Biotecnologie Mediche. Cinzia Di Pietro

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/"

Transcript

1 Biotecnologie Mediche Cinzia Di Pietro

2

3

4

5

6 Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo

7 Biotecnologie Mediche Prevenzione Diagnostica - Terapia

8

9 Prevenzione Ambiente e Genoma EPIGENETICA micrornas

10 A mio parere, il più grave errore che ho commesso è non aver dato sufficiente peso all azione diretta dell ambiente: il nutrimento, il clima, e così via, indipendentemente dalla selezione naturale Quando scrissi l Origine delle Specie, e per molti anni a seguire, non trovai che scarsissime prove dell azione diretta dell ambiente; ora invece sono numerose (Darwin, 1888)

11 Prevenzione

12

13 Prevenzione Comprendere le basi molecolari dei fattori di rischio Ricerca di mutazioni germinali di geni oncosoppressori nella prevenzione dei tumori; Studio di SNPs (Single Nucleotide Polymorphisms)

14

15 Differente predisposizione a determinate patologie

16 Differente risposta a specifiche terapie Tratta da lezioni di genetica Prof. PF Pignatti

17 Differente risposta a specifiche terapie

18

19 Diagnosi Screening degli eterozigoti; Diagnosi Prenatale; Diagnosi Preimpianto; Diagnosi Neonatale; Diagnosi precoce di tumori; Valutazione della malattia minima residua

20 Malattie ad eredità Mendeliana

21

22

23 Terapie Prodotti ottenuti con l impiego di biotecnologie: ormoni, fattori di crescita, vaccini, anticorpi monoclonali, terapie cellulari.

24 QUALI SONO LE APPLICAZIONI DELLE BIOTECNOLOGIE IN MEDICINA Le biotecnologie applicate in medicina servono ad esempio per: fabbricare medicine quali l'insulina che serve per curare le persone affette da diabete, l'ormone della crescita o somatotropina che serve per curare alcune forme di nanismo, e l'eritropoietina che serve nei casi di anemia produrre gli interferoni che servono per combattere virus, per far regredire tumori produrre gli antibiotici su scala industriale per difenderci dai batteri produrre vaccini per esempio per difenderci dal virus dell'epatite B o dalla Bordetella pertussis, batterio responsabile della pertosse individuare malattie infettive o genetiche in periodo prenatale e curare alcune malattie genetiche attraverso la terapia genica.

25 Le ricerche sono state condotte sul cetuximab, un anticorpo monoclonale utilizzato per il trattamento del cancro del colon-retto metastatico ed è stato individuato un gene (KRAS) che predice l'efficacia di questa molecola sul paziente. I risultati mostrano che il cetuximab funziona meglio nei pazienti che non presentano mutazioni in questo marcatore. Questa scoperta è un altro decisivo passo avanti verso la messa a punto di terapie sempre più mirate e su misura per il paziente.

26 26

27 27

28 Spinal muscular atrophy refers to a group of autosomal recessive neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMA is the second most common lethal, autosomal recessive disease in Caucasians after cystic fibrosis(wirth, 2000). Potential applications of ipscs. spinal muscular atrophy type I (SMA I) is caused by mutation or deletion in the copy of the SMN gene, known as SMN1 Stadtfeld M, Hochedlinger K Genes Dev. 2010;24: by Cold Spring Harbor Laboratory Press

29 La scoperta della doppia elica mezzo secolo fa ha coinvolto la pratica medica con lentezza, ma sono probabili trasformazioni significative nei prossimi 50 anni. Bisogna cambiare la pratica medica e la formazione dei medici per poter realizzare i potenziali benefici Bell, Nature 421: 414, 2003 Tratta da lezioni di genetica Prof. PF Pignatti

