GENI GENOMI e GENOMICA

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "GENI GENOMI e GENOMICA"

Transcript

1 GENI GENOMI e GENOMICA

2 L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza dello sviluppo e completamento dei vari progetto-genoma che si sono proposti, come fine ultimo il completo sequenziamento del genoma umano, oltre che di alcuni organismi di importanza strategica

3 I vari progetti che sono stati varati per mappare e sequenziare gli interi genomi dell uomo e di altri organismi aprono prospettive di ricerca entusiasmanti I dati di mappatura e di sequenziamento stanno producendo, ed in molti casi hanno prodotto, una ricchissima messe di nuove conoscenze sui processi biologici

4 Questo approccio e particolarmente fruttuoso quando la comparazione di sequenze fra specie differenti consente di individuare quelle che sono evolutivamente conservate, e che e probabile codifichino proteine funzionalmente importanti Questa e una delle ragioni per cui sono oggetto di intenso studio anche i genomi di specie diverse dall uomo

5

6 I Genomi Eucariotici NCBI: 895 Eukaryotic Genome Sequencing Projects: Complete 37 Assembly 350 In Progress 508 Complete Published Genome Projects: 1395 Archaeal: 94 Bacterial: 1168 Eukaryal: 133

7 La scelta dei genomi da sequenziare è dettata da vari criteri: Organismi modello - facilità di manipolazione (lievito, Drosophila, C. elegans, Ciona, Danio) - modelli di studio per malattie umane (scimpanzé, topo, ratto) Specie parassite e patogene di interesse per la salute/ economia umana - Identificazione di marcatori molecolari utili per la diagnosi della patologia o per identificare target per la messa a punto di nuovi farmaci (es. Plasmodium, tripanosomi, etc.) Organismi filogeneticamente interessanti - Organismi chiave per comprendere la storia evolutiva di un gruppo tassonomico (es. anfiosso, Ciona) Proprietà intrinseche del genoma - genoma relativamente piccolo rispetto ad altri organismi evolutivamente vicini, come per Arabidopsis thaliana e Fugu rubripes)

8 I Genomi Eucariotici Distribuzione filogenetica dei progetti genomici nei Metazoi amphioxus

9 DI COSA SI OCCUPA LA GENOMICA? In particolare si occupa della struttura, contenuto, funzione ed evoluzione del genoma. È una scienza che si basa sulla bioinformatica per l'elaborazione e la visualizzazione dell'enorme quantità di dati che produce.

10 GENOMICA La data di nascita si fa coincidere con il sequenziamento completo del primo genoma, nel 1980: si trattava del genoma di un virus, il fago Φ-X174. Il primo sequenziamento del genoma di un organismo vero e proprio fu completato nel 1995 e si trattava di un batterio, Hemophilus influenzae, con un genoma di notevoli dimensioni (1,8 milioni di paia di basi. Da allora i genomi "completati" aumentano esponenzialmente

11 Obiettivi della genomica mappe genetiche e fisiche del DNA degli organismi viventi, mediante il suo completo sequenziamento. La sequenza del DNA viene poi annotata, ovvero vengono identificati e segnalati tutti i geni e le altre porzioni di sequenza significative, insieme a tutte le informazioni conosciute su tali geni. Inserimento delle informazioni in appositi database, accessibili via Internet (gratuitamente). genomica comparativa, che si occupa del confronto tra i genomi di diversi organismi, nella loro organizzazione e sequenza.

12 Esempio di output

13 La genomica è stata affiancata più recentemente da nuove branche della biologia ad essa affini per modalità di approccio alla ricerca:

14 Lista di "-oma" Di seguito sono riportati i più importanti "-oma" proposti recentemente all'interno della comunità scientifica Il trascrittoma è l'insieme degli mrna trascritti nell'intero organismo, tessuto, cellula >> trascrittomica Il metaboloma comprende la totalità dei metaboliti presenti in un organismo >> metabolomica Il metalloma comprende la totalità delle specie di metalli e metalloidi >> metallomica Il lipidoma comprende la totalità dei lipidi >> lipidomica L' interattoma comprende la totalità delle interazioni molecolari che hanno luogo in un organismo; un nome che comunemente indica la disciplina della interattomica è quello di biologia dei sistemi (systems biology) Lo spliceoma (da non confondersi con lo spliceosoma, il complesso di proteine ed acidi nucleici coinvolti nello splicing) comprende la totalità delle isoforme proteiche dovute a splicing alternativo >> spliceomica L' ORFeoma comprende la totalità delle sequenze di DNA che iniziano con un codone ATG e terminano con un codone di stop (sequenze note come ORF, open reading frames) >> ORFeomica Kinoma: l'insieme delle protein chinasi (dall'inglese kinase) di una cellula >> kinomica Glicosiloma: correlato alle reazioni di glicosilazione >> glicosilomica) Fisioma: correlato alla fisiologia >> fisiomica) Neuroma: l'insieme delle componenti nervose di un organismo >> neuromica) Predittoma: l'insieme delle predizioni di struttura proteica Reattoma: l'insieme dei processi biologici

