La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari"

Transcript

1 La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula diploide (2n) dopo aver replicato il suo DNA (4n), mediante due divisioni successive forma quattro cellule aploidi (n)

2 Negli organismi pluricellulari la meiosi viene realizzata soltanto dalle cellule germinali La sessualità comporta l'alternarsi di due eventi a carico dei nuclei cellulari: la meiosi e la cariogamia La cariogamia, fusione dei nuclei di due diversi gameti, origina lo zigote, cellula il cui nucleo (2n) è fornito di una doppia serie di cromosomi a due a due omologhi

3 Nel corso della formazione di un individuo a partire dallo zigote, le cellule germinali si differenziano molto presto dalle linee cellulari somatiche Tutte le cellule, sia somatiche che germinali, aumentano di numero dividendosi per mitosi Solo le cellule germinali possono, una sola volta nel corso della vita di una singola cellula germinale, dividersi per meiosi La meiosi genera cellule aploidi che formeranno i gameti responsabili della riproduzione

4 Gametogenesi è il processo di formazione di gameti (aploidi, n) da cellule diploidi della linea germinale mediante la divisione meiotica Spermatogenesi è il processo di formazione dei gameti maschili. I 4 spermatidi diventano spermatozoi; un uomo produce circa 200 milioni di spermatozoi al giorno Oogenesi è il processo di formazione di un uovo attraverso la meiosi; una donna produce generalmente un solo oocita II (che se fecondato completerà la meiosi diventando UOVO) ad ogni ciclo mestruale

5

6 Metafase I Anafase I Telophase I

7 Meiosi II

8 La Meiosi è un processo di divisione cellulare che porta alla formazione di quattro cellule aploidi La Meiosi consiste di due divisioni cellulari successive (Meiosi I e Meiosi II) sono precedute da una unica duplicazione del DNA La Meiosi I comincia con la profase caratterizzata da: duplicazione dei centrioli ed inizio della formazione del fuso meiotico, scomparsa della membrana nucleare e appaiamento punto per punto dei cromosomi omologhi Durante l appaiamento, i cromatidi dei cromosomi omologhi si scambiano tra loro alcuni segmenti corrispondenti mediante un processo chiamato crossing-over In metafase, i cromosomi omologhi che restano legati per il centromero (formano le tetradi strutture formate da quattro cromatidi) vengono agganciati dalle fibre del fuso

9 Il Crossing-over genera nuove combinazioni geniche cromatidi fratelli cromosomi omologhi prima e dopo il crossing over Ma le nuove combinazioni possono essere sia migliori che peggiori

10 In anafase i cromosomi omologhi si separano migrando verso i poli della cellula

11 In telofase, i cromosomi omologhi si riforma la membrana nucleare e si formano due cellule figlie con un assetto aploide La Meiosi II è essenzialmente simile alla mitosi (con la differenza sostanziale che ha inizio da una cellula aploide anziché diploide), i cromatidi fratelli di ogni coppia vengono separati e si formano in tutto quattro cellule aploidi

12 Differenze tra Mitosi e Meiosi MITOSI MEIOSI Cellula madre (prima della duplicazione dei cromosomi) MEIOSI I Profase Cromosoma duplicato (due cromatidi fratelli) Duplicazione dei cromosomi 2n = 4 Duplicazione dei cromosomi Profase I Si forma la tetrade mediante la sinapsi dei cromosomi omologhi Metafase I cromosomi si allineano sul piano equatoriale Le tetradi si allineano sul piano equatoriale Metafase I Anafase Telofase 2n Cellule figlie prodotte per mitosi I cromatidi si separano durante l anafase 2n Durante l anafase I i cromosomi omologhi si separano: i cromatidi fratelli rimangono uniti Non si verifica un ulteriore duplicazione dei cromosomi; i cromatidi si separano durante l anafase II Cellule figlie prodotte per meiosi I n n n n Cellule figlie prodotte per meiosi II Anafase I Telofase I Aploide n = 2 MEIOSI II

13 Nella linea germinale maschile, gli spermatogoni colonizzano la parte centrale di una struttura ovoidale che diventerà un testicolo Le cellule che vanno negli strati superiori dei tubuli seminiferi diventeranno spermatociti I da cui origineranno 2 spermatociti II, da cui si origineranno 4 spermatidi che si differenzieranno quindi in spermatozoi