30 Human Genome Project GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGGAGCTGAGGA GCGGGGCCCGGCCAGGGCTGGAGACTTTGCGCCCGGGGGCACCGGGGCTGCGCGCGGTCGCACACATCCACCGGC GCGGCTTCCCTCGGCGGCCCGGGCTCCGCTCATCCTGCGGCGGGCGGCGCCGCTCAGGGGCGGGAAGAGGAGGCG GTAGACGCGACCACAGAAGATGTCGGGCCAAACGCTCACGGATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCT CTGCTGTAGCAAGAGCGGTCTGCAAAGCCACTACTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGAT CCAGGCTACCAACGAGACCAATGTTAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGG GTGGTTGTGTTTAAGGCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTC TAGAAATACACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAAGGCG CTATAGTAGATATTTGAATGAAAAGGCTTTTTCTTACAGACAGATGGCCTTTGATTTTGCCAGGGTGAAGAAAGGGGCC GATGGTGTAATGAGGACAATGGCTCCCGAAAAGCTGCTAAAGAGTATGCCAATACTACAGGGACAAATTGATGCACTGC TTGAATTTGATGTGCATCCAAATGAACTAACAAATGGTGTCATAAATGCAGCATTTATGCTTCTTTTCAAAGATCTTATCA AACTTTTTGCTTGCTACAATGATGGTGTTATTAACTTACTCGAAAAGTTTTTTGAAATGAAGAAAGGACAATGTAAAGATG CTCTAGAAATTTACAAACGATTTCTAACTAGAATGACACGAGTGTCTGAATTTCTCAAGGTTGCAGAGCAAGTTGGTATT GATAAAGGTGACATTCCTGACCTCACACAGGCTCCCAGCAGTCTTATGGAGACGCTTGAACAGCATCTAAATACATTAG AAGGAAAGAAACCTGGAAACAATGAAGGATCTGGTGCTCCCTCTCCATTAAGTAAGTCTTCTCCAGCCACAACTGTTAC GTCTCCTAATTCTACACCAGCTAAAACTATTGACACATCCCCACCGGTTGATTTATTTGCAACTGCATCTGCGGCTGTCC 15 February 2001 CAGTCAGCACTTCTAAACCATCTAGTGATCTCCTGGACCTCCAGCCAGACTTTTCCTCTGGAGGGGCAGCAGCAGCCG CAGCACCAGCACCACCACCACCTGCTGGAGGAGCCACTGCATGGGGAGACCTTTTGGGAGAGGATTCTTTGGCTGCA CTTTCCTCTGTTCCCTCTGAAGCACAGATTTCAGATCCATTTGCACCAGAACCTACCCCTCCTACTACAACTGCTGAAAT TGCAACCACTACTGCTGCCACCGCCGCTGCCACCACCACTACCATTCATCTCTTGCCAGCTTAGTAGGCAATCTTGGAA TTTCTGGTACCACAACAAAAAAGGGAGATCTTCAGTGGAATGCTGGAGAGAAAAAGTTGACTGGTGGAGCCAACTGGC AGCCTAAAGTAGCTCCAGCAACCTGGTCAGCAGGCGTTCCACCAAGTGCACCTTTGCAAGGAGCTGTACCTCCAACCA GTTCAGTTCCTCCTGTTGCCGGGGCCCCATCGGTTGGACAACCTGGAGCAGGATTTGGAATGCCTCCTGCTGGGACAG GCATGCCCATGATGCCTCAGCAGCCGGTCATGTTTGCACAGCCCATGATGAGGCCCCCCTTTGGAGCTGCCGCTGTAC CTGGCACGCAGCTTTCTCCAAGCCCTACACCTGCCAGTCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGG ATCTTAACATCAAGGATTTCTTGTAAACAATTTAAGCTGCAATATTTGTGACTGAATAGGAAAATAAATGAGTTTGGAGAC TTCAAATAAGATTGATGCTGAGTTTCAAAGGGAGCCACCAGTACCAAACCCAATACTTACTCATAACTTCTCTTCCAAAAT GTGTAACACAGCCGTGAAAGTGAACATTAGGAATATGTACTACCTTAGCTGTTATCCCTACTCTTGAAATTGTAGTGTAT TTGGATTATTTGTGTATTGTACGATGTAAACAATGAATGGATGTTACTGATGCCGTTAGTGCTTTTTTGGACTTCACCTGA GGACAGATGATGCAGCTGTTGTGTGGCGAGCTATTTGGAAAGACGTCTGTGTTTTTGAAGGTTTCAATGTACATATAAC TTTTGAACAAACCCCAAACTCTTCCCATAAATTATCTTTTCTTCTGTATCTCTGTTACAAGCGTAGTGTGATAATACCAGA TAATAAGGAAAACACTCATAAATATACAAAACTTTTTCAGTGTGGAGTACATTTTTCCAATCACAGGAACTTCAACTGTTG TGAGAAATGTTTATTTTTGTGGCACTGTATATGTTAAGAAATTTTATTTTAAAAAATATAAAGGTTAACGTCCATAATAAAT ACTTCTCTTTGAAGCTACCTTATCAAGAACGAAAAATCGTATGGGAAGAATCCCCTATTTATCACTGCTATATTAAAATAT ATATATTTTAATTATATTTGACAGGTTTTGCATCTAAATTGACCTATTTATTCATTCTTGATTAAATGCACTGAAAAGTAAAA TTTAAAAGTGGTTGTATCTGAATTTACTGTGGGGATAACATACACTGTAATGGGGAAAAATTACCTAAAACCAATTTCAAA ATGGCTTTCTTTGTATTTCAGTTTAAAAACCCAGTGCATGTACGCCCTCTGAGATGCAATAAACACCTTGAACAAAG

