Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica"

Transcript

1 Il laboratorio di Biologia Molecolare: introduzione alle tecniche e alla loro applicazione Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica Elisabetta Pagani Direttrice reggente Laboratorio Aziendale di Microbiologia e Virologia Comprensorio Sanitario di Bolzano 1 Trento, 26 novembre 2011

2 Biologia molecolare: le metodiche in uso presso il Laboratorio Aziendale di Microbiologia e Virologia PCR end point (nested-pcr, reverse transcriptase PCR) Parvovirus B19 Toxoplasma HIV Provirus Norovirus Sequenziamento HCV genotipo HBV genotipo Resistenze HBV Identificazione microbica (16S) MTC + rif res Tipizzazione Enterovirus Identificazione miceti Tipizzazione neuroaminidasi + emoagglutinina Flu Genogruppi Norovirus 2 Tipizzazione C. difficile Definizione resistenze Aspergillus rtpcr qualitativa HSV1/2, VZV Adenovirus JCV MTC Chlamydia trachomatis Chlamydia pneumoniae Mycoplasma pneumoniae Legionella pneumophila Enterovirus Influenza A(H1N1, H3N2,H1n1 v)/b rtpcr quantitativa HCMV, EBV BKV HHV6 HBV, HCV, HIV Immunoblot MOTT

3 Storia della sequenza del DNA Avery propone il DNA come materiale genetico Holley sequenza il trna di lievito METODO SANGER (terminazione di catena) METODO MAXAM-GILBERT (degradazione chimica) Miescher osserva per la prima volta il DNA KARY MULLIS Introduce la PCR 1989 Watson e Crick determinano la struttura della doppia elica Vengono sviluppate le tecniche per la sintesi degli oligonucleotidi e per la degradazione chimica del DNA. Viene introdotta l elettroforesi su gel per la Separazione di frammenti di DNA 1980 Il DNA genomico viene clonato nel fago M13 o in vettori plasmidici, nascono i primi Programmi informatici di analisi dei dati, vengono sviluppate nuove tecnologie per il sequenziamento BANCHE DATI!!!!!! 3 Automazione completa Sequenziamento completo del genoma umano 2000 AUTOMAZIONE PARZIALE Vengono sviluppate le prime Apparecchiature per il sequenziamento che impiegano sistemi per la rilevazione della fluorescenza.

4 DEFINIZIONI Sequenziamento Il termine, in biologia molecolare, indica il processo per la determinazione esatta della struttura primaria di un biopolimero (basi nel caso di un acido nucleico, aminoacidi nel caso di proteine) Sequenziamento del DNA Determinazione dell'ordine dei diversi nucleotidi che costituiscono l'acido nucleico Presupposto Ogni microrganismo ha porzioni di genoma comuni ad altri e porzioni esclusive 4

5 Applicazioni in microbiologia e virologia medica Identificazioni: sequenziamento di regioni speciespecifiche (16SrDNA, ITS1-2 ) Identificazioni: sequenziamento di regioni tipospecifiche (genotipi e sottotipi) Resistenze ai farmaci: sequenziamento di regioni in cui possono essere evidenziate mutazioni che individuano fenotipo resistente Studi epidemiologici (fenomeni epidemici, alberi filogenetici) 5

6 It is hard to exaggerate the impact of the polymerase chain reaction. PCR, the quick, easy method for generating unlimited copies of any fragment of DNA, is one of those scientific developments that actually deserves timeworn superlatives like "revolutionary" and "breakthrough." - Tabitha M. Powledge La PCR è una metodica molecolare che si basa sull impiego di un enzima, la Taq Polimerasi, in grado di catalizzare in vitro la reazione di amplificazione di una particolare sequenza di DNA o RNA a partire da una frazione di acido nucleico utilizzato come stampo Kary Mullis 6

7 Metodo enzimatico di Sanger Nucleotidi che bloccano l allungamento del filamento di acido nucleico: la mancanza del gruppo ossidrile in 3 impedisce l attacco al 7 gruppo fosforico del nucleotide successivo

8 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 8 8

9 Prima del sequenziamento Scelta del campione (puro) da cui è più indicato estrarre gli acidi nucleici (diretto o dopo isolamento?) Scelta del bersaglio (regione): -sequenza presente in tutti gli organismi che desideriamo tipizzare -sequenza regioni fiancheggianti conservate, ma contenenti regione variabile Messa a punto di una buona PCR (scelta dei primers e delle condizioni di amplificazione) Disponibilità di un database contenente le sequenze con cui si vuole confrontare il bersaglio 9

10 10 ALLA FINE DELLA PCR

11 Verifica dell amplificato (visualizzazione mediante corsa elettroforetica) Camera elettroforetica Gel di agarosio (1-3%) (agarosio, tampone TBE, ovvero Tris-borato in EDTA, etidio bromuro/sybr Green) Colorante Ladder (marker, peso molecolare) Transilluminatore (lampada UV) Movimento di molecole cariche sottoposte ad un campo elettrico, generato dalla differenza di potenziale (100 V=50mA), creata da un alimentatore di corrente; in tampone alcalino (TBE, ph 8.3) o neutro gli acidi nucleici si comportano come anioni (carica -) e migrano verso il polo positivo; le molecole di DNA passano attraverso i pori del gel e a seconda della loro lunghezza percorrono una distanza più o meno 11 lunga 11

12 12

13 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 13 13

14 Purificazione dei prodotti di PCR IMPLICA L ELIMINAZIONE DI PRIMER, dntp ED ENZIMA RIMASTI IN SOLUZIONE AL TERMINE DELLA REAZIONE DI AMPLIFICAZIONE SI CONSIGLIA quando la banda è singola EXOSAP-it (reazione enzimatica): esonucleasi I e fosfatasi alcalina (Shrimp Alkalin Phosphatase) degradano primer e dntps, ma non rimuovono sali o altri prodotti secondari della PCR quando le bande sono multiple Estrazione da gel utilizzando colonnine commerciali (ridurre al minimo le dimensioni della banda tagliata; aumentare il numero di lavaggi con la soluzione contenente etanolo; aumentare il tempo della spinnata a vuoto prima dell'eluizione del DNA dalla colonnina)

15 Verifica e quantificazione del prodotto purificato Verifica: visualizzazione dei prodotti di purificazione mediante corsa elettroforetica Quantificazione del prodotto di PCR purificato: spettrofotometria quantitative DNA Ladder

16 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 16 16

17 SEQUENZIAMENTO AUTOMATICO (metodo di Sanger) Richiede la presenza di una molecola stampo di DNA a singolo filamento e di un oligonucleotide d innesco (primer) ad essa complementare Il primer si appaia all estremità in 3 -OH del filamento di DNA e rende disponibile il proprio terminale idrossilico per la reazione di polimerizzazione, catalizzata dalla DNApolimerasi La reazione di sequenza prevede l utilizzo una miscela di reazioni contenente i quattro deossinucleotidi trifosfati (dntps) in quantità equimolari e un dideossinucleotide (ddntp) presente in bassa concentrazione 17

18 Nucleotidi terminatori (ddntp) Nucleotidi che bloccano l allungamento del filamento di acido nucleico: la mancanza del gruppo ossidrile in 3 impedisce l attacco al gruppo fosforico del nucleotide successivo Nucleotidi marcati con 32 P (in passato) o molecole fluorescenti (recentemente) 18

19 Quando la catena nascente incorpora un ddntp, la reazione di polimerizzazione si arresta e si ha la terminazione della catena; ciò avverrà più volte, in posizioni diverse della sequenza, generando una serie di frammenti interrotti di lunghezza variabile. 19

20 Produzione dei frammenti (metodo di Sanger) 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 3 5 molecola stampo di DNA a singolo filamento 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 3 5

21 Produzione dei frammenti (metodo di Sanger) 5 oligonucleotide d innesco (primer) 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCA 5 il primer si appaia all estremità in 3 -OH del filamento di DNA e rende disponibile il proprio terminale idrossilico per la polimerizzazione 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT da dc dg dt + DNA Polimerasi 5 3 TTACGTAACGTCA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 3 5

22 Produzione dei frammenti (metodo di Sanger) 5 sintesi del DNA 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA

23 Produzione dei frammenti (metodo di Sanger) miscela di reazione contenente i deossinucleotidi trifosfati (dntps) in quantità equimolari e i dideossinucleotidi (ddntp) a bassa concentrazione 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCG 5 3 TTACGTAACGTCA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGC 3 5 da dc dg dt dda ddc ddg ddt + DNA Polimerasi

24 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAAC AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACG AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACGT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACGTC AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA

25 Produzione dei frammenti (metodo di Sanger) 25

26 Quando la catena nascente incorpora un ddntp, la reazione di polimerizzazione si arresta e si ha terminazione, altrimenti l allungamento prosegue; ciò avverrà più volte, in posizioni diverse della sequenza, generando una serie di frammenti interrotti di lunghezza variabile: se il bersaglio è composto da n nucleotidi si avranno frammenti di tutte le lunghezze possibili da 1 a n, separabili mediante corsa elettroforetica Coniugando a ciascun ddntp un diverso marcatore fluorescente è possibile distinguerli e, indipendentemente dalla lunghezza, tutti i frammenti terminanti con A emetteranno fluorescenza di tipo A, quelli terminanti con citosina di tipo C e 26 via di seguito

27 Produzione dei frammenti (metodo di Sanger) Quando la catena nascente incorpora un ddntp, la reazione di polimerizzazione si arresta e si ha terminazione, altrimenti l allungamento prosegue; ciò avverrà più volte, in posizioni diverse della sequenza, generando una serie di frammenti interrotti di lunghezza 27 variabile.

28 28 Fluorocromi

29 29 Fluorocromi

30 PCR di sequenziamento: metodo Sanger o enzimatico Due reazioni parallele, utilizzando in ciascuna, un solo primer (forward o reverse) PRIMER (HPLC-purificati): sovrapposto, meglio se interno, al primer di I amplificazione (forward/reverse) 3,2 pmol reagente per 1 campione RRBigDye1.1/3.1 4 /2 µl Buffer5X 2 /3 µl H2O 3.8 /6.8 µl Primer (1pmol/µl) 3.2µl V intermedio 13 /15 EXOs-product 7/5µl Volume finale 20µl Buffer 5X: tampone di reazione con Mg++ Big Dye Terminator Kit ENZIMA: polimerasi (T-elongazione=60 C) 2 ml DEOSSINUCLEOTIDI TRIFOSFATO (dntps): datp, dctp, dgtp, dttp : precursori del DNA DI-DEOSSINUCLEOTIDI TRIFOSFATO: ddntps, nucleotidi terminator Ready Reaction Mix (2,5X) 4 ml TARGET: amplicone purificato 5 ng/100 bp 30

31 Protocollo di reazione: temperature e tempi Denaturazione iniziale: 96 C Denaturazione: 96 C Annealing: 50 C 25 cicli Elongazione: 60 C evitare temperature di annealing<50 C nel caso di primers con Ta>60 C, eliminare lo step di annealing 96 C, 60 C) aumentare il nr. di cicli se il prodotto di I amplificazione è debole 31

32 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 32 32

33 Metodi di purpficazione (ddntps non incorporati) 33

34 G e l - f i l t r a z i o n e 34

35 35 Elettroforesi Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti)

36 36 Corsa elettroforetica

37 Viene utilizzato un gel ad altissima risoluzione (poliacrilamide 4-6%), in condizioni denaturanti (urea), capace di separare frammenti di DNA che differiscono tra di loro per un solo nucleotide (spessore del gel: 0,3-0,4 mm; lunghezza lastre di vetro: 40 cm circa) Precursori normali del A C G deossiribonucleosidetrifosfato C G T G T CA T G Piccola quantità del A G T A C C A G dideossiribonucleoside- T G A T T trifosfato C Innesco per la DNA T G A polimerasi marcato a fluorescenza 5 3 G C T A C C T G C A T G G A DNA - POLIMERASI C G A T G G A C G T A C C T C T G A A G C G 3 5 Molecola di DNA a singolo filamento L infrequente incorporazione del dideossiribonucletide blocca l ulteriore accrescimento della molecola di DNA da sequenziare G C T A C C T G C A T G G A G C T A G C T A C C T G G A Miscela di molecole di DNA fluorescenti di diversa lunghezza, tutte terminate da A Quattro inneschi fluorescenti di colore diverso incubati nella miscela di nucleotidi contenente un diverso dideossiribonucleosidetrifosfato che termina la catena (A, C, G, T) Miscela di molecole di diversa lunghezza tutte terminate da A Miscela di molecole di diversa lunghezza tutte terminate da C Miscela di molecole di diversa lunghezza tutte terminate da G Miscela di molecole di diversa lunghezza tutte terminate da T A C G T 37

38 Elettroforesi L intensità e la lunghezza d onda delle emissioni fluorescenti vengono captate durante l elettroforesi, quando i frammenti di DNA, eccitati dalla luce laser, passano davanti ad un rilevatore 38

39 39 Elettroforesi

40 40 Il sequenziamento automatizzato (ABI Prism 3130 Genetic Analyzer)

41 41

42 Il sequenziamento automatizzato (elettroforesi capillare) Lo strumento, dopo aver prelevato il prodotto della PCR di marcatura lo sottopone ad elettroforesi all interno di un capillare in vetro-resina di diversa lunghezza a seconda delle esigenze Il capillare, del diametro di 50 mm, contiene un polimero di corsa, automaticamente caricato dal sistema Esistono sistemi a 1, 4, 16 e 96 capillari Un raggio laser colpisce il capillare eccitando i fluorocromi marcanti i frammenti di diversa lunghezza 42 Una cellula fotoelettrica rileva e memorizza i segnali fluorescenti

43 43

44 44 Calibrazioni: spettrale + spaziale

45 45 Analisi dei risultati Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti)

46 Elettroferogramma (Sequencing Analysis 5.2 AB) Durante la corsa elettroforetica i frammenti di DNA vengono colpiti da un raggio laser (emissione a 490 nm) Questo provoca l eccitamento dei fluorocromi che marcano i frammenti Ciascuno dei quattro fluorocromi emette ad una lunghezza d onda diversa Una cellula fotoelettrica rileva sequenza, tipo ed intensità delle emissioni luminose Il tutto viene convertito in un sistema grafico La sequenza dei picchi corrisponde alla sequenza dei nucleotidi ed il colore del picco corrisponde al tipo di base azotata 46

47 47 Raw data (Sequencing Analysis 5.2 AB)

48 48 ELETTROFEROGRAMMA

49 Analisi dei risultati: qualità 49

50 50 Allineamenti: banche dati

51 GenBank Banca dati ad accesso libero (internet) Circa 50 milioni di sequenze geniche (animali e vegetali) Permette il confronto della propria sequenza in tempo reale: motore di ricerca (programma blast) individua le sequenze con il più elevato grado di omologia Chiunque può depositarvi le proprie sequenze 51

52 52

53 53

54 54 Blast

55 55 Blast

56 56 Blast

57 57 Blast

58 58 Altre banche dati: redom

59 59 Altre banche dati: redom

60 60 Altre banche dati: redom

61 61 Altre banche dati: redom

62 62 Banche dati dedicate: HCV sequence database

63 63 Banche dati dedicate: HCV sequence database

64 64 Banche dati dedicate: HCV sequence database

65 65 Banche dati dedicate: geno2pheno

66 66

67 Applicazioni: la nostra esperienza Individuazione delle regioni da sequenziare (campione di partenza) Ricerca di una library (database) Definizione del flusso di lavoro Messa a punto e validazione Controlli di qualità Introduzione nella pratica giornaliera 67

68 Applicazioni: la nostra esperienza Determinazione dei differenti genotipi (1-3%) e sottotipi (0.5-1%) virali per HCV (NS5B) Determinazione dei differenti genotipi virali per HBV e individuazione del genotipo resistente a Lamivudina, Adefovir, e/o Entecavir (Tenofovir, Telbivudina)(pol) Identificazioni batteriche (16SrDNA) Identificazioni micobatteri per la speciazione all interno del MTC (gyrb) e definizione delle resistenze alla rifampicina (RNApolβ: rpo/tb) Identificazione dei miceti (ITS) Tipizzazione Enterovirus (5 UTR) Sorveglianza epidemiologica dell influenza (emoagglutinina) Sorveglianza epidemiologica Clostridium difficile (proteina C)

69 Micobatteri OBIETTIVI: 1) rapida distinzione, nell ambito del MTC, tra M. tuberculosis, M. bovis (intrinsecamente resistente alla pirazinamide, farmaco di dimostrata epatotossicità), M. africanum, M. microti; 2) rapida identificazione dei ceppi resistenti alla rifampicina, più diffusi nei pazienti stranieri, ma rilevati anche negli autoctoni. PUNTO DI PARTENZA: 1) le metodiche molecolari in uso (Innolipa) differenziano bene i MOTT, ma non sono in grado di distinguere all interno dell MTC; 2) l esecuzione dell antibiogramma (metodo di riferimento) richiede in media 20 gg.

70 Individuazione della regione: gyrb (no 16SrDNA, no ITS) 70

71 71 Database gyrb

72 S E Q U E N C I N G - A N A L Y S I S

73 Ridom 73

74 74 Ridom

75 75 IL SEQUENZIAMENTO GENICO NELLA PRATICA DEL LABORATORIO DI MICROBIOLOGIA e VIROLOGIA: L ESPERIENZA DEL COMPRENSORIO SANITARIO di BOLZANO e perché non Blast?

76 IL SEQUENZIAMENTO GENICO NELLA PRATICA DEL LABORATORIO DI MICROBIOLOGIA e VIROLOGIA: L ESPERIENZA DEL COMPRENSORIO SANITARIO di BOLZANO Limiti 76

77 Il nostro protocollo/flusso di lavoro Coltura positiva MOTT Innolipa MTC SEQ Rif-RES?

78 Messa a punto e validazione Prof. Proedinger; Division of Hygiene and Medical Microbiology, Department of Hygiene, Microbiology and Social Medicine, Innsbruck Medical University, Innsbruck, Austria. : MIRU genotyping (mycobacterial interspersed repetitive units) 78

79 79 Genotipizzazione HBV: individuazione della regione

80 Primers e condizioni d amplificazione reagente per 1 campione per campioni SYBR GREEN MasterMix primermix(hbpr256+ KL14;10pmol/ µl) 10 µl 2 µl Volume intermedio 12µl DNA estratto (easy mag) 9µl Volume finale 21µl 80

81 Datbase 60 genotipi 81

82 Esempio (ridom) HBV genotipo D Conferma Prof. Norder/Dr.ssa Crovatto 82

83 83

84 BIOLOGIA MOLECOLARE e VIROLOGIA Chiara Cemin Dr.ssa Federica Folli Adriana Giacomozzi Valentina Pasquetto Valentina Poletta Silvia Ruggeri 84

85 85 Domande??????

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Lo schema a blocchi di uno spettrofotometro

Lo schema a blocchi di uno spettrofotometro Prof.ssa Grazia Maria La Torre è il seguente: Lo schema a blocchi di uno spettrofotometro SORGENTE SISTEMA DISPERSIVO CELLA PORTACAMPIONI RIVELATORE REGISTRATORE LA SORGENTE delle radiazioni elettromagnetiche

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

Aptima HIV-1 Quant Dx Assay

Aptima HIV-1 Quant Dx Assay Aptima Aptima HIV-1 Quant Dx Assay Per uso diagnostico in vitro. Solo per l esportazione dagli USA. Informazioni generali................................................ 2 Utilizzo previsto................................................................

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Caratterizzazione molecolare dell Anidrasi Carbonica in Trematomus spp.

Caratterizzazione molecolare dell Anidrasi Carbonica in Trematomus spp. UNIVERSITÀ DEGLI STUDI DI PADOVA FACOLTÀ DI SCIENZE MM. FF. NN. Laurea di primo livello in Biologia Curriculum di Biologia Marina Caratterizzazione molecolare dell Anidrasi Carbonica in Trematomus spp.

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

L identificazione e la denominazione delle sostanze chimiche in ambito REACH

L identificazione e la denominazione delle sostanze chimiche in ambito REACH I DETERGENTI: COME CONIUGARE PRESTAZIONI ELEVATE E RISPETTO PER L AMBIENTE L identificazione e la denominazione delle sostanze chimiche in ambito REACH Resana, 5 ottobre 2007 FEDERICA CECCARELLI Ist. Sup.

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Altre novità della nostra ampia gamma di strumenti!

Altre novità della nostra ampia gamma di strumenti! L innovazione ad un prezzo interessante Altre novità della nostra ampia gamma di strumenti! Exacta+Optech Labcenter SpA Via Bosco n.21 41030 San Prospero (MO) Italia Tel: 059-808101 Fax: 059-908556 Mail:

Dettagli

Università di Foggia Dipartimento di Scienze Agrarie, degli Alimenti e dell Ambiente

Università di Foggia Dipartimento di Scienze Agrarie, degli Alimenti e dell Ambiente Università di Foggia Dipartimento di Scienze Agrarie, degli Alimenti e dell Ambiente Produzione di formaggio di bufala a pasta semidura: studio della proteolisi Barbara La Gatta, Giusy Rusco, Aldo Di Luccia

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 Cisteina di 3 gruppo (176) Unità ripetute ricche di leucina Cisteine di 2 gruppo

Dettagli

2. L INQUINAMENTO ATMOSFERICO

2. L INQUINAMENTO ATMOSFERICO 2. L INQUINAMENTO ATMOSFERICO L aria è una miscela eterogenea formata da gas e particelle di varia natura e dimensioni. La sua composizione si modifica nello spazio e nel tempo per cause naturali e non,

Dettagli

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali:

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali: Gli enzimi Nel metabolismo energetico le cellule producono notevoli quantità di CO 2 che deve essere eliminata con l apparato respiratorio. Il trasferimento della CO 2 dalle cellule al sangue e da esso

Dettagli

L Ozono è un gas altamente reattivo, di odore pungente e ad elevate concentrazioni di colore blu, dotato di un elevato potere ossidante.

L Ozono è un gas altamente reattivo, di odore pungente e ad elevate concentrazioni di colore blu, dotato di un elevato potere ossidante. Ozono (O 3 ) Che cos è Danni causati Evoluzione Metodo di misura Che cos è L Ozono è un gas altamente reattivo, di odore pungente e ad elevate concentrazioni di colore blu, dotato di un elevato potere

Dettagli

1,25 (OH) 2 Vitamina D ELISA kit

1,25 (OH) 2 Vitamina D ELISA kit 1,25 (OH) 2 Vitamina D ELISA kit Per la determinazione in vitro della 1,25 (OH) 2 Vitamina D in plasma e siero Gültig ab/valid from 17.03.2008 +8 C IMM-K 2112 +2 C 48 1. APPLICAZIONE Il kit ELISA (Enzyme-Linked-Immuno-Sorbent-Assay)

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

CROMATOGRAFIA SU COLONNA

CROMATOGRAFIA SU COLONNA 1 CROMATOGRAFIA SU COLONNA La cromatografia è una tecnica di migrazione differenziata che permette la separazione dei costituenti di una miscela di sostanze affini. La cromatografia può essere di tipo

Dettagli

AC Anywhere. Inverter. Manuale utente. F5C400u140W, F5C400u300W F5C400eb140W e F5C400eb300W

AC Anywhere. Inverter. Manuale utente. F5C400u140W, F5C400u300W F5C400eb140W e F5C400eb300W AC Anywhere Inverter (prodotto di classe II) Manuale utente F5C400u140W, F5C400u300W F5C400eb140W e F5C400eb300W Leggere attentamente le istruzioni riguardanti l installazione e l utilizzo prima di utilizzare

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

DEFINIZIONE DELLE SPECIFICHE TECNICHE DI SVILUPPO DELL ATTREZZATURA PROTOTIPO PER LA CONCENTRAZIONE DI BIOMASSA MICROBICA DA ESTRATTO DI CASTAGNA

DEFINIZIONE DELLE SPECIFICHE TECNICHE DI SVILUPPO DELL ATTREZZATURA PROTOTIPO PER LA CONCENTRAZIONE DI BIOMASSA MICROBICA DA ESTRATTO DI CASTAGNA DEFINIZIONE DELLE SPECIFICHE TECNICHE DI SVILUPPO DELL ATTREZZATURA PROTOTIPO PER LA CONCENTRAZIONE DI BIOMASSA MICROBICA DA ESTRATTO DI CASTAGNA Premesso che nell ambito del progetto Castagna di Montella:

Dettagli

I modelli atomici da Dalton a Bohr

I modelli atomici da Dalton a Bohr 1 Espansione 2.1 I modelli atomici da Dalton a Bohr Modello atomico di Dalton: l atomo è una particella indivisibile. Modello atomico di Dalton Nel 1808 John Dalton (Eaglesfield, 1766 Manchester, 1844)

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Ricerca, Qualità, Sicurezza e Salute

Ricerca, Qualità, Sicurezza e Salute Ricerca, Qualità, Sicurezza e Salute Chi Siamo Hygeia Lab S.r.l. nasce nel 2011 dalla passione e dal desiderio di giovani laureati di continuare la crescita e la formazione scientifica. E una Start-Up

Dettagli

Capitolo 2 Caratteristiche delle sorgenti luminose In questo capitolo sono descritte alcune grandezze utili per caratterizzare le sorgenti luminose.

Capitolo 2 Caratteristiche delle sorgenti luminose In questo capitolo sono descritte alcune grandezze utili per caratterizzare le sorgenti luminose. Capitolo 2 Caratteristiche delle sorgenti luminose In questo capitolo sono descritte alcune grandezze utili per caratterizzare le sorgenti luminose. 2.1 Spettro di emissione Lo spettro di emissione di

Dettagli

Unità 12. La corrente elettrica

Unità 12. La corrente elettrica Unità 12 La corrente elettrica L elettricità risiede nell atomo Modello dell atomo: al centro c è il nucleo formato da protoni e neutroni ben legati tra di loro; in orbita intorno al nucleo si trovano

Dettagli

U N I V E R S I T À D E G L I S T U D I D I T O R I N O

U N I V E R S I T À D E G L I S T U D I D I T O R I N O U N I V E R S I T À D E G L I S T U D I D I T O R I N O Il Centro della Innovazione Nato inizialmente per ospitare alcune attività didattiche dell Università di Torino, il complesso polifunzionale di Via

Dettagli

La corrente elettrica

La corrente elettrica PROGRAMMA OPERATIVO NAZIONALE Fondo Sociale Europeo "Competenze per lo Sviluppo" Obiettivo C-Azione C1: Dall esperienza alla legge: la Fisica in Laboratorio La corrente elettrica Sommario 1) Corrente elettrica

Dettagli

TECNICHE DI BASE PER LA SEPARAZIONE DEI COMPONENTI DI UNA MISCELA

TECNICHE DI BASE PER LA SEPARAZIONE DEI COMPONENTI DI UNA MISCELA TECNICHE DI BASE PER LA SEPARAZIONE DEI COMPONENTI DI UNA MISCELA CENTRIFUGAZIONE La centrifugazione è un processo che permette di separare una fase solida immiscibile da una fase liquida o due liquidi

Dettagli

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza?

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Con ALLIANCE Uvitec di Eppendorf Italia risparmi tempo e materiale di consumo, ottieni immagini quantificabili e ci guadagni anche in salute.

Dettagli

Vitamina D, PTH ed omeostasi del calcio

Vitamina D, PTH ed omeostasi del calcio Vitamina D, PTH ed omeostasi del calcio Funzioni principali della vit D Stimolazione dell'assorbimento del calcio e del fosforo a livello intestinale; Regolazione, in sinergia con l'ormone paratiroideo,

Dettagli

Curriculum Vitae Europass

Curriculum Vitae Europass Curriculum Vitae Europass Informazioni personali Nome(i) / Cognome(i) Indirizzo(i) Roberto CARUSO Corso Mazzini, 11-87100 Cosenza, Italia Telefono(i) Tel. + 39 0984681824 Fax+ 39 0984681322 E-mail Cittadinanza

Dettagli

Sostituzioni sull anello aromatico

Sostituzioni sull anello aromatico Sostituzioni sull anello aromatico Criteri per stabilire l esistenza di carattere aromatico 1. Il composto deve essere ciclico, planare e deve avere una nuvola ininterrotta di elettroni π sopra e sotto

Dettagli

LAMPADE A VAPORI DI MERCURIO AD ALTA PRESSIONE

LAMPADE A VAPORI DI MERCURIO AD ALTA PRESSIONE Pag. 1 di 20 LAMPADE A VAPORI DI MERCURIO AD ALTA PRESSIONE Funzione Responsabile Supporto Tecnico Descrizione delle revisioni 0: Prima emissione FI 00 SU 0002 0 1: Revisione Generale IN 01 SU 0002 1 2:

Dettagli

Manuale sull illuminazione UV www.dohse-terraristik.com

Manuale sull illuminazione UV www.dohse-terraristik.com Manuale sull illuminazione UV La corretta illuminazione dei terrari è importante per il benessere degli animali da terrario e per il successo dell allevamento. In ciò rivestono particolare importanza determinate

Dettagli

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione PROTOCOLLO DI BIOSICUREZZA Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione Disinfezione Il ricorso a disinfettanti e disinfestanti, se unito ad altre misure tese a minimizzare

Dettagli

Attività di sorveglianza e controllo delle infezioni ospedaliere a livello aziendale: risultati di un indagine conoscitiva.

Attività di sorveglianza e controllo delle infezioni ospedaliere a livello aziendale: risultati di un indagine conoscitiva. Attività di sorveglianza e controllo delle infezioni ospedaliere a livello aziendale: risultati di un indagine conoscitiva. Mario Saia CIO: Normativa Italiana Circolare Ministeriale 52/1985 Lotta contro

Dettagli

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la INFIAMMAZIONE Risposta protettiva che ha lo scopo di eliminare sia la causa iniziale del danno cellulare (es. microbi, tossine etc), sia i detriti cellulari e le cellule necrotiche che compaiono a seguito

Dettagli

10.- DISINFETTANTI PIÙ COMUNI E MODALITÀ D USO

10.- DISINFETTANTI PIÙ COMUNI E MODALITÀ D USO 10.- DISINFETTANTI PIÙ COMUNI E MODALITÀ D USO 10.0.- Disinfettanti e loro caratteristiche Questa sezione descrive alcune famiglie di disinfettanti facilmente reperibili sul mercato che attualmente vengono

Dettagli

Il gelato artigianale proprio come lo vuoi tu. E tanto altro ancora...

Il gelato artigianale proprio come lo vuoi tu. E tanto altro ancora... Impianti Carpigiani per Artigianale a Norme HACCP Tutte le macchine Carpigiani sono progettate e realizzate per rispettare appieno le norme internazionali di sicurezza ed igiene. Il Gelatiere professionista

Dettagli

PULIZIA IN-SITU PULIZIA DIFFUSORI MODALITÀ DI FUNZIONAMENTO DEL MODULO KUBOTA ESTRAZIONE PERMEATO PER ASPIRAZIONE ESTRAZIONE PERMEATO PER GRAVITÀ

PULIZIA IN-SITU PULIZIA DIFFUSORI MODALITÀ DI FUNZIONAMENTO DEL MODULO KUBOTA ESTRAZIONE PERMEATO PER ASPIRAZIONE ESTRAZIONE PERMEATO PER GRAVITÀ MODALITÀ DI FUNZIONAMENTO DEL MODULO KUBOTA Il modulo a membrana piana Kubota utilizza la tecnologia di microfiltrazione detta cross flow. Insufflando aria sul fondo del modulo, si crea un flusso ascensionale

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

(Atti non legislativi) REGOLAMENTI

(Atti non legislativi) REGOLAMENTI 15.1.2011 IT Gazzetta ufficiale dell Unione europea L 12/1 II (Atti non legislativi) REGOLAMENTI REGOLAMENTO (UE) N. 10/2011 DELLA COMMISSIONE del 14 gennaio 2011 riguardante i materiali e gli oggetti

Dettagli

CONTROLLO MICROBIOLOGICO AMBIENTALE NELLE SALE OPERATORIE

CONTROLLO MICROBIOLOGICO AMBIENTALE NELLE SALE OPERATORIE ASO S. Croce e Carle di Cuneo C.I.O. COMITATO INFEZIONI OSPEDALIERE DOCUMENTO DESCRITTIVO TITOLO CONTROLLO MICROBIOLOGICO AMBIENTALE NELLE SALE OPERATORIE Data di emissione: 20 aprile 2004 revisione n

Dettagli

LA DONAZIONE DI SANGUE

LA DONAZIONE DI SANGUE CHE COSA è La donazione di sangue consiste nel prelievo di un determinato volume di sangue da un soggetto sano, chiamato donatore, al fine di trasfonderlo in un soggetto che ha bisogno di sangue o di uno

Dettagli

QUALITÀ E TRATTAMENTO DELL ACQUA DEL CIRCUITO CHIUSO

QUALITÀ E TRATTAMENTO DELL ACQUA DEL CIRCUITO CHIUSO QUALITÀ E TRATTAMENTO DELL ACQUA DEL CIRCUITO CHIUSO (PARTE 1) FOCUS TECNICO Gli impianti di riscaldamento sono spesso soggetti a inconvenienti quali depositi e incrostazioni, perdita di efficienza nello

Dettagli

L ACQUA : STRUTTURA E PROPRIETA

L ACQUA : STRUTTURA E PROPRIETA L ACQUA : STRUTTURA E PROPRIETA 1. Sostanza più abbondante in tutti gli esseri viventi 2. Più del 70% del peso di tutti gli esseri viventi 3. Influenza la struttura e la proprietà di tutte le molecole

Dettagli

ALLEGATO al verbale della riunione del 3 Settembre 2010, del Dipartimento di Elettrotecnica e Automazione.

ALLEGATO al verbale della riunione del 3 Settembre 2010, del Dipartimento di Elettrotecnica e Automazione. ALLEGATO al verbale della riunione del 3 Settembre 2010, del Dipartimento di Elettrotecnica e Automazione. COMPETENZE MINIME- INDIRIZZO : ELETTROTECNICA ED AUTOMAZIONE 1) CORSO ORDINARIO Disciplina: ELETTROTECNICA

Dettagli

STUDI PRELIMINARI COMPARATIVI SULLA BIODISPONIBILITA E CAPACITA DI PERMEARE LA PELLE DI:

STUDI PRELIMINARI COMPARATIVI SULLA BIODISPONIBILITA E CAPACITA DI PERMEARE LA PELLE DI: STUDI PRELIMINARI COMPARATIVI SULLA BIODISPONIBILITA E CAPACITA DI PERMEARE LA PELLE DI: - RETINOLO PURO - RETINOLO IN LIPOSOMI - RETINOLO IN LIPOSYSTEM COMPLEX - RETINOLO IN CYCLOSYSTEM COMPLEX - VITAMINA

Dettagli

unità B3. Le teorie sull evoluzione

unità B3. Le teorie sull evoluzione documentazione fossile è provata da embriologia comparata anatomia comparata biologia molecolare L evoluzione avviene per selezione naturale microevoluzione può essere macroevoluzione speciazione allopatrica

Dettagli

Batterie per recinti. Batteria alcalina a secco 9 V. Batteria a secco 9 V zinco-carbonio

Batterie per recinti. Batteria alcalina a secco 9 V. Batteria a secco 9 V zinco-carbonio Batterie per recinti Batteria alcalina a secco 9 V Le batterie alcaline AKO 9 V mantengo un alto voltaggio costante per tutta la loro durata. Questo permette al recinto di mantenere un andamento costante

Dettagli

DAI POLIMERI SINTETICI ALLE PLASTICHE BIODEGRADABILI

DAI POLIMERI SINTETICI ALLE PLASTICHE BIODEGRADABILI IT- Settore Tecnologico - B. FOCACCIA Salerno Piano dell Offerta Formativa 2011/2012 Presentazione del Progetto: DAI POLIMERI SINTETICI ALLE PLASTICHE BIODEGRADABILI Referente Prof. Anna Maria Madaio Cosa

Dettagli

La base di partenza per la maggior parte dei processi produttivi di materiali ceramici sono le sospensioni. Queste si ottengono dalla miscelazione di

La base di partenza per la maggior parte dei processi produttivi di materiali ceramici sono le sospensioni. Queste si ottengono dalla miscelazione di La base di partenza per la maggior parte dei processi produttivi di materiali ceramici sono le sospensioni. Queste si ottengono dalla miscelazione di un solido (polvere) che diverrà il ceramico, con un

Dettagli

Scuola SuperioreMedico Tecnica Formazione Tecnico in Analisi Biomediche Anno:2012 2013

Scuola SuperioreMedico Tecnica Formazione Tecnico in Analisi Biomediche Anno:2012 2013 Scuola SuperioreMedico Tecnica Formazione Tecnico in Analisi Biomediche Anno:20122013 Nuovo test di screening rapido per la messa in evidenza dei micobatteri del complesso tubercolare e della resistenza

Dettagli

funzionamento degli accumulatori al piombo/acido.

funzionamento degli accumulatori al piombo/acido. Il triangolo dell Incendio Possibili cause d incendio: I carrelli elevatori Particolare attenzione nella individuazione delle cause di un incendio va posta ai carrelli elevatori, normalmente presenti nelle

Dettagli

VITAMINE. Composti organici eterogenei; indispensabili all organismo; non hanno valore energetico; agiscono in dosi minime (LARN: 1-200 mg/die);

VITAMINE. Composti organici eterogenei; indispensabili all organismo; non hanno valore energetico; agiscono in dosi minime (LARN: 1-200 mg/die); VITAMINE Composti organici eterogenei; indispensabili all organismo; non hanno valore energetico; agiscono in dosi minime (LARN: 1-200 mg/die); hanno funzioni specifiche e funzioni comuni, tra cui: - agiscono

Dettagli

Stat Profile CCX Critical Care Xpress

Stat Profile CCX Critical Care Xpress Stat Profile CCX Critical Care Xpress Semplicemente la miglior soluzione strumentale e gestionale dell emogasanalisi e dei parametri biochimici d urgenza Stat Profile CCX Critical Care Xpress PIU TEST...

Dettagli

Spettrofotometro Agilent Cary 8454. Prestazioni, affidabilità e conformità eccezionali

Spettrofotometro Agilent Cary 8454. Prestazioni, affidabilità e conformità eccezionali Spettrofotometro Agilent Cary 8454 Prestazioni, affidabilità e conformità eccezionali UV-VIS AGILENT Cary 8454 TECNOLOGia DIODE ARRAY COLLAUdata Agilent Technologies è il tuo partner ideale per la spettroscopia

Dettagli

Istituto per l Energia Rinnovabile. Autori: David Moser, PhD; Daniele Vettorato, PhD. Bolzano, Gennaio 2013

Istituto per l Energia Rinnovabile. Autori: David Moser, PhD; Daniele Vettorato, PhD. Bolzano, Gennaio 2013 Istituto per l Energia Rinnovabile Catasto Solare Alta Val di Non Relazione Versione: 2.0 Autori: David Moser, PhD; Daniele Vettorato, PhD. Coordinamento e Revisione: dott. Daniele Vettorato, PhD (daniele.vettorato@eurac.edu)

Dettagli

SeroCP Quant IgA. Applicazioni. Introduzione - 2 -

SeroCP Quant IgA. Applicazioni. Introduzione - 2 - SeroCP Quant IgA I Applicazioni SeroCP Quant IgA è un Enzyme Linked Immunosorbent Assay (ELISA) per la determinazione semiquantitativa di anticorpi IgA specie specifici anti Chlamydia pneumoniae nel siero

Dettagli

PET. Radionuclidi più utilizzati nella PET. Elemento prodotto T 1/2 in minuti primi B5 20 C6 10 N7 2 F 9 O8 110

PET. Radionuclidi più utilizzati nella PET. Elemento prodotto T 1/2 in minuti primi B5 20 C6 10 N7 2 F 9 O8 110 PET L acronimo PET sta per Positron Emission Tomography. Come per la SPECT, anche in questo caso si ha a che fare con una tecnica tomografica d indagine di tipo emissivo in quanto la sorgente di radiazione

Dettagli

WQuesto orologio è un modello a W onde radio che riceve le onde radio dell orario standard trasmesso in Germania.

WQuesto orologio è un modello a W onde radio che riceve le onde radio dell orario standard trasmesso in Germania. LQuesto orologio indica con il terminale più corto della lancetta dei secondi, il livello di ricezione e il risultato di ricezione. Lancetta dei secondi Lancetta dei minuti Lancetta delle ore Pulsante

Dettagli

Termometri portatili. Temp 16 RTD Basic. Temp 10 K Basic Per sonde a termocoppia K. Temp 6 Basic

Termometri portatili. Temp 16 RTD Basic. Temp 10 K Basic Per sonde a termocoppia K. Temp 6 Basic Temp 360 Professional Datalogger, per sonde Pt100 RTD - 0,01 C Temp 300 Professional Datalogger, a doppio canale, per sonde a termocoppia K, T, J, B, R, E, S, N Temp 16 RTD Basic Per sonde Pt100 RTD Temp

Dettagli

E SE IL TUO SMARTPHONE INDOSSASSE GLI OCCHIALI?

E SE IL TUO SMARTPHONE INDOSSASSE GLI OCCHIALI? E SE IL TUO SMARTPHONE INDOSSASSE GLI OCCHIALI? Buona Caccia e Buon Volo, giovani amici di Eureka! Siete tra gli eletti che hanno deciso di passare al livello successivo: site pronti? Questo mese vi proponiamo

Dettagli

ESPERIENZE DI LABORATORIO

ESPERIENZE DI LABORATORIO ESPERIENZE DI LABORATORIO Determinazione dello zinco nei capelli..1 Determinazione di anioni inorganici presenti in acque potabili 4 Determinazione degli acidi grassi in lipidi di origine naturale..6 Determinazione

Dettagli

grandezze illuminotecniche

grandezze illuminotecniche Grandezze fotometriche Flusso luminoso caratteristica propria delle sorgenti luminose; Lezioni di illuminotecnica grandezze illuminotecniche ntensità luminosa lluminamento Luminanza caratteristica propria

Dettagli

L EQUILIBRIO CHIMICO

L EQUILIBRIO CHIMICO EQUIIBRIO CHIMICO Molte reazioni chimiche possono avvenire in entrambe i sensi: reagenti e prodotti possono cioè scambiarsi fra di loro; le reazioni di questo tipo vengono qualificate come reazioni reversibili.

Dettagli

LE SOLUZIONI 1.molarità

LE SOLUZIONI 1.molarità LE SOLUZIONI 1.molarità Per mole (n) si intende una quantità espressa in grammi di sostanza che contiene N particelle, N atomi di un elemento o N molecole di un composto dove N corrisponde al numero di

Dettagli

Astra Formedic S.r.l. - Via Piero Portaluppi, 15 20138 Milano Tel. 02.580011 Email: info.astraformedic@ademorigroup.it web : www.astraformedic.

Astra Formedic S.r.l. - Via Piero Portaluppi, 15 20138 Milano Tel. 02.580011 Email: info.astraformedic@ademorigroup.it web : www.astraformedic. Astra Formedic S.r.l. - Via Piero Portaluppi, 15 20138 Milano Tel. 02.580011 Email: info.astraformedic@ademorigroup.it web : www.astraformedic.it è un sistema integrato completo di tutti i moduli per eseguire

Dettagli

Prova scritta di Fisica Generale I Corso di studio in Astronomia 22 giugno 2012

Prova scritta di Fisica Generale I Corso di studio in Astronomia 22 giugno 2012 Prova scritta di Fisica Generale I Corso di studio in Astronomia 22 giugno 2012 Problema 1 Due carrelli A e B, di massa m A = 104 kg e m B = 128 kg, collegati da una molla di costante elastica k = 3100

Dettagli

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp.

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. RECENSIONI&REPORTS recensione Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. 154, 12 «Il vasto e importante e molto

Dettagli

Elettrificatori per recinti

Elettrificatori per recinti Elettrificatori per recinti 721 Cod. R315527 Elettri catore multifunzione PASTORELLO SUPER PRO 10.000 Articolo professionale, dotato di rotoregolatore a 3 posizioni per 3 diverse elettroscariche. Può funzionare

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

RESISTIVITA ELETTRICA DELLE POLVERI: MISURA E SIGNIFICATO PER LA SICUREZZA

RESISTIVITA ELETTRICA DELLE POLVERI: MISURA E SIGNIFICATO PER LA SICUREZZA RESISTIVITA ELETTRICA DELLE POLVERI: MISURA E SIGNIFICATO PER LA SICUREZZA Nicola Mazzei - Antonella Mazzei Stazione sperimentale per i Combustibili - Viale A. De Gasperi, 3-20097 San Donato Milanese Tel.:

Dettagli

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD)

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Pædiatric Rheumatology InterNational Trials Organisation Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Che cos è? Il deficit di mevalonato chinasi è una malattia genetica. E un errore congenito

Dettagli

Meccanismi di azione degli antiossidanti

Meccanismi di azione degli antiossidanti Meccanismi di azione degli antiossidanti Materiali rganici Sistemi biologici Lipidi, Proteine, Acidi Nucleici Alimenti Polimeri Materiali plastici, Gomme Lubrificanti Idrocarburi Carburanti Degradazione

Dettagli

VLT. Aminoacidi Caffeina Derivati botanici Vitamine idrosolubili.

VLT. Aminoacidi Caffeina Derivati botanici Vitamine idrosolubili. VLT VLT (leggi Volt) è un gel energizzante il cui effetto si fonda sulla combinazione e sinergia d azione propria dei componenti in esso contenuti. In VLT si ritrovano, difatti, molteplici principi attivi

Dettagli

The Future Starts Now. Termometri portatili

The Future Starts Now. Termometri portatili Termometri portatili Temp 70 RTD Professional Datalogger, per sonde Pt100 RTD 0,01 C da -99,99 a +99,99 C 0,1 C da -200,0 a +999,9 C Temp 7 RTD Basic Per sonde Pt100 RTD 0,1 C da -99,9 a +199,9 C 1 C da

Dettagli

Criteri Ambientali Minimi (CAM) Gestione del verde pubblico

Criteri Ambientali Minimi (CAM) Gestione del verde pubblico Criteri Ambientali Minimi (CAM) Gestione del verde pubblico Marco Glisoni Maria Lisa Procopio Incontro formativo Progetto APE settembre 2014 Il Piano d Azione Nazionale per il GPP Piano d azione per la

Dettagli

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza Simona Giampaoli, Anna Rita Ciccaglione Istituto Superiore di Sanità Prevalenza e carico dell infezione cronica da virus dell epatite

Dettagli

Acidi nucleici non codificanti

Acidi nucleici non codificanti Vol. Giacca 4bozza 17-02-2011 11:05 Pagina 19 Acidi nucleici non codificanti 19 maniera controllata in modo da non favorire la crescita di eventuali tumori presenti in sedi lontane da quella in cui sono

Dettagli

Analisi termografica su celle litio-ione sottoposte ad esperienze di "second life" Francesco D'Annibale, Francesco Vellucci. Report RdS/PAR2013/191

Analisi termografica su celle litio-ione sottoposte ad esperienze di second life Francesco D'Annibale, Francesco Vellucci. Report RdS/PAR2013/191 Agenzia nazionale per le nuove tecnologie, l energia e lo sviluppo economico sostenibile MINISTERO DELLO SVILUPPO ECONOMICO Analisi termografica su celle litio-ione sottoposte ad esperienze di "second

Dettagli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli DAI GENI AI SEMI genetica e biotecnologie in agricoltura Simona Baima e Giorgio Morelli Copyright 2010 Editori: Simona Baima e Giorgio Morelli Copertina e disegni: Franco Marchiolli [www.francomarchiolli.com]

Dettagli

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica).

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica). 3.4. I LIVELLI I livelli sono strumenti a cannocchiale orizzontale, con i quali si realizza una linea di mira orizzontale. Vengono utilizzati per misurare dislivelli con la tecnica di livellazione geometrica

Dettagli

Vedere ciò che non si vede

Vedere ciò che non si vede Vedere ciò che non si vede LA LUCE UV È INVISIBILE Tuttavia essa influenza l aspetto finale dei prodotti stampati. Pertanto è importante conoscere le condizioni di visualizzazione in cui sono destinati

Dettagli