14 I MASCHI CONTRIBUISCONO ALLE MUTAZIONI GENICHE PIÙ DELLE FEMMINE Poiché la maggior parte delle mutazioni si verificano durante la Fase S del Ciclo Cellulare, i Maschi sono più a rischio di mutazioni in quanto: poco più di 24 divisioni cellulari si verificano a partire da uno zigote che inizia lo sviluppo di un embrione femmina prima che siano messe da parte le cellule germinali che produrranno le sue future uova mature (tutto questo accade molto prima della nascita!) Gli spermatozoi di un uomo di 30 anni, al contrario, sono i discendenti di almeno 400 divisioni mitotiche che si sono verificate a partire da uno zigote che inizia lo sviluppo di un embrione di sesso maschile

15 1. abbozzo del flagello; 2. Golgi 3. abbozzo dell acrosoma 7. flagello; 9. coda 4. centrioli; 6. nucleo 5. mitocondri che si disporranno a spirale nel collo dello spermatozoo 8. microtubuli; 10. acrosoma

16 CELLULE SOMATICHE PROTAMMINE ISTONI SPERMATOZOI Cromatina nel nucleo della cellula somatica e dello spermatozoo Assemblaggio DNA-protammine PROTEINE DI TRANSIZIONE Formazione delle strutture a ciambella PROTAMMINE : dimensione pari a circa metà di quella degli istoni (5-8 KDa) il 55-70% degli amminoacidici sono arginina che ha una elevata basicità presenza di cisteine con formazione di legami crociati inter- ed intraprotaminici Organizzazione in loop domains PROTAMINE Neutralizzazione della carica negativa del DNA e grande compattazione del nucleo

17 Rimodellamento nucleare degli spermatozoi dei mammiferi Nucleo cellula somatica DNA\RNA Da 1\10 fino a Istoni Spermatogenesi Maturazione epididimale 1 / 40 DNA RNA Protamine

18 Spermiogenesi: differenziazione dello spermatide a spermatozoo

19 Topo\Ratto Verro Toro Uomo Cavallo Capra

20 Nelle gonadi femminili, gli ovociti posizionati nelle ovaie prima della nascita dopo aver subito la replicazione del DNA ed all inizio della ricombinazione meiotica che assicura la diversità genetica della prole potenziale (sono fermi nella profase della prima divisione meiotica, nutrito ed ingrassato dalle cellule somatiche che lo circondano nel follicolo Una volta ogni ciclo mestruale, un aumento delle gonadotropine induce la maturazione meiotica di un grosso ovocita, scoppia il follicolo e l ovocita di secondo ordine si ritrova solo nelle tube Nel periodo precedente, attraverso le gap junctions, l'ovocita primario aveva avuto modo di accumulare tutte le molecole necessarie per sostenere lo sviluppo di un embrione Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M.

21 Nella linea germinale femminile, gli oogoni colonizzano la parte periferica di quello che diverrà l ovario ed aumentano di numero per mitosi, ma solo nei primi periodi di vita embrionale/fetale Prima della nascita si differenziano in oociti I che iniziano la profase della meiosi I in cui trascorreranno lunghissimi periodi Dalla pubertà in poi, ciclicamente un oocita I completa la meiosi I, scoppia il follicolo e l oocita II si troverà nelle tube privo delle cellule che lo nutrivano. Se non incontrerà uno spermatozoo, non inizierà la Meiosi II. Se avviene invece la fecondazione, l oocita II inizierà la Meiosi II dando una cellula Uovo aploide

22

23 UOVA DI MAMMIFERI: ZONA PELLUCIDA E COMPOSTA DA TRE GLICOPROTEINE ZP2, ZP3 : FORMANO FILAMENTI ZP1: forma legami tra i filamenti costituendo una RETE TRIDIMENSIONALE ZP3 : è un recettore per gli spermatozoi che si legano agli oligosaccaridi attivando la reazione acrosomale

24 Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M. Nelle tube, lo spermatozoo si lega alla zona pellucida (matrice glicoproteica) che circonda l'uovo ed i due gameti fondono per formare lo zigote. L'uovo riprende la meiosi e segrega la metà dei rimanenti cromatidi fratelli in un globulo polare. I due pronuclei aploidi, maschile e femminile, migrano uno verso l altro in modo tale che il primo fuso mitotico si agganci ad un genoma diploide (zigotico). Una rapida serie di mitosi produce otto piccole cellule embrionali (blastomeri) che aderiscono tra loro formando la morula. Le due successive mitosi generano due differenti popolazioni di cellule, quelle all'interno che costituiranno l'embrione e quelle all esterno che daranno origine al tessuto extra-embrionale necessario per supportare lo sviluppo embrionale in utero.