31 Le malattie genetiche. Dalle malattie monogeniche ai fenotipi complessi. Metodi di Analisi degli acidi nucleici estrazione di DNA RNA sonde molecolari e ibridazione PCR, RT-PCR, Real Time PCR disegno di primers per PCR utilizzando software disponibili online. Metodi per l identificazione di mutazioni geniche Analisi specifica di mutazioni note Ricerca aspecifica di mutazioni Metodi High Throughput per l analisi del Genoma, del Trascrittoma, del Proteoma, dell Interattoma.

32 Testi Fonti bibliografiche Strachan e Read Genetica umana molecolare Zanichelli

Biotecnologie Mediche. Cinzia Di Pietro

Biotecnologie Mediche. Cinzia Di Pietro Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Human Genome Project GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGGAGCTGAGGA

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Researchers C Di Pietro Slides http://www.bgbunict.it/ Researchers C Di Pietro Articoli Studenti COSA SONO LE

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Variazioni del genoma possono determinare:

Variazioni del genoma possono determinare: Variazioni del genoma possono determinare: Insorgenza di malattie genetiche Differente predisposizione a determinate patologie Differente risposta a specifiche terapie Differente risposta a stress ambientali,

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010 PLASMIDI puc ALTRI TIPI DI VETTORI VETTORI λ (15-20 Kb) = vettori ottenuti apportando delle modifiche al genoma del batteriofago λ. COSMIDI (40-45 Kb) = plasmidi che contengono i siti cos di λ utili per

Dettagli

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Watson & Crick DNA 1953 Tappe della GENETICA UMANA G. Mendel leggi dell

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE?

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? SCREENING NEONATALE GENETICO RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? Pietro Chiurazzi Istituto di Genetica Medica Facoltà di Medicina e Chirurgia Università Cattolica Associazione Culturale Giuseppe

Dettagli

Verbale n. 3: Discussione dei titoli e delle pubblicazioni scientifiche

Verbale n. 3: Discussione dei titoli e delle pubblicazioni scientifiche Verbale n. 3: Discussione dei titoli e delle pubblicazioni scientifiche Il giorno 24.10.2011 alle ore 11,00, presso la sede dell Università degli Studi Parthenope di Napoli, in Via Acton 38, si riunisce

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

Screening dei soggetti a rischio e diagnostica molecolare

Screening dei soggetti a rischio e diagnostica molecolare Screening dei soggetti a rischio e diagnostica molecolare Daniela Furlan U.O. Anatomia Patologica Varese, 3 luglio 2012 Il carcinoma pancreatico Patogenesi Suscettibilità genetica Implicazioni diagnostiche

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY) http://www.molecularstation.com/molecular-biology-images/data/502/human-genome-gene.png

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

DNA RICOMBINANTE E BIOTECNOLOGIE

DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi

Dettagli

La prevenzione: un piano regionale per la Puglia. Perché?