15 Organizzazione del genoma umano GENOMA UMANO Genoma nucleare geni 30% 70% Geni e sequenze DNA annesse Intergenico Unico o moderatamente ripetuto 10% 90% DNA DNA codificante non codificante due geni per rrna Genoma mitocondriale 16.6 kb 37 geni 22 geni per trna 13 geni codificanti proteine 80% 20% Unico o basso Moderatamente numero di copie o altamente ripetuto Pseudogeni frammenti genici Introni, UTR Tandem repeats Repeats interspersi

16 Organizzazione del genoma umano Genoma nucleare 3200Mb Geni e sequenze annesse 1200Mb DNA Intergenico 2000Mb Geni 48Mb Sequenze correlate 1152Mb Ripetizioni Intersperse 1400Mb Altre regioni intersperse 600Mb Pseudogeni frammenti genici Introni, UTR Microsatelliti 90Mb Varie 510Mb LINE 640Mb Elementi LTR 250Mb SINE 420Mb Trasposoni a DNA 90b

17 Cosa e un gene?

18 Che cosa è un GENE L avvento dell era genomica ha messo in crisi la tradizionale definizione di GENE, tuttora molto dibattuta. Lewin B. Il Gene VIII Segmento di DNA coinvolto nella produzione di una catena polipeptidica, comprende regioni (leader e coda) che precedono e seguono la regione codificante, oltre alle sequenze intercalate (introni) tra i singoli elementi codificanti (esoni). Brown T.A. Genomi 2 Un segmento di DNA contenente informazioni biologiche, che codifica per una molecola di RNA e/o proteina. Ovviamente, se non ci si accorda sulla definizione di gene, non è possibile determinarne il numero, anche assumendo di disporre della annotazione completa del genoma.

19 Un gene e una sequenza di DNA che specifica le informazioni richieste dalla cellula per fare uno specifico prodotto. La sequenza di DNA di un gene specifica inoltre quando, quanto ed in che tipo di cellule il prodotto deve essere fatto.

20 intron intron Enhancer Promoter Exon 1 Exon 2 Exon 3 Transcription termination

21

22 Promoters Elements Core promoter Proximal promoter Distal promoter (Enhancer) CORE PROMOTER posizionato PROM. PROSSIMALE regione sufficiente a deteminare il TSS esatto; approssimativamente a - 35 dal TTS; sito di legame dei GTF bp upstream al TSS; sito di legame di TF specifici; responsabile, almeno in parte, della modulazione della espressione PROMOTORE DISTALE 100 bp 2 Mb; sito di legame di TF specifici

23 Definizione di GENE Per giungere ad una definizione il più possibile corretta di GENE è necessario conoscerne le caratteristiche principali. Un gene può utilizzare diversi promotori La trascrizione di un gene si può arrestare in corrispondenza di diversi terminatori I trascritti espressi da un gene possono subire splicing alternativo che generano trascritti che differiscono sia nelle regioni non tradotte (5 e 3 UTR) che nella regione codificante

24 I geni possono essere sovrapposti I geni possono essere sovrapposti tra loro, nello stesso orientamento o in orientamento opposto, o anche essere completamente contenuti in altri geni. L introne 26 del gene neurofibromatosis type I (NF1) contiene 3 geni diversi nell orientamento opposto (OMGP, EVI2A, EVI2B).