25 Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M. Allo stadio di 32 cellule, all interno dell embrione si inizia a formare una cavità piena di liquido, che continua a crescere mentre l'embrione matura in blastocisti. Arrivata nell utero, la blastocisti si stacca dalla zona pellucida per legarsi alla parete uterina su cui l'embrione si continua a sviluppare. La transizione da uovo ad embrione è una delle trasformazioni cellulari più drammatiche e complesse della biologia umana. La cellula risultante dalla fecondazione, lo zigote, è in grado di generare tutte le cellule del corpo umano.

26 Al momento della fecondazione, il genoma materno è organizzato in cromosomi bloccati nella metafase II, il genoma paterno è privo di cromatina, strettamente compattato nella testa dello spermatozoo. Nello zigote esiste inizialmente una notevole differenza nello stato cromatina dei genomi parentali che deve essere risolto per garantire la segregazione accurata dei cromosomi durante la prima divisione mitotica. Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M.

27 Dopo la fecondazione, mentre il pronucleo femminile completa la seconda divisione meiotica, nel pronucleo maschile si riforma la cromatina eliminando le protammine e riformando i nucleosomi con nuovi istoni Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M.

28 Dopo la fecondazione, i nuclei materno e paterno subiscono drammatici cambiamenti della cromatina, soprattutto il nucleo dello spermatozoo in cui le protamine sono rapidamente sostituite da istoni materni per riformare la cromatina. Untangling the mysteries of maternal inheritance with polycomb - Sengupta e Surani - EMBO Journal, 31, , doi: /emboj

29 Dopo la fecondazione, i genomi parentali devono essere riprogrammati per la totipotenza, ed il macchinario del ciclo cellulare deve essere modificato per passare dalla meiosi alla segregazione della mitosi. Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M.

30 Lo zigote acquisisce la totipotenza dalla riprogrammazione della cromatina dei genomi parentali, che coinvolge una demetilazione globale del DNA. Durante le prime divisioni mitotiche dell'embrione, entrambi i genomi parentali subiscono una massiccia demetilazione che è massima allo stadio di blastocisti. Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M.

31 L' eredità materna gioca un ruolo cruciale nello sviluppo degli ovociti per la regolazione dello sviluppo attraverso istruzioni epigenetiche e l'avvio della transizione dal programma trascrizionale dello zigote a quello embrionale Dopo la fecondazione, lo sviluppo embrionale inizia soltanto con la formazione dello zigote, dopo la fusione del nucleo dello spermatozoo con quello dell uovo. Untangling the mysteries of maternal inheritance with polycomb - Sengupta e Surani - EMBO Journal, 31, , doi: /emboj

32 La demetilazione del genoma dell'embrione non è totale, una piccola porzione dei geni hanno imprinting, il che significa che saranno espressi solo da uno dei due cromosomi parentali, protetti da una particolare metilazione al momento della formazione dei gameti che non sarà modificata durante la riprogrammazione epigenetica dell'embrione. Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M.

33 L imprinting genomico viene selettivamente cancellato e ripristinato, ed il controllo dell espressione delle proteine si sposta da traduzionale a trascrizionale. Con la fecondazione, i genomi aploidi di ciascun gamete vengono riuniti per formare il genoma diploide nuovo ed unico dell individuo che nascerà. Il percorso per la riproduzione comincia molto tempo prima della fusione tra i gameti maschili e femminili. Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M.