La prevenzione: un piano regionale per la Puglia. Perché? La prevenzione: un piano regionale per la Puglia. Perché? Rita Fischetto Referente Genetica Clinica U.O.C. Malattie Metaboliche Diabetologia A.O.U. Policlinico-Giovanni XXIII Bari -CRESCITA CONOSCENZE

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica DSTB - Università degli Studi di Udine P.le Kolbe,1-33100 Udine - ITALIA

Dettagli

6 modulo didattico- Le malattie genetiche non mendeliane,

6 modulo didattico- Le malattie genetiche non mendeliane, 6 modulo didattico- Le malattie genetiche non mendeliane, diagnosi e terapia. CLASSIFICAZIONE DELLE MALATTIE GENETICHE Malattie monogeniche ( 1%) Autsomiche dominanti Autosomiche recessive Legate al sesso

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo A COSA SERVE il

Dettagli

Il supporto del Laboratorio Regionale nelle Emergenze Microbiologiche (CRREM)

Il supporto del Laboratorio Regionale nelle Emergenze Microbiologiche (CRREM) II Corso Nazionale Teorico Pratico Emergenze in Infettivologia Ferrara, 30 Settembre 2009 Il supporto del Laboratorio Regionale nelle Emergenze Microbiologiche (CRREM) Vittorio Sambri Laboratorio CRREM

Dettagli

7 domande sui tumori. Convivere con la malattia

7 domande sui tumori. Convivere con la malattia 1. 7 domande sui tumori 2. Convivere con la malattia Dott. Andrea Angelo Martoni Direttore Unità Operativa di Oncologia Medica Policlinico S.Orsola-Malpighi Bologna 1. Cosa sono i tumori? i tumori Malattia

Dettagli

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE EREDITA MENDELIANA CLASSICA ~ 600 E C M 10.000 Enzimi

Dettagli

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio

Dettagli

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica - Facoltà di Medicina e Chirurgia PUGD - Università degli Studi di Udine

Dettagli

Tecniche Periodo Esempi di diagnosi (in settimane) Invasive Amniocentesi 16 anomale cromosomiche,

Tecniche Periodo Esempi di diagnosi (in settimane) Invasive Amniocentesi 16 anomale cromosomiche, Tecniche Periodo Esempi di diagnosi (in settimane) Invasive Amniocentesi 16 anomale cromosomiche, parte cospuscolata malattie metab., difetti mol. parte non corpuscolata difetti del tubo neurale Villocentesi

Dettagli

Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra

Dettagli

Il tumore al colon è temuto ma è necessario continuare nell'attività di Prevenzione

Il tumore al colon è temuto ma è necessario continuare nell'attività di Prevenzione Il tumore al colon è temuto ma è necessario continuare nell'attività di Prevenzione Milano - Nonostante la sua aggressività è definito il tumore silenzioso. Data la sua scarsa pubblicizzazione, infatti,

Dettagli

ITIS ENRICO MEDI. Individuare l organizzazione strutturale, le funzioni e classificare i virus

ITIS ENRICO MEDI. Individuare l organizzazione strutturale, le funzioni e classificare i virus UDA UDA N. 1 I Virus UDA 2 Attività patogena dei microrganismi ITIS ENRICO MEDI PIANO DELLA DISCIPLINA: Biologia, Microbiologia e Tecnologie di controllo Ambientale Classe 4Ab PIANO DELLE UDA ANNO 2013-2014

Dettagli

Sperimenta il BIOLAB

Sperimenta il BIOLAB Sperimenta il BIOLAB I numeri del BIOLAB Il Maserati porta annualmente al CusMiBio circa 200 alunni dalla 2^ alla 5^ Liceo Scientifico tecnologico per fare 2-3 laboratori di Genetica, Citologia e Biologia

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

Espressione di geni specifici per un determinato tumore

Espressione di geni specifici per un determinato tumore Espressione di geni specifici per un determinato tumore Paziente A: Non ha il cancro Espressione dei geni: Nessuna Biopsia Geni associati al cancro allo stomaco Paziente B: Ha un tumore allo stomaco Bassa

Dettagli

www.biotecnologie.univaq.it FACOLTA DI BIOTECNOLOGIE Delegata all orientamento Prof. Anna Poma anna.poma@cc.univaq.it

www.biotecnologie.univaq.it FACOLTA DI BIOTECNOLOGIE Delegata all orientamento Prof. Anna Poma anna.poma@cc.univaq.it www.biotecnologie.univaq.it FACOLTA DI BIOTECNOLOGIE Delegata all orientamento Prof. Anna Poma anna.poma@cc.univaq.it Le Biotecnologie La fine del XX secolo ha conosciuto un incredibile sviluppo della

Dettagli

VIRTUALAB PON01_01297 PON01_01297

VIRTUALAB PON01_01297 PON01_01297 VIRTUALAB Sistemi Avanzati di Meccatronica Biomedicale di Diagnosi e Terapia Medica basati su Realtà Virtuale e Aumentata, Microelettronica, e su Laboratori robotizzati ad elevato throughput Soggetti proponenti