25 I Genomi degli Eucarioti:Compattezza I genomi degli eucarioti hanno una densità genica molto variabile. Nei genomi dei procarioti unicellulari, che sono di dimensioni ridotte, la densità genica è molto alta e ricorda quella dei genomi procariotici. In figura è rappresentato un segmento del genoma di lievito che presenta 26 geni + 2 trna. I suoi geni sono molto poveri di introni e di elementi ripetuti (3,4% del genoma)

26 I Genomi degli Eucarioti:Compattezza I genomi degli eucarioti più complessi hanno genomi meno compatti. In Drosophila, che presenta un organismo più complesso del lievito ma meno dei mammiferi, presenta una densità genica intermedia tra queste. Nel segmento corrispondente troviamo meno geni (11) con più introni ed elementi ripetuti (12% del genoma).

27 I Genomi degli Eucarioti:Compattezza I genomi dei mammiferi, e l uomo ne è un tipico esempio, eucarioti hanno una densità genica molto ridotta. In media, i geni codificanti per proteine occupano solo il 1-3% dell intero genoma. La scarsa compattezza del genoma nucleare è dovuta alla struttura discontinua dei geni, con introni che nei mammiferi possono raggiungere dimensioni intorno a kpb (ed oltre) e alla presenza di elementi ripetuti (44% del genoma). I geni eucariotici sono monocistronici, tuttavia strutture simili agli operoni batterici sono state descritte in C. elegans.

28

29

30

31

32 I Genomi degli Eucarioti:Compattezza Nelle piante infine troviamo delle situazioni ancora più spinte verso la diminuzione della compattezza

33 Assenza di correlazione tra numero di geni e dimensione del genoma negli eucarioti Gene number Genome s ize (M b) human mous e c hic ken xenopus zebrafis h fugu c iona fly worm yeas t

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare

Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare Insegnamento di Genomica Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare docenti: Silvia Fuselli (fss@unife.it) Vincenza Colonna Inga Prokopenko Morena

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

Dimensioni dei Genomi Eucariotici

Dimensioni dei Genomi Eucariotici Dimensioni dei Genomi Eucariotici plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide.

In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. Lodish et al. Molecular Cell Biology In molecular terms,

Dettagli

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente)

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente) Come si ferma una macchina in corsa? Il terminatore Terminazione intrinseca (rho-indipendente) Terminazione dipendente dal fattore Rho (r) 1 Operoni: gruppi di geni parte di una unica unità trascrizionale

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a. 2014-2015 Università di Catania La stru(ura del gene Stefano Forte I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Seconda Università di Napoli II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Gruppo di studio La Sbobba A cura di dodo e Ely24e 1) Introduzione alla Genetica Medica Pag. 2

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

ISTITUTO D ISTRUZIONE SUPERIORE ISTITUTO TECNICO ECONOMICO STATALE. Roberto Valturio RELAZIONE FINALE E PROGRAMMA SVOLTO. a.s.

ISTITUTO D ISTRUZIONE SUPERIORE ISTITUTO TECNICO ECONOMICO STATALE. Roberto Valturio RELAZIONE FINALE E PROGRAMMA SVOLTO. a.s. ISTITUTO D ISTRUZIONE SUPERIORE ISTITUTO TECNICO ECONOMICO STATALE Roberto Valturio RELAZIONE FINALE E PROGRAMMA SVOLTO a.s. 2O13-2014 Materia : Chimica e Biologia Classe : II sez. B Rimini,05/06/2014

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

Mappe fisiche. Si basano sulla localizzazione fisica delle molecole di DNA

Mappe fisiche. Si basano sulla localizzazione fisica delle molecole di DNA Mappe fisiche Si basano sulla localizzazione fisica delle molecole di DNA Costruzione di una mappa fisica diversi metodi - Mappe a bassa risoluzione - Mappe ad alta risoluzione Risoluzione= distanza a

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

Trascrizione negli eucarioti

Trascrizione negli eucarioti Trascrizione negli eucarioti TRASCRIZIONE EUCARIOTI Fattori di trascrizione fattori basali, attivatori (costitutivi, non costitutivi), co-attivatori, repressori Enhancer Promotore 100bp 200bp Enhancer:

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

L utilizzo dell approccio integrato è applicato in particolare per l identificazione di:

L utilizzo dell approccio integrato è applicato in particolare per l identificazione di: Lo ZooPlantLab, nasce all inizio del 2007, dall incontro di due ricercatori del Dipartimento di Biotecnologie e Bioscienze dell Università degli Studi di Milano Bicocca, Massimo Labra e Maurizio Casiraghi.

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

IL DOGMA CENTRALE DELLA BIOLOGIA RNA

IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena

Dettagli