34 fecondazione cariogamia inizio delle mitosi

35 Restarting life: fertilization and the transition from meiosis to mitosis - Nat Rev Mol Cell Biol Sep;14(9): doi: /nrm Clift D, Schuh M. Figura a lato: da ovocita a embrione: (a) panoramica dello sviluppo pre-impianto. A seguito dell ovulazione, l ovocita secondario può essere fecondato, completa la seconda divisione meiotica diventando un uovo maturo che, unendo il suo nucleo con quello dello spermatozoo fecondante, forma lo zigote. Dopo diverse divisioni mitotiche, lo zigote forma la morula, la successiva formazione di una cavità piena di liquido porta ala formazione della blastocisti che si impianta nella parete uterina; (b) Stadi di maturazione degli ovociti e relative configurazioni cromosomiche. Dopo la scomparsa dell'involucro nucleare si assembla il fuso meiotico, in alto vicino alla superficie dell'ovocita, avviene la segregazione della metà dei cromosomi omologhi e si forma il primo corpo polare. A questo punto un secondo fuso meiotico aggancia i cromosomi restanti e (il quasi) uovo si arresta nella metafase II in attesa della fecondazione. Se arriva uno spermatozoo, l'uovo segrega la metà dei cromatidi fratelli e forma il secondo globulo polare. Lo zigote risultante contiene pronuclei aploidi dalla madre e del padre.

36

37 MORULA : 8 16 cellule (primi 3-4 giorni) Lo zigote inizia a dividersi rapidamente per mitosi Già allo stadio di 8 blastomeri si perde la totipotenza Anche se le cellule sembrano uguali tra loro, lentamente iniziano ad avviare i programmi di differenziamento per formare un embrione con i giusti tessuti ed organi

38 BLASTOCISTI : : cellule (dal 4 al 13 giorno) formata da due tessuti: trofectoderma e ICM (Inner Cell Mass) detto anche nodulo embrionale il primo formerà tessuti per nutrire il feto (placenta) il secondo formerà l embrione cavità blastocelica trofectoderma ICM (massa cellulare laterale)

39 EMBRIONE : giorno Trofectoderma e ICM si separano ICM si attacca all utero dando inizio, così, al contatto fisico e nutritivo con la madre Dal Trofoectoderma inizia a formarsi l embrione disco embrionale (futuro embrione) sacco vitellino corion amnios

40 SUCCESSIVAMENTE SI PARLA DI ~3 settimane ~ 4 settimane FETO

41 Un organismo DIPLOIDE riceve un cromosoma dalla madre (= materno) ed un cromosoma dal padre (= paterno) Cariotipo umano Una coppia di cromosomi corrispondenti, uno di origine materna e l altro paterna formano una coppia di cromosomi omologhi Il cariotipo umano è composto da 46 cromosomi. Il cariotipo umano è composto da 44 cromosomi detti autosomi e da due cromosomi sessuali, XX o XY. Le coppie di autosomi sono formate da cromosomi omologhi (stessa lunghezza, stessi geni). I cromosomi sessuali X ed Y sono diversi per dimensione e non hanno gli stessi geni XY

42

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

La riproduzione e lo sviluppo

La riproduzione e lo sviluppo La riproduzione e lo sviluppo La riproduzione umana In biologia si definisce riproduzione il processo attraverso il quale vengono generati nuovi individui della stessa specie. La riproduzione umana è caratterizzata

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI La Fecondazione Processo con cui due cellule sessuali (gameti) si uniscono per formare un nuovo individuo cha ha un genoma

Dettagli

APPARATO GENITALE INSIEME DI ORGANI DEPUTATI ALLA : FORMAZIONE DEI GAMETI FECONDAZIONE SVILUPPO DELL EMBRIONE E DEL FETO

APPARATO GENITALE INSIEME DI ORGANI DEPUTATI ALLA : FORMAZIONE DEI GAMETI FECONDAZIONE SVILUPPO DELL EMBRIONE E DEL FETO APPARATO GENITALE INSIEME DI ORGANI DEPUTATI ALLA : FORMAZIONE DEI GAMETI FECONDAZIONE SVILUPPO DELL EMBRIONE E DEL FETO APPARATO RIPRODUTTORE MASCHILE GONADI VIE SPERMATICHE convogliano i gameti all uretra

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

LA MEIOSI E LA RIPRODUZIONE

LA MEIOSI E LA RIPRODUZIONE LA MEIOSI E LA RIPRODUZIONE Gli organismi eucarioti si riproducono asessualmente o sessualmente. Nella riproduzione asessuata (o agamica o vegetativa), un singolo individuo si riproduce mediante mitosi