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA2013/14 Prof Alberto Turco Lezioni 57 e 58 11.12.2013 Test Genetici Storiche date. 1865 1859 1953.momenti memorabili dell impresa intellettuale e scientifica

Dettagli

LA DIAGNOSI PRENATALE : PRESENTE E FUTURO

LA DIAGNOSI PRENATALE : PRESENTE E FUTURO LA DIAGNOSI PRENATALE : PRESENTE E FUTURO LA CONSULENZA GENETICA PRENATALE Fare Dr. Renato clic per Scarinci modificare lo stile del sottotitolo dello schema GENETICA CLINICA Costituisce la parte applicativa

Dettagli

Immunodiagnostica e Diagnostica Molecolare attualità e prospettive. Prof.ssa Anna Onofri Liceo Scientifico «Iris Versari» Maggio 2015

Immunodiagnostica e Diagnostica Molecolare attualità e prospettive. Prof.ssa Anna Onofri Liceo Scientifico «Iris Versari» Maggio 2015 Immunodiagnostica e Diagnostica Molecolare attualità e prospettive Prof.ssa Anna Onofri Liceo Scientifico «Iris Versari» Maggio 2015 DATI INFORMAZIONE CONOSCENZA La Diagnostica di Laboratorio permette

Dettagli

Corso integrato di Genetica e Biologia Molecolare GENETICA. a.a. 2013-2014 Pier Franco Pignatti 1.10.2013 LEZIONI N. 1 e 2 (INTRODUZIONE)

Corso integrato di Genetica e Biologia Molecolare GENETICA. a.a. 2013-2014 Pier Franco Pignatti 1.10.2013 LEZIONI N. 1 e 2 (INTRODUZIONE) Corso integrato di Genetica e Biologia Molecolare GENETICA a.a. 2013-2014 Pier Franco Pignatti 1.10.2013 LEZIONI N. 1 e 2 (INTRODUZIONE) A) Il corso di genetica B) Genetica classica, genetica molecolare,

Dettagli

Scuola di specializzazione in GENETICA MEDICA.

Scuola di specializzazione in GENETICA MEDICA. Scuola di specializzazione in GENETICA MEDICA. La Scuola di specializzazione in Genetica medica afferisce all Area Servizi clinici sotto area Servizi clinici diagnostici e terapeutici, Classe dei Servizi

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza

Dettagli

Verso la terapia personalizzata

Verso la terapia personalizzata Verso la terapia personalizzata M.G.Tibiletti Genetista Ospedale di Circolo-Università dell Insubria Varese Soroptimist Club Varese Varese 20 aprile 2013 Test genetici DIAGNOSTICI PRESINTOMATICI PREDITTIVI,

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

GENETICA E GENOMICA. La Missione. BIOTEC GEN

GENETICA E GENOMICA. La Missione. BIOTEC GEN GENETICA E GENOMICA La Missione. Ricerca e sviluppo a livello pilota e/o prototipale di processi/prodotti a base biologica, a forte contenuto innovativo e suscettibili di interesse per imprese industriali

Dettagli

centrale (CNS) causata dall infezione litica degli oligodendrociti da parte del Polyomavirus JC (JCPyV). Ad

centrale (CNS) causata dall infezione litica degli oligodendrociti da parte del Polyomavirus JC (JCPyV). Ad RESOCONTO ATTIVITÀ DI RICERCA ANNO 2013 Studio dell espressione di fattori virali e cellulari implicati nella replicazione del Polyomavirus umano JC Responsabile scientifico: Dr. Simone Giannecchini, Dipartimento

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

Innovazione tecnologica e farmacologica in chirurgia oncologica. Sovrintendente Sanitario IEO - CCM

Innovazione tecnologica e farmacologica in chirurgia oncologica. Sovrintendente Sanitario IEO - CCM Innovazione tecnologica e farmacologica in chirurgia oncologica Milano, 20 novembre 2015 Dott. Massimo Castoldi Sovrintendente Sanitario IEO - CCM Medicina di precisione La transizione verso l'era della

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Corso di BioMedicina Molecolare Genomica e dei Sistemi Complessi

Corso di BioMedicina Molecolare Genomica e dei Sistemi Complessi Corso di BioMedicina Molecolare Genomica e dei Sistemi Complessi CFU: 6 Anno accademico 2010-2011 Logica del Corso Il completamento del Progetto Genoma di Homo sapiens e di molti altri organismi e virus

Dettagli

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati

Dettagli

Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna

Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Prof. Giorgio Gallinella Prof.ssa Giovanna Gentilomi Dott.ssa Francesca Bonvicini (ricercatore) Dott.ssa Elisabetta Manaresi

Dettagli

Medicina personalizzata: Trasferimento tecnologico kit IVDD di medicina iomolecolare a marchio Alphagenics

Medicina personalizzata: Trasferimento tecnologico kit IVDD di medicina iomolecolare a marchio Alphagenics Medicina personalizzata: Trasferimento tecnologico kit IVDD di medicina iomolecolare a marchio Alphagenics Milena Sinigaglia Quality Systems Management & Health S.r.l. Meetjob Oristano 23/24 Aprile 2013

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Test genetici per evidenziare il rischio di trombolfilia Il Fattore V della coagulazione è un cofattore essenziale per l attivazione della protrombina a trombina. La variante G1691A, definita variante

Dettagli

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica Silvio Pascucci 1 Anamnesi Sintomi Lesioni Esami : Istologici Virologici Sierologici Diagnosi Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica 2

Dettagli

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente!

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente! LEUCEMIE tessuto ematopoieitico MIELOMI più precisamente! TUMORI EVOLUZIONE E SELEZIONE CLONALE Cambiano: Velocita proliferazione Velocità di mutazione Stabilità genetica Attività telomerasica Vantaggi

Dettagli

LE BIOTECNOLOGIE APPLICATE ALLA RICERCA FARMACEUTICA LE CONOSCENZE E GLI ORIENTAMENTI DEGLI ITALIANI E DEI GIOVANI

LE BIOTECNOLOGIE APPLICATE ALLA RICERCA FARMACEUTICA LE CONOSCENZE E GLI ORIENTAMENTI DEGLI ITALIANI E DEI GIOVANI GfK Group e gli orientamenti degli italiani e dei giovani LE BIOTECNOLOGIE APPLICATE ALLA RICERCA FARMACEUTICA LE CONOSCENZE E GLI ORIENTAMENTI DEGLI ITALIANI E DEI GIOVANI Roma, Isabella Cecchini Direttore

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Principi dello screening raccomandati dalla World Health Organization

Principi dello screening raccomandati dalla World Health Organization EMOGLOBINE: DIAGNOSTICA, STANDARDIZZAZIONE, PROSPETTIVE Approcci diagnostici e problematiche in relazione ad uno screening neonatale Giovanni Ivaldi Laboratorio di Genetica - Settore Microcitemia Ospedali

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Dal punto di vista del genetista medico è di primaria importanza che la maggior parte di coloro che decidono di sottoporsi ad un test genetico possano

Dal punto di vista del genetista medico è di primaria importanza che la maggior parte di coloro che decidono di sottoporsi ad un test genetico possano I brevetti hanno come scopo primario di determinare un beneficio per la società in generale, trascinando l innovazione tecnologica e promuovendone il progresso Un brevetto determina sostanzialmente un

Dettagli

Crediti formativi 26 Partecipanti 50

Crediti formativi 26 Partecipanti 50 Corso di aggiornamento PROVIDER NAZIONALE 301 DIAGNOSTICA GENETICA ATTUALITA E PROSPETTIVE IL LABORATORIO DELLA GENETICA FORENSE 2015 Coordinamento scientifico Prof. Maurizio Margaglione Crediti formativi

Dettagli

Ricerca e sviluppo: non solo competitività ma speranza

Ricerca e sviluppo: non solo competitività ma speranza Ricerca e sviluppo: non solo competitività ma speranza Sergio Dompé Presidente Farmindustria Malattie rare e disabilità Siamo rari ma tanti Roma, 1 dicembre 2006 Ogni quattro mesi, uno di vita in più Italia:

Dettagli

La terapia in utero delle malattie genetiche: cellule staminali, terapia genica

La terapia in utero delle malattie genetiche: cellule staminali, terapia genica La terapia in utero delle malattie genetiche: cellule staminali, terapia genica Prof. M.Seri: U.O. Genetica Clin ica Dipartimento per la Salute della Donna, del Bambin o e dell Adolescente Geni e malattie

