Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica"

Transcript

1 Il laboratorio di Biologia Molecolare: introduzione alle tecniche e alla loro applicazione Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica Elisabetta Pagani Direttrice reggente Laboratorio Aziendale di Microbiologia e Virologia Comprensorio Sanitario di Bolzano 1 Trento, 26 novembre 2011

2 Biologia molecolare: le metodiche in uso presso il Laboratorio Aziendale di Microbiologia e Virologia PCR end point (nested-pcr, reverse transcriptase PCR) Parvovirus B19 Toxoplasma HIV Provirus Norovirus Sequenziamento HCV genotipo HBV genotipo Resistenze HBV Identificazione microbica (16S) MTC + rif res Tipizzazione Enterovirus Identificazione miceti Tipizzazione neuroaminidasi + emoagglutinina Flu Genogruppi Norovirus 2 Tipizzazione C. difficile Definizione resistenze Aspergillus rtpcr qualitativa HSV1/2, VZV Adenovirus JCV MTC Chlamydia trachomatis Chlamydia pneumoniae Mycoplasma pneumoniae Legionella pneumophila Enterovirus Influenza A(H1N1, H3N2,H1n1 v)/b rtpcr quantitativa HCMV, EBV BKV HHV6 HBV, HCV, HIV Immunoblot MOTT

3 Storia della sequenza del DNA Avery propone il DNA come materiale genetico Holley sequenza il trna di lievito METODO SANGER (terminazione di catena) METODO MAXAM-GILBERT (degradazione chimica) Miescher osserva per la prima volta il DNA KARY MULLIS Introduce la PCR 1989 Watson e Crick determinano la struttura della doppia elica Vengono sviluppate le tecniche per la sintesi degli oligonucleotidi e per la degradazione chimica del DNA. Viene introdotta l elettroforesi su gel per la Separazione di frammenti di DNA 1980 Il DNA genomico viene clonato nel fago M13 o in vettori plasmidici, nascono i primi Programmi informatici di analisi dei dati, vengono sviluppate nuove tecnologie per il sequenziamento BANCHE DATI!!!!!! 3 Automazione completa Sequenziamento completo del genoma umano 2000 AUTOMAZIONE PARZIALE Vengono sviluppate le prime Apparecchiature per il sequenziamento che impiegano sistemi per la rilevazione della fluorescenza.

4 DEFINIZIONI Sequenziamento Il termine, in biologia molecolare, indica il processo per la determinazione esatta della struttura primaria di un biopolimero (basi nel caso di un acido nucleico, aminoacidi nel caso di proteine) Sequenziamento del DNA Determinazione dell'ordine dei diversi nucleotidi che costituiscono l'acido nucleico Presupposto Ogni microrganismo ha porzioni di genoma comuni ad altri e porzioni esclusive 4

5 Applicazioni in microbiologia e virologia medica Identificazioni: sequenziamento di regioni speciespecifiche (16SrDNA, ITS1-2 ) Identificazioni: sequenziamento di regioni tipospecifiche (genotipi e sottotipi) Resistenze ai farmaci: sequenziamento di regioni in cui possono essere evidenziate mutazioni che individuano fenotipo resistente Studi epidemiologici (fenomeni epidemici, alberi filogenetici) 5

6 It is hard to exaggerate the impact of the polymerase chain reaction. PCR, the quick, easy method for generating unlimited copies of any fragment of DNA, is one of those scientific developments that actually deserves timeworn superlatives like "revolutionary" and "breakthrough." - Tabitha M. Powledge La PCR è una metodica molecolare che si basa sull impiego di un enzima, la Taq Polimerasi, in grado di catalizzare in vitro la reazione di amplificazione di una particolare sequenza di DNA o RNA a partire da una frazione di acido nucleico utilizzato come stampo Kary Mullis 6

7 Metodo enzimatico di Sanger Nucleotidi che bloccano l allungamento del filamento di acido nucleico: la mancanza del gruppo ossidrile in 3 impedisce l attacco al 7 gruppo fosforico del nucleotide successivo

8 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 8 8

9 Prima del sequenziamento Scelta del campione (puro) da cui è più indicato estrarre gli acidi nucleici (diretto o dopo isolamento?) Scelta del bersaglio (regione): -sequenza presente in tutti gli organismi che desideriamo tipizzare -sequenza regioni fiancheggianti conservate, ma contenenti regione variabile Messa a punto di una buona PCR (scelta dei primers e delle condizioni di amplificazione) Disponibilità di un database contenente le sequenze con cui si vuole confrontare il bersaglio 9