Dettagli

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi Vie genitali maschili e ghiandole accessorie FECONDAZIONE

Dettagli

APPARATO SESSUALE MASCHILE E FEMMINILE

APPARATO SESSUALE MASCHILE E FEMMINILE APPARATO SESSUALE MASCHILE E FEMMINILE ANATOMIA 2 Il corpo umano è costituito da organi ed apparati uguali tra maschi e femmine ad esclusione dell apparato riproduttivo. L apparato riproduttivo è composto

Dettagli

Lo sviluppo embrionale.

Lo sviluppo embrionale. Lo sviluppo embrionale. La riproduzione umana In biologia si definisce riproduzione il processo attraverso il quale vengono generati nuovi individui della stessa specie. La riproduzione umana è caratterizzata

Dettagli

1 a LEGGE DI MENDEL Legge della Segregazione

1 a LEGGE DI MENDEL Legge della Segregazione IMPRINTING 1 a LEGGE DI MENDEL Legge della Segregazione I due membri di una coppia di alleli, durante la formazione dei gameti segregano in maniera indipendente, cioè in modo che metà dei gameti porti

Dettagli

RIPRODUZIONE E SVILUPPO EMBRIONALE

RIPRODUZIONE E SVILUPPO EMBRIONALE RIPRODUZIONE E SVILUPPO EMBRIONALE Il ponte di collegamento tra i genitori ed i figli, loro diretti discendenti, è molto stretto e consiste in una cellula uovo fecondata (lo zigote) che porta i materiali

Dettagli

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita.

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita. IL CICLO CELLULARE Il ciclo cellulare, o ciclo di divisione cellulare (CDC), è la serie di eventi che avvengono in una cellula tra una divisione cellulare e quella successiva. La durata del ciclo cellulare

Dettagli

testicolo dotto deferente

testicolo dotto deferente LA SPERMATOGENESI Struttura del testicolo epididimo testicolo dotto deferente Funzioni del testicolo: esporta spermatozoi ed ormoni androgeni Struttura del testicolo LA SPERMATOGENESI Per testicolo ci

Dettagli

La riproduzione èl unicomezzochehaunorganismoperassicurarela sopravvivenza della sua specie sullaterra.

La riproduzione èl unicomezzochehaunorganismoperassicurarela sopravvivenza della sua specie sullaterra. La riproduzione èl unicomezzochehaunorganismoperassicurarela sopravvivenza della sua specie sullaterra. Se l organismo per qualche causa non può più riprodursi o diminuisce la messa al mondo di nuovi esseri

Dettagli

Seminario di BIOLOGIA APPLICATA Zannotti maria

Seminario di BIOLOGIA APPLICATA Zannotti maria Seminario di BIOLOGIA APPLICATA Zannotti maria Testi Quelli dello scorso anno Programma 1 LA RIPRODUZIONE DEI VIVENTI Cellule (mitosi) Organismi (meiosi) Gametogenesi fecondazione: barbieri carinci. Cap

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015 1) I batteri sono organismi: a- bicellulari b- monocellulari c- pluricellulari 2) I virus: a- possono riprodursi solo nell acqua b- possono riprodursi solo sulla superficie di una cellula c- possono riprodursi

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che

Dettagli

La fecondazione. www.fisiokinesiterapia.biz

La fecondazione. www.fisiokinesiterapia.biz La fecondazione www.fisiokinesiterapia.biz Siti utili http://arbl.cvmbs.colostate.edu/hbooks/pathphys/reprod/fert/index.html http://worms.zoology.wisc.edu/frogs/fert/fert_intro.html http://www.centrogenesis.it/attlante_index.htm

Dettagli

Embryology. Early development from a phenomenological point of view. Bolk s Companions for the study of medicine www.louisbolk.org

Embryology. Early development from a phenomenological point of view. Bolk s Companions for the study of medicine www.louisbolk.org Tratto da: Guus van der Bie, M.D. Embryology. Early development from a phenomenological point of view Bolk s Companions for the study of medicine www.louisbolk.org Traduzione a cura di: Stefano Cecchi