Dettagli

-malattie monogeniche o mendeliane:

-malattie monogeniche o mendeliane: Martedì 16 Febbraio è venuta nella nostra classe la dr.ssa Petrelli Maria a spiegarci le malattie sessualmente trasmissibili e ereditarie, sessualità e affettività. Ci ha spiegato la divisione delle cellule

Dettagli

REPORT FINALE DEL PROGETTO III Controllo di qualità nazionale per la valutazione delle mutazioni di RAS nel carcinoma del colon-retto -2014

REPORT FINALE DEL PROGETTO III Controllo di qualità nazionale per la valutazione delle mutazioni di RAS nel carcinoma del colon-retto -2014 REPORT FINALE DEL PROGETTO III Controllo di qualità nazionale per la valutazione delle mutazioni di RAS nel carcinoma del colon-retto -2014 Il Comitato Scientifico AIOM e SIAPEC-IAP ha organizzato per

Dettagli

MASTER IN BIOTECNOLOGIE AVANZATE PER DIAGNOSI E TERAPIA MOLECOLARE

MASTER IN BIOTECNOLOGIE AVANZATE PER DIAGNOSI E TERAPIA MOLECOLARE UNIONE EUROPEA Fondo sociale europeo ab MINISTERO DELL ISTRUZIONE DELL UNIVERSITA E DELLA RICERCA BIOTECNOLOGIE AVANZATE LISTENING TO BIOMOLECULES TO SILENCE DISEASE UNIVERSITÀ DEGLI STUDI DI NAPOLI FEDERICO

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

4 modulo didattico - Modalità di trasmissione delle malattie

4 modulo didattico - Modalità di trasmissione delle malattie 4 modulo didattico - Modalità di trasmissione delle malattie monogeniche. L analisi dell albero genealogico: uno strumento indispensabile della genetica medica I SIMBOLI DELL ALBERO GENEALOGICO L ANEMIA

Dettagli

LA DIAGNOSTICA MOLECOLARE E I TUMORI DEL SANGUE

LA DIAGNOSTICA MOLECOLARE E I TUMORI DEL SANGUE LA DIAGNOSTICA MOLECOLARE E I TUMORI DEL SANGUE UNA NUOVA FRONTIERA NELLA DIAGNOSI DI ALCUNI TUMORI La diagnostica molecolare ha l obiettivo di accertare un ampia varietà di patologie (infettive, oncologiche

Dettagli

Biofarmaci. Contributo ENEA Sviluppo di biofarmaceutici innovativi per terapie anti-metastatiche. Conferenza Stampa. Roma, 22 settembre 2011

Biofarmaci. Contributo ENEA Sviluppo di biofarmaceutici innovativi per terapie anti-metastatiche. Conferenza Stampa. Roma, 22 settembre 2011 Biofarmaci Contributo ENEA Sviluppo di biofarmaceutici innovativi per terapie anti-metastatiche Eugenio Benvenuto Laboratorio Biotecnologie UT BIORAD Conferenza Stampa Roma, 22 settembre 2011 UT BIORAD

Dettagli

"Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple VIII Incontro-Convegno A.C.A.R 2006-2016: DIECI ANNI DI A.C.A.R. Montecatini Terme (PT), 16 Aprile 2016 A.C.A.R "Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli

Il ruolo dei marcatori molecolari nello screening colo rettale

Il ruolo dei marcatori molecolari nello screening colo rettale Il ruolo dei marcatori molecolari nello screening colo rettale Cristina Sani (1), Leonardo Ventura (2), Marco Zappa (2), Carlo Senore (3), Luigi Bisanti (4), Grazia Grazzini (5), Germana Martinasso (3),

Dettagli

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico ALLEGATO 1 DESCRIZIONE DELLA FORNITURA PROCEDURA APERTA PER LA FORNITURA IN PIU LOTTI, IN MODALITA SERVICE, DI SISTEMI ANALITICI DI BIOLOGIA MOLECOLARE PER I LABORATORI ANALISI DELL AZIENDA ASL N. 8 DI

Dettagli

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi generali Metodi mirati Scoperta e sviluppo di nuovi

Dettagli

La Cellula Staminale

La Cellula Staminale Corso di Laurea in Medicina e Chirurgia A.D.E. Le CelluleStaminali 17 maggio 2016 Cinzia Di Pietro Dipartimento di Scienze Biomediche e Biotecnologiche Sezione di Biologia e Genetica G Sichel La Cellula

Dettagli

Biotecnologie Mediche

Biotecnologie Mediche Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it Le malattie genetiche. Dalle malattie monogeniche ai fenotipi complessi. Metodi di Analisi degli acidi nucleici estrazione di DNA RNA

Dettagli

ProDect CHIP HPV TYPING

ProDect CHIP HPV TYPING bcs Biotech SpA Your partner in biotechnology www.biocs.it ProDect CHIP HPV TYPING Il test per RIVELARE e TIPIZZARE in maniera rapida ed accurata il PAPILLOMA VIRUS UMANO A lifi i Amplificazione e rivelazione

Dettagli

NUTRIGENOMICA :foresight bio-tecnologico Paolo Manzelli pmanzelli@gmail.com : www.egocreanet.it ; www.edscuola.it/lre.html

NUTRIGENOMICA :foresight bio-tecnologico Paolo Manzelli pmanzelli@gmail.com : www.egocreanet.it ; www.edscuola.it/lre.html NUTRIGENOMICA :foresight bio-tecnologico Paolo Manzelli pmanzelli@gmail.com : www.egocreanet.it ; www.edscuola.it/lre.html http://www.medicinalive.com/wp-content/uploads/2008/07/nutrigenomica.jpg Ippocrate

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

Cosa deve cambiare nella prevenzione del cervicocarcinoma

Cosa deve cambiare nella prevenzione del cervicocarcinoma Cosa deve cambiare nella prevenzione del cervicocarcinoma MARIO SIDERI ISTITUTO EUROPEO DI ONCOLOGIA Milano Istituto Europeo di Oncologia Prevenzione STRATEGIA PREVENTIVA Eliminazione dei CIN3 per prevenire

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Thalassaemias. Thalassaemia Hb Variants. A group of blood deseases caused by a genetically determined. alteration in globin synthesis

Thalassaemias. Thalassaemia Hb Variants. A group of blood deseases caused by a genetically determined. alteration in globin synthesis Approccio diagnostico delle Varianti Hb Giovanni Ivaldi Laboratorio di Genetica Umana - Settore Microcitemia Ospedali Galliera - Genova A group of blood deseases caused by a genetically determined reduction

Dettagli

VEQ in Biologia Molecolare ciclo 2013. HBV DNA HIV RNA HCV RNA Genotipo HCV

VEQ in Biologia Molecolare ciclo 2013. HBV DNA HIV RNA HCV RNA Genotipo HCV VEQ in Biologia Molecolare ciclo 2013 HBV DNA HIV RNA HCV RNA Genotipo HCV Firenze 21 ottobre 2014 Maria Grazia Colao VEQ 2013 2 7 54 4 1 1 2 17 5 3 2 4 1 2 4 3 112 partecipanti Metodi utilizzati Gruppi

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

AlphaReal BREAST Scheda Tecnica

AlphaReal BREAST Scheda Tecnica AlphaReal BREAST Scheda Tecnica A3 DS RT 607 ARBreast_01_2015.doc Pag. 1 di 5 Rev. 01 del Gennaio 2015 Prodotto: AlphaReal BREAST Codice prodotto: RT-607.05.20 / RT-607.10.20 N Tests: 5/10 tests Destinazione

Dettagli

Diagnosi prenatale di malattie geneticamente trasmissibili. Trasferimento genico. Terapia genica DNA per l ambiente

Diagnosi prenatale di malattie geneticamente trasmissibili. Trasferimento genico. Terapia genica DNA per l ambiente Diagnosi prenatale di malattie geneticamente trasmissibili Distrofia muscolare Fibrosi cistica Corea di Huntington Trasferimento genico Insulina Ormone della crescita Eritropoietina Terapia genica DNA

Dettagli

Conoscenza delle tecniche per studiare le cellule in coltura

Conoscenza delle tecniche per studiare le cellule in coltura Corso di Laurea in Biotecnologie Tecnologie per linee cellulari e staminali Docente: Grazyna Ptak Ricevimento: per appuntamento; contatto: e-mail: gptak@unite.it Obiettivo del corso: Conoscenza delle tecniche

Dettagli