10 10 ALLA FINE DELLA PCR

11 Verifica dell amplificato (visualizzazione mediante corsa elettroforetica) Camera elettroforetica Gel di agarosio (1-3%) (agarosio, tampone TBE, ovvero Tris-borato in EDTA, etidio bromuro/sybr Green) Colorante Ladder (marker, peso molecolare) Transilluminatore (lampada UV) Movimento di molecole cariche sottoposte ad un campo elettrico, generato dalla differenza di potenziale (100 V=50mA), creata da un alimentatore di corrente; in tampone alcalino (TBE, ph 8.3) o neutro gli acidi nucleici si comportano come anioni (carica -) e migrano verso il polo positivo; le molecole di DNA passano attraverso i pori del gel e a seconda della loro lunghezza percorrono una distanza più o meno 11 lunga 11

12 12

13 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 13 13

14 Purificazione dei prodotti di PCR IMPLICA L ELIMINAZIONE DI PRIMER, dntp ED ENZIMA RIMASTI IN SOLUZIONE AL TERMINE DELLA REAZIONE DI AMPLIFICAZIONE SI CONSIGLIA quando la banda è singola EXOSAP-it (reazione enzimatica): esonucleasi I e fosfatasi alcalina (Shrimp Alkalin Phosphatase) degradano primer e dntps, ma non rimuovono sali o altri prodotti secondari della PCR quando le bande sono multiple Estrazione da gel utilizzando colonnine commerciali (ridurre al minimo le dimensioni della banda tagliata; aumentare il numero di lavaggi con la soluzione contenente etanolo; aumentare il tempo della spinnata a vuoto prima dell'eluizione del DNA dalla colonnina)

15 Verifica e quantificazione del prodotto purificato Verifica: visualizzazione dei prodotti di purificazione mediante corsa elettroforetica Quantificazione del prodotto di PCR purificato: spettrofotometria quantitative DNA Ladder

16 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 16 16

17 SEQUENZIAMENTO AUTOMATICO (metodo di Sanger) Richiede la presenza di una molecola stampo di DNA a singolo filamento e di un oligonucleotide d innesco (primer) ad essa complementare Il primer si appaia all estremità in 3 -OH del filamento di DNA e rende disponibile il proprio terminale idrossilico per la reazione di polimerizzazione, catalizzata dalla DNApolimerasi La reazione di sequenza prevede l utilizzo una miscela di reazioni contenente i quattro deossinucleotidi trifosfati (dntps) in quantità equimolari e un dideossinucleotide (ddntp) presente in bassa concentrazione 17

18 Nucleotidi terminatori (ddntp) Nucleotidi che bloccano l allungamento del filamento di acido nucleico: la mancanza del gruppo ossidrile in 3 impedisce l attacco al gruppo fosforico del nucleotide successivo Nucleotidi marcati con 32 P (in passato) o molecole fluorescenti (recentemente) 18

19 Quando la catena nascente incorpora un ddntp, la reazione di polimerizzazione si arresta e si ha la terminazione della catena; ciò avverrà più volte, in posizioni diverse della sequenza, generando una serie di frammenti interrotti di lunghezza variabile. 19

20 Produzione dei frammenti (metodo di Sanger) 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 3 5 molecola stampo di DNA a singolo filamento 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 3 5

21 Produzione dei frammenti (metodo di Sanger) 5 oligonucleotide d innesco (primer) 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCA 5 il primer si appaia all estremità in 3 -OH del filamento di DNA e rende disponibile il proprio terminale idrossilico per la polimerizzazione 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT da dc dg dt + DNA Polimerasi 5 3 TTACGTAACGTCA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 3 5

22 Produzione dei frammenti (metodo di Sanger) 5 sintesi del DNA 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA

23 Produzione dei frammenti (metodo di Sanger) miscela di reazione contenente i deossinucleotidi trifosfati (dntps) in quantità equimolari e i dideossinucleotidi (ddntp) a bassa concentrazione 5 3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCG 5 3 TTACGTAACGTCA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGC 3 5 da dc dg dt dda ddc ddg ddt + DNA Polimerasi

24 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAAC AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACG AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACGT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACGTC AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA

25 Produzione dei frammenti (metodo di Sanger) 25

26 Quando la catena nascente incorpora un ddntp, la reazione di polimerizzazione si arresta e si ha terminazione, altrimenti l allungamento prosegue; ciò avverrà più volte, in posizioni diverse della sequenza, generando una serie di frammenti interrotti di lunghezza variabile: se il bersaglio è composto da n nucleotidi si avranno frammenti di tutte le lunghezze possibili da 1 a n, separabili mediante corsa elettroforetica Coniugando a ciascun ddntp un diverso marcatore fluorescente è possibile distinguerli e, indipendentemente dalla lunghezza, tutti i frammenti terminanti con A emetteranno fluorescenza di tipo A, quelli terminanti con citosina di tipo C e 26 via di seguito

27 Produzione dei frammenti (metodo di Sanger) Quando la catena nascente incorpora un ddntp, la reazione di polimerizzazione si arresta e si ha terminazione, altrimenti l allungamento prosegue; ciò avverrà più volte, in posizioni diverse della sequenza, generando una serie di frammenti interrotti di lunghezza 27 variabile.

28 28 Fluorocromi

29 29 Fluorocromi

30 PCR di sequenziamento: metodo Sanger o enzimatico Due reazioni parallele, utilizzando in ciascuna, un solo primer (forward o reverse) PRIMER (HPLC-purificati): sovrapposto, meglio se interno, al primer di I amplificazione (forward/reverse) 3,2 pmol reagente per 1 campione RRBigDye1.1/3.1 4 /2 µl Buffer5X 2 /3 µl H2O 3.8 /6.8 µl Primer (1pmol/µl) 3.2µl V intermedio 13 /15 EXOs-product 7/5µl Volume finale 20µl Buffer 5X: tampone di reazione con Mg++ Big Dye Terminator Kit ENZIMA: polimerasi (T-elongazione=60 C) 2 ml DEOSSINUCLEOTIDI TRIFOSFATO (dntps): datp, dctp, dgtp, dttp : precursori del DNA DI-DEOSSINUCLEOTIDI TRIFOSFATO: ddntps, nucleotidi terminator Ready Reaction Mix (2,5X) 4 ml TARGET: amplicone purificato 5 ng/100 bp 30

31 Protocollo di reazione: temperature e tempi Denaturazione iniziale: 96 C Denaturazione: 96 C Annealing: 50 C 25 cicli Elongazione: 60 C evitare temperature di annealing<50 C nel caso di primers con Ta>60 C, eliminare lo step di annealing 96 C, 60 C) aumentare il nr. di cicli se il prodotto di I amplificazione è debole 31

32 Le fasi del sequenziamento Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti) 32 32

33 Metodi di purpficazione (ddntps non incorporati) 33

34 G e l - f i l t r a z i o n e 34

35 35 Elettroforesi Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti)

36 36 Corsa elettroforetica

37 Viene utilizzato un gel ad altissima risoluzione (poliacrilamide 4-6%), in condizioni denaturanti (urea), capace di separare frammenti di DNA che differiscono tra di loro per un solo nucleotide (spessore del gel: 0,3-0,4 mm; lunghezza lastre di vetro: 40 cm circa) Precursori normali del A C G deossiribonucleosidetrifosfato C G T G T CA T G Piccola quantità del A G T A C C A G dideossiribonucleoside- T G A T T trifosfato C Innesco per la DNA T G A polimerasi marcato a fluorescenza 5 3 G C T A C C T G C A T G G A DNA - POLIMERASI C G A T G G A C G T A C C T C T G A A G C G 3 5 Molecola di DNA a singolo filamento L infrequente incorporazione del dideossiribonucletide blocca l ulteriore accrescimento della molecola di DNA da sequenziare G C T A C C T G C A T G G A G C T A G C T A C C T G G A Miscela di molecole di DNA fluorescenti di diversa lunghezza, tutte terminate da A Quattro inneschi fluorescenti di colore diverso incubati nella miscela di nucleotidi contenente un diverso dideossiribonucleosidetrifosfato che termina la catena (A, C, G, T) Miscela di molecole di diversa lunghezza tutte terminate da A Miscela di molecole di diversa lunghezza tutte terminate da C Miscela di molecole di diversa lunghezza tutte terminate da G Miscela di molecole di diversa lunghezza tutte terminate da T A C G T 37

38 Elettroforesi L intensità e la lunghezza d onda delle emissioni fluorescenti vengono captate durante l elettroforesi, quando i frammenti di DNA, eccitati dalla luce laser, passano davanti ad un rilevatore 38

39 39 Elettroforesi

40 40 Il sequenziamento automatizzato (ABI Prism 3130 Genetic Analyzer)

41 41

42 Il sequenziamento automatizzato (elettroforesi capillare) Lo strumento, dopo aver prelevato il prodotto della PCR di marcatura lo sottopone ad elettroforesi all interno di un capillare in vetro-resina di diversa lunghezza a seconda delle esigenze Il capillare, del diametro di 50 mm, contiene un polimero di corsa, automaticamente caricato dal sistema Esistono sistemi a 1, 4, 16 e 96 capillari Un raggio laser colpisce il capillare eccitando i fluorocromi marcanti i frammenti di diversa lunghezza 42 Una cellula fotoelettrica rileva e memorizza i segnali fluorescenti

43 43

44 44 Calibrazioni: spettrale + spaziale

45 45 Analisi dei risultati Amplificazione (PCR/RT-PCR o clonaggio) Verifica dell amplificato (visualizzazione dei prodotti di PCR/corsa ellettroforetica) Purificazione (digestione enzimatica / precipitazione / gel filtrzione) Verifica Quantificazione Marcatura (PCR di sequenziamento) Purificazione (gel-filtrazione/precipitazione) Elettroforesi (capillare) Analisi dei risultati (elettroferogramma ed allineamenti)

46 Elettroferogramma (Sequencing Analysis 5.2 AB) Durante la corsa elettroforetica i frammenti di DNA vengono colpiti da un raggio laser (emissione a 490 nm) Questo provoca l eccitamento dei fluorocromi che marcano i frammenti Ciascuno dei quattro fluorocromi emette ad una lunghezza d onda diversa Una cellula fotoelettrica rileva sequenza, tipo ed intensità delle emissioni luminose Il tutto viene convertito in un sistema grafico La sequenza dei picchi corrisponde alla sequenza dei nucleotidi ed il colore del picco corrisponde al tipo di base azotata 46

47 47 Raw data (Sequencing Analysis 5.2 AB)

48 48 ELETTROFEROGRAMMA

49 Analisi dei risultati: qualità 49

50 50 Allineamenti: banche dati

51 GenBank Banca dati ad accesso libero (internet) Circa 50 milioni di sequenze geniche (animali e vegetali) Permette il confronto della propria sequenza in tempo reale: motore di ricerca (programma blast) individua le sequenze con il più elevato grado di omologia Chiunque può depositarvi le proprie sequenze 51

52 52

53 53

54 54 Blast

55 55 Blast

56 56 Blast

57 57 Blast

58 58 Altre banche dati: redom

59 59 Altre banche dati: redom

60 60 Altre banche dati: redom

61 61 Altre banche dati: redom

62 62 Banche dati dedicate: HCV sequence database

63 63 Banche dati dedicate: HCV sequence database

64 64 Banche dati dedicate: HCV sequence database

65 65 Banche dati dedicate: geno2pheno

66 66

67 Applicazioni: la nostra esperienza Individuazione delle regioni da sequenziare (campione di partenza) Ricerca di una library (database) Definizione del flusso di lavoro Messa a punto e validazione Controlli di qualità Introduzione nella pratica giornaliera 67

68 Applicazioni: la nostra esperienza Determinazione dei differenti genotipi (1-3%) e sottotipi (0.5-1%) virali per HCV (NS5B) Determinazione dei differenti genotipi virali per HBV e individuazione del genotipo resistente a Lamivudina, Adefovir, e/o Entecavir (Tenofovir, Telbivudina)(pol) Identificazioni batteriche (16SrDNA) Identificazioni micobatteri per la speciazione all interno del MTC (gyrb) e definizione delle resistenze alla rifampicina (RNApolβ: rpo/tb) Identificazione dei miceti (ITS) Tipizzazione Enterovirus (5 UTR) Sorveglianza epidemiologica dell influenza (emoagglutinina) Sorveglianza epidemiologica Clostridium difficile (proteina C)

69 Micobatteri OBIETTIVI: 1) rapida distinzione, nell ambito del MTC, tra M. tuberculosis, M. bovis (intrinsecamente resistente alla pirazinamide, farmaco di dimostrata epatotossicità), M. africanum, M. microti; 2) rapida identificazione dei ceppi resistenti alla rifampicina, più diffusi nei pazienti stranieri, ma rilevati anche negli autoctoni. PUNTO DI PARTENZA: 1) le metodiche molecolari in uso (Innolipa) differenziano bene i MOTT, ma non sono in grado di distinguere all interno dell MTC; 2) l esecuzione dell antibiogramma (metodo di riferimento) richiede in media 20 gg.

70 Individuazione della regione: gyrb (no 16SrDNA, no ITS) 70

71 71 Database gyrb

72 S E Q U E N C I N G - A N A L Y S I S

73 Ridom 73

74 74 Ridom

75 75 IL SEQUENZIAMENTO GENICO NELLA PRATICA DEL LABORATORIO DI MICROBIOLOGIA e VIROLOGIA: L ESPERIENZA DEL COMPRENSORIO SANITARIO di BOLZANO e perché non Blast?

76 IL SEQUENZIAMENTO GENICO NELLA PRATICA DEL LABORATORIO DI MICROBIOLOGIA e VIROLOGIA: L ESPERIENZA DEL COMPRENSORIO SANITARIO di BOLZANO Limiti 76

77 Il nostro protocollo/flusso di lavoro Coltura positiva MOTT Innolipa MTC SEQ Rif-RES?

78 Messa a punto e validazione Prof. Proedinger; Division of Hygiene and Medical Microbiology, Department of Hygiene, Microbiology and Social Medicine, Innsbruck Medical University, Innsbruck, Austria. : MIRU genotyping (mycobacterial interspersed repetitive units) 78

79 79 Genotipizzazione HBV: individuazione della regione

80 Primers e condizioni d amplificazione reagente per 1 campione per campioni SYBR GREEN MasterMix primermix(hbpr256+ KL14;10pmol/ µl) 10 µl 2 µl Volume intermedio 12µl DNA estratto (easy mag) 9µl Volume finale 21µl 80

81 Datbase 60 genotipi 81

82 Esempio (ridom) HBV genotipo D Conferma Prof. Norder/Dr.ssa Crovatto 82

83 83

84 BIOLOGIA MOLECOLARE e VIROLOGIA Chiara Cemin Dr.ssa Federica Folli Adriana Giacomozzi Valentina Pasquetto Valentina Poletta Silvia Ruggeri 84

85 85 Domande??????

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Tecniche di sequenziamento del DNA

Tecniche di sequenziamento del DNA Tecniche di sequenziamento del DNA -Metodo di Maxam e Gilbert (della degradazione chimica del DNA) -Metodo di Sanger (a terminazione di catena) Metodo di Maxam-Gilbert Questo metodo, basato sulla degradazione

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Il tecnico di laboratorio biomedico: Applicazioni nel laboratorio di anatomia patologica

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA.

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA. ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE Margherita Vinciguerra U.O. Ematologia II Laboratorio per lo Studio e la Diagnosi Molecolare Prenatale di Talassemia A.O. V. Cervello, Palermo. Analisi di sequenza

Dettagli

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Un nuovo approccio: la VEQ in biologia molecolare

Un nuovo approccio: la VEQ in biologia molecolare Un nuovo approccio: la VEQ in biologia molecolare Il crescente interesse nella biologia molecolare applicata alla diagnostica è il risultato dei profondi progressi ottenuti nelle conoscenze scientifiche

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction)

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Elettroforesi degli acidi nucleici

Elettroforesi degli acidi nucleici Elettroforesi degli acidi nucleici Una volta che i frammenti del DNA o del RNA da analizzare sono stati amplificati con la reazione PCR è necessario separarli ed identificarli. A tale scopo si utilizza

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale

Dettagli

SPECIFICHE TECNICHE. LOTTO 1 Applicazioni di biologia molecolare per la diagnostica della Sepsi.

SPECIFICHE TECNICHE. LOTTO 1 Applicazioni di biologia molecolare per la diagnostica della Sepsi. 1 ALLEGATO A) SPECIFICHE TECNICHE LOTTO 1 Applicazioni di biologia molecolare per la diagnostica della Sepsi. Il sistema deve essere costituito da idonea strumentazione nuova di fabbrica, gruppo di continuità

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno).

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Programma: Giorno 1Preparazione di DNA genomico da foglie 2 - Controllo qualità DNA

Dettagli

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Moria del pero (Candidatus Phytoplasma pyri) Fitoplasmi: Microrganismi

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche I T A L B I O F O R M A i n c o l l a b o r a z i o n e c o n O R D I N E N A Z I O N A L E D E I B I O L O G I o r g a n i z z a i l c o r s o d i a g g i o r n a m e n t o BIOLOGIA MOLECOLARE: introduzione

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test U.O.C. di Epatologia Clinica e Biomolecolare Lotto N. DESCRIZIONE PRODOTTO Quantità annua richiesta Unità di misura Repertorio CND Codice Prodotto, Confezione Offerta e nome commerciale Prezzo unitario

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Tecniche di biologia molecolare

Tecniche di biologia molecolare Tecniche di biologia molecolare Obiettivi dello studio: conoscere i principi base delle tecnologie e le possibili applicazioni Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti Sensibilità:

Dettagli

PROGETTO BIOFORM. Tipizzazione del gene PV92

PROGETTO BIOFORM. Tipizzazione del gene PV92 Ci fu un tempo in cui per amplificare il DNA, dovevi crescere tonnellate e tonnellate di piccole cellule. Poi è arrivato un ragazzo di nome Dr. Kary Mullis, Ha detto che si può amplificare in vitro altrettanto

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica

Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica Biologia molecolare clinica Organizzazione del laboratorio di biologia molecolare clinica Le tecniche di biologia molecolare negli ultimi anni si sono diffuse nei laboratori di diagnostica clinica dove

Dettagli

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del

Dettagli

Analisi mutazionale di K-RAS metodiche a confronto

Analisi mutazionale di K-RAS metodiche a confronto Analisi mutazionale di K-RAS metodiche a confronto Aula Magna Villa Sironi Gallarate 16 ottobre Dott. Carmelo Lupo Coordinatore Tecnico Anatomia Patologica e Patologia Molecolare Oncologica PERCHÉ K-RAS

Dettagli

Preparazione dei campioni da inviare per il sequenziamento

Preparazione dei campioni da inviare per il sequenziamento Preparazione dei campioni da inviare per il sequenziamento PCR preparativa Buffer 10x dntp 2mM Taq polimerasi Oligonucleotidi up e down 100 ng/ul Volume finale 2 ul/campione 2 ul/campione 0,5 U/campione

Dettagli

Genotipizzazione virale

Genotipizzazione virale Genotipizzazione virale Typing Separazione basata su maggiori differenze genetiche tra i membri di una singola specie virale Subtyping Individuazione di differenze stabili all interno di un gruppo di virus

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

PROGETTO BIOFORM. Tipizzazione del locus PV92

PROGETTO BIOFORM. Tipizzazione del locus PV92 Ci fu un tempo in cui per amplificare il DNA, dovevi crescere tonnellate e tonnellate di piccole celle. Poi è arrivato un ragazzo di nome Dr. Kary Mullis, Ha detto che si può amplificare in vitro altrettanto

Dettagli

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING DALL ESTRAZIONE DEL DNA AL FINGERPRINTING SCOPO DELL'ATTIVITÀ Ciascuno studente estrae il proprio DNA da cellule della mucosa boccale. Quindi, mediante PCR, vengono amplificati frammenti corrispondenti

Dettagli

AREA GESTIONE PATRIMONIO DETERMINAZIONE

AREA GESTIONE PATRIMONIO DETERMINAZIONE ISTITUTO TUMORI GIOVANNI PAOLO II ISTITUTO DI RICOVERO E CURA A CARATTERE SCIENTIFICO BARI AREA GESTIONE PATRIMONIO DETERMINAZIONE Raccolta Particolare Raccolta Generale delle Determinazioni dell Area

Dettagli

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010 Percorso nº 3: Clonaggio di segmenti di DNA 11-5-2010 I plasmidi: un mondo da esplorare. Elementi genetici capaci di replicarsi autonomamente

Dettagli

La PCR e le sue applicazioni. La PCR di base L RT-PCR Applicazioni mediche e forensi

La PCR e le sue applicazioni. La PCR di base L RT-PCR Applicazioni mediche e forensi La PCR e le sue applicazioni La PCR di base L RT-PCR Applicazioni mediche e forensi Polymerase Chain Reaction e sue applicazioni La polymerase chain reaction o PCR è una tecnica relativamente recente che

Dettagli

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza

Dettagli

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA Sequenziamento del DNA Preparazione di librerie Library di cdna e di DNA genomico Analisi di librerie Sequenziamento del DNA 1) Metodo di Maxam&Gilbert (taglio chimico): il DNA viene marcato ad un estremità

Dettagli

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail: orgabiohuman@fastwebnet.it

Dettagli

ELETTROFORESI SU GEL

ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi

Dettagli

LA RIASSOCIAZIONE MOLECOLARE DNA/DNA

LA RIASSOCIAZIONE MOLECOLARE DNA/DNA LA RIASSOCIAZIONE MOLECOLARE DNA/DNA Il grado di riassociazione o ibridazione molecolare DNA/DNA rappresenta uno dei cardini su cui si basa la definizione di specie batterica. Allo scopo ricordiamo cosa

Dettagli

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA

Dettagli

Il sequenziamento del DNA

Il sequenziamento del DNA Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile

Dettagli

Capitolo 1 Introduzione alla PCR

Capitolo 1 Introduzione alla PCR Capitolo 1 Introduzione alla PCR La tecnologia della PCR ha rivoluzionato l attività dei laboratori di ricerca e di diagnostica trovando applicazioni ed impieghi in svariati campi della medicina e della

Dettagli

Determinazione dei microrganismi negli alimen1 Argomen( e obbie(vi

Determinazione dei microrganismi negli alimen1 Argomen( e obbie(vi Determinazione dei microrganismi negli alimen1 Argomen( e obbie(vi Necessità e problema0che nella determinazione dei microrganismi negli alimen0 Metodologie alterna0ve Principi - vantaggi e svantaggi applicazioni

Dettagli

12-05-2010 ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI

12-05-2010 ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI Il primo passaggio per la maggior parte delle procedure che verranno trattate in questo corso consiste nell estrazione del DNA (e dell RNA) da materiale biologico, e nella sua purificazione mediante separazione

Dettagli

Azienda Ospedaliero-Universitaria Policlinico - Vittorio Emanuele Catania

Azienda Ospedaliero-Universitaria Policlinico - Vittorio Emanuele Catania Azienda Ospedaliero-Universitaria Policlinico - Vittorio Emanuele Catania Settore: Provveditorato ed Economato - tel. 095/7435769 fax 095/37844 Oggetto: Procedura negoziata per la fornitura di diagnostici

Dettagli

PURIFICAZIONE DI DNA

PURIFICAZIONE DI DNA PURIFICAZIONE DI DNA Esistono diverse metodiche per la purificazione di DNA da cellule microbiche, più o meno complesse secondo il grado di purezza e d integrità che si desidera ottenere. In tutti i casi

Dettagli

Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (www.cusmibio.unimi.it).

Dettagli

Biotecnologie e bonifica ambientale

Biotecnologie e bonifica ambientale Biotecnologie e bonifica ambientale Prof. Laura Martinis Liceo Scientifico G. Marinelli Prof. Massimo Vischi e Luca Marchiol - Facoltà di Scienze Agrarie dell Università di Udine Cl. III B Noi studenti

Dettagli

AZIENDA OSPEDALIERA UNIVERSITARIA INTEGRATA - VERONA

AZIENDA OSPEDALIERA UNIVERSITARIA INTEGRATA - VERONA Pag.. 1 AZIENDA OSPEDALIERA UNIVERSITARIA INTEGRATA - FORNITURA QUINQUENNALE IN SOMMINISTRAZIONE, SUDDIVISA IN LOTTI, DI SISTEMI PER LA DIAGNOSTICA DELLE INFEZIONI DA HBV, HCV E ALTRI MICRORGANISMI IN

Dettagli

Controllo ufficiale degli OGM nel settore agroalimentare

Controllo ufficiale degli OGM nel settore agroalimentare Controllo ufficiale degli OGM nel settore agroalimentare Ugo Marchesi Istituto Zooprofilattico Sperimentale Lazio e Toscana Centro di Referenza Nazionale per la ricerca di OGM ugo.marchesi@izslt.it ORGANISMI

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello

Dettagli