Dettagli

unità C11. La riproduzione

unità C11. La riproduzione Gli animali a fecondazione interna si suddividono in base al tipo di sviluppo dell embrione ovipari ovovivipari vivipari lo sviluppo avviene all esterno del corpo della madre lo sviluppo avviene all interno

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

Apparato Riproduttore

Apparato Riproduttore Apparato Riproduttore LA RIPRODUZIONE. Ogni essere vivente può creare un altro essere vivente, ed è possibile grazie alla RIPRODUZIONE. La riproduzione è possibile grazie all APPARATO RIPRODUTTORE. A differenza

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

FECONDAZIONE E IMPIANTO

FECONDAZIONE E IMPIANTO FECONDAZIONE E IMPIANTO La fecondazione rappresenta l insieme dei La fecondazione rappresenta l insieme dei fenomeni attinenti al riconoscimento e all unione dei due gameti e all ottenimento dell embrione

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano

Dettagli

Corso integrato di Biologia e Genetica

Corso integrato di Biologia e Genetica Corso integrato di Biologia e Genetica Coordinatore: Prof.ssa Giovanna Bianchi Scarrà Genetica Generale e Molecolare (testo: vedi Biologia) Genetica Medica (testo: Genetica Medica Essenziale, Dalla Piccola,

Dettagli

cenni di anatomia del testicolo

cenni di anatomia del testicolo cenni di anatomia del testicolo Il gamete maschile è rappresentato della spermatozoo la produzione e maturazione del gamete maschile avviene nel testicolo Il testicolo fa parte dell apparato riproduttivo

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche costituzionali acquisite nelle cellule germinali nelle cellule somatiche Le alterazioni che avvengono nelle cellule germinali se compatibili con la vita porteranno alla nascita di

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

X CICLO DI CONFERENZE

X CICLO DI CONFERENZE X CICLO DI CONFERENZE Professione Biologo Biologo della Fecondazione Assistita Giovedì 27 settembre 2012 Alessandro Miceli Promea S.p.A. - Torino alessandro.miceli@promea.net Dipartimento di Biologia Animale

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

Glossario essenziale a cura di Salvino Leone

Glossario essenziale a cura di Salvino Leone Glossario essenziale a cura di Salvino Leone I molti termini tecnici usati dagli addetti ai lavori in materia di procreazione assistita non sono usuali. Ne proponiamo un elenco che pur non essendo completo

Dettagli

GAMETOGENESI Dove avviene la meiosi nel nostro corpo?

GAMETOGENESI Dove avviene la meiosi nel nostro corpo? GAMETOGENESI Dove avviene la meiosi nel nostro corpo? gametogenesi nella femmina e nel maschio prima divisione meiotica globulo polare seconda divisione meiotica gametogenesi nella femmina e nel maschio

Dettagli

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Corso di Genetica Docente: Prof. Alberto Pallavicini pallavic@units.it MITOSI E MEIOSI Il materiale genetico deve essere trasmesso di generazione in generazione in modo pressoché perfetto. Analizziamo

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

SCHEDA DI PRESENTAZIONE

SCHEDA DI PRESENTAZIONE SCHEDA DI PRESENTAZIONE TITOLO: L APPARATO RIPRODUTTORE BREVE DESCRIZIONE DELL UNITÀ DI APPRENDIMENTO: in questa unità di apprendimento si vuole trattare lo studio degli apparati riproduttori. DIDATTIZZAZIONE

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it,

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia

Dettagli

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata.

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata. La riproduzione La riproduzione La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. Riguarda tutti gli esseri viventi, può essere Riguarda tutti gli esseri viventi,

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie Nullisomia: 2n-2 (morte preimpianto) Monosomia: : 2n-1 (generalmente morte embrionale) Trisomia: :

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

1 Parte: Identità e Statuto dell embrione Umano - A.Giuli - Seminario Russia - 10/2014 1 PARTE: IDENTITÀ E STATUTO DELL EMBRIONE UMANO

1 Parte: Identità e Statuto dell embrione Umano - A.Giuli - Seminario Russia - 10/2014 1 PARTE: IDENTITÀ E STATUTO DELL EMBRIONE UMANO Introduzione 1 PARTE: IDENTITÀ E STATUTO DELL EMBRIONE UMANO Il progresso biotecnologico e la terza cultura In ambito scientifico gli ultimi decenni hanno visto lo straordinario progresso nel campo della

