi + emoagglutinina Flu Genogruppi Norovirus 2 Tipizzazione C. difficile Definizione resistenze Aspergillus rtpcr qualitativa HSV1/2, VZV Adenovirus JCV MTC Chlamydia trachomatis Chlamydia pneumoniae Mycoplasma pneumoniae Legionella pneumophila Enterovirus Influenza A(H1N1, H3N2,H1n1 v)/b rtpcr quantitativa HCMV, EBV BKV HHV6 HBV, HCV, HIV Immunoblot MOTT

3 Storia della sequenza del DNA Avery propone il DNA come materiale genetico Holley sequenza il trna di lievito METODO SANGER (terminazione di catena) METODO MAXAM-GILBERT (degradazione chimica) Miescher osserva per la prima volta il DNA KARY MULLIS Introduce la PCR 1989 Watson e Crick determinano la struttura della doppia elica Vengono sviluppate le tecniche per la sintesi degli oligonucleotidi e per la degradazione chimica del DNA. Viene introdotta l elettroforesi su gel per la Separazione di frammenti di DNA 1980 Il DNA genomico viene clonato nel fago M13 o in vettori plasmidici, nascono i primi Programmi informatici di analisi dei dati, vengono sviluppate nuove tecnologie per il sequenziamento BANCHE DATI!!!!!! 3 Automazione completa Sequenziamento completo del genoma umano 2000 AUTOMAZIONE PARZIALE Vengono sviluppate le prime Apparecchiature per il sequenziamento che impiegano sistemi per la rilevazione della fluorescenza.

4 DEFINIZIONI Sequenziamento Il termine, in biologia molecolare, indica il processo per la determinazione esatta della struttura primaria di un biopolimero (basi nel caso di un acido nucleico, aminoacidi nel caso di proteine) Sequenziamento del DNA Determinazione dell'ordine dei diversi nucleotidi che costituiscono l'acido nucleico Presupposto Ogni microrganismo ha porzioni di genoma comuni ad altri e porzioni esclusive 4

5 Applicazioni in microbiologia e virologia medica Identificazioni: sequenziamento di regioni speciespecifiche (16SrDNA, ITS1-2 ) Identificazioni: sequenziamento di regioni tipospecifiche (genotipi e sottotipi) Resistenze ai farmaci: sequenziamento di regioni in cui possono essere evidenziate mutazioni che individuano fenotipo resistente Studi epidemiologici (fenomeni epidemici, alberi filogenetici) 5

6 It is hard to exaggerate the impact of the polymerase chain reaction. PCR, the quick, easy method for generating unlimited copies of any fragment of DNA, is one of those scientific developments that actually deserves timeworn superlatives like "revolutionary" and "breakthrough." - Tabitha M. Powledge La PCR è una metodica molecolare che si basa sull impiego di un enzima, la Taq Polimerasi, in grado di catalizzare in vitro la reazione di amplificazione di una particolare sequenza di DNA o RNA a partire da una frazione di acido nucleico utilizzato come stampo Kary Mullis 6

7 Metodo enzimatico di Sanger Nucleotidi che bloccano l allungamento del filamento di acido nucleico: la mancanza del gruppo ossidrile in 3 impedisce l attacco al 7 gruppo fosforico del nucleotide successivo

8 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 8 8

9 Prima del sequenziamento Scelta del campione (puro) da cui è più indicato estrarre gli acidi nucleici (diretto o dopo isolamento?) Scelta del bersaglio (regione): -sequenza presente in tutti gli organismi che desideriamo tipizzare -sequenza regioni fiancheggianti conservate, ma contenenti regione variabile Messa a punto di una buona PCR (scelta dei primers e delle condizioni di amplificazione) Disponibilità di un database contenente le sequenze con cui si vuole confrontare il bersaglio 9

10 10 ALLA FINE DELLA PCR

11 Verifica dell amplificato (visualizzazione mediante corsa elettroforetica) Camera elettroforetica Gel di agarosio (1-3%) (agarosio, tampone TBE, ovvero Tris-borato in EDTA, etidio bromuro/sybr Green) Colorante Ladder (marker, peso molecolare) Transilluminatore (lampada UV) Movimento di molecole cariche sottoposte ad un campo elettrico, generato dalla differenza di potenziale (100 V=50mA), creata da un alimentatore di corrente; in tampone alcalino (TBE, ph 8.3) o neutro gli acidi nucleici si comportano come anioni (carica -) e migrano verso il polo positivo; le molecole di DNA passano attraverso i pori del gel e a seconda della loro lunghezza percorrono una distanza più o meno 11 lunga 11

12 12

13 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 13 13

14 Purificazione dei prodotti di PCR IMPLICA L ELIMINAZIONE DI PRIMER, dntp ED ENZIMA RIMASTI IN SOLUZIONE AL TERMINE DELLA REAZIONE DI AMPLIFICAZIONE SI CONSIGLIA quando la banda è singola EXOSAP-it (reazione enzimatica): esonucleasi I e fosfatasi alcalina (Shrimp Alkalin Phosphatase) degradano primer e dntps, ma non rimuovono sali o altri prodotti secondari della PCR quando le bande sono multiple Estrazione da gel utilizzando colonnine commerciali (ridurre al minimo le dimensioni della banda tagliata; aumentare il numero di lavaggi con la soluzione contenente etanolo; aumentare il tempo della spinnata a vuoto prima dell'eluizione del DNA dalla colonnina)

15 Verifica e quantificazione del prodotto purificato Verifica: visualizzazione dei prodotti di purificazione mediante corsa elettroforetica Quantificazione del prodotto di PCR purificato: spettrofotometria quantitative DNA Ladder

16 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 16 16

17 SEQUENZIAMENTO AUTOMATICO (metodo di Sanger) Richiede la presenza di una molecola stampo di DNA a singolo filamento e di un oligonucleotide d innesco (primer) ad essa complementare Il primer si appaia all estremità in 3 -OH del filamento di DNA e rende disponibile il proprio terminale idrossilico per la reazione di polimerizzazione, catalizzata dalla DNApolimerasi La reazione di sequenza prevede l utilizzo una miscela di reazioni contenente i quattro deossinucleotidi trifosfati (dntps) in quantità equimolari e un dideossinucleotide (ddntp) presente in bassa concentrazione 17

18 Nucleotidi terminatori (ddntp) Nucleotidi che bloccano l allungamento del filamento di acido nucleico: la mancanza del gruppo ossidrile in 3 impedisce l attacco al gruppo fosforico del nucleotide successivo Nucleotidi marcati con 32 P (in passato) o molecole fluorescenti (recentemente) 18

19 Quando la catena nascente incorpora un ddntp, la reazione di polimerizzazione si arresta e si ha la terminazione della catena; ciò avverrà più volte, in posizioni diverse della sequenza, generando una serie di frammenti interrotti di lunghezza variabile. 19

20 Produzione dei frammenti (metodo di Sanger) 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 3 5 molecola stampo di DNA a singolo filamento 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 3 5

21 Produzione dei frammenti (metodo di Sanger) 5 oligonucleotide d innesco (primer) 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCA 5 il primer si appaia all estremità in 3 -OH del filamento di DNA e rende disponibile il proprio terminale idrossilico per la polimerizzazione 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT da dc dg dt + DNA Polimerasi 5 3 TTACGTAACGTCA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 3 5

22 Produzione dei frammenti (metodo di Sanger) 5 sintesi del DNA 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA

23 Produzione dei frammenti (metodo di Sanger) miscela di reazione contenente i deossinucleotidi trifosfati (dntps) in quantità equimolari e i dideossinucleotidi (ddntp) a bassa concentrazione 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCG 5 3 TTACGTAACGTCA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGC 3 5 da dc dg dt dda ddc ddg ddt + DNA Polimerasi

24 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAAC AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACG AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACGT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACGTC AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA

25 Produzione dei frammenti (metodo di Sanger) 25

26 Quando la catena nascente incorpora un ddntp, la reazione di polimerizzazione si arresta e si ha terminazione, altrimenti l allungamento prosegue; ciò avverrà più volte, in posizioni diverse della sequenza, generando una serie di frammenti interrotti di lunghezza variabile: se il bersaglio è composto da n nucleotidi si avranno frammenti di tutte le lunghezze possibili da 1 a n, separabili mediante corsa elettroforetica Coniugando a ciascun ddntp un diverso marcatore fluorescente è possibile distinguerli e, indipendentemente dalla lunghezza, tutti i frammenti terminanti con A emetteranno fluorescenza di tipo A, quelli terminanti con citosina di tipo C e 26 via di seguito

27 Produzione dei frammenti (metodo di Sanger) Quando la catena nascente incorpora un ddntp, la reazione di polimerizzazione si arresta e si ha terminazione, altrimenti l allungamento prosegue; ciò avverrà più volte, in posizioni diverse della sequenza, generando una serie di frammenti interrotti di lunghezza 27 variabile.

28 28 Fluorocromi

29 29 Fluorocromi

30 PCR di sequenziamento: metodo Sanger o enzimatico Due reazioni parallele, utilizzando in ciascuna, un solo primer (forward o reverse) PRIMER (HPLC-purificati): sovrapposto, meglio se interno, al primer di I amplificazione (forward/reverse) 3,2 pmol reagente per 1 campione RRBigDye1.1/3.1 4 /2 µl Buffer5X 2 /3 µl H2O 3.8 /6.8 µl Primer (1pmol/µl) 3.2µl V intermedio 13 /15 EXOs-product 7/5µl Volume finale 20µl Buffer 5X: tampone di reazione con Mg++ Big Dye Terminator Kit ENZIMA: polimerasi (T-elongazione=60 C) 2 ml DEOSSINUCLEOTIDI TRIFOSFATO (dntps): datp, dctp, dgtp, dttp : precursori del DNA DI-DEOSSINUCLEOTIDI TRIFOSFATO: ddntps, nucleotidi terminator Ready Reaction Mix (2,5X) 4 ml TARGET: amplicone purificato 5 ng/100 bp 30

31 Protocollo di reazione: temperature e tempi Denaturazione iniziale: 96 C Denaturazione: 96 C Annealing: 50 C 25 cicli Elongazione: 60 C evitare temperature di annealing<50 C nel caso di primers con Ta>60 C, eliminare lo step di annealing 96 C, 60 C) aumentare il nr. di cicli se il prodotto di I amplificazione è debole 31

32 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 32 32

33 Metodi di purpficazione (ddntps non incorporati) 33

34 G e l - f i l t r a z i o n e 34

35 35 Elettroforesi Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti)

36 36 Corsa elettroforetica

37 Viene utilizzato un gel ad altissima risoluzione (poliacrilamide 4-6%), in condizioni denaturanti (urea), capace di separare frammenti di DNA che differiscono tra di loro per un solo nucleotide (spessore del gel: 0,3-0,4 mm; lunghezza lastre di vetro: 40 cm circa) Precursori normali del A C G deossiribonucleosidetrifosfato C G T G T CA T G Piccola quantità del A G T A C C A G dideossiribonucleoside- T G A T T trifosfato C Innesco per la DNA T G A polimerasi marcato a fluorescenza 5 3 G C T A C C T G C A T G G A DNA - POLIMERASI C G A T G G A C G T A C C T C T G A A G C G 3 5 Molecola di DNA a singolo filamento L infrequente incorporazione del dideossiribonucletide blocca l ulteriore accrescimento della molecola di DNA da sequenziare G C T A C C T G C A T G G A G C T A G C T A C C T G G A Miscela di molecole di DNA fluorescenti di diversa lunghezza, tutte terminate da A Quattro inneschi fluorescenti di colore diverso incubati nella miscela di nucleotidi contenente un diverso dideossiribonucleosidetrifosfato che termina la catena (A, C, G, T) Miscela di molecole di diversa lunghezza tutte terminate da A Miscela di molecole di diversa lunghezza tutte terminate da C Miscela di molecole di diversa lunghezza tutte terminate da G Miscela di molecole di diversa lunghezza tutte terminate da T A C G T 37

38 Elettroforesi L intensità e la lunghezza d onda delle emissioni fluorescenti vengono captate durante l elettroforesi, quando i frammenti di DNA, eccitati dalla luce laser, passano davanti ad un rilevatore 38

39 39 Elettroforesi

40 40 Il sequenziamento automatizzato (ABI Prism 3130 Genetic Analyzer)

41 41

42 Il sequenziamento automatizzato (elettroforesi capillare) Lo strumento, dopo aver prelevato il prodotto della PCR di marcatura lo sottopone ad elettroforesi all interno di un capillare in vetro-resina di diversa lunghezza a seconda delle esigenze Il capillare, del diametro di 50 mm, contiene un polimero di corsa, automaticamente caricato dal sistema Esistono sistemi a 1, 4, 16 e 96 capillari Un raggio laser colpisce il capillare eccitando i fluorocromi marcanti i frammenti di diversa lunghezza 42 Una cellula fotoelettrica rileva e memorizza i segnali fluorescenti

43 43

44 44 Calibrazioni: spettrale + spaziale

45 45 Analisi dei risultati Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti)

46 Elettroferogramma (Sequencing Analysis 5.2 AB) Durante la corsa elettroforetica i frammenti di DNA vengono colpiti da un raggio laser (emissione a 490 nm) Questo provoca l eccitamento dei fluorocromi che marcano i frammenti Ciascuno dei quattro fluorocromi emette ad una lunghezza d onda diversa Una cellula fotoelettrica rileva sequenza, tipo ed intensità delle emissioni luminose Il tutto viene convertito in un sistema grafico La sequenza dei picchi corrisponde alla sequenza dei nucleotidi ed il colore del picco corrisponde al tipo di base azotata 46

47 47 Raw data (Sequencing Analysis 5.2 AB)

48 48 ELETTROFEROGRAMMA

49 Analisi dei risultati: qualità 49

50 50 Allineamenti: banche dati

51 GenBank Banca dati ad accesso libero (internet) Circa 50 milioni di sequenze geniche (animali e vegetali) Permette il confronto della propria sequenza in tempo reale: motore di ricerca (programma blast) individua le sequenze con il più elevato grado di omologia Chiunque può depositarvi le proprie sequenze 51

52 52

53 53

54 54 Blast

55 55 Blast

56 56 Blast

57 57 Blast

58 58 Altre banche dati: redom

59 59 Altre banche dati: redom

60 60 Altre banche dati: redom

61 61 Altre banche dati: redom

62 62 Banche dati dedicate: HCV sequence database

63 63 Banche dati dedicate: HCV sequence database

64 64 Banche dati dedicate: HCV sequence database

65 65 Banche dati dedicate: geno2pheno

66 66

67 Applicazioni: la nostra esperienza Individuazione delle regioni da sequenziare (campione di partenza) Ricerca di una library (database) Definizione del flusso di lavoro Messa a punto e validazione Controlli di qualità Introduzione nella pratica giornaliera 67

68 Applicazioni: la nostra esperienza Determinazione dei differenti genotipi (1-3%) e sottotipi (0.5-1%) virali per HCV (NS5B) Determinazione dei differenti genotipi virali per HBV e individuazione del genotipo resistente a Lamivudina, Adefovir, e/o Entecavir (Tenofovir, Telbivudina)(pol) Identificazioni batteriche (16SrDNA) Identificazioni micobatteri per la speciazione all interno del MTC (gyrb) e definizione delle resistenze alla rifampicina (RNApolβ: rpo/tb) Identificazione dei miceti (ITS) Tipizzazione Enterovirus (5 UTR) Sorveglianza epidemiologica dell influenza (emoagglutinina) Sorveglianza epidemiologica Clostridium difficile (proteina C)

69 Micobatteri OBIETTIVI: 1) rapida distinzione, nell ambito del MTC, tra M. tuberculosis, M. bovis (intrinsecamente resistente alla pirazinamide, farmaco di dimostrata epatotossicità), M. africanum, M. microti; 2) rapida identificazione dei ceppi resistenti alla rifampicina, più diffusi nei pazienti stranieri, ma rilevati anche negli autoctoni. PUNTO DI PARTENZA: 1) le metodiche molecolari in uso (Innolipa) differenziano bene i MOTT, ma non sono in grado di distinguere all interno dell MTC; 2) l esecuzione dell antibiogramma (metodo di riferimento) richiede in media 20 gg.

70 Individuazione della regione: gyrb (no 16SrDNA, no ITS) 70

71 71 Database gyrb

72 S E Q U E N C I N G - A N A L Y S I S

73 Ridom 73

74 74 Ridom

75 75 IL SEQUENZIAMENTO GENICO NELLA PRATICA DEL LABORATORIO DI MICROBIOLOGIA e VIROLOGIA: L ESPERIENZA DEL COMPRENSORIO SANITARIO di BOLZANO e perché non Blast?

76 IL SEQUENZIAMENTO GENICO NELLA PRATICA DEL LABORATORIO DI MICROBIOLOGIA e VIROLOGIA: L ESPERIENZA DEL COMPRENSORIO SANITARIO di BOLZANO Limiti 76

77 Il nostro protocollo/flusso di lavoro Coltura positiva MOTT Innolipa MTC SEQ Rif-RES?

78 Messa a punto e validazione Prof. Proedinger; Division of Hygiene and Medical Microbiology, Department of Hygiene, Microbiology and Social Medicine, Innsbruck Medical University, Innsbruck, Austria. : MIRU genotyping (mycobacterial interspersed repetitive units) 78

79 79 Genotipizzazione HBV: individuazione della regione

80 Primers e condizioni d amplificazione reagente per 1 campione per campioni SYBR GREEN MasterMix primermix(hbpr256+ KL14;10pmol/ µl) 10 µl 2 µl Volume intermedio 12µl DNA estratto (easy mag) 9µl Volume finale 21µl 80

81 Datbase 60 genotipi 81

82 Esempio (ridom) HBV genotipo D Conferma Prof. Norder/Dr.ssa Crovatto 82

83 83

84 BIOLOGIA MOLECOLARE e VIROLOGIA Chiara Cemin Dr.ssa Federica Folli Adriana Giacomozzi Valentina Pasquetto Valentina Poletta Silvia Ruggeri 84

85 85 Domande??????

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Un nuovo approccio: la VEQ in biologia molecolare

Un nuovo approccio: la VEQ in biologia molecolare Un nuovo approccio: la VEQ in biologia molecolare Il crescente interesse nella biologia molecolare applicata alla diagnostica è il risultato dei profondi progressi ottenuti nelle conoscenze scientifiche

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Elettroforesi degli acidi nucleici

Elettroforesi degli acidi nucleici Elettroforesi degli acidi nucleici Una volta che i frammenti del DNA o del RNA da analizzare sono stati amplificati con la reazione PCR è necessario separarli ed identificarli. A tale scopo si utilizza

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno).

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Programma: Giorno 1Preparazione di DNA genomico da foglie 2 - Controllo qualità DNA

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Moria del pero (Candidatus Phytoplasma pyri) Fitoplasmi: Microrganismi

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche I T A L B I O F O R M A i n c o l l a b o r a z i o n e c o n O R D I N E N A Z I O N A L E D E I B I O L O G I o r g a n i z z a i l c o r s o d i a g g i o r n a m e n t o BIOLOGIA MOLECOLARE: introduzione

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test U.O.C. di Epatologia Clinica e Biomolecolare Lotto N. DESCRIZIONE PRODOTTO Quantità annua richiesta Unità di misura Repertorio CND Codice Prodotto, Confezione Offerta e nome commerciale Prezzo unitario

Dettagli

Analisi mutazionale di K-RAS metodiche a confronto

Analisi mutazionale di K-RAS metodiche a confronto Analisi mutazionale di K-RAS metodiche a confronto Aula Magna Villa Sironi Gallarate 16 ottobre Dott. Carmelo Lupo Coordinatore Tecnico Anatomia Patologica e Patologia Molecolare Oncologica PERCHÉ K-RAS

Dettagli

Genotipizzazione virale

Genotipizzazione virale Genotipizzazione virale Typing Separazione basata su maggiori differenze genetiche tra i membri di una singola specie virale Subtyping Individuazione di differenze stabili all interno di un gruppo di virus

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del

Dettagli

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING DALL ESTRAZIONE DEL DNA AL FINGERPRINTING SCOPO DELL'ATTIVITÀ Ciascuno studente estrae il proprio DNA da cellule della mucosa boccale. Quindi, mediante PCR, vengono amplificati frammenti corrispondenti

Dettagli

Capitolo 1 Introduzione alla PCR

Capitolo 1 Introduzione alla PCR Capitolo 1 Introduzione alla PCR La tecnologia della PCR ha rivoluzionato l attività dei laboratori di ricerca e di diagnostica trovando applicazioni ed impieghi in svariati campi della medicina e della

Dettagli

LA RIASSOCIAZIONE MOLECOLARE DNA/DNA

LA RIASSOCIAZIONE MOLECOLARE DNA/DNA LA RIASSOCIAZIONE MOLECOLARE DNA/DNA Il grado di riassociazione o ibridazione molecolare DNA/DNA rappresenta uno dei cardini su cui si basa la definizione di specie batterica. Allo scopo ricordiamo cosa

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

PROGETTO BIOFORM. Tipizzazione del locus PV92

PROGETTO BIOFORM. Tipizzazione del locus PV92 Ci fu un tempo in cui per amplificare il DNA, dovevi crescere tonnellate e tonnellate di piccole celle. Poi è arrivato un ragazzo di nome Dr. Kary Mullis, Ha detto che si può amplificare in vitro altrettanto

Dettagli

Il sequenziamento del DNA

Il sequenziamento del DNA Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile

Dettagli

12-05-2010 ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI

12-05-2010 ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI Il primo passaggio per la maggior parte delle procedure che verranno trattate in questo corso consiste nell estrazione del DNA (e dell RNA) da materiale biologico, e nella sua purificazione mediante separazione

Dettagli

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti

Dettagli

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail: orgabiohuman@fastwebnet.it

Dettagli

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA

Dettagli

Azienda Ospedaliero-Universitaria Policlinico - Vittorio Emanuele Catania

Azienda Ospedaliero-Universitaria Policlinico - Vittorio Emanuele Catania Azienda Ospedaliero-Universitaria Policlinico - Vittorio Emanuele Catania Settore: Provveditorato ed Economato - tel. 095/7435769 fax 095/37844 Oggetto: Procedura negoziata per la fornitura di diagnostici

Dettagli

AZIENDA OSPEDALIERA UNIVERSITARIA INTEGRATA - VERONA

AZIENDA OSPEDALIERA UNIVERSITARIA INTEGRATA - VERONA Pag.. 1 AZIENDA OSPEDALIERA UNIVERSITARIA INTEGRATA - FORNITURA QUINQUENNALE IN SOMMINISTRAZIONE, SUDDIVISA IN LOTTI, DI SISTEMI PER LA DIAGNOSTICA DELLE INFEZIONI DA HBV, HCV E ALTRI MICRORGANISMI IN

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

Lezione 7-8 Giovedì 18 Marzo 2010. aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM)

Lezione 7-8 Giovedì 18 Marzo 2010. aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) Lezione 7-8 Giovedì 18 Marzo 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) materiale del T-Rex system pfrt/laczeo = Flp-In target site vector for stable transfection

Dettagli

LOTTO 1 (indivisibile)

LOTTO 1 (indivisibile) LOTTO 1 (indivisibile) SISTEMA MACCHINA REATTIVI PER LA DIAGNOSI MOLECOLARE DI VIRUS, BATTERI E FUNGHI IN REAL TIME PCR 1. Obiettivi organizzativi del laboratorio: Gli obiettivi di organizzazione che il

Dettagli

DNA BARCODE: ALLESTIRE UNA BANCA DATI PER TUTELARE LE NOSTRE RISORSE E GARANTIRE LA TRACCIABILITA.

DNA BARCODE: ALLESTIRE UNA BANCA DATI PER TUTELARE LE NOSTRE RISORSE E GARANTIRE LA TRACCIABILITA. DNA BARCODE: ALLESTIRE UNA BANCA DATI PER TUTELARE LE NOSTRE RISORSE E GARANTIRE LA TRACCIABILITA. Ogni regione italiana vanta una quantità notevole di prodotti agroalimentari ed animali tipici e caratteristici.

Dettagli

Purificazione degli acidi nucleici

Purificazione degli acidi nucleici A cosa serve? Purificazione degli acidi nucleici DNA genomico: per costruire librerie genomiche e/o usato nell analisi d ibridazione Southern. mrna: sintesi del cdna; analisi d ibridazione Northern, o

Dettagli

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello

Dettagli

ALGORITMI PER L'ANALISI ED IL TROUBLESHOOTING DI SEGNALI DI SEQUENZIAMENTO SANGER DEL DNA

ALGORITMI PER L'ANALISI ED IL TROUBLESHOOTING DI SEGNALI DI SEQUENZIAMENTO SANGER DEL DNA UNIVERSITA DEGLI STUDI DI PADOVA FACOLTA DI INGEGNERIA CORSO DI LAUREA SPECIALISTICA IN BIOINGEGNERIA ALGORITMI PER L'ANALISI ED IL TROUBLESHOOTING DI SEGNALI DI SEQUENZIAMENTO SANGER DEL DNA ALGORITHMS

Dettagli

Tecniche per il sequenziamento degli acidi nucleici

Tecniche per il sequenziamento degli acidi nucleici Tecniche per il sequenziamento degli acidi nucleici Nel 1965 viene determinata la prima sequenza completa di un Acido Nucleico: il trna dell alanina di lievito (78 nucleotidi) 1971: prima mappa di restrizione

Dettagli

PCR (Polymerase chain reaction)

PCR (Polymerase chain reaction) LABORATORIO DI METOLOGIE E TECNOLOGIE GENETICHE PCR (Polymerase chain reaction) La PCR è un metodo di biologia molecolare, utile per amplificare (i.e. creare copie multiple di) DNA, inventato da Kary Mullis

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Metodiche tradizionali

Metodiche tradizionali Diagnostica microbiologica innovativa INTRODUZIONE Attualmente, per la rilevazione dei microrganismi patogeni accanto alle metodiche tradizionali rappresentate: dall esame colturale, l esame diretto al

Dettagli

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI 1953: scoperta del DNA (Watson e Crick) CENNI STORICI 1977: metodo di Sanger per il sequenziamento del DNA (pubblicazione della

Dettagli

INTRODUZIONE ALLA BIOLOGIA MOLECOLARE CLINICA (a cura del Responsabile Scientifico del Congresso: Dott. Paolo Lanzafame)

INTRODUZIONE ALLA BIOLOGIA MOLECOLARE CLINICA (a cura del Responsabile Scientifico del Congresso: Dott. Paolo Lanzafame) INTRODUZIONE ALLA BIOLOGIA MOLECOLARE CLINICA (a cura del Responsabile Scientifico del Congresso: Dott. Paolo Lanzafame) La Biologia Molecolare Clinica è il settore disciplinare afferente alla Medicina

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (www.cusmibio.unimi.it).

Dettagli

Biosensori 3: Biosensori a DNA e Bio- Gene Chip

Biosensori 3: Biosensori a DNA e Bio- Gene Chip Biosensori 3: Biosensori a DNA e Bio- Gene Chip mazzei@di.unipi.it (materiale parzialmente tratto da: http://nestor.med.unibo.it/shared_files/seminari/sartini_21-10-2004.ppt) Biosensori ad affinità basati

Dettagli

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità RELAZIONE TECNICA Indagini Biologico-Molecolari per Accertamento di Paternità PROSPETTO RIASSUNTIVO DELL'ANALISI ANALISI INDAGINE DI PATERNITA' PERSONE SOTTOPOSTE AL TEST QUESITO Campione Biologico Tampone

Dettagli

Dott.ssa Maria Antonietta Lozzi Dipartimento di sanità Pubblica e Malattie Infettive Sapienza Università di Roma

Dott.ssa Maria Antonietta Lozzi Dipartimento di sanità Pubblica e Malattie Infettive Sapienza Università di Roma DAGLI ESORDI DELLA MEDICINA MOLECOLARE ALL EVOLUZIONE DELL AUTOMAZIONE Dott.ssa Maria Antonietta Lozzi Dipartimento di sanità Pubblica e Malattie Infettive Sapienza Università di Roma La scoperta che il

Dettagli

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA CLM Biotecnologie per l Alimentazione CLM in Biotecnologie Sanitarie Corso di Chimica e certificazione degli alimenti DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA VIRUS ENTERICI virus escreti tramite

Dettagli

Relazione conclusiva delle esperienze di laboratorio

Relazione conclusiva delle esperienze di laboratorio Relazione conclusiva delle esperienze di laboratorio Emiliano Giovanni Vavassori e.vavassori@sssup.it Allievo Ordinario Settore di Agraria Scuola Superiore di Studi Universitari e di Perfezionamento Sant

Dettagli

Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni

Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni Corso di: GESTIONE FAUNISTICA Prof. Bernardino Ragni Università degli Studi di Perugia Facoltà di Scienze Matematiche Fisiche Naturali Corso di laurea in Scienze Naturali LAUREA MAGISTRALE Caso di studio:

Dettagli

PRESENTAZIONE DEI RISULTATI FINALI DEL PROGETTO. Università degli Studi di Palermo C.I.R.I.T.A.

PRESENTAZIONE DEI RISULTATI FINALI DEL PROGETTO. Università degli Studi di Palermo C.I.R.I.T.A. PROGETTO POR SICILIA 2000/2006 1999.IT.16.1.PO.011/4.17b/8.3.7/0056 Università degli Studi di Palermo C.I.R.I.T.A. PRESENTAZIONE DEI RISULTATI FINALI DEL PROGETTO Studio della struttura genetica e demografica

Dettagli

Tecniche molecolari per la diagnosi di funghi fitopatogeni

Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche che consentono l identificazione, la diagnosi, la quantificazione di un organismo mediante l analisi degli acidi nucleici: DNA RNA Diagnosi

Dettagli

Corso integrato di microbiologia ATTIVITA PROFESSIONALIZZANTI Docente M.R.Iovene Indirizzo mail :mariarosaria.iovene@unina2.it

Corso integrato di microbiologia ATTIVITA PROFESSIONALIZZANTI Docente M.R.Iovene Indirizzo mail :mariarosaria.iovene@unina2.it Corso integrato di microbiologia ATTIVITA PROFESSIONALIZZANTI Docente M.R.Iovene Indirizzo mail :mariarosaria.iovene@unina2.it 1 Le indagini microbiologiche rappresentano gli strumenti più appropriati

Dettagli

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico ALLEGATO 1 DESCRIZIONE DELLA FORNITURA PROCEDURA APERTA PER LA FORNITURA IN PIU LOTTI, IN MODALITA SERVICE, DI SISTEMI ANALITICI DI BIOLOGIA MOLECOLARE PER I LABORATORI ANALISI DELL AZIENDA ASL N. 8 DI

Dettagli

Metodi: CEN/TC275/WG6/TAG4

Metodi: CEN/TC275/WG6/TAG4 Determinazione di HAV e Norovirus in molluschi bivalvi mediante Real time PCR Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Ancona

Dettagli

T V A. Il processo analitico è costituito da tre fasi distinte: a) Estrazione - arricchimento b) Retrotrascrizione c) Amplificazione Real Time TM

T V A. Il processo analitico è costituito da tre fasi distinte: a) Estrazione - arricchimento b) Retrotrascrizione c) Amplificazione Real Time TM genedia DIVISIONE BIOMOLECOLARE DETERMINAZIONE QUANTITATIVA DI RNA HCV MEDIANTE HPA (HIGH PERFORMANCE AMPLIFICATION) T V A L HPA è un protocollo d amplificazione che coniuga le conoscenze acquisite con

Dettagli

Identificazione e quantificazione degli acidi nucleici DNA RNA

Identificazione e quantificazione degli acidi nucleici DNA RNA BIOLOGIA MOLECOLARE Identificazione e quantificazione degli acidi nucleici DNA RNA ESTRAZIONE DEGLI ACIDI NUCLEICI DNA genomico RNA totale messaggero 1) OMOGENIZZAZIONE LISI Soluzione alcalina concentrata

Dettagli

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine Università degli Studi del Piemonte Orientale A. Avogadro CORSO DI ALTA FORMAZIONE IN LEGISLAZIONE ALIMENTARE Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Caratterizzazione della comunità microbica

Caratterizzazione della comunità microbica Caratterizzazione della comunità microbica Monitoraggio biologico annuale dell impianto Dipartimento di Biologia Università di Pisa Monitoraggio biologico del reattore Monitoraggio biologico del prototipo

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

Metodica fu ideata nel 1983

Metodica fu ideata nel 1983 Metodica fu ideata nel 1983 PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi

Dettagli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona

Dettagli

Ministero della Giustizia

Ministero della Giustizia Ministero della Giustizia Dipartimento dell Amministrazione Penitenziaria Direzione Generale del Personale e della Formazione CONCORSO PUBBLICO PER TITOLI ED ESAMI A 7 POSTI DI VICE DIRETTORE BIOLOGO,

Dettagli

Immagine di una sequenza ben riuscita. Sequences troubleshooting

Immagine di una sequenza ben riuscita. Sequences troubleshooting Immagine di una sequenza ben riuscita. Sequences troubleshooting Sequenza fallita Reazione fallita: non presenta picchi definiti e ha un alto rumore di fondo. il primer non trova sito di annealing il DNA

Dettagli

Il Programma ISTSCUOLA

Il Programma ISTSCUOLA esercitazioni pratiche guidate per insegnanti anno scolastico 2009/2010 Il Programma ISTSCUOLA L IST, Istituto nazionale per la ricerca sul cancro di Genova è un ente di diritto pubblico riconosciuto dal

Dettagli

Lezione 4. Il sequenziamento del DNA, Sanger

Lezione 4. Il sequenziamento del DNA, Sanger Lezione 4 Il sequenziamento del DNA, Sanger Schema della lezione Polymerase chain reaction (PCR) Dal prodotto di PCR al sequenziamento di Sanger Lettura dei prodotti di sequenziamento con sequenziatori

Dettagli

Analisi quantitativa dell espressione genica mediante. real-time RT-PCR. Elaborato in Biochimica

Analisi quantitativa dell espressione genica mediante. real-time RT-PCR. Elaborato in Biochimica ALMA MATER STUDIORUM UNIVERSITA DI BOLOGNA CAMPUS DI CESENA SCUOLA DI INGEGNERIA E ARCHITETTURA CORSO DI LAUREA IN INGEGNERIA BIOMEDICA Analisi quantitativa dell espressione genica mediante real-time RT-PCR

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

ESTRAZIONE ACIDI NUCLEICI CON PARTICOLARE RIFERIMENTO A DNA ESTRATTO DA TESSUTI FISSATI IN FORMALINA E INCLUSI IN PARAFFINA (FFPE)

ESTRAZIONE ACIDI NUCLEICI CON PARTICOLARE RIFERIMENTO A DNA ESTRATTO DA TESSUTI FISSATI IN FORMALINA E INCLUSI IN PARAFFINA (FFPE) ESTRAZIONE ACIDI NUCLEICI CON PARTICOLARE RIFERIMENTO A DNA ESTRATTO DA TESSUTI FISSATI IN FORMALINA E INCLUSI IN PARAFFINA (FFPE) SALVATORE GIRLANDO LABORATORIO PATOLOGIA MOLECOLARE ANATOMIA PATOLOGICA

Dettagli

Elettroforesi in gel di Agarosio

Elettroforesi in gel di Agarosio Elettroforesi in gel di Agarosio Le molecole di DNA possono essere separate in base alla loro dimensione, facendole migrare attraverso una matrice polimerica sotto l attrazione di un campo elettrico 1

Dettagli