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di

Dettagli

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di

Dettagli

LA PRIMA SETTIMANA. La segmentazione

LA PRIMA SETTIMANA. La segmentazione LA PRIMA SETTIMANA La segmentazione LA PRIMA SETTIMANA 24-30 ore 2 giorni 3 giorni I primi stadi di sviluppo embrionali globulo polare Embrioni di topo a diversi stadi di sviluppo. LA PRIMA SETTIMANA A,

Dettagli

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi

Dettagli

GENI, GENOMI E CROMOSOMI

GENI, GENOMI E CROMOSOMI www.fisiokinesiterapia.biz GENI, GENOMI E CROMOSOMI GENOMA E il DNA che contiene l intera informazione genetica di un organismo Le dimensioni e la sequenza nucleotidica del genoma sono tipiche di ciascuna

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Mitosi e meiosi: duplicazione cellulare

Mitosi e meiosi: duplicazione cellulare Mitosi e meiosi: duplicazione cellulare Mitosi: 4 fasi Profase Metafase Anafase Telofase Profase: i cromosomi si compattano e l involucro nucleare inizia a scomparire. I cromosomi si accorciano e si inspessiscono.

Dettagli

EMBRIOLOGIA UMANA ESSENZIALE

EMBRIOLOGIA UMANA ESSENZIALE MASSIMO DE FELICI EMBRIOLOGIA UMANA ESSENZIALE Per corsi di laurea in Professioni sanitarie e per il corso di laurea in Odontoiatria e protesi dentaria II edizione DVD in abbinamento editoriale Copyright

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti

Dettagli

La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

VERIFICA La cellalula si divide, gli organismi si riproducono

VERIFICA La cellalula si divide, gli organismi si riproducono ERIICA La cellalula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o falso? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la

Dettagli

SISTEMA RIPRODUTTORE. realizzato da Irene Valorosi sulla base testuale di "Invito alla Biologia" ed. Zanichelli

SISTEMA RIPRODUTTORE. realizzato da Irene Valorosi sulla base testuale di Invito alla Biologia ed. Zanichelli SISTEMA RIPRODUTTORE UMANO realizzato da Irene Valorosi sulla base testuale di "Invito alla Biologia" ed. Zanichelli 1 GAMETOGENESI 2 Vaso deferente SPERMATOGENESI A partire dall adolescenza, e fino alla

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

Fisiologia procreativa

Fisiologia procreativa Fisiologia procreativa Divergenze biologiche Divergenze socioculturali Sistema procreativo femminile Sistema procreativo maschile Fecondazione Sviluppo embrionale e fetale 1/7 Divergenze biologiche I moventi

Dettagli

a.a CORSO DI LAUREA IN INFERMIERISTICA Dott.ssa Marilena Greco Biologia applicata Mitosi e Meiosi

a.a CORSO DI LAUREA IN INFERMIERISTICA Dott.ssa Marilena Greco Biologia applicata Mitosi e Meiosi a.a. 2015-16 CORSO DI LAUREA IN INFERMIERISTICA Dott.ssa Marilena Greco Biologia applicata Mitosi e Meiosi 1 Quando le cellule raggiungono una certa dimensione devono arrestare l accrescimento o dividersi.

Dettagli

Gameti. Gonadi. Riproduzione di tipo sessuato. Fecondazione. Zigote

Gameti. Gonadi. Riproduzione di tipo sessuato. Fecondazione. Zigote APPARATO GENITALE Gameti cellule sessuali Gonadi organi in cui avviene la produzione di gameti Riproduzione di tipo sessuato Fecondazione Zigote APPARATO GENITALE MASCHILE Gonadi: testicoli (contenuti

Dettagli

Riproduzione e sviluppo

Riproduzione e sviluppo www.matematicamente.it Riproduzione e sviluppo (medicina) 1 Riproduzione e sviluppo Domande tratte dal test di ammissione a medicina, odontoiatria e veterinaria 1. Nel liquido spermatico di una sola eiaculazione

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA CICLO VITALE & MEIOSI AA 2011-2012 Dott.ssa Veronica

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli