Dimensione: px
Iniziare la visualizzazioe della pagina:




2 INDICE 1.INTRODUZIONE 1.1. RBSs (RNA binding proteins) nelle malattie genetiche umane Patologie associate ad una perdita di funzione delle RBPs Patologie associate ad un guadagno di funzione del metabolismo dell RNA Coinvolgimento delle RBPs nelle patologie neoplastiche Sam Storia ed Origine Struttura del gene Struttura della proteina Ruolo di Sam68 nei processi cellulari Ruolo di Sam68 nel signalling cellulare Ruolo di Sam68 nella trascrizione Ruolo di Sam68 nello splicing alternativo Ruolo di Sam68 nella risposta allo stress genotossico Ruolo di Sam68 nei processi fisiologici Sam68 nelle neoplasie umane Il linfoma anaplastico a grandi cellule Il recettore tirosin-chinasi ALK Ruolo di ALK nelle neoplasie umane L oncogene NPM/ALK Aspetti molecolari delle proprietà trasformanti di NPM/ALK Il mesotelioma maligno della pleura SCOPO DEL LAVORO MATERIALI E METODI Vettori utilizzati Linee cellulari Colture cellulari Pre-trattamento delle cellule Transfezione Infezione Citofluorimetria a flusso (FACS) Lisati cellulari Dosaggio delle proteine Immunoprecipitazione Elettroforesi su gel di poliacrilammide

3 3.12. Western blot Anticorpi utilizzati Purificazione della proteina di fusione GST-PAKCRIB Saggio di interazione proteica in vitro Saggio di interferenza dell RNA con plasmidi Saggio di proliferazione, vitalità e chemio sensibilità Saggi di migrazione Immunofluorescenza Real Time PCR RISULTATI Fosforilazione di Sam68 in cellule esprimenti ALK Effetti del silenziamento di Sam68 sulla migrazione e sulla proliferazione Effetti del silemento di Sam68 sull azione dei chemioterapici Ruolo di p60 src sull attivazione di Sam Associazione Sam68/Vav Fosforilazione in vivo di Vav Attivazione di Rac Effetti biologici del silenziamento di Vav Sam68 e mesotelioma Effetti del silenziamento di Sam68 su cellule MM Localizzazione di Sam68 nelle cellule MM-5 dopo trattamento con cisplatino Effetti del silenziamento di Sam68 sull espressione delle isoforme di CD DISCUSSIONE BIBLIOGRAFIA

4 1. INTRODUZIONE 1.1. RBPs (RNA Binding Proteins) nelle malattie genetiche umane. Le RNA binding proteins sono componenti chiave nel metabolismo dell RNA regolandone ogni passaggio, dalla biogenesi, alla maturazione, alla stabilità, alla localizzazione cellulare fino alla traduzione e allo splicing alternativo ed infine alla degradazione (Figura 1). Le RBPs sono in grado di formare specifici e dinamici complessi detti ribonucleoproteine (RNP) sia con RNA codificanti che non (Glisovic, T. et al., 2008). Inoltre studi condotti sull assemblaggio di questi complessi in differenti specie supportano ormai l ipotesi che trascritti relativi a proteine con funzioni simili siano legati dalle stesse RBP. (Keene, J.D. 2007). Modificazioni post-traduzionali atte a modificare la loro capacità di legare l RNA o altre molecole, permettono a queste proteine di funzionare come sensori o adattatori, rappresentando un valido meccanismo con cui la cellula cambia velocemente profilo di espressione in risposta a stimoli extracellulari. L uomo possiede più di 500 RBPs, ognuna con una specifica affinità per il proprio bersaglio molecolare, ma ciascuna caratterizzata dalla presenza di un dominio legante l RNA (RNA Binding Domain), in singola o multipla copia (Lunde, B.M. et al., 2007). Esistono svariate tipologie di RBD, ma tra i più comuni possono essere annoverati (Figura 2): RRM (RNA recognition motif): composto da aminoacidi con una disposizione modulare contenente due sequenze consenso ed alcuni residui aromatici estrememente conservati impacchettati in una struttura β1α1β2β3α2β4; più del 50% delle RBPs (tra cui, ad esempio, la proteina legante la poly(a), PABP) possiedono questo domini. KH (K omology domain): è un dominio estremamente conservato nell evoluzione, inizialmente identificato come sequenza ripetuta nelle ribonucleoproteine hnrnp K e composto da residui aminoacidici che formano una struttura β1α1α2β2β3 (tipo I) o β1α1β2α2α3β3 (tipo II). 4

5 PAZ (Piwi/Argonaute/Zwille domain): si trova in proteine coinvolte nel biogenesi dei mirna, come Dicer o Argo, e il suo legame con l RNA è stabilizzato da residui idrofobici. Figura 1. Ruolo delle RBP nelle cellule eucariote. (a) Pathway del mrna: il pre-mrna è trascritto dalla RNA polimerasi II e processato in mrna maturo tramite la rimozione degli introni durante lo splicing, la poliadenilaziione in 3 e l aggiunta di un un residuo di 7-metilguanosina in corrispondenza dell estremità 5 ; il legame di specifiche RBP all mrna è fondamentale per il corretto svolgimento di questi processi di maturazione. Il complesso mrna-proteine esce dal nucleo attraverso dei pori sulla membrana nucleare (NPC) e nel citoplasma viene riconosciuto da altre proteine, tra cui la PABP, una proteina che riconosce la coda poli(a) degli mrna e il fattore della traduzione eif4e, il quale lega il residuo di 7-metilguanosina; questi eventi permettono la stabilizzazione e la traduzione dell mrna messaggero in proteina. Se sono presenti codoni di stop prematuri, le RBP non permettono l assemblggio del ribosoma evitando la traduzione di proteine mutate e potenzialmente dannose. (b) Pathway dei mirna. La biogenesi dei mirna parte dalla trascrizione da parte della RNApol II di microrna primari (pri-mirna) che vengono processati dal complesso Drosha in micro-rna precursori (pre-mirna), i quali, a loro volta, sono esportati nel citoplasma e processati dall enzima Dicer in mirna maturi a singolo filamento, in grado di formare il complesso ribonucleoproteico RISC ed appaiarsi a specifici mrna-target impedendone la traduzione. 5

6 Figura 2. Struttura ottenuta tramite cristallografia dei più comuni domini in grado di legare l RNA. Le α-eliche sono disegnate in giallo, i β-foglietti in verde e i loop in blu Considerando che le RBPs fanno parte di un elaborato network che regola ogni aspetto del metabolismo dell RNA, qualsiasi evento che comprometta la loro capacità associativa con gli RNAs bersaglio e/o con altri interattori cellulari può avere conseguenze sull espressione genica nonché sull attivazione di pathways cellulari, ed eventualmente risultare in un fenotipo patologico. Curiosamente le patologie neurodegenerative sono le principali manifestazioni cliniche di difetti strutturali e/o funzionali delle RBPs, probabilmente a causa dell alta frequenza con cui si manifesta nelle cellule neuronali lo splicing alternativo, uno dei meccanismi di maturazione dell RNA sotto il controllo di queste proteine (Gabut, M. et al., 2008). In aggiunta è stato dimostrato che cambiamenti morfo-funzionali di queste proteine possono contribuire alla patogenesi di altre malattie umane, tra cui principalmente atrofie muscolari e neoplasie (Figura 3). Figura 3. Il coinvolgimento delle RBP nelle patologie umane. L aberrante espressione delle RBP (in verde) è stato verificata in molte patologie umane (in arancione) tra cio malattie neurodegenerative, atrofie muscolari e neoplasie. Il loro coinvolgimento in patologie specifiche (in blu) può essere diretto (linea intera) o indiretto (linea tratteggiata). 6

7 1.1.1.Patologie associate ad una perdita di funzione delle RBPs Sindrome dell X fragile: è la più comune forma ereditaria di ritardo mentale (Garber, K.B. et al., 2008) ed è causata da una mutazione del gene FMR1. Normalmente questo gene contiene varie ripetizioni del codone CGG in numero variabile tra 6 e 53; negli individui affetti dalla sindrome, le ripetizioni della tripletta CGG sono generalmente superiori a 230. Questo grado di espansione provoca la metilazione delle citosine presenti anche livello del promotore, con conseguente silenziamento dell'espressione. La metilazione del locus FMR1, che è situato nella banda cromosomica Xq27.3, provoca, a quel livello, costrizione e fragilità del cromosoma X, fenomeno che dà il nome alla sindrome. La proteina trascritta dal gene, la FMRP, è una RBP espressa soprattutto nei testicoli e nel cervello, i tessuti più colpiti dalla sindrome. L FMRP si associa ad RNA messaggeri che codificano per proteine neuronali, regolandone alcuni aspetti essenziali, quali la stabilità, il trasporto lungo i dendriti e la traduzione. Sebbene alti livelli di espressione della proteina, in vari modelli sperimentali, inducano una repressione della traduzione sia in vitro che in vivo (Laggerbauer, B. et al., 2001, Li, Z. et al., 2001, Mazroui, R. et al., 2002), il meccanismo con cui l FMRP regola la traduzione di mrnas neurospecifici non è stato ancora chiarito. L identificazione e la caratterizzazione dei suoi bersagli molecolari potrebbe fornire indizi chiave per la comprensione della patogenesi di questa malattia ereditaria. Sindrome neurologica paraneoplastica: Le sindromi paraneoplastiche neurologiche rappresentano l effetto collaterale di una reazione del sistema immunitario ad un tumore primario o ad una metastasi, in cui la risposta immunitaria danneggia strutture del sistema nervoso centrale (cervello, cervelletto), periferico (nervi) oppure le sinapsi. I sintomi sono variabili e spesso poco specifici, tanto da essere facilmente interpretabili con altre patologie molto più frequenti, come ad esempio le difficoltà di memoria e la depressione associata all'encefalite limbica oppure i disturbi di sensibilità associati ad una neuropatia sensitiva. Insorgono spesso in modo graduale e nel tempo possono essere di intensità variabile. Spesso una PNS si manifesta prima del tumore stesso ed in tali pazienti possono essere riscontrati specifici auto-anticorpi, importanti per la diagnosi e la terapia del tumore. In due 7

8 specifiche situazioni cliniche, si è dimostrato che gli auto-anticorpi prodotti sono diretti contro RBPs e più precisamente: nella neuropatia sensitiva paraneoplastica con o senza encefaomielite, che può accompagnare carcinoma polmonare a piccole cellule, il carcinoma alla prostata o il neuroblastoma. I sintomi consistono nella neuropatia sensitiva dolorosa, con perdita di tutti i tipi di sensibilità. La degenerazione cerebellare e le anomalie del tronco encefalico sono variabili. L'encefalite limbica insorge con ansia e depressione, comportando amnesia, agitazione, confusione, allucinazione e anomalie comportamentali. Spesso tali pazienti presentano, nel siero e nel liquor, auto-anticorpi diretti contro la proteina Hu, il cui ruolo riconosciuto è quello di stabilizzare molti mrnas che trascrivono per proteine rilevanti per molte funzioni neuronali, quali il differenziamento e la plasticità sinaptica (Bolognani, F. et al., 2008); nell atassia paraneoplastica opsoclono-mioclono (POMA, Paraneoplastic Opsoclonus- Myoclonus Ataxia) che può presentarsi in pazienti affetti da carcinoma alla mammella, al polmone o neoplasie delle cellule del sangue nei quali possono essere rilevati auto-anticorpi diretti contro Nova, una RBP che regola lo splicing alternativo di svariati mrnas coinvolti nella trasmissione sinaptica inibitoria. (Ule, J. et al., 2003). Atrofia muscolare spinale: Si tratta di una patologia delle cellule nervose delle corna anteriori del midollo spinale, da cui si diramano i motoneuroni. Nella sua forma più comune, l'atrofia muscolare spinale è una malattia autosomica recessiva, causata da delezioni o mutazione dei geni SMN1 e SMN2, con conseguente perdita di funzione delle proteine corrispondenti, coinvolte nell assemblaggio dello splisosoma e nella localizzazione degli mrnas, e quindi fondamentali per lo sviluppo e la sopravvivenza dei α-neuroni della corda spinale (Carrel, T.L. et al., 2006) Patologie associate ad un guadagno di funzione del metabolismo dell RNA Distrofia miotonica: è una malattia genetica neuromuscolare degenerativa a carattere autosomico dominante, dovuta all amplificazione della tripletta CUG nel 8

9 gene DMPK (nella distrofia miotonica di tipo 1 - DM1) o della sequenza ripetuta CCTG nel gene ZNF9 (nella distrofia miotonica di tipo 2 - DM2). Normalmente le sequenze sopraindicate sono coinvolte nel legame con proteine necessarie per il processamento nucleare dell RNA. Attualmente si ritiene che, sia nella DM-1 che nella DM-2, l amplificazione delle sequenze osservate svolga un ruolo patogenetico primario poiché determinerebbe un reclutamento abnorme di proteine coinvolte nel metabolismo dell RNA, sottraendole ad altri trascritti ed inibendo in questo modo importanti funzioni cellulari (Kanadia, R.N. et al., 2006). Sindrome del tremore e atassia legata all X fragile: si tratta di una patologia neurodegenerativa progressiva caratterizzata da tremore intenzionale ad esordio tardivo e andatura atassica. Sebbene siano stati descritti sia pazienti maschi che femmine, colpisce prevalentemente i maschi di età superiore ai 50 anni. La trasmissione è dominante; la sindrome è causata da una moderata amplificazione (da 50 fino a 200 volte) del codone CGG del gene FMR1. Anche in questo caso l mrna del FMR1 mutato non viene tradotto, ma l espansione moderata delle triplette porta al legame e quindi al sequestro di proteine (come l hnrnpa2) coinvolte nel processamento dell RNA ed alla formazione di foci intranucleolari in neuroni ed astrociti, con conseguente progressiva neurodegenerazione (Iwahashi, C.K et al., 2006). Distrofia muscolare oculofaringea: è caratterizzata da ptosi palpebrale e disfagia, associate talvolta ad altri segni a carico della muscolatura cranica e degli arti. I primi casi furono descritti nella popolazione francese del Canada, ma è stato successivamente dimostrato che la malattia è ubiquitaria. La malattia si manifesta attorno alla quarta-sesta decade di vita con ptosi ingravescente, generalmente accompagnata da contrazione compensatoria dei muscoli della fronte, che determina una postura anomala del collo. La disfagia compare precocemente e si accompagna a rigurgito nasale, con gravi episodi di aspirazione ab ingestis. La diagnosi si basa, oltre che sulla distribuzione della debolezza muscolare, sul riscontro, all'esame istologico, di inclusioni nel nucleo dei miociti. La diagnosi molecolare si basa sul riscontro dell' espansione di una sequenza instabile di triplette GCG nel gene PABPN1, localizzato sul cromosoma 14q, che codifica per la proteina legante la 9

10 poly(a) di tipo N1, coinvolta nella regolazione della poliadenilazione degli mrnas nascenti. Sebbene la patogenesi della malattia non è ancora ben definita, si ritiene che l espansione descritta del gene PABPN1 determini un accumulo abnorme della proteina corrispondente nel nucleo delle fibre muscolari, con conseguente malfunzionamento (Brais, B. et al., 1998) Coinvolgimento delle RBPs nelle patologie neoplastiche Un numero sempre maggiore di studi mette in evidenza un possibile ruolo delle RPBs nella regolazione della proliferazione e della migrazione cellulare, rendendo plausibile l ipotesi che una loro disfunzione possa essere associata alla trasformazione neoplastica. A sostegno di ciò, riarrangiamenti cromosomici che coinvolgono geni che codificano per le proteine appartenenti alla famiglia dei fattori di trascrizione TET sono stati descritti in associazione ad alcune tipologie di sarcoma, quali il sarcoma di Ewing di origine familiare e il liposarcoma mixoide (Riggi, N. et al., 2007). Recenti studi hanno messo in evidenza una lista sempre più ampia di RBPs la cui espressione è alterata nei tumori umani; in particolare la proteina eif4e, fattore di trascrizione la cui attività è regolata dalla pathway PI3K-Akt-mTOR, si comporta come proto-oncogene, determinando trasformazione neoplastica in seguito ad iperespressione (Sonenberg, N. et al., 2007). Inoltre, elevati livelli di SF2/ASF sono correlati a disregolazione dello splicing degli mrnas, tra cui quelli relativi ad oncosoppressori come la proteina Bridging Integrator 1 (Karni, R. et al., 2007). Tra le numerose RPBs, le proteine della famiglia STAR (Signal Transduction and Activation of RNA) sono, tuttavia, quelle la cui espressione è più frequentemente alterata nelle neoplasie umane, almeno sulla base degli studi finora condotti. Questo gruppo di proteine possiede infatti domini multifunzionali che gli permettono di interagire con molteplici pathway cellulari, rappresentando un valido meccanismo tramite cui la cellula risponde più prontamente agli stimoli extra-cellulari senza dover attendere l espressione proteica derivante da una trascrizione de novo. (Sette, C. 2010). Tuttavia sono necessari ulteriori studi sulla correlazione tra un espressione aberrante di queste proteine e lo sviluppo di neoplasie. ed è proprio su questo 10

11 argomento, cioè sul ruolo di uno dei membri della famiglia STAR, la proteina Sam68, nella trasformazione neoplastica, che si è concentrata la mia attività di ricerca in questi tre anni di dottorato Sam Storia e Origini. Alla famiglia delle proteine STAR appartengono molte proteine di organismi diversi, quali GRP33 dell Artemia Salina (Cru-Alvarez, M. et al., 1987), GLD1 di C.elegans (Jan, E. et al., 1999), HOW di Drosophila (Zaffran, S. et al., 1997) e QKI (Mezquita, J. et al., 1998), SLM1 e 2 (Venables, J.P et al., 1999), KHDRBS2 (Wang, L. et al., 2002), Sam50 (DiFruscio, M. et al., 1998) e SF1(Arning, S. et al., 1996) nell uomo. Questa famiglia di proteine estremamente conservate è caratterizzata dalla presenza in ognuna di esse di un dominio strutturale capace di legare l RNA, il dominio GSG (GRP33/SAM68/GLD-1), che deve il suo nome alle prime tre proteine in cui è stato descritto. Oltre il dominio GSG, le proteine STAR presentano nella loro struttura regioni responsabili di interazioni proteina-proteina e residui aminoacidici bersaglio di modificazioni post-traduzionali. L interazione delle proteine STAR con trasduttori intracellulari differenti nonché le diverse modificazioni post-traduzionali ne regolano la localizzazione intracellulare e l affinità di legame per l RNA bersaglio (Vernet, C. and Artzt, K. 1997). Tra le proteine STAR fino ad oggi caratterizzate la proteina Sam68 (Srcassociated substrate during mitosis) è quella negli ultimi anni è stata oggetto di maggiori studi in virtù del suo ruolo in molti processi cellulari, nonché in svariate patologie, tra cui le neoplasie umane Sam68 fu identificata nel 1990 nei laboratori di Tony Pawson come una proteine di 68KDa che subiva fosforilazione in tirosina in seguito a trasfezione cellulare con l oncogene v-src (Ellis, C. et al., 1990). In questo lavoro iniziale gli autori sono stati in grado di dimostrare l associazione di Sam68 con Ras-GAP. La sua purificazione fu però ottenuta da cellule NIH3T3 v-src-trasformate dal team di McCornick tramite cromatografia da affinità; lo stesso gruppo riuscì a clonarne il cdna, a dimostrare la sua capacità di legare gli acidi nucleici e a caratterizzarne il 11

12 dominio di legame SH2 (Wong, G. et al., 1992). Due anni più tardi gruppi differenti dimostrarono che Sam68 conteneva domini SH3 (Fumagalli, S. et al., 1994; Richard, S. et al., 1995; Taylor, S.J. et al., 1995; Vogel, L.B. et al., 1995) e che era un substrato di src durante la mitosi (Fumagalli, S. et al., 1994; Taylor, S.J. et al., 1995). Solo nel 1995 fu ottenuta la sequenza murina di Sam68, omologa al 95% con quella umana (Richard, S. et al., 1995). Il 21 Maggio 2002 la commissione per la nomenclatura della HUGO (Human Genoma Organization) ha stabilito i nomi KHDRBS1 e khdrbs1(kh Domain containing, RNA Binding, Signal transduction associated 1) rispettivamente per la proteina Sam68 umana e per l omologa murina. Tuttavia, per semplicità, nella comunità scientifica si è soliti chiamare questa proteina con il suo nome originario Struttura del gene. Figura4. Struttura del gene umano codificante per Sam68. Il gene codificante per Sam68 è composta da 9 esoni e 8 sequenze introniche. Nella figura sono indicate le lunghezze in paia di basi (bp) relative a ciascuno sequenza. Ad oggi sono stati clonati sia il gene umano codificante per Sam68, che quello di altri mammiferi quali topo e ratto (Numero di accesso GenBank: NM_130405) e del pollo (Numero di accesso GenBank:Ayo57837). Sono stati inotre clonati e sequenziati anche geni codificanti per proteine omologhe a quella umana espresse in D.melanogaster (DiFruscio, M. et al., 1998) e in Torpedo Californica (Fung, E.T. et al., 1998). Le sequenze codificanti per i domini funzionali risultano molte conservate in tutte le specie. Nonostante non sia stato pubblicato nessun lavoro sulla struttura genomica, avendo a disposizione l intera sequenza del gene umano e murino, è possibile dedurre la struttura genica e la sequenza del trascritto utilizzando programmi come BLAST. 12

13 Nell uomo il gene codificante per Sam68 è localizzato sul cromosoma 1 in posizione p32 ed è composto da 9 esoni alternati a 8 sequenze introniche, per una lunghezza totale di paia di basi. (Figura 4). Il gene murino è strutturalmente molto simile a quello umano, ed è caratterizzato dallo stesso numro di esoni e introni Struttura della proteina Come tutte le proteine STAR, Sam68 presenta il dominio GSG, responsabile del legame con l RNA, composto dal dominio KH (una regione di circa 200 aminoacidi omologa alla ribonucleoproteina eteronucleare K), fiancheggiato da sequenze N e C-terminali di 80 e 30 aminoacidi rispettivamente (Figura 5). La sequenza GXXXGXXG del dominio KH, presente nei batteri, negli archea ed in tutti gli eucarioti, risulta essere quella maggiormente conservata (Vernet, C e Artzt, K. 1997). Grazie a questo dominio la proteina è in grado di legare l RNA, con particolare affinità per le sequenza omopolimeriche, come le poly(u) e le poly(a) (Chen, T. et al., 1997). Figura 5. Struttura della proteina Sam68. La molecola è composta da: dominio GSG formato dal dominio KH fiancheggiato dalla sequenza NK (sequenza N-terminale di KH) e CK (sequenza C- terminale di KH); sei motivi consenso ricchi in prolona (P0-P5); box RGG; regioni ricche in residui di tirosina (YY) e una sequenza di localizzazione nucleare (NLS). Sono indicate le relative posizioni aminoacidiche. Nella proteina Sam68 sono inoltre presenti sei regioni ricche in prolina (P0- P5), tre delle quali localizzate in posizione N-terminale e due in posizione C- terminale rispetto al dominio GSG; queste regioni consentono a Sam68 di poter interagire con domini SH3 e WW di altre proteine. Esperimenti di delezione e mutagenesi di questa RBP hanno dimostrato che le regioni P0, P3, P4, e P5 sono 13

14 responsabili dell interazione con il dominio SH3 di src (Derry, J.J. et al., 2000). Questa associazione è fondamentale affinché questa chinasi fosforili in tirosina Sam68. I dominio P1, P3 e P4 associano con il dominio SH3 della subunità p85 della PI3K (Taylor, S.J. et al., 1995), mentre il dominio SH3 della proteina Sik/BRK nonché quelli delle proteine Itk, Tec e BTK mostrano un affinità maggiore per la regione P3 (Andreotti, A.H. et al., 1997). La proteina PLCγ-1 interagisce con le regioni P3 e P4. (Maa, M.C. et al., 1994), mentre il dominio SH3 carbossi-terminale della proteina Vav1 si associa esclusivamente con la regione P0 (Lazer, G. et al., 2007). È stata inoltre dimostrata l interazione diretta di Sam68 con i domini SH3 di PRMT2 (Espejo, A. et al., 2002), di Grb-2, di Grap (Trub, T. et al., 19) e di Nck (Lawe, D.C. et al., 1997). Le regioni ricche in prolina possono inoltre associarsi ai domini WW delle proteine FBP21 e FBP30 (Bedford, M.T et al., 1998). La metilazione dei residui di arginina di Sam68 inibisce le interazioni con i domini SH3 ma non con quelli WW. Visto che le proteine FBP21 e FBP30 sono caratterizzate da localizzazione nucleare, questa modificazione post-traduzionale potrebbe far si che Sam68 prenda parte maggiormente a processi nucleari a scapito di quelli citoplasmatici (Arning, S. et al., 1996). La regione carbossi-terminale di tutte le proteine STAR è caratterizzata dalla presenza di residui di tirosina che possono essere fosforilati da molte chinasi, oltre alla già citata p60 src, tra cui: p59 fyn (Richard, S. et al., 1995), p56 lck (Vogel, L.B. et al., 1995), ZAP-70 (Lang, V. et al., 1997) e Sik/BRK (Derry, J.J et al., 2000). Questa modificazione post-traduzionale permette a Sam68 di poter interagire con i domini SH2 di proteine tra cui: la subunità p85 della PI3K (Taylor, S.J. et al., 1995), PLCγ-1 (Maa, M.C et al., 1994), Sik/BRK (Derry, J.J. et al., 2000), Grb-2, Grap (Trub, T. et al., 1997), Itk/Tec/BTK (Andreotti, A.H. et al., 1997), Nck (Lawe, D.C. et al., 1997) e RasGAP (Richard, S. et al., 1995). La fosforilazione in tirosina, inoltre, diminuisce drasticamente l affinità di Sam68 per l RNA. È interessante notare che l interazione di Sam68 con domini SH3 di altre proteine ne impedisce il legame con l RNA; è quindi probabile che l associazione di questa proteina con altre molecole adattatrici la faccia dissociare dai suoi RNA target. Le RGG box, regioni ricche in arginina e glicina, fiancheggiano le sequenza ricche in prolina e costituiscono potenziali siti di metilazione, reazione catalizzata 14

15 dall enzima PRMT1(Protein-arginine N-methyltransferase). La metilazione di residui di arginina non è un meccanismo di regolazione rapido come la fosforilazione in tirosina, è irreversibile e non influenza l affinità per l RNA come quest ultima. Di conseguenza esso rappresenta, probabilmente, un processo di maturazione richiesto per il corretto funzionamento e per la traslocazione nucleare della proteina sintetizzata de novo (Gary, J.D et al., 1998; Cote, J. et al., 2003). Sam68 possiede un segnale di localizzazione nucleare (NLS, Nuclear Localization Signal) di 24 aminoacidi situato nella regione carbossi-terminale del polipeptide che le consente di localizzarsi a livello nucleare (Ishidate, T. et al., 1997); è bene precisare che sebbene questa proteina sia principalmente localizzata nel nucleo, osservazioni sperimentali condotte su neuroni, fibroblasti, adipociti e spermatociti infettati da virus, indicano la sua presenza anche a livello citoplasmatico (McBride, A. E. et al., 1998; Paronetto M. P. et al., 2006; Ben Fredj N. et al., 2006; Lazer G. et al., 2007). Le proprietà biochimiche di Sam68 sono influenzate da altre modificazioni post-traduzionali oltre quelle già citate: l acetilazione aumenta la sua affinità per l RNA (Babic, I. et al., 2004), mentre la sumolazione catalizzata dell enzima SUMO E3 ligasi promuovea la sua capacità di reprimere la trascrizione (Babic, I. et al., 2006) Ruolo di Sam68 nei processi cellulari. Sam68 prende parte a numerosi processi cellulari. Questa RBP è coinvolta in molteplici fasi del metabolismo dell RNA, come la trascrizione, lo splicing alternativo e la traduzione di mrna bersaglio; inoltre, agendo come proteina adattatrice, potenzia le vie di segnale stimolate dalle chinasi della famiglia di Src (Paronetto, M.P. et al., 2003) ed interagisce con varie proteine coinvolte nella trasduzione del segnale attivata dai recettori per i fattori di crescita (Lukong, K.E. and Richard, S., 2003); Sam68 promuove l adesione e la motilità cellulare (Huot, M.E. et al., 2009b) ed è coinvolta nella risposta allo stress genotossico (Busà, R. et al., 2010). 15

16 Ruolo di Sam68 nel signalling cellulare. Nei linfociti T la stimolazione del recettore TCR e la conseguente attivazione delle chinasi della famiglia src p56 lck e p59 fyn porta all aumento della fosforilazione in tirosina di Sam68 promuovendone l interazione con varie molecole coinvolte nella trasduzione del segnale del TCR, tra cui PI3K, PLCγ-1 e di Grb-2; anche l Itk, è in grado di interagire tramite il suo dominio SH3 con Sam68 e di fosforilarla (Najib, S., et al, 2005). Nei monociti e nei linfociti, Sam68 è coinvolta nella trasduzione del segnale di un altro recettore di membrana, l Ob-R, il recettore della leptina (Sanchez- Margalet, V. et al., 2003). Ugualmente ad altri recettori per le citochine, questa proteina di membrana manca di un attività tirosin-chinasica intrinseca, ma è in grado di attivare la pathway delle JAK/STAT promuovendo fosforilazione di molte proteine, tra cui Sam68 (Najib, S. et al., 2005). Nelle cellule di epatoma di ratto transfettate con il recettore umano per l insulina (HTC-IR), la stimolazione con questo ormone promuove la fosforilazione in tirosina di Sam68; questo effetto è dose-dipendente, rapido e reversibile (Sanchez- Margalet, V e Najib, S. 1999); la proteina fosforilata può essere reclutata da differenti complessi attivati dalla cascata di trasduzione del recettore dell insulina; negli adipociti Sam68, quando fosforilata in tirosina, è in grado di formare un complesso ternario con la PI3K e con IRS-1 e di reclutare tramite il suo dominio SH2 la proteina Ras-GAP, in grado di attivare il pathway di Ras; inoltre nelle cellule HTC-IR Sam68 è associato costitutivamente a Grb2 ed in seguito a stimolazione con insulina essa è in grado di reclutare la proteina GAP nel complesso Grb2-SOS-Ras, con conseguente aumento dell attività GTPasica e di scambio GDP/GTP fondamentale per l attività di Ras (Najib, S. e Sanchez-Margalet, V. 2002). Numerosi studi svolti negli ultimi anni hanno evidenziato il ruolo di questa proteina nelle pathways di trasduzione del segnale, spesso alterati, delle cellule neoplastiche. Paronetto e collaboratori hanno dimostrato che l assemblaggio del complesso ternario Sam68/PLCγ/Fyn è stimolato dall espressione di una forma troncata del RTK (RTK, Receptor Tyrosine Kinase) c-kit, espresso in maniera aberrante in un sottotipo di cancro alla prostata (PCa). L espressione di questo recettore correla con un aumento della fosforilazione in tirosina di Sam68 (Paronetto, 16

17 M.P. et al., 2004). Nelle cellule di cancro alla mammella, in seguito a stimolazione con EGF, la chinasi BRK promuove la fosforilazione di Sam68, diminuendone l affinità per l RNA e promuovendo una sua rilocalizzazione transiente nel citoplasma (Lukong, K.E. et al., 2005); è importante sottolineare che in queste cellule la BRK e Sam68 sono iper-espresse e promuovono entrambe la proliferazione e l invasività cellulare (Ostander, J.H. et al., 2010; Song, L. et al., 2010). Infine, Sam68 è coinvolta nella regolazione della migrazione cellulare: il silenziamento di Sam68 nelle cellule Hela è associato ad una drastica diminuzione delle capacità migratorie di queste cellule (Huot, M.E. et al., 2009b), mentre fibroblasti embrionali murini Sam68 -/- sono caratterizzati da difetti nell organizzazione del citoscheletro di actina (Huot, M.E et al., 2009a) Ruolo di Sam68 nella trascrizione. Numerosi studi indicano Sam68 come l anello di congiunzione tra la trasduzione del segnale e la trascrizione genica. Questa proteina è in grado di inibire la trascrizione mediata dal cofattore della trascrizione CBP, legandosi ad esso e impedendo il legame con molecole che ne promuovono l attività (Hong, W. et al., 2002). CBP controlla la trascrizione di geni codificanti per proteine che regolano il ciclo cellulare, come la ciclina D1 e la ciclina E; in linea con queste osservazioni, l iperespressione di Sam68 nelle cellule NIH- 3T3 è associata ad una repressione della trascrizione di queste cicline (Taylor, S.J. et al., 2004). Recenti studi hanno dimostrato che la di repressione della trascrizione del gene della ciclina D1 (CCND1) può avvenire anche con un meccanismo che coinvolge il fattore di splicing SF2/ASF. Questa RBP favorisce la SUMOilazione di Sam68 catalizzata dell enzima PIAS1; in seguito a questa modificazione Sam68 è in grado di legare l enzima istone de-acetilasi, inibendo in questo modo la trascrizione a partire dal promotore di CCND1 (Pelisch, F. et al., 2010). Nelle cellule di cancro alla prostata PCa, Sam68 è iperespressa ed interagisce con il recettore degli androgeni AR aumentandone la capacità trascrizionale. Anche la ciclina D1 è in grado di legare l AR, ma il suo effetto è contrario rispetto a quello di Sam68: Questa RBP promuove, quindi, l attività del recettore AR sia tramite 17

18 un interazione diretta sia indirettamente reprimendo la trascrizione del gene per la ciclinad1 (Rajan,P. et al., 2008) (Figura 6). Figura 6. Modello schematico del ruolo di Sam68 nella regolazione della trascrizione. Repressione della trascrizione dei geni target di CBP:Sam68 interagisce con CBP, competendo con fattori necessari per la trascrizione e promuovendoo il legame di fattori repressori della trascrizione (TF); Sam68 interagisce direttamente con il recettore per gli androgeni AR promuovendo la trascrizione dei geni target (es:psa); il complesso PIAS1-SF2/ASF modifica Sam68 per SUMOilazione determinandone il legame con la istone de-acetilasi (HDAC) e la conseguente repressione della trascrizione del gene codificante la ciclina D Ruolo di Sam68 nello splicing alternativo Lo splicing alternativo è un processo che, tramite un diverso arrangiamento degli esoni, permette a molti geni umani di trascrivere RNA messaggeri maturi differenti a partire da un unico precursore; questo particolare meccanismo di maturazione dei trascritti è stato una conquista chiave nell evoluzione degli organismi superiori in quanto rappresenta un raffinato meccanismo di generazione della diversità. Alla scelta di quali esoni variabili includere nell mrna maturo partecipano, oltre al canonico apparato dello spliceosoma, molti altri fattori, come ad esempio le proteine SR e le ribonucleoproteine hnrnp, che contribuiscono quindi al complesso meccanismo di regolazione dello splicing alternativo (Black,D.L. 2003). 18

19 Grossman e collaboratori furono i primi a suggerire un possibile ruolo di Sam68 nello splicing alternativo; questi ricercatori osservarono che Sam68 era in grado di legare un tratto ricco in pirimidine localizzato vicino ad un sito di splicing del premrna della β-tropomiosina insieme alla proteina U2AF65, coinvolta nel processa mento di questo messaggero (Grossman, J.S. et al., 1998); ma la vera conferma del coinvolgimento di Sam68 in questo meccanismo arrivò solamente qualche anno dopo, quando ne fu dimostrato il ruolo diretto nel processamento del pre-mrna di CD44. Questa glicoproteina transmembrana è coinvolta nell adesione, nella proliferazione e nella migrazione cellulare. Questa capacità di CD44 di intervenire in diversi processi cellulari risiede nel meccanismo di processamento alternativo del suo pre-mrna, che può essere processato in circa 20 mrna alternativi. Il gene CD44 è, infatti, composto da dieci esoni costitutivi, presenti cioè in tutte le isoforme, e dieci esoni variabili, posti tra gli esoni costitutivi c5 e c6 (Figura 7), codificanti per domini localizzati nella regione extracellulare della proteina. Di conseguenza queste isoforme proteiche sono caratterizzate da differente affinità per la matrice extracellulare nonché da una diversa abilità di interagire con fattori di crescita e di rendere la cellula pronta a rispondere a stimoli extracellulari (Cheng, C. and Sharp, P.A., 2006). In particolare l espressione delle isoforme contenenti l esone variabile 5 (CD44v5) conferisce alle cellule capacità migratorie ed è riscontrabile durante il movimento delle cellule T e durante la fase invasiva di molti tumori (Matter, N. et al., 2002). Sam68, quando fosforilata in serina e treonina in seguito ad attivazione della pathway Ras/MAPK, promuove l inclusione dell esone variabile v5 del mrna maturo di CD44 (Matter, N. et al., 2002). Studi successivi hanno dimostrato che la fosforilazione in serina e treonina, oltre ad aumentare l affinità di Sam68 per l RNA, ne promuove il legame con la proteina di rimodellamento della cromatina Brm e con ribonucleoproteina U5; la formazione di questo complesso sul pre-mrna di CD44 rallenta la RNA polimerasi II, consentendo l inclusione di esoni alternativi (Batschè, E. et al., 2006). Infine, l abolizione dell espressione di Sam68 nelle cellule Hela riduce l inclusone anche di altri esoni variabili di CD44 (Cheng, C. and Sharp, P.A., 2006). 19

20 Figura 7. Splicing alternativo del gene CD44. Il gene di CD44 è composto da 10 esoni costitutivi (in arancione) e 10 esoni variabili (in blu), soggetti a eventi di splicing alternativo. Sam68, quando fosforilato dalle chinasi della famiglia MAP, promuove l inclusione dell esone 5 nell mrna maturo di CD44. Il complesso Bmr/Sam68 regola inoltre lo splicing dell mrna policistronico del papilloma virus ed anche in questo caso l attività di Sam68 è regolata dalla sua fosforilazione da parte delle MAPK (Rosemnberger,S. et al., 2010). La ciclina D1 è un proto-oncogene che codifica per due isoforme, la variante D1a, full-lenght, ed una variante più corta, la ciclina D1b, che viene trascritta in seguito alla mancata eliminazione dell introne 4 dal pre-mrna, evento che porta alla prematura terminazione della traduzione (Figura 8); la variante breve è caratterizzata da un attività trasformante maggiore rispetto all isoforma full-lenght, sebbene non se ne conoscano le ragioni (Knudsen, K.E 2006). Nelle linea cellulare di carcinoma prostatico PCa, Sam68, quando fosforilata dalle chinasi MAP, promuove l espressione dell isoforma D1b legando una sequenza all interno dell introne 4 del pre-mrna ed impedendone l excisione. In linea con queste osservazioni lo splicing alternativo della ciclina D1 è stimolato dall espressione di una forma oncogenica di Ras, mentre l over-espressione della tirosin-chinasi Fyn, appartenente alla famiglia src, abolisce completamente l espressione della variante D1b. La fosforilazione in tirosina, come già precedentemente sottolineato, diminuisce l affinità di Sam68 per l RNA, impedendo il legame si questa proteina con l introne 4, e permettendo alle ribonucleoproteine dello spliceosoma di legarsi al pre-mrna e procedere nell eliminazione dell introne (Paronetto, M.P et al., 2010). 20

21 Figura 8. Splicing alternativo del gene codificante per la ciclina D1. Quando fosforilata dalle MAPK, Sam68 si lega al pre-mrna in corrispondenza dell introne 4, promuovendo l interruzione prematura della traduzione e la conseguente codifica della variante D1b, con attività trasformante; la fosforilazione in tirosina di questa RBP è, al contrario, correlata con una diminuzione della sua affinità per l RNA; ciò permette l espressione dell isoforma canonica full-lenght D1a. Il gene BCL-X codifica per due isoforme con effetti sulla sopravvivenza cellulare diametralmente opposti. L esone 2 di questo gene contiene infatti due siti di splicing in 5 alternativi; la scelta di quello prossimale porta alla traduzione della proteina Bcl-X L, cioè l isoforma di maggior dimensione e con proprietà antiapoptotiche, mentre la scelta del sito distale porta alla codifica della variante breve, Bcl-X S, una proteina con proprietà pro-apoptotiche (Figura 9). Nelle cellule HEK293 l iper-espressione di Sam68 promuove lo splicing della variante pro-apoptotica Bcl-X S (Paronetto, M.P., et al., 2007). Questo studio suggerirebbe quindi che l up-regolazione di Sam68 danneggi la sopravvivenza cellulare;questa osservazione è però smentita dal fatto che nelle linee cellulari derivanti da carcinoma prostatico sia Sam68 si Bcl-X L sono espresse ad alti livelli. (Mercatante, D.R et al., 2002, Busa, R. et al., 2007). D altro canto, la completa abolizione di questa RBP nelle cellule PCa causa una marcata diminuzione dei livelli di espressione di Bcl-X L (Busà, R. et al., 2007); questi risultati apparentemente in conflitto potrebbero essere spiegati dall osservazione che la fosforilazione in tirosina di Sam68 mediata delle chinasi della famiglia Src, estremamente attive in queste cellule, promuove lo splicing dell isoforma Bcl-X L. (Paronetto, M.P. et al., 2007). 21

22 Figura 9. Sam68 regola lo splicing del gene BclX. Sam68 è necessario per lo splicing dell isoforma BclXs; d altronde, quando fosforilata in tirosina, l affinità di questa RBP per l RNA diminuisce e viene tradotta la variante BclXl. Sam68 è coinvolto anche in splicing di messaggeri che codificano per proteine coinvolte nel differenziamento cellulare. Chawla ed il suo gruppo hanno dimostrato che questa proteina è necessario per il differenziamento delle cellule neuronali, in quanto regola lo splicing di molti mrna aventi un ruolo chiave nella neurogenesi (Chawla, G. et al., 2009) ed il cui alterato processamento potrebbe essere alla base dei difetti nella coordinazione motoria osservati nei topi Sam68 -/- (Lukong, K.E. and Richard, S. 2008). L attività di Sam68 non è rilevante solamente nei processi fisiologici, ma è coinvolta anche nella patogenesi di malattie neurodegenerative; in pazienti affetti da atrofia spinale muscolare, Sam68 promuove lo splicing alternativo del gene SMN2 con conseguente espressione di una proteina non funzionale (Pedrotti, S. and Sette, C., 2010). Nelle cellule di pazienti affetti da sindrome del tremore e atassia legata all X fragile, Sam68 è sequestrata in aggregati di RNA, agendo come centro di reclutamento per altre molecole coinvolte nella maturazione dell RNA; questo meccanismo potrebbe essere la causa dei difetti nella maturazione degli mrna che caratterizzano la patogenesi di questa malattia (Sellier, C. et al., 2010). 22

23 Ruolo di Sam68 nella risposta allo stress genotossico Le cellule hanno sviluppato meccanismi di difesa per far fronte a svariate tipologie di stress che perturbano la loro omeostasi, come lo stress ossidativo e lo shock al calore o contro agenti che possono danneggiare l integrità del genoma, come i raggi ultravioletti e agenti alchilanti. A seconda della natura e della durata dello stress, la cellula adotta meccanismi differenti per limitare e riparare i danni, come l arresto del ciclo cellulare e l attivazione di meccanismi di riparo del DNA; se tuttavia, tutto ciò non è sufficiente, se il danno è troppo esteso, le cellule attivano il programma di morte. La risposta cellulare allo stress genotossico è estremamente complessa, ma molto studiata date le forti implicazioni cliniche nella chemioterapia; molti farmaci chemioterapici inducono infatti la rottura della doppia elica del DNA direttamente o indirettamente, alterando l attività di enzimi coinvolti nella processazione del DNA, come le topoisomerasi. Sebbene in seguito al trattamento con questi farmaci, la maggior parte delle cellule va incontro ad apoptosi, alcune cellule neoplastiche adottano meccanismi di risposta allo stress, i quali le rendono resistenti alla chemioterapia. Recenti studi dimostrano che lo stress genotossico induce in queste cellule modificazioni nel profilo di espressione dovute a cambiamenti nello splicing alternativo (Biamonti, G. and Caceres, J.F., 2009). Il silenziamento di Sam68 nelle cellule LNCaP, cellule androgeno-responsive derivate da carcinoma prostatico, è stato associato ad una maggiore sensibilizzazione all apoptosi indotta da cisplatino e ectoposide. Inoltre è stato dimostrato che il trattamento con mitoxantrone, un inibitore della topoisomerasi II, determina nella linea cellulare di carcinoma prostatatico PC3, una rilocalizzazione di Sam68, che da una diffusa distribuzione nucleoplasmatica, passa ad una distribuzione in aree ben distinte dall apparenza granulare, presenti sia a livello nucleare che citoplasmatico. È stata avanzata l ipotesi che tali granuli nucleari e citoplasmatici indotti dallo stress genotossico rappresentino foci trascrizionalmente attive.. Questa ipotesi è avvalorata dalla presenza di altre RBP coinvolte nello splicing alternativo, come TIA -1, hnrnp A1, e ASF/SF2 e all RNA polimerasi II in forma attiva; si può quindi dedurre che questi granuli costituiscono delle foci trascrizionalmente attive (Figura 10). Infine la rilocalizzazione di Sam68 indotta dal mitoxantrone correla con l aumento dell espressione dell isoforma CD44v5; è quindi probabile che la 23

24 compartimentalizzazione di Sam68 e degli altri fattori di splicing in queste foci permetta alla cellula di ridirezionare gli eventi di splicing alternativo, aumentando la traduzione di quelle isoforme proteiche che aumentano la sopravvivenza cellulare e la risposta al danno al DNA. (Busà, R. et al., 2010). Figura 10. La rilocalizzazione di Sam68 è un evento fondamentale nella risposta allo stress genotossico. Le cellule PC3 sono state trattate per 24h con mitoxantrone 5µM e sottoposte ad analisi confocale utilizzando anticorpi specifci per Sam68 (colorazione rossa) e per altre proteine coinvolte nello splicing e nella trascrizione delle RNA (colore verde); in particolare (a) anti- hnrnp A1; (b) anti-tia-1; (c)anti- ASF/SF2; (d) H5 antl RNApol II fosforilata 1.4. Ruolo di Sam68 nei processi fisiologici Lo sviluppo di un modello murino knockout per Sam68 ha permesso di identificare i processi fisiologici in cui questa proteina è coinvolta. Questo modello è caratterizzato da un alta mortalità subito dopo la nascita dovuta a cause ancora sconosciute; tuttavia, gli animali che sopravvivono al periodo perinatale mostrano, contro ogni aspettativa, una durata della vita normale. I topi Sam68 -/- non mostrano un aumento della frequenza di tumori o di malattie autoimmunitarie e di altra causa. Gli animali giovani mostrano una massa ossea del tutto simile a quella dei loro coetanei wild type, e la conservano anche durante la vecchiaia (dopo i 12 mesi di età), non andando incontro all osteoporosi fisiologica indotta dall età; la perdita di 24

25 densità ossea dovuta all età è sempre accompagnata ad un aumento della differenziazione della linea mesenchimale nella linea adipocitaria a scapito di quella osteoblatica; il differente metabolismo osseo dei topi Sam68 -/- è presumibilmente imputabile al fatto che le cellule mesenchimali di questi animali si differenziano quasi esclusivamente in osteoblasti, mentre la differenziazione in adipociti è gravemente compromessa, a prescindere dall età dell animale (Richard, S. et al., 2005). Sam68 è coinvolta anche nel differenziamento delle cellule del sistema nervoso: infatti, come già accennato nel paragrafo 1.3.3, in seguito ad abolizione dell espressione si Sam68, le cellule progenitrici neuronali non sono più in grado di differenziarsi. I topi Sam68 -/- mostrano, difetti nella coordinazione motoria ma non nella neurogenesi; è possibile quindi che i difetti che caratterizzano in vitro questo processo siano causati da una perdita di funzioni cellulari generali, come il controllo del ciclo cellulare; un altra ipotesi è quella che in vivo Sam68 sia sostituita nel suo ruolo da altre proteine, come Slm-1 e Slm-2, appartenenti alla sua stessa famiglia (Chawla, G. et al., 2009). Infine, le femmine di topo Sam68 -/- non sviluppano organi sessuali completi: lo sviluppo dellla ghiandola mammaria e dell utero risultano incompleti negli animali di 6 settimane, con un recupero solo parziale alla dodicesima settimana di età (Richard, S. et al., 2008); inoltre le femmine Sam68 -/- sono caratterizzate da una riduzione del numero dei follicoli ovarici sviluppati, da un alterato ciclo mestruale e da una fertilità ridotta rispetto alle femmine wild type; parallelamente nei maschi Sam68 -/- la fertilità cala drasticamente, in quanto Sam68 regola la trascrizione, lo splicing, e la stabilità di molti mrna fondamentali nella spermatogenesi (Paronetto, M.P., et al., 2009) Sam68 nelle neoplasie umane. Fin da quando Sam68 fu caratterizzata come substrato della chinasi Src, è stato sempre stato ipotizzato un suo ruolo nella trasformazione neoplastica (Fumagalli, et al., 1994). Gli studi iniziali identificarono Sam68 come un oncosoppressore: l overespressione di Sam68 in cellule NIH3T3 causa l arresto del ciclo cellulare in G1 e 25

26 l induzione dell apoptosi (Taylor, S.J. et al., 2004), mentre l abolizione della sua espressione in queste cellule è associata ad una crescita ancoraggio-indipendente nonché alla capacità di formare metastasi quando iniettate nei topi nudi. La reintroduzione di Sam68 in queste cellule, tuttavia, non reverte il fenotipo, suggerendo che la trasformazione cellulare sia sostenuta anche da altri fattori (Liu, K. et al., 2000); Tuttavia, studi più recenti suggeriscono per questa proteina il ruolo di protooncogene. Infatti, nei topi Sam68 -/- non si osserva un aumento della frequenza di sviluppo di neoplasie in vivo rispetto ai topi wild type, come accadrebbe se Sam68 fosse un oncosoppressore. Inoltre, analisi immunoistochimiche indicano che Sam68 è over-espressa nei tessuti dei pazienti affetti da tumore alla prostata (Busà, R. et al., 2007), alla mammella (Song, L. et al., 201) e da carcinoma renale (Zhang, Z. et al., 2009). L attivazione costitutiva di Src nelle cellule di PCa dovuta all espressione del recettore troncato c-kit stimola la fosforilazione di Sam68 sia in vivo che in vitro (Paronetto, M.P. et al., 2004); l espressione di questa RBP è, inoltre, fondamentale per la proliferazione nonché per la resistenza ai farmaci chemioterapici (Busà, R. et al., 2007; Busà, R. et al., 2010) contribuendo così alla sopravvivenza delle cellule di tumore alla prostata; fondamentale è la sua abilità di modulare gli eventi di splicing di geni come CD44, BclX e CiclinaD favorendo l espressione di isoforme che favoriscono la proliferazione, la migrazione e la resistenza all apoptosi. Infine, Sam68 favorisce l espressione del recettore per l androgeno (AR) e la sua attività trascrizionale, molto importante nell oncogenesi prostatica. Nelle linee cellulari di cancro alla mammella la deplezione di Sam68 provoca un aumento dell espressione di p21 e p27, inibitori delle chinasi ciclina-dipendenti, riduce la fosforilazione della proteina Rb e della proteina Akt, con conseguente attivazione dei fattori di trascrizione della famiglia FOXO e arresto del ciclo cellulare (Song, L. et al., 2010). Questi risultati sono in linea con quelli ottenuti in vivo: nei topi l aploinsufficienza di Sam68 nelle cellule della mammella ritarda l insorgenza di tumori alla ghiandola mammaria indotti dall espressione dell oncogene del polioma virus PyMT e riduce la disseminazione delle metastasi in vivo (Richard, S. et al., 2008). 26

27 L aumento dell espressione di Sam68 correla con una cattiva prognosi sia nel carcinome alla mammella (Song, L. et al., 2010) che in quello renale (Zhang, Z. et al., 2009); in entrambi i casi, inoltre la localizzazione citoplasmatica di questa proteina rappresenta un fattore indipendente di prognosi negativa. È possibile che nel citoplasma delle cellule tumorali in stadio avanzato Sam68, interagendo con proteine coinvolte nella traduzione e con i polisomi (Paronetto, M.P. et al., 2009) contribuisca non solo allo splicing ma anche alla traduzione di geni coinvolti nella trasformazione neoplastica. Anche l interazione altre proteine citoplasmatiche risulta estremamente importante ai fini delle sue proprietà trasformanti: RET/PTC2 e RETMEN2B, due oncogeni implicati nella patogenesi di tumori alla tiroide stimolano la fosforilazione di Sam68 anche se non si è ancora indagato a fondo sulla rilevanza di questo evento (Gorla, L. et al., 2006). Approcci proteomici individuano inoltre Sam68 come una delle proteine associate al dominio SH3 carbossi terminale di Vav1, una GNEF (Guanine nucleotide Exchange Factors) di Rac. Mutazioni del dominio SH3 di Vav1 che ne impediscono il legame con Sam68 aboliscono anche il potenziale trasformante Di Vav1, mentre la co-espressione di queste due proteine nei fibroblasti NIH-3T3 promuove la trasformazione (Lazer, G. et al., 2007). La leucemia mieloide acuta è una neoplasia caratterizzata da traslocazioni cromosomiche che portano all espressione di proteine di fusione oncogeniche, come MLL-EEN, (So, C.W. et al., 1997). Questa proteina chimerica possiede un dominio SH3 necessario per le sue capacità trasformanti, in grado di legare quattro regioni ricche in prolina di Sam68; la soppressione dell espressione di Sam68 abolisce la trasformazione mediata dall oncogene MLL-EEN, confermando il ruolo critico della RBP nella via di trasduzione di questo oncogene. (Cheung, N. et al., 2007) Il linfoma anaplastico a grandi cellule. Il linfoma anaplastico a grandi cellule (ALCL, Anaplastic Large Cell Lymphoma) è un tipo di linfoma non Hodgkin s (NHL), definito per la prima volta nel 1985 come linfoma pleiomorfico a cellule grandi e caratterizzato da una morfologia anaplastica, frequente infiltrazione dei seni linfoidali e forte espressione dell antigene Ki-1, oggi più diffusamente conosciuto come antigene CD30 (Stein, H. 27

28 et al., 1985). A causa della loro inusuale modalità di crescita, in passato gli ALCL sono stati spesso erroneamente diagnosticati e scambiati per carcinomi metastatici, istiocitosi maligne o melanomi. Di fatto, l espressione dell antigene CD30 non è una caratteristica strettamente distintiva degli ALCL, dato che può essere presente in altre forme neoplastiche, incluse patologie sia di tipo NHL, sia di tipo Hodgkin s e in casi di carcinoma embrionale (Chiarle, R. et al., 1999). A complicare ulteriormente la diagnosi di ALCL, è l esistenza di diverse varianti; oltre al sottotipo predominante, sono state, infatti, identificate varianti più rare di tipo pleiomorfico, monomorfico, a piccole cellule, varianti correlate a patologia Hodgkin s-simile, varianti linfoistiocitiche dove un gran numero di istiociti sono frammisti a cellule tumorali e forme con quadro istologico sarcomatoide ricco di cellule giganti e neutrofile (Kadin, M. E., 1997; Chan, J. K. 1998; Kinney, M. C., and Kadin, M. E., 1999; Skinnider, B. F. et al., 1999) (Figura 11). A B A A C A D E A A Figura11. Varianti istologiche degli ALCLs ALK-positivi. Colorazione ematossilina-eosina di sezioni di linfonodo in paraffina. (A) Variante pleiomorfica: le cellule sono displastiche, con nuclei a bordi frastagliati e abbondante citoplasma eosinofilo. Tra le varianti pleomorfiche sono comprese forme rare come la sarcomatosa che qui non è mostrata a causa della sua rarità; (B) Variante monomorfica: le cellule hanno dimensioni medie, poco differenti tra loro e nuclei sottili; (C) Variante a piccole cellule : è caratterizzata dalla predominanza di piccoli linfociti irregolari, e qualche cellula tumorale di grandi dimensioni; (D) Variante linfoistiocitica: è costituita da piccoli linfociti, istiociti plasmacitoidi e poche cellule tumorali di maggiori dimensioni; (E) Variante Hodgkin s-simile: le cellule hanno l aspetto di cellule di Reed-Sternberg con grandi nucleoli. 28

29 Anche le manifestazioni cliniche sono notevolmente eterogenee e possono includere presentazioni sistemiche nodali o extra-nodali oppure presentazioni primarie e cutanee. Gli ALCL si possono, inoltre, manifestare secondariamente in pazienti con positività per il virus HIV o in seguito ad altri disturbi linfoproliferativi (Morris, S. W. et al., 2001). Il fenotipo degli ALCL è prevalentemente di tipo T o nullo e, più raramente, di tipo B (Gascoyne, R. D. et al., 1999). Deve essere comunque sottolineato che la maggior parte degli studiosi non considera le forme a cellule B come ALCL; infatti, entrambe le classificazioni REAL (Revised European American Lymphome) e WHO (World Health Organisation) escludono i casi a fenotipo B dagli ALCL, collocandoli in una categoria distinta e definita come linfoma diffuso a grandi cellule B (Harris, N. L. et al., 1994). L ALCL è un tumore relativamente infrequente; esso infatti rappresenta meno del 5% dei NHL ed il 10-20% delle forme ad alto grado di aggressività nei pazienti adulti (Kadin, M. E. and Morris, S. W., 1998), mentre mostra un picco di incidenza nell infanzia, dove rappresenta circa il 40% dei linfomi non Hodgkin s diagnosticati nei pazienti pediatrici (Sandlund, J. T. et al., 1994). Alla fine degli anni ottanta, poco dopo l iniziale definizione dell ALCL, un alterazione citogenetica, e più precisamente la traslocazione cromosomica t(2;5)(p23;q35), è stata descritta nel 45% dei casi (Kaneko, Y. et al., 1989; LeBeau, M. M. et al.,1989; Rimokh, R. et al., 1989; Bitter, M. A. et al., 1990; Mason, D. Y. et al., 1990). Successivamente, nel 1994, il gruppo di Morris S. W. ha identificato i geni coinvolti in questa traslocazione cromosomica e più precisamente il gene che codifica per la nucleofosmina (NPM) (presente sul locus 5q35) ed un nuovo gene (localizzato nel locus 2p23) codificante per un recettore ad attività tirosin-chinasica, per questo originariamente denominato chinasi del linfoma anaplastico (ALK, Anaplastic Lymphoma Kinase) (Morris, S. W. et al., 1994). La caratterizzazione molecolare di questa traslocazione è stata particolarmente rilevante in campo diagnostico, portando alla definizione di una nuova entità tumorale nell ambito dell eterogeneo gruppo degli ALCLs, in base alla presenza dell espressione aberrante del gene ALK e denominata linfoma ALK positivo (Benharroch, D. et al., 1998), o più informalmente ALKoma. 29

30 In base agli studi effettuati su un numero ampio di pazienti affetti da ALCL, è risultato che i linfomi ALK-positivi hanno generalmente una prognosi migliore rispetto a quelli ALK-negativi (Sandlund, J. T. et al., 1994; Shiota, M. et al., 1995; Nakamura, S. et al., 1997), sebbene bisogna tener conto che questa differenza risente anche della più giovane età della popolazione colpita da linfomi ALK-positivi. Oltre alla proteina di fusione NPM/ALK, riscontrata con una frequenza pari al 70-80% dei casi di ALKoma (Jaffe, E. S. et al., 2001), altri riarrangiamenti cromosomici sono stati descritti negli ALCL ALK-positivi, suggerendo meccanismi multipli dell'attivazione di ALK nella linfomagenesi. Le proteine di fusione di ALK descritte negli ALCL ALK-positivi, condividono alcune caratteristiche comuni. Innanzitutto sono tutte proteine ampiamente espresse nelle cellule ematopoietiche; di conseguenza il promotore che ne controlla la trascrizione determina inevitabilmente l espressione aberrante della porzione citoplasmatica di ALK ad esse fusa. In secondo luogo, la loro localizzazione cellulare influenza profondamente quella del prodotto di fusione. Infine, generalmente esse presentano domini di oligomerizzazione, che possono essere alla base dell attivazione costitutiva di ALK e quindi delle proprietà oncogeniche della proteina chimerica. (Fujimoto, J. et al., 1996; Rosenwald, A. et al., 1999; Puldorf, K. et al., 1999; Ma, Z. et al., 2000; Touriol, C. et al., 2000; Trinei, M. et al., 2000; Tort, F. et al., 2001) Il recettore tirosin-chinasi ALK. Il gene che codifica per l intera proteina ALK è stato clonato nel 1997 contemporaneamente da due gruppi di ricerca (Iwahara, T. et al., 1997; Morris, S.W. et al., 1997). In base ad omologie di sequenza, il recettore ALK è stato collocato nella famiglia dei recettori per l insulina, della quale fanno parte anche il recettore tirosin chinasi di tipo leucocitario (LTK, Leucocyte Tyrosine Kinase), il recettore per il fattore di crescita insulinico di tipo I (IGFR-1), i recettori TRK per la neurotrofica, MET e cros (Fantl, J. et al., 1993; Huff, J. L. et al., 1993; Gaudino, G. et al., 1994; Barbacid, G., 1995). Nell uomo il gene composto da 6226bp (Genebank accession number U66559) codifica per una proteina di 177 kda, ma modificazioni posttrascrizionali, quali la N-glicosilazione, determinano un aumento delle dimensioni 30

31 fino a 200 kda (Morris, S. W. et al., 1994; Pulford, K. Et al., 1997; Lamant, L. et al., 2000). Il recettore ALK, che appare estremamente conservato tra le varie specie, è rappresentato da una singola catena polipeptidica di 1620 aa nell uomo, aa nel topo e aa nel moscerino della frutta (Iwahara,T. et al., 1997; Morris et al., 1997; Loren, C.E. et al., 2001). Come tutti i recettori tirosin-chinasici, è costituito da una porzione extracellulare, un dominio transmembrana ed una regione citoplasmatica in cui risiede l attività catalitica. Nella proteina umana (Figura 12) la regione extracellulare di 1030 aa contiene 26 aminoacidi idrofobici all estremità amino-terminale che costituiscono il peptide segnale. Il sito di legame per i ligandi endogeni finora scoperti, cioè la pleiotropina (PTN) e midkine (MK), si trova tra i residui (Stoica, G.E. et al., 2001; Stoica, G.E. et al., 2002). La regione extracellulare possiede anche sedici siti consenso per la N-glicosilazione (Asn-X-Ser/Thr), mentre i ventisei residui di cisteina, presenti all interno di due raggruppamenti tra i residui e , sono probabilmente responsabili della specificità di legame del ligando (Iwahara,T. et al., 1997; Morris et al., 1997) NH 2 - -COOH Dominio extracellulare Dominio di legame al ligando Dominio LDL-A Regione MAM Regione ricca in glicina Dominio transmembrana Dominio tirosin-chinasico Figura 11. Rappresentazione schematica del recettore ALK umano con i suoi i domini principali. La numerazione (in base alla pubblicazione di Morris, S. W. et al., 1997) si riferisce ai residui aminoacidici. 31

32 La regione extracellulare contiene anche un dominio LDL-A (Daly, N. L. et al., 1995; Fass, D. et al., 1997) la cui funzione è ancora sconosciuta, fiancheggiato da due domini MAM che potrebbero essere coinvolti nell interazione cellula/cellula (Beckmann, G. and Bork, P., 1993; Yang, H. L. et al., 2007) e una regione ricca in glicine. Il dominio transmembrana composto da 28 aa è seguito da una regione juxtamembrana di 64 aa che contiene il sito di legame (residui ) per l interazione fosfotirosina-dipendente con il dominio SH2 del substrato-1 del recettore per l insulina (IRS-1, Insulin Receptor Substrate 1). Il dominio catalitico di ALK consiste di 254 aa, tra i quali sono presenti tre residui tirosinici (e più precisamente i residui ) nell ambito del loop di attivazione. Analogamente agli altri membri della famiglia dei recettori dell insulina, questi resudui tirosinici rappresentano i siti principali di regolazione del loop di attivazione. Passando dallo stato di non fosforilazione a quello fosforilato, questi tre siti precludono o consentono l accesso dell ATP alla sua tasca di legame. Studi iniziali sull espressione dell mrna umano di ALK hanno evidenziato la presenza di due trascritti delle dimensioni di 6,5 e 8 Kb, sia in cellule di rabdomiosarcoma, sia a livello dell innervazione enterica e del cervello; è stata inoltre dimostrata la sola presenza della forma di 6,0 kb nei testicoli, nella placenta e nel fegato fetale (Morris S. W. et al., 1994). Studi successivi hanno confermato la presenza dell mrna di ALK nel cervello e nel midollo spinale del topo (Iwahara,T. et al., 1997; Morris et al., 1997). Studi di ibridazione in situ condotti dagli stessi autori su topi embrionali hanno confermato che la presenza dell mrna di ALK è principalmente ristretta a regioni specifiche del cervello in via di sviluppo (il talamo, l ipotalamo, il mesencefalo, il bulbo olfattorio), così come del sistema nervoso periferico (la radice dorsale e i gangli e il plesso mioenterico). Nel topo l espressione del gene ALK inizia approssimativamente all undicesimo giorno di vita embrionale e persiste, ma a livelli drasticamente inferiori, per tutto il periodo neonatale ed adulto (Iwahara, T. et al., 1997). Studi immunocitochimici condotti sull uomo adulto hanno rilevato la presenza di ALK solo in poche cellule neuronali disperse, nei periciti e nelle cellule endoteliali del cervello, supportando così l ipotesi della ristretta distribuzione di ALK in condizioni fisiologiche (Pulford, K. et al., 1997; Falini, B. et al., 1999). 32

33 Il quadro di espressione di questo RTK ne suggerisce quindi un probabile ruolo nello sviluppo e nel mantenimento del sistema nervoso centrale (Iwahara, T. et al., 1997; Morris, S. W. et al., 1994; Pulford, K. Et al., 1997; Loren, C. E. et al., 2001; Vernersson, E. et al., 2006); questa ipotesi è confermata, inoltre, da esperimenti condotti su modelli animali, quali Drosophila melanogaster e caenorabditis elegans: dove ALK è fondamentale per la formazione delle sinapsi e del sistema nervoso. I topi knockout per ALK, al contrario, presentano uno sviluppo e una longevità paragonabile ai topi di tipo selvatico (Englund, C. et al., 2003; Bazigou, E. et al., 2007; Pulford, K. et al, 2004) Inizialmente la proteina pleiotropina (PTN) e la proteina midkine (MK) sono state indicate quali possibili ligandi di ALK nell uomo(stoica, G. E. et al., 2001; Stoica, G. E. et al., 2002); tuttavia, dopo dieci anni, la rilevanza fisiologica di questa coppia recettore/ligando non è stata ancora dimostrata in maniera convincente: la fosforilazione di ALK tramite stimolazione con PTN é infatti assente in molti sistemi cellulari (Motegi, A. et al., 2004; Moog-Lutz, C. et al., 2005; Miyake, I. et al., 2002). Perez-Pinera e collaboratori, nel 2007, hanno proposto un nuovo modello in cui, nelle cellule stimolate con PTN, la fosforilazione di ALK è mediata da legame di PTN con il recettore RPTP /. Quando PTN si lega ad RPTP /., ne provoca la dimerizzazione con conseguente perdita dell attività tirosinfosfatasica. A sua volta, l inattivazione di RPTP / determina l aumento dei livelli di fosforilazione di tutti i substrati ad esso associati (Meng, K. et al., 2000; Kawachi, H. et al., 2001; Pariser, H. et al., 2005a; Pariser, H. et al., 2005b; Pariser, H. et al.,2005c; Tamura, H. et al., 2006). Tuttavia, Le conoscenze sulle proprietà biologiche di ALK, nonché sui meccanismi molecolari sottostanti, sono piuttosto limitate a causa dell incertezza sulla vera natura del ligando. Per ovviare a questo problema sono stati ideati modelli molecolari di ALK che ne consentono l analisi in condizioni ligando-inducibili. In particolare, sono stati sviluppati due sistemi modello sfruttando uno stratagemma sperimentale simile, ovvero la creazione di un recettore chimerico formato dal dominio intracellulare di ALK fuso ad un dominio extracellulare dimerizzabile sotto stimolazione specifica e, quindi, capace di innescare il processo di trasduzione ALK-specifico. La chimera ideata dal gruppo di ricerca del Dr. Souttou è stata ottenuta per 33

34 sostituzione del dominio extracellulare di ALK con il frammento cristallizzabile (regione Fc) della immunoglobulina 2b murina. In condizioni sperimentali non riducenti, le cisteine presenti nel dominio Fc tendono a formare ponti disolfuro: ciò induce dimerizzazione e oligomerizzazione delle chimere con conseguente transfosforilazione dei domini intracellulari di ALK e, quindi, attivazione del recettore. Utilizzando questo modello molecolare è stata dimostrata la capacità di ALK di indurre, in seguito ad attivazione, la crescita di neuriti nella linea cellulare PC12, a supporto del probabile ruolo di questo recettore nello sviluppo e mantenimento del sistema nervoso. Lo stesso sistema è stato inoltre utilizzato per l iniziale caratterizzazione degli effettori intracellulari che intervengono nella trasduzione di questo segnale ALK-mediato. Una via di segnalazione critica nella mediazione della differenziazione delle cellule PC12 è stata identificata nella cascata delle MAPK (Souttou, B. et al., 2001), risultato successivamente confermato da altri autori. In questo Laboratorio è stata, invece, generata una chimera EGFR/ALK, nella quale i domini extracellulari e transmembrana del recettore ALK sono stati sostituiti con le corrispondenti regioni del recettore per il fattore di crescita epidermico (EGFR). La validità di questo sistema modello è stata ampiamente dimostrata: analisi biochimiche e immuno-istochimiche hanno, infatti, rivelato che nelle cellule NIH- 3T3 la chimera EGFR/ALK è correttamente espressa in superficie, dove è in grado di interagire con l EGF e trasdurre all interno della cellula un segnale EGF-mediato, ma ALK-specifico. Utilizzando questo sistema modello molecolare è stata dimostrata la capacità di ALK di promuovere mitogenesi nelle cellule fibroblastiche murine NIH- 3T3 (Piccinini G. et al., 2002) e in cellule ematopoietiche murine 32D (Bacchiocchi R. et al., 2005). L analisi dei processi molecolari ALK-mediati in condizioni di controllata attivazione mediante stimolazione con EGF in questi sistemi cellulari ha messo in evidenza lo specifico reclutamento, nonché attivazione, dei trasduttori intracellulari quali la fosfolipasi C-, la fosfatidil-inositolo-3-chinasi(pi3k) (Piccinini, G. et al., 2002), c-src e l isoforma alfa della diacil-glicerolo chinasi ( DGK) (Bacchiocchi R. et al., 2005). 34

35 1.8. Ruolo di ALK nelle neoplasie umane L attenzione scientifica per il recettore ALK deriva dall alta percentuale di casi di ALCL caratterizzati dall espressione di sue varianti oncogenicamente attive; più recentemente è stata dimostrato il coinvolgimento di questo recettore nella patogenesi di altri tumori, facendo di ALK uno dei pochi esempi di RTKs implicato nell oncogenesi di neoplasie di origine sia ematopoietica che non (Pulford, K. et al., 2004). L espressione aberrante di ALK è stata descritta in un piccolo sottogruppo di casi di NHL di tipo B (Reichard, K.K. et al., 2007) nonché in alcuni casi di linfoma diffuso a grandi cellule B (DLBCL, Diffuse Large B-cell Lymphoma) caratterizzati dall espressione delle proteine chimeriche Clatrhin/ALK, SEC31A/ALK e meno frequentemente la stessa NPM/ALK (VanRoosbroeck, K. et al., 2010). Altre proteine di fusione di ALK sono state descritte anche in neoplasie di origine non-ematopietica, come i tumori miofibroblastici infiammatori (IMTs) (Puldorf, K. et al., 2004), carcinomi dell esofago a cellule squamose (Jazii, F.R., et al., 2006; Du, X.L., et al., 2002), carcinomi renali (Debelenko L. et al., 2010) e tumori polmonari non a piccole cellule (NSCLC, Non Small Cell Lung Cancer); nel 2007, infatti, Soda e collaboratori hanno descritto per primi un nuovo riarrangiamneto cromosomico che coinvolge il cromosoma 2 e determina la formazione di un gene chimerico codificante per una proteina di fusione formata dalla porzione ammino-terminale della proteina EML4 e dalla regione intracellulare del recettore ALK nella porzione carbossi terminale, espressa da circa il 6% dei casi di NSCLC (Soda, M. et al., 2007); più recentemente sono stati descritti anche altri riarrangiamenti cromosomici che coinvolgono il gene codificante per la proteina KIF5B (Wong, D.W et al., 2011). I casi di NSCLC ALK+ condividono alcune caratteristiche comuni, a prescindere dalla traslocazione descritta: insorgono in pazienti giovani e non fumatori e la presenza di questi riarrangiamenti esclude altre anomalie genetiche, come mutazioni di K-Ras o dell EGFR (Paez, J.C. eta l., 2004). L espressione della proteina di fusione EML4/ALK è stata descritta anche nel 2,5% di casi di cancro alla mammella; dati analoghi sono emersi da studi condotti sul cancro al colon (Lin, E. et al., 2009). 35

36 Negli ultimi anni stati caratterizzanti meccanismi diversi dal riarrangiamento cromosomico che portano all attivazione aberrante dell attività chinasica di ALK, tra cui mutazioni e amplificazione (Ardini, E. et al, 2010). In linea con queste osservazioni, l amplificazione genica di ALK è stata descritta in diverse linee cellulari di neuroblastoma (Miyake I., et al., 2002) glioblastoma (Powers, C., et al., 2002) e melanoma (Cessna, M.H., et al., 2002; Pillay, K., et al., 2002; Li, X.Q., et al., 2004; Dirks, W.G., 2002). Una correlazione diretta tra l iper-espressione della forma selvatica di ALK e la trasformazione cellulare è stata riportata da più autori (Weber, D. et al., 2000; Stoica, G. E. et al., 2001; Piccinini, G. et al., 2002) ed è stata riscontrata anche in carcinomi alla mammella (Perez-Pinera, P., et al., 2007). Studi più recenti hanno, inoltre, dimostrato che mutazioni puntiformi del gene ALK sono alla base di molti casi di neuroblastoma sia ereditario che sporadico (Mossè, Y.P., et al., 2008); queste mutazioni che inducono l attivazione costitutiva del recettore correlano con un fenotipo trasformante, mentre l inibizione genetica o farmacologica di ALK provoca una diminuzione nella crescita tumorale (George, R.E. et al., 2008; Mosse Y.P. et al., 2008; McDermott, U. et al., 2008). Nei pazienti affetti da neuroblastoma, l'iperespressione di ALK, sia nella forma wild-type che in quelle mutate, correla con una prognosi infausta (Passoni, L., et al., 2009) L oncogene NPM/ALK Come già accennato precedentemente, la traslocazione t(2;5)(p23;q35) è una delle più frequenti negli ALCL. Strategie di clonaggio posizionale hanno evidenziato che la traslocazione interrompe, sul cromosoma 5, il locus codificante per la nucleofosmina (NPM), mentre sul cromosoma 2 interrompe il locus codificante per il recettore tirosin-chinasi ALK (Morris, S. W. et al., 1994). La rottura cromosomica all interno della sequenza genomica di ALK cade all interno di un introne di 1935 bp, localizzato tra gli esoni che codificano per il dominio transmembrana e quello juxtamembrana del recettore. La rottura del gene NPM invece, è all altezza dell introne 4 di NPM (Ladanyi, M. and Cavalchire, G., 1996; Chan, P.K. et al., 1997; Luthura, R. et al., 1998). Questo riarrangiamento cromosomico ha come risultato l espressione di una proteina di fusione di 80kDa che contiene i primi

37 NP NPM/ALK ALK aminoacidi della porzione amino-terminale di NPM uniti ai residui della porzione intracitoplasmatica di ALK, inclusa la regione catalitica che risulta costitutivamente attiva (Morris, S. W. et al., 1994; Fujimoto, J. et al., 1996) (Figura 12). Il gene di fusione reciproco ALK-NPM non è trascritto a livelli apprezzabili e quindi non contribuisce alla patogenesi degli ALCL (Morris, S. W., 1994; Beylot Berry, M. et al., 1998; Cordell, J. L. et al., 1999). NPM ALK 117 N P NPM/ALK Figura 12. Rappresentazione schematica della traslocazione t(2;5)(p23;q35). La numerazione (stabilita da Morris, S. W. et al., 1994 e 1997) si riferisce al numerodei residui aminoacidici delle rispettive proteine. Normalmente ALK non è espresso a livello del sistema ematopietico; pertanto, la traslocazione t(2;5)(p23;q35), determinando la trascrizione del gene ALK sotto la guida del forte promotore di NPM, risulta nell espressione anomala e nell attivazione costitutiva di ALK nelle cellule ematopoietiche. Si ritiene che l attivazione costitutiva di ALK nella molecola di fusione sia dovuta alla formazione di omodimeri, in virtù del dominio di oligomerizzazione presente nella porzione amino-terminale di NPM. La proteina NPM/ALK è un potente oncogene, infatti la sua espressione è sufficiente per trasformare diversi tipi cellulari in vitro, inclusi fibroblasti di topo e di ratto come le cellule NIH3T3, Fr3T3 e Rat-1 e cellule ematopietiche come le linee mielidi 32D e Ba/F3 ( Fujimoto, J. et al., 1996; Bai, R. Y. et al., 1998; Bischof, D. et al., 1997; Mason, D. Y. et al., 1998; Bacchiocchi R. et al., 2005). Il suo potenziale oncogenico è principalmente dovuto all attività enzimatica costitutiva di ALK: infatti, in vitro, p80 NPM/ALK presenta una forte attività chinasica assolutamente necessaria per indurre il fenotipo neoplastico. 37

38 Successivamente, il potenziale trasformante di NPM/ALK è stato confermato in vivo attraverso il trasferimento di cellule midollari NPM/ALK infettate in topi irradiati letalmente (Kuefer, M. U., et al., 1997). In questo modello sperimentale, l espressione di NPM/ALK determina lo sviluppo di linfomi negli animali, a diretto sostegno di un ruolo diretto dell attivazione di ALK nella linfomagenesi. Tuttavia, l analisi genotipica dei tumori formatisi in questi animali ha dimostrato una derivazione B e quindi chiaramente differenti dai linfomi umani che sono classicamente di tipo T o nullo (Falini, B., 2001). Un modello murino più appropriato è stato recentemente ottenuto attraverso la generazione di topi transgenici nei quali l espressione di NPM/ALK è stata selettivamente indirizzata sui linfociti T. Nonostante quest ultimo modello rappresenti la prima evidenza diretta delle proprietà oncogeniche di NPM/ALK sui linfociti T in vivo, lo sviluppo di modelli sperimentali più appropriati nei quali analizzare la linfomagenesi ALK mediata è necessaria. Lo sviluppo di linfomi NPM/ALK positivi è, inoltre, strettamente dipendente dalla risposta immunitaria individuale: è stata, infatti, recentemente dimostrata nel siero dei pazienti affetti da ALCL, la presenza di anticorpi circolanti con specificità per NPM/ALK (Puldorf, K. et al., 2004; Borish, B. et al., 2003). Inoltre, nel repertorio dei linfociti circolanti di soggetti sani, è stata evidenziata la presenza di cellule T citotossiche funzionali (CTLs, Cytotoxic T Lymphocytes) anti-alk, suggerendo che tale molecola si comporta da potente antigene tumorale. Effettivamente, cellule derivate da ALCL e HLA compatibili e linee cellulari di neuroblastoma possono essere lisate efficacemente in vitro da CTL specifiche. Tale dato apre la possibilità allo sviluppo di nuove strategie terapeutiche per i tumori esprimenti ALK basate sulla definizione di protocolli immunoterapici (Passoni, L. et al., 2002) Aspetti molecolari delle proprietà trasformanti di NPM/ALK. Nonostante siano stati effettuati numerosi studi in questa direzione, i meccanismi patogenetici che sottendono alla trasformazione NPM/ALK-mediata sono ancora poco definiti. Similmente alle altre proteine tirosin-chinasi, sia normali 38

39 che oncogeniche, NPM/ALK attiva varie e differenti cascate di segnalazione che sono strettamente connesse e sovrapposte. Attualmente, sono state identificate diverse molecole segnale che sono reclutate e/o attivate da ALK, tra cui la molecola adattatrice Grb2 (Fujimoto J. et al., 1996; Bai R. Y. et al., 1998; Piccinini G. et al., 2002), Shc (Fujimoto J. et al., 1996; Bai R. Y. et al., 1998), IRS-1 (Fujimoto J. et al., 1996; Bai R. Y. et al., 1998), PLC (Bai R. Y. et al., 2000; Piccinini G. et al., 2002), PI3-K (Bai R. Y. et al, 2000; Slupianek A. et al., 2001; Piccinini G. et al., 2002) e p60 src (Cussac D. et al., 2004; Bacchiocchi R. et al., 2005), sebbene solo per alcune di esse sia stato effettivamente dimostrato un ruolo essenziale nella mediazione del potenziale trasformante di ALK. In particolare, vari studi hanno fornito solide evidenze sperimentali sull importanza sia della PI3-K che della PLC per le proprietà oncogeniche di NPM/ALK, attraverso una loro specifica regolazione di segnali mitogenici e/o antiapoptotici (Bai R. Y. et al., 1998; Bai R. Y. et al., 2000; Slupianek A. et al., 2001). Al contrario, sebbene sia Shc che IRS-1 siano effettivamente reclutati da ALK su specifici residui tirosinici fosforilati tramite i loro domini SH2, essi non sembrano svolgere una funzione essenziale nella trasduzione dei segnali trasformanti. Infatti, molecole di NPM/ALK mutate nei rispettivi siti di tirosina mantengono intatta la capacità di indurre trasformazione di cellule fibroblastiche murine NIH-3T3 (Fujimoto J. et al., 1996). Altri effettori fondamentali per le proprietà trasformanti di NPM/ALK sono rappresentati dalle molecole Stat3 (Stat, Signal Transducer and Activator of Transcription 3) e Stat5. Il ruolo di Stat3 è stato analizzato dettagliatamente sia in vitro (Zamo A. et al., 2002) che in vivo (Chiarle R. et al., 2005). NPM/ALK è in grado di fosforilare direttamente Stat3 od indirettamente, previa attivazione di JAK3 (JAK, Janus Kinase) (Zamo A. et al., 2002; Amin H. M. et al., 2003; Marzec M. et al., 2005). In linee cellulari umane derivate da ALCL, Stat3 regola positivamente la trascrizione di geni coinvolti nel ciclo cellulare e geni codificanti per proteine a funzione anti-apoptotica, come la ciclina D3, MCL1 (MCL, Myeloid Cell Leukemia), BCL-X L e survivina (Zamo A. et al., 2002; Piva R. et al., 2006). Inoltre, il silenziamento genico di Stat3 mediante l uso di oligonucleotidi anti-senso risulta nell annullamento della trasformazione delle cellule, determinando sia una 39

40 diminuizione delle capacità proliferative che da un aumentata sensibilizzazione all apoptosi (Ruchaz H. et al., 2003). Il meccanismi di azione di Stat5B nella mediazione delle proprietà oncogeniche di NPM/ALK richiede, invece, l attivazione di JAK2. L inibizione di questa molecola determina una drastica riduzione della trasformazione NPM/ALKmediata sia in vitro che in vivo, risultando in un significativo aumento dell apoptosi cellulare (Ruchaz H. et al., 2003). Al contrario, Stat5A agisce nelle ALCL come soppressore tumorale ed infatti, in queste cellule tumorali, risulta epigeneticamente silenziato; quando ri-espresso determina, a sua volta, un inibizione dell espressione di NPM/ALK (Zhang Q. et al., 2007). L importanza della proteina p60 src è stata recentemente analizzata in una serie di linee cellulari umane derivate da ALCL ed NPM/ALK positive e dimostrata attraverso gli effetti osservati sulla proliferazione cellulare in seguito alla sua specifica inibizione ottenuta mediante silenziamento genico o trattamento delle cellule con inibitori farmacologici (Cussac D. et al., 2004; Bacchiocchi R. et al., 2005). Tali dati sono stati ulteriormente consolidati in questo Laboratorio utilizzando come sistema modello le cellule NIH-3T3 esprimenti la chimera ligando-attivabile EGFR/ALK. Va, inoltre, aggiunto che in questo sistema cellulare è stata dimostrato un ruolo dell -DGK nella segnalazione ALK-mediata, attraverso un meccanismo che richiede sia associazione che attivazione da parte di p60 src (Bacchiocchi R. et al., 2005). In cellule NPM/ALK positive è stata descritta la fosforilazione mediata dalle chinasi della famiglia Src del fattore di scambio per nucleotidi guaninici (GNEFs, Guanine nucleotide Exchange Factors) Vav1 che a sua volta modula l attivazione della RhoGTPasi Cdc42, proteina coinvolta nella regolazione della forma cellulare e fondamentale per processi quali migrazione, crescita e sopravvivenza cellulare (Ambrogio, C. et al., 2008). Ovviamente ulteriori studi sono resi necessari per la caratterizzazione dei meccanismi molecolari coinvolti nella trasformazione cellulare mediata dall oncogene NPM/ALK e per l identificazione di pathway di segnalazione addizionali che risultino operative nelle neoplasie ALK-positive. 40

41 1.11 Il mesotelioma maligno della pleura Il mesotelioma maligno è una forma tumorale relativamente rara e molto aggressiva che origina per lo più dalle cellule della sierosa pleurica la sottile membrana che riveste e protegge i polmoni (mesotelioma pleurico) può originare anche dal peritoneo o, più raramente, della sierosa pericardica, ovarica o della tonaca vaginale del testicolo (Carbone, M., et al., 2002). Il Mesotelioma Maligno della Pleura (MMP) è fra tutti il più frequente. Tale neoplasia ha focalizzato l attenzione di clinici e ricercatori per la forte associazione con l esposizione all asbesto (amianto) e le conseguenti importanti implicazioni di natura medico-legale. Inoltre, il mesotelioma rappresenta una neoplasia caratterizzata da elevata mortalità data l alta resistenza a qualsiasi trattamento terapeutico. Generalmente, la popolazione più colpita è quella compresa tra la quinta e la settima decade di vita, con un età media pari a 53 anni. L Unione Europea, con la direttiva 83/477/ EC, articolo 17 del 19 settembre 1983, ha suggerito l istituzione in ogni stato membro della Comunità, di un registro dei casi verificati di asbestosi e mesotelioma. Ciò ha consentito, negli anni successivi, un attenta analisi dei tassi di incidenza di mesotelioma in tutta Europa, fornendo così degli indicatori indiretti di esposizione lavorativa ed ambientale all asbesto. I rischi per la salute sono direttamente legati alla quantità, al tipo di fibre inalate, alla loro stabilità chimica, ed ad una predisposizione personale a sviluppare la malattia. Anche indagini a livello mondiale hanno confermato l incidenza dell esposizione all asbesto nel 70-80% dei casi di mesotelioma. Dalle analisi statistiche effettuate, è emerso che dopo 15 anni dall inizio dell esposizione il 6% dei lavoratori esposti in età superiore ai 35 anni muore di mesotelioma. L esposizione inoltre non è da considerarsi esclusivamente di natura occupazionale ma è anche ambientale e spesso familiare, quest ultima si realizza generalmente attraversi gli abiti del lavoratore contaminati dalle fibre di asbesto. La cancerogenesi dell asbesto inizia con l inalazione delle fibre di cui gran parte, circa il 70%, viene eliminata con l espettorato o con le feci mentre il rimanente 30% attraversa l endotelio penetrando nei tessuti interstiziali. Le fibre tendono ad 41

42 accumularsi prevalentemente a livello del terzo inferiore del polmone in posizione contigua alla pleura viscerale. Ovviamente quando le fibre vengono inalate si scatena un meccanismo di difesa con attivazione dei macrofagi alveolari. L attivazione di questi porta alla produzione di citochine ed alla alterata regolazione di alcuni proto-onocogeni, tra cui PDGFB con proliferazione delle cellule mesoteliali. Altri fattori di rischio implicati nell insorgenza della neoplasia sono: l esposizione al diossido di torio (thorotrast) ed alla zeolite, le infezioni polmonari croniche (possibile ruolo del virus simian 40, SV40), la tubercolosi polmonare e le irradiazioni. Il Mesotelioma Maligno della Pleura origina dal mesotelio della pleura con una tendenza a ricoprire la superficie del polmone avvolgendolo completamente e spesso invadendo anche le cavità mediastiniche. Tale neoplasia si presenta come una lesione diffusa che coinvolge ampiamente gli spazi pleurici e si associa, in genere, ad un cospicuo versamento e alla invasione diretta delle strutture toraciche ed il mediastino. Nei casi di malattia avanzata, può arrivare ad interessare anche la cavità pleurica controlaterale oppure il peritoneo attraverso il diaframma, è spesso presente l invasione della superficie del parenchima polmonare sottostante. Circa nella metà dei casi è possibile riscontrare, tardivamente, metastasi a distanza. Queste metastasi avvengono per via linfatica o per via ematica con localizzazione più frequenti a livello dei linfonodi loco-regionali. Il MMP è di notevole problematicità sul piano diagnostico, data l elevata variabilità istologica, difficile la determinazione dell estensione della malattia e della sua stadiazione, difficile sul piano terapeutico. La sopravvivenza media varia tra i 12 ed i 15 mesi dall inizio della sintomatologia e tra gli 8 ed i 10 mesi dalla diagnosi. Allo stato attuale più del 75% dei pazienti muore entro l anno e praticamente nessuno sopravvive a 5 anni, tutto ciò a causa del ritardo con cui viene effettuata la diagnosi. Il trattamento combinato con chemioterapia, radioterapia o chirurgia. andrebbe iniziato il più precocemente possibile evitando di affrontare la malattia in uno stadio avanzato con pazienti in condizioni generali compromesse. 42

43 Attualmente tali modalità di trattamento non hanno dimostrato un significativo miglioramento di sopravvivenza, è stata osservata una scarsa sensibilità ai chemioterapici, che nella maggior parte dei casi non sono in grado di determinare altro che risposte parziali o marginali. Moltissimi chemioterapici sono stati testati nella terapia per il Mesotelioma Maligno della Pleura. L efficacia della chemioterapia è difficile da valutare in quanto gli studi sono pochi e molto disomogenei tra loro; i chemioterapici vengono infatti usati sia da soli, che in associazione tra loro ed insieme ad altre terapie per differenti stadi di malattia. Gli agenti chemioterapici più efficaci sono risultati Doxorubicina, Ciclofosfamide e Cisplatino con una percentuale di risposta del 20-30%. In altri studi, discreti risultati sono stati ottenuti con la combinazione di cisplatino e gemcitabina (48% di risposta parziale) (Nowak, A.K., et al., 2002). In generale i regimi polichemioterapici sono risultati più efficaci rispetto alla terapia con un singolo farmaco (23% contro 12%). Un esame condotto suggerisce che il Cisplatino è il chemioterapico più efficace usato come singolo agente e che l associazione Cisplatino-Doxorubicina è il regime più attivo. Più recentemente, nuovi agenti hanno dimostrato la loro efficacia nel trattamento del MPM. Tra di essi il pemetrexate (Alimta), un antifolato con un ampia attività antitumorale; dati clinici preliminari mostrano risultati incoraggianti dall associazione dell Alimta e del Cisplatino con un tasso di risposta in studi di fase I e II fino al 45% (Scagliotti, G.V., et al., 2003). Per ridurre la tossicità ed aumentare l efficacia del pemetrexate, è necessaria l aggiunta di acido folico e vitamina B12. Alla luce di questi dati, la combinazione Cisplatino-Alimta è divenuta la terapia standard per i pazienti con MPM (Garcia-Carbonero, R., et al., 2006). Anche l imatinib (Gleevec) e il gefitinibe (Iressa), rispettivamente inibitori del PDGF e del EGF sono attivi sul MPM; tuttavia studi iniziali su questi farmaci, non hanno dato risultati convincenti (Nowak, A.K., et al., 2002). La chemioterapia viene utilizzata anche come trattamento intra-toracico, riducendo la tossicità sistemica e permettendo di rilasciare il farmaco direttamente nella sede del tumore, dove invece il chemioterapico sistemico arriva solo in minima parte. Come in precedenza detto l impiego di un singolo agente non sembra dare risultati soddisfacenti a causa della particolare resistenza delle cellule di MM nei confronti dei farmaci antineoplastici. 43

44 Gli scarsi risultati ottenuti con la chemioterapia nel MMP possono essere imputabili a diffferenti cause. Una prima spiegazione riguarda il sito di comparsa della malattia, la cavità pleurica, che risulta difficilmente raggiungibile con terapie sistemiche. Altra causa è imputabile alle caratteristiche molecolari delle cellule tumorali che presentano un elevata resistenza all azione citotossica dei farmaci chemioterapici questa può essere dovuta ad alterazioni del codice genetico della cellula tumorale che inibiscono l azione del chemioterapico (resistenza intrinseca). Esiste però un altro tipo di resistenza, cosiddetta indotta o acquisita, che emerge sotto la pressione selettiva dovuta all utilizzo dei farmaci antitumorali. Recenti studi dimostrano che lo stress genotossico induce in queste cellule modificazioni nel profilo di espressione dovute a cambiamenti nello splicing alternativo di alcune proteine (Biamonti, G. and Caceres, J.F., 2009). 44

45 2. SCOPO DEL LAVORO. Durante la trasformazione neoplastica, le cellule tumorali vanno incontro a cambiamenti nell espressione genica che promuovono la motilità, la capacità proliferativa cellulare e la resistenza all apoptosi. Un numero sempre crescente di evidenze sperimentali indica che l attivazione delle proteine della famiglia STAR mediata da stimoli extracellulari è importante nel promuovere lo splicing alternativo di alcuni geni durante la tumorigenesi e la formazione di metastasi. Tra questi, Sam68 è uno dei membri più studiati e negli anni più recenti sono stati fatti enormi progressi per rivelare la correlazione esistente tra la proprietà di questa proteina di legare l RNA e la sua capacità di regolare vari processi cellulari, tra cui la trasduzione del segnale, la progressione del ciclo cellulare e la tumori genesi. Questa proteina possiede, inoltre, domini multifunzionali che gli permettono di interagire con molte altre proteine, entrando a far parte di molteplici pathway cellulari. Sulla base di quanto discusso nella parte introduttiva, con il presente lavoro ho voluto analizzare il ruolo della proteina Sam68 nella trasformazione mediata da ALK. La caratterizzazione delle molecole segnale reclutate da questo recettore in seguito ad attivazione è, infatti, di estrema importanza per definire gli effettori intracellulari critici per le sue proprietà trasformanti. Inoltre, visti i risultati ottenuti sulle cellule derivanti da ALCL, ho ritenuto interessante indagare il ruolo di questa proteina anche in cellule derivanti da mesotelioma maligno della pleura, essendo questa una neoplasia occupazionale estremamente aggressiva e chemioresistente. 45

46 3. MATERIALI E METODI Vettori utilizzati. LTR EGFR/ALK: il vettore di espressione contenente la molecola ricombinante EGFR/ALK è stato preparato partendo da una versione modificata del plasmide LTR EGFR 5M, in cui un frammento XhoI MluI, contenente l'intero codice di lettura dell'egfr umano (Ullrich, A. et al.,1984), è clonato sotto il controllo trascrizionale del promotore retrovirale Moloney MuLV LTR (indicato come 5' LTR e 3' LTR), che assicura livelli molto elevati di espressione del gene nella cellula ospite. La modificazione era rappresentata dall inserimento nella sequenza dell EGFR di due siti di restrizione unici per ClaI e SalI, rispettivamente all inizio e alla fine della regione transmembrana: tali modificazioni sono state eseguite in modo da non alterare la sequenza aminoacidica codificante per il recettore (Lonardo, F. et al., 1990). Al fine di ottenere il recettore chimerico EGFR/ALK, l'intera porzione intracellulare di ALK è stata amplificata mediante reazione a catena della polimerasi (PCR) usando come templato il cdna di NPM-ALK clonato in pcdna3 (gentilmente fornito dal Prof. P. G. Pelicci, Istituto Europeo di Oncologia, Milano, Italia) e come inneschi appropriati oligonucleotidi disegnati in modo tale da introdurre nella sequenza amplificata di ALK un sito di riconoscimento per l enzima SalI alla sua estremità 5' ed un sito di riconoscimento per l enzima MluI alla sua estremità 3'. In seguito alla digestione enzimatica con SalI e MluI, il frammento ottenuto di 1705 bp è stato clonato nel vettore LTR EGFR 5M precedentemente digerito con SalI e MluI. I cloni batterici ottenuti dalla trasformazione sono stati controllati per la presenza dell'inserto clonato. Questa procedura di ricombinazione generava, però, una modificazione nella sequenza di ALK in corrispondenza del codone Di conseguenza, il frammento di 2.2 Kb BamHI-BamHI ottenuto da questo vettore, é stato subclonato nel vettore fagico M13mp18 e quindi, sottoposto a mutagenesi sito-specifica in modo da modificare il codone CTG (corrispondente ad un residuo di istidina) in posizione 1058, in GTG (corrispondente ad un residuo di 46

47 valina) e quindi ripristinare l'esatta sequenza aminoacidica della porzione intracellulare di ALK. Ottenuta questa modificazione, tale frammento BamHI-BamHI é stato riclonato nel suo vettore di origine. Il vettore di espressione risultante, denominato LTR-EGFR/ALK (Figura 13), contiene l'informazione genetica per codificare una proteina di 1245 aminoacidi (peso molecolare atteso 140 kda) composta dai domini extracellulare e transmembrana dell'egfr fusi al dominio intracellulare di ALK (Piccinini, G. et al., 2002). Sal I Figura 13. Rappresentazione schematica del vettore LTR EGFR/ALK. I siti di restrizione SalI e MluI sono stati utilizzati per la ricombinazione. Il frammento BamHI BamHI, utilizzato per ripristinare la corretta sequenza di ALK (eliminando il sito SalI) tramite mutagenesi sito specifica, è anche indicato. Tale vettore presenta un determinante di resistenza per l ampicillina (Amp R ), che consente la selezione di ceppi batterici trasformati in presenza di tale antibiotico. E', inoltre, presente nel vettore il marcatore Ecogpt. Il gene gpt di E. Coli codifica per l enzima xantina-guanina-fosforibosil trasferasi (XGPRT), omologo dell enzima eucariotico ipoxantina-guanina-fosforibosil trasferasi (HGPRT). L enzima HGPRT catalizza la conversione delle basi puriniche ipoxantina e guanina nei corrispondenti nucleotidi acido inosinico (IMP) e acido guanilico (GMP). Mentre HGPRT può utilizzare come substrati solo l'ipoxantina e la guanina, l'enzima batterico XGPRT è in grado di agire, efficientemente, anche sulla xantina, convertendola in acido xantilico, precursore del GMP. In presenza di acido micofenolico, la sintesi ex novo 47

48 dei nucleotidi purinici si arresta, poiché tale sostanza blocca l attività dell IMP deidrogenasi e, di conseguenza, la formazione di GMP. L enzima XGPRT è in grado di complementare il difetto enzimatico delle cellule eucariotiche, conferendo in più la capacità di utilizzare la xantina nella biosintesi del GMP. Cellule trasformate con vettori contenenti il marcatore Ecogpt sono in grado di crescere in un terreno supplementato con ipoxantina, xantina, adenina e l'inibitore acido micofenolico. La selezione delle cellule transfettate può essere resa ancora più efficace aggiungendo, nel terreno, anche amminopterina, che blocca specificatamente la via biosintetica endogena delle purine (Mullingan, R. C. e Berg, P., 1981). LTR EGFR/ALK Y979F: per la preparazione del mutante Y979F il frammento di 2.2 Kb BamHI-BamHI ottenuto dal vettore LTR-EGFR/ALK è stato sub clonato nel vettore fagico M13mp18 e sottoposto a mutagenesi sito-specifica in modo da modificare il cosone TAC (corrispondente al residuo di tirosina in posizione 979) in TCC (corrispondente ad un residuo di fenilalanina): per ottenere questa singola modificazione è stato utilizzato l oligonucleotide 5 -Pho- GGGCCCTGTATTCCGGATAATG-3. I cloni selezionati sono stati sequenziali in entrambe le direzioni per verificare la presenza della mutazione indotta. Ottenuta questa modificazione, il frammento BamHI-BamHI modificato è stato riclonato nel vettore di origine. M13mp18: è un vettore derivato dal fago M13 (Yanisch Perron, C. et al., 1985). Tale vettore contiene il promotore e parte della sequenza del gene per la - galattossidasi (lacz) (Figura 14). In mezzo a tale sequenza, che codifica per i primi 146 residui aminoacidici della -galattossidasi, è inserito il "polycloning site": tale inserzione non altera il corretto codice di lettura della -galattossidasi, ma determina la sintesi di un piccolo frammento aminoterminale privo di attività enzimatica. Vettori di questo genere sono, generalmente, usati in cellule batteriche ospiti che contengono la sequenza per la restante porzione carbossi terminale della - galattossidasi. Sebbene entambi i frammenti, sintetizzati dal vettore e dalla cellula ospite, siano enzimaticamente inattivi, essi possono associare dando luogo all'enzima 48

49 attivo. Questo tipo di complementazione può essere facilmente visualizzata se i batteri sono cresciuti in presenza del substrato cromogenico 5-bromo-4-cloro-3- indolil-β-galattoside (X-Gal). Figura 14. Mappa di restrizione del vettore fagico M13mp18. La figura mostra i siti in cui diversi enzimi di restrizione tagliano la forma replicativa a doppio filamento di M13mp18. Il polycloning site contiene i siti per gli enzimi di restrizione EcoRI, SacI, KpnI, SmaI, XmaI, BamHI, XbaI, SalI, AccI, HincII, PstI, SphI e HindIII Tuttavia, l'inserimento di un frammento di DNA all'interno del "polycloning site" del plasmide risulta nella produzione di un frammento aminoterminale della - galattossidasi incapace di effettuare l'α complementazione. Pertanto, i batteri trasformati con i plasmidi ricombinanti formeranno delle colonie bianche, quando cresciuti in un terreno contenente X Gal, e quindi saranno facilmente identificabili. PINCO-NPM/ALK: NPM/ALK è stato clonato nel vettore PINCO (Figura 15), un vettore retrovirale che esprime la proteina a fluorescenza verde (GFP, Green Fluorescent Protein) e quindi consente una facile selezione delle cellule infettate. 49

50 Figura 15. Mappa di restrizione del vettore pinco. pll-h1sam68 e pll-h2sam68: questi vettori lentivirali sono stati ottenuti clonando nel sito di clonazione multipla (MCS: Multiple Cloning Site) una sequenza esprimenti molecole di shrna (shrna, short harpin RNA) in grado di sopprimere in maniera specifica l espressione di Sam68. Qui di seguito sono riportati i primer utilizzati per il clonaggio. h1sam68-f: 5 -TGAAAGATCCTCATGAATTATTCAAGAGATAATTCATGAG GATCTTTCTTTTTTC-3 h1sam68-r: 5 -TCGAGAAAAAAGAAAGATCCTCATGAATTATCTCTTGAAT AATTCATGAGGATCTTTCA-3 h2sam68-f: 5 -TGAAGAATCTTTCAGTCATATTCAAGAGATATGACTGAAA GATTCTTCTTTTTTC-3 h2sam68-r: 5 -TCGAGAAAAAAGAAGAATCTTTCAGTCATATCTCTTGAAT ATGACTGAAAGATTCTTCA-3 La cassetta di espressione CMV-EGFP, contenente il sito di clonazione multipla e la sequenza codificante per la GFP (Green Fluorescent Protein) è posta sotto il controllo del promotore U6 e permette l espressione simultanea sia della molecola shrna che del gene reporter, facilitando in questa maniera la selezione delle cellule 50

51 infettate. La cassetta è posta tra sequenze che ne consentono l integrazione casuale all interno del genoma umano. PGEX4T1 PAK-CRIB: il plasmide pgex4t-1 (Figura 26) è stato utilizzato per il clonaggio del dominio CRIB (CRIB, Cdc42/Rac Interactive Binding Region) della proteina PAK (PAK, p21-activated kinase) nel sistema di fusione genica alla glutatione S trasferasi (GST, Glutathione-S-Transferase). Tale dominio associa esclusivamente con Rac- GTP. In questo plasmide, l espressione delle proteine ricombinanti è sotto il controllo del promotore Taq. Questo plasmide contiene inoltre l interno del gene lac I q che codifica un repressore che si lega con il promotore inibendo l espressione della proteina in fusione con la GST. Dopo induzione con isopropil- -Dtiogalattopiranoside (IPTG), il repressore viene inattivato e si ha la rapida produzione della proteina di fusione. Nel plasmide sono anche presenti il gene che conferisce resistenza all ampicillina in E.coli (Amp R ) e l origine di replicazione batterica (pbr322 ori) pexv-val12rac1-myc-tag: il cdna di Val12Rac1, una versione attivata di Rac1caratterizzata da una mutazione dell aa 12 da glicina a valina, è stato marcato al 5 tramite PCR con una sequenza codificante l epitopo myc MEQKLIEEDL e subclonato all interno del sito EcoRI di pexv, un vettore di espressione eucariotico. In questo plasmide l espressione della proteina ricombinante è sotto il controllo del promotore SV40. E inoltre presente il gene che conferisce resistenza all ampicillina in E.coli (Amp R ) Linee cellulari. In questo lavoro sono state utilizzate diverse linee cellulari, le cui caratteristiche sono qui di seguito riassunte. NIH-EGFR/ALK: tali cellule sono state ottenute in seguito a transfezione stabile della linea cellulare NIH-3T3, ottenuta da fibroblasti murini (Jainchill, J. L. et al., 1969), con il vettore di espressione LTR-EGFR/ALK, precedentemente descritto. 51

52 Questa linea cellulare, già ampiamente caratterizzata, esprime in superficie due classi di recettori, le cui costanti di affinità sono di nm (siti a bassa affinità: circa 2.5 X 10 6 /cellula) e nm (siti ad alta affinità: circa 1.8 X 10 5 /cellula) rispettivamente. E stato precedentemente dimostrato che queste cellule sono in grado di rispondere mitogenicamente alla stimolazione con EGF con una trasduzione ALK-specifica (Piccinini G. et al., 2002). NIH-EGFR/ALK Y979F: tali cellule sono state ottenute in seguito a trasfezione stabile della linea cellulare NIH-3T3 con il vettore di espressione LTR- EGFR/ALK Y979F precedentemente descritto. Per i nostri protocolli sperimentali è stata selezionata una linea esprimente un numero di recettori /cellula paragonabile alla linea NIH-EGFR/ALK e simile distribuizione di siti a bassa ed alta affinità. Tali cellule sono già state caratterizzate per l attività chinasica in vitro della molecola EGFR/ALK mutante espressa in superficie, che risulta assolutamente comparabile a quella posseduta dalla chimera EGFR/ALK di tipo selvatico. 32D: è una linea cellulare murina mieloide spesso utilizzata come modello sperimentale per saggi di trasformazione dato che la sua propagazione è strettamente dipendente dalla presenza di interleuchina-3 (IL-3) nel mezzo di coltura (Pierce, J. H. et al., 1988). 32D-NPM/ALK: tale linea cellulare, gentilemente fornita dalla Dott.ssa Emanuela Colombo dell Istituto Europeo di Milano, è stata ottenuta infettando le cellule 32D con il vettore pinco-npm/alk. In questo Laboratorio, è stato precedentemente dimostrato che l espressione dell oncogene NPM/ALK in queste cellule conferisce la capacità di propagazione in un mezzo privo di IL 3. 32D-EGFR/ALK: tale linea cellulare è stata ottenuta tramite transfezione stabile delle cellule 32D con il vettore di espressione LTR-EGFR/ALK, precedentemente descritto. La transfezione è stata effettuata per elettroporazione. In questo laboratorio è stato precedentemente dimostrato che queste cellule sono in grado di rispondere mitogenicamente alla stimolazione con EGF con una trasduzione ALK-specifica. Karpas 299: Si tratta di una linea cellulare umana ottenuta da un caso di ALCL con traslocazione t(2;5)(p23;q35) e quindi esprimente la proteina oncogenica NPM/ALK. 52

53 Karpas-CTR e Karpas-H2Sam68: tali linee cellulari sono state ottenute infettando le Karpas 299 rispettivamente con il vettore lentivirale vuoto e con il vettore lentivirale pllh2sam68 descritto precedentemente. MM5: si tratta di cellule umane in coltura primaria ottenute da biopsia di mesotelioma maligno della plaura. Le cellule sono state utilizzate per gli esperimenti tra il passaggio 5 e il Colture cellulari. Le cellule NIH-EGFR/ALK e NIH-EGFR/ALKY979F, cresciute in adesione, sono state mantenute in D-MEM (Dulbecco s Modified Eagle Medium), supplementato con siero fetale bovino (FBS, Fetal Bovine Serum) al 10%, xantina 250 μg/ml, sali HAT e acido micofenolico 25 μg/ml. Le cellule MM5, anch esse in adesione, e le linee cellulari Karpas 299, Karpas-CTR, Karpas-H2Sam68 e 32D- NPM/ALK, cresciute in sospensione, sono mantenute in coltura con il terreno RPMI (RPMI, Roswell Park Memorial Institute) supplementato con FBS al 10%. Le linee cellulari 32D e 32D-EGFR/ALK sono state coltivate come le Karpas 299, salvo che la loro propagazione avveniva in terreno RPMI al 10% di FBS supplementato con 10% di terreno condizionato ottenuto da cellule WEHI-3, ricco in IL-3. La crescita delle cellule è avvenuta a 37 C, in atmosfera contenente il 5% di CO Pre-trattamento delle cellule. Prima di effettuare esperimenti di stimolazione con EGF, le colture cellulari NIH-derivate cresciute a confluenza sono state opportunamente lavate con D-MEM e quindi mantenute per 16 ore a 37 C, al 5% di CO 2 in D-MEM privo di FBS supplementato con 5 g/ml di trasferrina (Becton Dickinson, Bedford, MA) e 10-8 M di selenio (condizione di starvation ). Le linee cellulari Karpas 299, 32D, 32D- NPM/ALK e 32D EGFR/ALK sono state mantenute a 37 C, al 5% di CO 2, per 18 ore in mezzo di coltura contenente 0.1% FBS e albumina di siero bovina (BSA, Bovine Serum Albumin) 0.2 mg/ml o per 6 ore in mezzo di coltura contenente 2% di BSA, a seconda dell esperimento da eseguire successivamente. 53

54 Quando indicato, le cellule sono state incubate con gli inibitori farmacologici R M o PP2 ( 4-amino-5-(4-chlorophenyl)-7-(t-butyl) pyrazolo[3,4-di] pyramidine 1 M (entrambi Alexis Biochemicals, San Diego, CA) o con DMSO utilizzato come controllo 30 minuti prima di effettuare il trattamento con l EGF Transfezione. La transfezione è una tecnica attraverso la quale è possibile introdurre sequenze di DNA esogeno all interno di cellule eucariotiche riceventi. A questo scopo, sono state utilizzate tre metodiche differenti. Nella metodica della precipitazione con calcio fosfato, utilizzata per transfettare le cellule NIH- derivate, il DNA viene fornito sotto forma di microprecipitato, aumentandone così l efficienza di assunzione Nel nostro caso, 30 g del DNA da transfettare sono stati risospesi in 1 ml di una soluzione contenente Tris 1mM, ph 7.5, EDTA 0.1 mm e CaCl M. Tale soluzione è stata, in seguito, dispensata molto lentamente in un tubo di polipropilene da 15 ml, nel quale era stato precedentemente posto 1 ml di 2X H 2 BS (NaCl 20 mm, Hepes 50 mm e Na 2 PO mm) e nel quale veniva costantemente insufflata dell aria. In questo modo il DNA precipita sotto forma di sali di fosfato di calcio. La sospensione è stata versata sopra il monostrato cellulare in presenza di D-MEM contenente 10% di FBS; le cellule sono state, quindi, incubate a 37 C al 5% di CO 2. Dopo un periodo di 18 ore, le cellule sono state lavate con PBS; quindi sono stati aggiunti 10ml/piastra di D-MEM al 10% di FBS. L elettroporazione, la metodica utilizzata per transfettare la linea cellulare Karpas 299, consiste nell applicazione temporanea di un campo elettrico pulsante controllato ad un sistema biologico. Essa provoca la formazione temporanea di pori nelle membrane cellulari che consente il trasferimento di DNA all interno della cellula. Nel nostro caso, 2,5 g di DNA da trasfettare sono stati aggiunti a cellule risospese in 65 l di buffer siport (Ambion, Austin, TX). Tale sospensione è stata elettroporata in cuvette da 1 mm di diametro a 250 Volts per 960 µf tramite uso di un Gene Pulser (Biorad) o, alternativamente, a 250 Volts per 400 sec utilizzando un generatore ad onda quadra, l ECM 830 (Genetronics, San Diego, CA). 54

55 La sospensione è stata, quindi, versata su piastra contenente RPMI al 10% di FBS e incubata a 37 C al 5% di CO 2. Il reagente di transfezione non liposomiale XtremeGENE 9DNA (Roche Diagnostic) è stato utilizzato per transfettare le cellule MM5. 7x 10 4 cellule sono state piastrate in ciascun pozzetto di una piastra da 6 in terreno privo di antibiotici. Il giorno dopo le cellule sono state lavate con PBS, quindi sono stati aggiunti 1,5ml di RPMI privo di FBS e antibiotici per pozzetto. 1 g di DNA da transfettare è stato risospeso in una soluzione contenente terreno privo di siero e il reagente XtremeGENE 9DNA, seguendo dettagliatamente le istruzioni della ditta produttrice. Tale soluzione è stata versata con una pipetta goccia a goccia sopra il monostrato cellulare. Dopo 6 ore veniva aggiunto FBS alla concentrazione finale del 10%. A prescindere dalla metodica utilizzata, dopo 48 ore dalla transfezione, le cellule sono state utilizzate per i successivi esperimenti Infezione. Le cellule 293T sono state co-trasfettate con i vettori pll e i vettori di packaging pmdlg/prre (codificanti le proteine virali gag/pol), prsv-rev e pmd.g (codificante per la proteina env) in modo da produrre particelle virali in grado di infettare le cellule e integrare stabilmente la cassetta di espressione del vettore pll nel genoma. Dopo 36 ore il surnatante è stato raccolto e ultracentrifugato per 1 ora e mezzo a rpm. Le particelle lentivirali sono state quindi risospese in PBS, aliqotate e congelate a -80 C. Un aliquota è stata utilizzata per infettare le cellule Karpas 299. L efficienza di infezione è stata calcolata analizzando l espressione della GFP al citofluorimetro Citomefluorimetria a flusso (FACS). La citofluorimetria permette di analizzare le caratteristiche fisiche e/o chimiche di cellule sospese in un fluido. Nella cella di misura di un citofluorimetro le cellule sono forzate ad allinearsi e ad attraversare singolarmente il fascio di luce del sistema di eccitazione. L interazione del fascio di luce con la cellula dà luogo a tre 55

56 fenomeni diversi: light scattering, assorbimento e fluorescenza. Il light scattering dipende dalla riflessione, rifrazione e diffrazione del fascio di luce che colpisce le singole cellule, e fornisce informazioni riguardanti caratteristiche fisiche e morfologiche delle stesse cellule. Il segnale legato alla diffrazione, il Forward scatter (FSC), fornisce informazioni sul diametro delle cellule analizzate; il Side scatter (SSC) è, invece, legato ai fenomeni di riflessione e rifrazione a loro volta dipendenti dalla granulosità interna, dal rapporto nucleo citoplasma, dalla rugosità di superficie oltre che dal diametro. La combinazione di FSC e SSC definisce il citogramma, un diagramma di dispersione che risolve le popolazioni cellulari in base alle caratteristiche fisiche. L altro parametro analizzato è la fluorescenza ottenuta marcando molecole citosoliche e di superficie o organelli interni delle cellule con opportuni fluorocromi. Poiché la GFP ha la peculiare caratteristica di assorbire la luce nel campo del blu (λ=395) e riemetterla nel campo del verde (λ=509), le cellule che esprimono la proteina,irradiate dai raggi UV, appaiono di un colore verde fluorescente; l analisi della fluorescenza emessa dalle cellule esprimenti la GFP ha permesso di calcolare l efficienza di infezione del vettore lentivirale (vedi paragrafo 3.6). Le cellule sono state lavate, centrifugate e risospese in una soluzione ipotonica. I campioni sono stati analizzati al citofluorimetro FACScalibu (BD, Milano, Italia) con il programma CellQuest (BD, Milano, Italia). Con il termine sorting si indica la capacità di particolari citofluorimetri di raccogliere fisicamente le sottopopolazioni cellulari separandole dalla popolazione eterogenea iniziale in base alla differenza in un determinato parametro. Sulla base dell analisi della fluorescenza, le cellule GFP positive sono state separate dal resto della popolazione ( sortate ) utilizzando il FACS-Aria (BD bioscience) 3.8. Lisati cellulari. Questa parte sperimentale è sempre eseguita rigorosamente a freddo. Immediatamente prima della lisi, le cellule sono state lavate due volte con PBS freddo. La lisi delle cellule è stata effettuata con un tampone, la cui composizione è di seguito descritta: concentrazione finale: Triton X-100 1% 56

57 Hepes ph mm NaCl 150 mm Glicerolo 10% MgCl mm EGTA 5 mm Per le cellule MM5 è stato utilizzando il buffer di lisi con la seguente composizione: concentrazione finale: Triton X-100 1% Tris-HCl 10 mm NaCl 150 mm EDTA 2 mm Al tampone di lisi sono sempre stati aggiunti, immediatamente prima dell uso, gli inibitori specifici per le proteasi (fenilmetilsulfonil-fluoride, PMSF: concentrazione finale 4 mm e aprotinina: concentrazione finale 50μg/ml), al fine di impedire la degradazione delle proteine estratte e, se necessario, gli inibitori specifici per le fosfatasi (sodio ortovanadato 10 mm e sodio pirofosfato 10 mm). I lisati sono stati centrifugati a 4 C per 20 minuti a rpm in una microcentrifuga da banco (Biofuge Pico Heraeus). Terminata la centrifugazione, il surnatante è stato recuperato ed eventualmente mantenuto a 80 C fino al momento dell'uso Dosaggio delle proteine. La quantità di proteine totali contenute in ogni campione è stata misurata per mezzo del dosaggio delle proteine secondo il metodo di Bradford (Bradford, M., 1976) utilizzando il kit della Biorad (Hercules, CA). Il dosaggio è basato sull utilizzo del colorante Comassie Brillant Blue G-250 in acido fosforico e metanolo. E noto che quando avviene il legame con la proteina, l assorbanza massima per una soluzione acida di tale colorante si sposta da 465 a 595 nm. Per il dosaggio delle proteine la lettura dell assorbanza viene effettuata a 595nm. 57

58 Ogni volta è stata preparata una curva di taratura con diverse diluizioni contenenti da 1 a 8 µg di proteina standard BSA. La concentrazione di ogni campione è stata calcolata in base all equazione della curva di taratura Immunoprecipitazione. I lisati cellulari sono stati incubati a 4 C per 2 ore con l anticorpo desiderato. I complessi antigene/anticorpo formatisi sono stati, quindi, purificati utilizzando 30 l di Gamma Bind G Sefarosio/campione. Gamma Bind G Sepharosio è una forma ricombinante di proteina G di Streptococco, purificata da E.coli e legata covalentemente ad una matrice solida di Sefarosio 4B. L incubazione è stata mantenuta per circa 45 minuti sempre a 4 C e in condizione di gentile agitazione. Le proteine che non si erano adsorbite alla resina venivano ulteriormente rimosse mediante ripetuti lavaggi a 4 C. Ogni lavaggio è stato effettuato utilizzando 1 ml/campione di buffer HNTG (Hepes 20 mm, NaCl 150 mm, Glicerolo 10%, Triton 0.1 %) con ph identico a quello del tampone di lisi. I complessi purificati sono stati separati per elettroforesi su gel di poliacrilammide in SDS (vedi paragrafo 3.8.), eluendo la proteina mediante l aggiunta di Laemmli buffer, composto da Tris-HCl 0.1 mm ph 6.8, glicerolo 30%, SDS 5%, blu di bromofenolo 0.01%, e -ME 1 M Elettroforesi su gel di poliacrilammide. L elettroforesi su gel di poliacrilammide in SDS (SDS-PAGE) è stata eseguita in accordo con il metodo descritto da Laemmli (Laemmli, U.K., 1970), utilizzando un apparato elettroforetico verticale (Gibco BRL). La separazione delle proteine è avvenuta in presenza di SDS, detergente anionico con la proprietà di circondare tutta la superficie proteica, omogeneizzandone la carica superficiale (che comunque rimane negativa). Generalmente, i campioni sono stati separati per elettroforesi in condizioni denaturanti; in questo modo le proteine sono dissociate nella loro subunità polipeptidiche individuali. Il gel verticale utilizzato in questo apparato è composto da una parte superiore, detta stacking gel, al 3% di poliacrilamide e da una parte inferiore, detta 58

59 separating gel, contenente una % variabile di poliacrilammide a seconda della separazione delle proteine che si desidera ottenere. La separazione è avvenuta mediante elettroforesi, con il gel di poliacrialmmide immerso nella soluzione SDS-PAGE running buffer e composto da glicina 250 mm, Tris-HCl 25 mm e SDS 0.1 %. applicando una corrente costante di 20 ma. Come riferimento, una miscela di polipeptidi a peso molecolare noto (Rainbow Full Range, GE Healthcare) è stata fatta migrare nelle stesse condizioni. Dopo separazione mediante elettroforesi, le proteine sono state rivelate tramite Western blot (vedi paragrafo 3.11) Western blot. Dopo separazione su gel di poliacrilammide, le proteine sono state trasferite su filtro di nitrocellulosa mediante eluizione elettroforetica, sfruttando, cioè, il trasferimento sotto l azione di un campo elettrico. Il trasferimento è avvenuto in apposita camera in un tampone di trasferimento composto da Tris-Base 3g/L; Glicina 14,4g/L e metanolo al 20%. L avvenuto trasferimento delle proteine dal gel è stato verificato attraverso colorazione con Rosso Ponceau e successivamente il colorante è stato eliminato per mezzo di alcuni lavaggi con TTBS 1X. il filtro di nitrocellulosa è stato incubato per almeno 2 ore in un tampone di blocco (TBS al 5% di latte) e successivamente incubato per almeno due ore a temperatura ambiente oppure a 4 C over night con l anticorpo primario opportunamente diluito in TBS al 5% di latte (tranne nel caso dell anti-fosfotirosina, diluita in TBS al 3% di latte) sotto gentile agitazione meccanica. I filtri sono stati, quindi, lavati 3 volte in TTBS 1X allo scopo di rimuovere l eccesso di anticorpo. A seconda dell anticorpo primario utilizzato, il complesso antigene-anticorpo è stato visualizzato mediante incubazione con anticorpi (anticorpo di pecora diretto contro il frammento Fc delle IgG murine o anticorpo di asino diretto contro il frammento Fc di coniglio) coniugati alla perossidasi di rafano Tali reagenti sono stati utilizzati ad una diluizione finale di 1:15000 in TBS 1X contenente L incubazione è stata condotta per 1 ora e dopo altri tre lavaggi in TTBS 1X, i filtri sono stati incubati con l opportuna soluzione (ECL Plus Western Blotting Detection System (Amersham) per rivelare il segnale 59

60 attraverso una reazione di chemioluminescenza. Le lastre sono state poi sviluppate tramite immersione prima nel liquido di sviluppo e poi nel fissativo. TBS (Tris Buffered Saline): Tris-HCl ph 7.5 NaCl 10 mm 150 mm TTBS (Tween Tris Buffered Saline): Tris-HCl ph mm NaCl 150 mm Tween % Anticorpi utilizzati. Anticorpo anti-sam68: l anticorpo anti-sam68 utilizzato (Santa Cruz Biotechnology, Santa Cruz, CA) è un anticorpo policlonale prodotto nel coniglio e diretto sia contro la proteina murina che quella umana. Anticorpo anti-fosfotirosina: l anticorpo anti-fosfotirosina utilizzato (Upstate Biotecnology, Lake Placid, N.Y.) è un anticorpo monoclonale IgG 2bk, prodotto in vitro dall ibridoma murino 4G10 e purificato cromatograficamente su colonna contenente Proteina A-Sefarosio. Anticorpo anti-vav1: l anticorpo anti-vav1 utilizzato (Upstate Biotecnology, Lake Placid, N.Y.) è un anticorpo monoclonale murino che riconosce le p95 vav e p85 vav sia umane che murine. Anticorpo anti- actina: l anticorpo anti- actina utilizzato (Santa Cruz Biotechnology, Santa Cruz, CA) è un anticorpo monoclonale murino diretto contro l actina. Anticorpo anti-p21: l anticorpo anti-p21 utilizzato (Santa Cruz Biotechnology, Santa Cruz, CA) è un anticorpo policlonale diretto contro la p21 umana. Anticorpo anti-rac-1: l anticorpo anti-rac-1 utilizzato (BD Biosciences Transduction Laboratories, Lexington, KY) è una anticorpo monoclonale murino IgG2b. 60

61 3.14. Purificazione della proteina di fusione GST-PAK-CRIB. Ceppi di E Coli HB101 trasformati con il vettore plasmidico pgex4t-1 contenente la sequenza relativa al dominio CRIB della proteina PAK umana, inserita secondo il corretto modulo di lettura, a valle della sequenza della glutatione S trasferasi (GST), sono stati fatti crescere per tutta la notte a 37 C in agitazione meccanica, nel brodo di coltura Luria-Bertani supplementato di ampicillina alla concentrazione finale di 50 μg/ml. La sospensione batterica è stata diluita 1:10 con brodo di coltura di fresca preparazione e fatta crescere ancora a 37 C in agitazione meccanica, fino ad una OD 600 = 0.6. Quindi, la coltura batterica è stata indotta con IPTG alla concentrazione finale di 0,1 mm per un periodo di 2 ore. La sospensione batterica è stata centrifugata per 10 minuti a 4 C a 7000 rpm in una centrifuga Beckman J2 21; il pellet è stato, quindi, risospeso nel buffer di lisi, composto da Tris-HCl, 50 mm ph 7.5, EDTA 1 mm, NaCl 100 mm, glicerolo 5%, Triton X-100 0,1%, DTT 1 mm. Al buffer di lisi sono stati aggiunti gli inibitori delle proteasi PMSF (concentrazione finale, 4 mm) e aprotinina (concentrazione finale, 50 μg/ml). Quindi, la sospensione è stata sottoposta a sonicazione in ghiaccio per un minuto ed infine centrifugata a 2500 g per 1 ora e 15 minuti a 4 C. Il surnatante è stato incubato con glutatione legato covalentemente ad una matrice solida rappresentata dal Sefarosio-GSH (glutatione Sefarosio), rispettando il rapporto 100 μl/10 ml di lisato. L'incubazione è avvenuta in condizioni di gentile agitazione per 1 ora a temperatura di 4 C. Al termine dell'incubazione, la matrice solida è stata ripetutamente lavata con il buffer GST-FISH freddo, composto da glicerolo 50%, Tris HCl, 50 mm ph 7.4, NaCl 100 mm, NP-40 1%, MgCl 2 2 mm, DTT 1 mm. A questo buffer sono stati addizionati gli inibitori delle proteasi (fenilmetilsulfonilfluoride, PMSF: concentrazione finale 4 mm e aprotinina: concentrazione finale 50 μg/ml) e gli inibitori specifici per le fosfatasi (sodio ortovanadato 10 mm e sodio pirofosfato 10 mm). Dopo i lavaggi la matrice solida è stata risospesa in 200 l di GST-FISH BUFFER, e mantenuta a -80 C fino all utilizzo in saggi di interazione proteica. Un aliquota della resina coniugata con la proteina di fusione è sempre stata controllata 61

62 tramite colorazione con blu di Comassie, dopo opportuna separazione mediante SDS-PAGE Saggio di interazione proteica in vitro. Prima di essere lisate con l di buffer GST-FISH (per la composizione vedi paragrafo 3.15), le cellule sono state lavate con PBS freddo. I lisati, incubati in ghiaccio per 5 minuti, sono stati centrifugati per 5 minuti a 4 C a rpm. Il sovranatante è stato trasferito in nuove provette e incubato con 60 l di resina coniugata con la proteina di fusione. L incubazione è avvenuta in condizioni di gentile agitazione a 4 C per 45 minuti. Tutte le proteine che non avevano formano complessi con la proteina di fusione sono stati rimossi con alcuni lavaggi con il buffer GST-FISH freddo. I complessi purificati sono stati separati per elettroforesi su gel di poliacrilammide in SDS, eluendo la proteina mediante l aggiunta di Laemmli buffer, composto da Tris-HCl 0.1 mm ph 6.8, glicerolo 30%, SDS 5%, blu di bromofenolo 0.01%, e -ME 1 M Saggio di interferenza dell RNA con plasmidi. Con la tecnica dell interferenza dell RNA (RNAi) si intende un processo di inattivazione genica post trascrizionale, altamente specifico, innescato da RNA a doppia elica (dsrna) omologo alla sequenza del gene da sopprimere. Figura 16. Mappa del vettore prs shrna. 62

63 In questa tesi sperimentale ho effettuato diverse trasfezioni con vettori prs shrna dell OriGene (OriGene Techonologies, Inc., Rockville, MD). Questi vettori esprimono piccole molecole di shrna (shrna, short harpin RNA) in grado di ripiegarsi in una struttura a forcina. Tali vettori di espressione contengono ripetizioni terminali lunghe 3 e 5 (LTR) dell MMLV (MMLV, Moloney Murine Leukemia Virus), il gene per la resistenza alla puromicina e una cassetta di espressione codificante per l shrna posta sotto il controllo del promotore del gene per l RNA nucleare U6. Questa cassetta è composta da una sequenza di 29 nt specifica per il gene bersaglio e dalla sequenza complementare e reversa ad essa, separate da 7 nt codificanti per il loop; a concludere è presente una sequenza di terminazione TTTTTT (Figura 16). Per questa tesi sono stati utilizzati plasmidi in grado di silenziare l espressione sia di Sam68 che di Vav1. In entrambi i casi la ditta ha fornito quattro vettori shrna contenenti quattro cassette di espressione differenti. La sequenza ottimale per ottenere l interferenza del gene Vav1 (shrna #1) è risultata la seguente: TGTCCATTGAGAACCTGGACCAGTCTCTG, mentre la sequenza ottimale per il l abolizione dell espressione della proteina Sam68 (shrna #2) è TTATGAGCAAAGTTGTTACTGATTTCTTG. Come controllo negativo sono stati utilizzati due plasmidi, uno senza cassetta di espressione, l altro codificante per un shrna non in grado di silenziare alcun gene (scramble). I plasmidi specifici per Sam68 sono stati transfettati in maniera transiente sia nelle cellule Karpas 299 che nelle cellule MM5, mentre quelli in grado di interferire con l espressione di Vav1 sono stati transfettati esclusivamente nelle Karpas 299 (vedi capitolo 3.5.) Saggi di proliferazione, vitalità e chemiosensibilità. Diversi saggi possono essere utilizzati per valutare l attività proliferativa delle cellule. In particolare ho potuto valutare la proliferazione cellulare tramite la costruzione di curve di crescita. Le cellule Karpas 299, Karpas CTR e Karpas H2Sam68 sono state starvate e successivamente piastrate in fiasca ad una concentrazione di cellule/ml (volume iniziale 5ml). Il numero delle cellule è stato valutato ogni giorno per una settimana tramite conta in trypan blu. Ogni due 63

64 giorni veniva aggiunto del terreno fresco per assicurare la sopravvivenza cellulare (volume finale 15ml). Per valutare la vitalità cellulare è stato utilizzato il saggio MTT. Il bromuro di metiltiazolildifenil-tetrazolio (MTT) è un sale di tetrazolio che attraversa la membrana plasmatica e viene convertito dalle deidrogenasi mitocondriali di cellule metabolicamente attive in un composto insolubile di colore viola, il formazano. Le cellule morte non sono in grado di effettuare tale conversione. Per questo saggio, le cellule sono state incubate per 3 ore con MTT, previo eventuale trattamenti con il cis- platino alla concentrazione desiderata (vedi risultati), ed i cristalli di formazano solubilizzati attraverso l uso di una soluzione SDS 10% dimetilformamide 50%. La produzione di formazano, indice di vitalità, è stata quantificata mediante misurazione colorimetrica alla densità ottica di 540 nm Saggi di migrazione Per valutare la migrazione cellulare sono stati eseguiti due saggi differenti, a seconda delle caratteristiche delle cellule analizzate. Per valutare la migrazione delle cellule in sospensione è stato utlizzato il metodo di Boyden che consiste in un sistema dotato di due compartimenti dove è possibile indurre le cellule a migrare atrraverso una membrana porosa da un compartimento superiore ad uno inferiore seguendo un gradiente chemotattico. La larghezza dei pori viene scelta in base al tipo cellulare in modo da non consentirne un passaggio passivo. Per i nostri esperimenti sono state utilizzate delle transwell con inserti in policarbonato caratterizzati da pori di 8 m di diametro da inserire in piastre da 24 pozzetti. Le cellule sono state starvate e successivamente piastrate sulla superficie superiore dell inserto ad una concentrazione di 1 x 10 6 / ml in terreno privo di antibiotico e siero. Le transwell sono state poste nei pozzetti di una piastra da 24 per colture cellulari contenenti RPMI come controllo o RPMI 10% di FBS per indurre la migrazione delle cellule. Dopo quattro ore a 37 C sono state contate le cellule nel compartimento inferiore della piastra, quelle cioè che avevano attraversare i pori dell inserto. Il risultato è stato espresso come percentuale del controllo. Per analizzare le capacità migratorie delle cellule in adesione è stato effettuato il Wound/Healing test. Questo saggio è stato sviluppato per la valutazione 64

65 in vitro della migrazione cellulare e prevede la creazione di un solco, detto scratch, su cellule aderenti sub-confluenti. Il monitoraggio dello scratch e del seguente riempimento/riparazione viene fatto mediante microscopio a contrasto di fase munito di fotocamera, immagini (ingrandimento 10X) sono state prese all inizio e ad intervalli regolari scelti fra 12 e 36 ore. La comparazione delle immagini ottenute permette di quantificare il grado di migrazione cellulare. Le cellule di mesotelioma maligno MM-5 sono state seminate in piastre da 24 pozzetti alla concentrazione di 2x104 cellule/pozzetto in 500 μl di terreno completo e poste in incubatore per 24 ore al fine di permettere l adesione delle cellule. Al termine delle 24 ore è stato controllato al microscopio che la confluenza delle cellule sia del 70-80% e quindi si sono praticati 2 scratchs,orizzontalmente, vicini al centro del pozzetto utilizzando un puntale da 10μl sterile; quindi il terreno viene rimosso e sostituito con del terreno fresco. La migrazione è stata valutata in maniera qualitativa osservando se le cellule avevano o meno migrato all interno del solco nell arco di tempo preso in esame (24 e 48 ore) Immunofluorescenza Tale tecnica permette la valutazione di antigeni su diversi preparati biologici mediante l impiego di anticorpi specifici che vengono rilevati con anticorpi secondari coniugati a fluoro cromi. Per la preparazione dei vetrini, questi erano sterilizzati, lavati in etanolo e quindi lasciati asciugare completamente sotto il flusso di una cappa aspirante e successivamente trattati con poli-lisina per facilitare l adesione cellulare ed infine posti su ciascun pozzetto di piastre da 6 per colture cellulari. Su di essi sono state piastrate 4x10 4 cellule in terreno al 10% FBS. Quando le cellule hanno raggiunto una confluenza dell 80% e/o dopo aver effettuato il trattamento con l agente chemioterapico (vedi risultati) le cellule sono state lavate in PBS 1X e fissate in paraformaldeide al 4% in PBS per 10 minuti. Seguivano quindi tre lavaggi in PBS e la permeabilizzazione effettuata tramite trattamento per 10 minuti con PBS 1X contenente 0,05% di saponina + 0,5% di BSA. Dopo tre lavaggi in PBS 1X i campioni sono stati incubati per 1 ora con l anticorpo primario diluito nella soluzione di permeabilizzazione, lavati per 3 volte in PBS 1X e incubati per 45 minuti con l anticorpo anti secondario coniugato con il fluorocromo TEXAS-RED. 65

66 Dopo altri tre lavaggi le cellule sono state incubate per 5 con l Hoechst, un colorante specifico per il nucleo. I vetrini sono stati osservati con il microscopio a fluorescenza Nikon Eclipse 80i e le immagini analizzate con il software Adobe PhotoShop Real Time PCR. La real time RT-PCR è una tecnica specifica, sensibile e riproducibile che permette di quantificare i livelli di espressione di un qualsiasi templato misurando in tempo reale l emissione di fluorescenza di un fluoroforo reporter. Il segnale di fluorescenza aumenta in maniera direttamente proporzionale alla quantità di amplicone che viene sintetizzato ad ogni ciclo. Il dato reale di quantificazione è estrapolato dalla fase esponenziale di emissione di fluorescenza. Viene definito un valore soglia, denominato C T (ciclo soglia), in corrispondenza del quale inizia la fase esponenziale di emissione di fluorescenza, e che viene considerato per l analisi di espressione. Ad elevati livelli di espressione corrisponderanno, quindi, valori di C T bassi e viceversa, a bassi livelli di espressione corrisponderanno valori alti di C T. L RNA totale è stato isolato dalle cellule secondo le istruzioni riportate nel kit RNAeasy (Quiagen, Milano, Italia). Un microgrammo di RNA totale è stato, quindi, retro-trascritto con il QuantiTect Reverse Transcription Kit (Qiagen, Milano), che consente di eliminare la contaminante di DNA genomico Le reazioni di RT-PCR sono state eseguite nel Chromo4 sequence detector (Bio-Rad, Milano, Italia). I livelli di espressione dei trascritti sono stati valutati in real-time RT-PCR con la metodica Syber Green, e sono stati normalizzati rispetto ai livelli di espressione del GAPDH di ogni campione. Le coppie di primers utilizzate per l amplificazione delle sequenze geniche sono le seguenti: CD44std F: 5 -ATCACCGACAGCACAGACAG-3 CD44std R: 5 -GGTTGTGTTTGCTCCACCTT-3 CD44v5 F: 5 -GAAACTGGAACCCAGAAGCA-3 CD44v5 R: 5 -TGTGGGGTCTCTTCTTCCTC-3 CD44v6 F: 5 -CCCAGAAGGAACAGTGGTTT-3 CD44v6 R: 5 -CAGCTGTCCCTGTTGTCGAA-3 66

67 4. RISULTATI Attivazione di Sam68 in cellule esprimenti ALK. Sam68 ha una struttura che le permette di interagire con trasduttori cellulari in risposta all attivazione di molti recettori ad attività tirosin-chinasica, come si verifica in seguito a stimolazione del recettore dell insulina (Sanchez-Margalet, V and Najib, S. 1999) e nella trasduzione del segnale mediata da c-kit (Paronetto, M.P. et al., 2004). Inoltre, nei linfociti T la stimolazione del TCR porta all aumento dei livelli di fosforilazione in tirosina di Sam68 (Najiib, S. et al., 2005). Ho voluto, quindi, valutare la possibilità di un coinvolgimento di Sam68 nella trasduzione mediata dal recettore ALK. A questo scopo ho inizialmente utilizzato la linea di fibroblasti murini NIH- 3T3 transfettate con una proteina chimerica EGFR/ALK (da qui in poi denominata NIH-EGFR/ALK), precedentemente caratterizzata per le sue capacità di indurre in varie linee cellulari risposte biologiche EGF-stimolabili, ma ALK-specifiche (Piccini, G. et al 2002; Bacchiocchi, R. et al, 2005). Tale sistema permette di analizzare, in assenza di un ligando scientificamente riconosciuto, l analisi dei processi molecolari mediati da questo recettore in condizioni di attivazione controllata (Piccinini, G. et al., 2002). A questo scopo le cellule sono state coltivate in medium senza siero per circa 16 ore e successivamente stimolate con 100 ng/ml EGF per periodi di tempo differenti prima di essere sottoposte a lisi. I lisati ottenuti sono stati quindi immunoprecipitati con un anticorpo anti-sam68 e successivamente divisi in due aliquote, ognuna delle quali è stata separata per SDS-PAGE e quindi analizzata per Western-Blot con anticorpo anti-ptyr, per valutare il livello di fosforilazione di Sam68 o con anticorpo anti-sam68 al fine di controllare che, da ogni lisato, fossero stati effettivamente immunoprecipitati quantitativi simili. La stimolazione di ALK provoca la fosforilazione in tirosina di Sam68 che raggiunge i massimi livelli dopo circa 10 minuti dal trattamento delle cellule con EGF, come si evince dal risultato mostrato in figura 17. Simili esperimenti sono stati effettuati su cellule Karpas299, una linea umana 67

68 ottenuta da un caso di ALCL, esprimente la proteina oncogenica NPM/ALK. Nello specifico, tali cellule sono state coltivate per 6 ore in un mezzo contenente 2% di BSA prima di essere sottoposte a lisi e conseguente immunoprecipitazione. Come mostrato in Figura 17 in tali cellule è possibile osservare una fosforilazione costitutiva di Sam68. Nel loro insieme questi risultati dimostrano una modulazione dello stato fosforilativo sui residui tirosinici di Sam68 dipendente dalla attivazione di ALK e quindi un suo possibile coinvolgimento nella trasduzione del segnale da esso mediata. NIH-EGFR/ALK Karpas EGF: + IP: α-sam68 WB: α-ptyr IP: α-sam68 WB: α-sam68 WB: α-ptyr Figura 17: Livelli di fosforilazione in tirosina della proteina Sam68. Cellule NIH-EGFR/ALK e cellule Karpas299 sono state starvate e successivamente coltivate in assenza (-) o in presenza di EGF 100 ng/ml per 10 minuti a 37 C. I lisati cellulari sono stati immunoprecipitati con l anticorpo anti- Sam68; gli immunocomplessi sono stati separati per SDS-PAGE e analizzati per Western Blot utilizzando un anticorpo anti-fosfotirosina (pannello superiore) o anti-sam68 (pannello inferiore) Effetti del silenziamento di Sam68 sulla migrazione e sulla proliferazione. Al fine di valutare l importanza di Sam68 per le proprietà trasformanti di ALK, ho voluto analizzare gli effetti biologici conseguenti all inibizione dell espressione di Sam68 nelle cellule Karpas299. Le cellule Karpas299 sono state, quindi transfettate per elettroporazione con due diversi plasmidi RNA interferenti (shrna; Short Harpin RNA; vedi capitolo 3.14) o con un plasmide vuoto (scramble shrna), utilizzato come controllo negativo. 48 ore dopo la transfezione le cellule sono state lisate e controllate per i livelli di espressione di Sam68 tramite analisi per Western Blot. La transfezione con il shrna-1 non interferisce significativamente con la produzione endogena di Sam68, dato che i livelli di espressione sono 68

69 Migratig cells (% of control) comparabili a quelli osservabili nelle cellule Karpas299 non transfettate o transfettate con il shrna di controllo; per tale motivo tale reagente è stato scartato dalle successive fasi sperimentali. Al contrario, seppur non in grado di abolirne completamente l espressione, la transfezione con il shrna-2 comporta una drastica diminuzione di Sam68 (Figura 18A). A Karpas 299 B Saggio di migrazione Karpas299 Karpas C- Karpas-sh2 Figura 18. Effetto del silenziamento di Sam68 con plasmidi shrna sulla migrazione delle cellule Karpas ore dopo la transfezione con shrna-1, shrna-2 o il vettore scramble (C-) le cellule Karpas299 sono state lisate ed analizzate per il loro contenuto in Sam68 tramite Western Blot utilizzando un anticorpo specifico (A) e contemporaneamente ne è stata valutata la capacità di migrazione. Il risultato è espresso come percentuale di migrazione rispetto al controllo (valore della migrazione delle cellule Karpas299 non transfettate, assunto come 100%) (B). Tali cellule (Karpas299-Sh2) sono state quindi sottoposte a test di migrazione attraverso membrane di policarbonato Transwell (diametro dei pori 8 m) in comparazione alle cellule Karpas299 e Karpas299 transfettate con il shrna scramble di controllo. Come si può osservare dalla Figura 18 B, il silenziamento di Sam68 correla con una fortissima inibizione della migrazione cellulare (inibizione intorno al 75% rispetto ai controlli). Un effetto molto meno importante, seppur significativo, del silenziamento di Sam68, è stato osservato con il test colorimetrico MTT, che consente la valutazione della vitalità cellulare, correlabile al tasso di proliferazione. Più nello specifico, il test MTT, eseguito dopo 48 ore dalla transfezione, ha evidenziato nelle cellule Karpas299-Sh2 un decremento colorimetrico di circa il 20% quando paragonato a quello osservato nelle cellule controllo (Figura 19). 69

70 OD (% of control) Saggio MTT Karpas299 Karpas C- Karpas-sh2 Figura 19. Effetto del silenziamento di Sam68 sulla proliferazione delle cellule Karpas ore dopo la transfezione con il plasmide shrna-2 e il vettore scramble (C - ), le cellule Karpas299 sono state sottoposte a saggio colorimetrico con MTT. Per confermare ulteriormente questo dato, il silenziamento di Sam68 è stato da me anche perseguito mediante infezione delle cellule Karpas299 con due vettori lentivirali contenenti shrna (pllh1-sam68 pllh2-sam68; vedi paragrafo 3.1) in grado di integrarsi nel DNA genomico cellulare e trascrivere molecole di RNA interferenti con il trascritto umano di Sam68 ed impedirne la traduzione e quindi l espressione. Come controllo negativo, le cellule Karpas299 sono state anche infettate con lo stesso construtto lentivirale privo di sequenze interferenti (pll-c - ). Quarantotto ore dopo l infezione, le cellule sono state analizzate per citofluorometria con lo scopo di calcolare la percentuale delle cellule infettate in base alla fluorescenza emessa dalla molecola GFP, contenuta nel construtto lentivirale. I risultati sono riportati nella Figura 20A: la percentuale di cellule positive era del 21,7%, 49,5% e 73;5% per le cellule infettate con pll-h1-sam68, pll-h2-sam68 e pll-c - rispettivamente. L analisi per Western blot delle cellule infettate ha evidenziato una significativa diminuizione dell espressione di Sam68 solamente nelle cellule infettate con il costrutto pll-h2-sam68 (Figura 20 B). Tuttavia, dato che l efficienza di infezione non si era rivelata ottimale, ho sottoposto le Karpas299/pLL-C- (da qui in avanti denominate Karpas-CTR) e le Karpas-pLLh2Sam68 (da qui in avanti denominate Karpas-H2) a separazione tramite FACS- 70

71 sorting, una procedura che permette di selezionare solo le cellule fluorescenti e quindi solo quelle che hanno incorporato il costrutto lentivirale. L analisi per Western blot effettuata dopo FACS-sorting è mostrata in Figura 20 C: con tale procedura sono riuscita ad ottenere una completa abolizione dell espressione di Sam68 nelle cellule Karpas-H2. A B Karpas 299 Sam68 β-actina C Karpas 299 Sam68 β-actin Figura 20. Silenziamento di Sam68 mediante l uso di vettori lenti virali nelle cellule Karpas 299 (A)Quarantotto ore dopo l infezione, le cellule sono state analizzate per citofluorometria per controllare l efficienza d infezione (B). e per Western Blot, per analizzare l espressione della proteina Sam68 (C).Dopo FACS-sorting, le cellule sono state lisate e quindi analizzate per Western Blot, per analizzare l espressione della proteina Sam68 (pannello superiore) e della β- actina utilizzata come controllo interno dell esperimento(pannello inferiore) Sulle cellule ottenute dopo FACS-sorting, ho inoltre analizzato le curve di crescita. I dati, riportiati in Figura 21, evidenziano una significativa diminuzione della vitalità/proliferazione cellulare in seguito ad abolizione dell espressione di Sam68, pari a circa il 35% (giorno 3-5), confermando il dato precedentemente osservato sulle cellule Karpas-sh2 con il saggio colorimetrico MTT. 71

72 cells number x 10^5 60 Curva di crescita Karpas299 Karpas-CTR Karpas-H days of culture Figura 21. Effetto del silenziamento di sam68 sulla crescita delle cellule. Le cellule Karpas299, Karpas-CTR e Karpas-H2 sono state starvate e coltivate per gli intervalli di tempo indicati ad una concentrazione iniziale 10 5 /ml. Le cellule sono state colorate con trypan blue e contate ogni giorno per una settimana. I livelli di espressione di p21/waf1, una proteina in grado di arrestare il ciclo cellulare legando i complessi CDK4/ciclinaD1 e CDK2/ciclina E (Harper, J.W., et al., 1993), risultano elevati nelle cellule Karpas-H2 se paragonati a quelli riscontrati nelle cellule di controllo (Karpas299 e Karpas-CTR) (Figura 22). Karpas299 WB: α-p21 WB: α-β actina Figura 22. Espressione di p21 nelle cellule Karpas-H2. Le cellule Karpas 299, Karpas-CTR e Karpas-H2 sono state lisate ed analizzate per la loro espressione di p21 tramite Western Blot utilizzando un anticorpo specifico (pannello superiore). Nel pannello inferiore sono mostrati i livelli della β- actina nei rispettivi lisati (pannello inferiore). Anche la migrazione delle cellule Karpas-H2 è drasticamente inibita rispetto alle cellule controllo. In tali esperimenti l inibizione osservata è di circa l 85 %, in 72

73 Migrating cells (% of control) linea con il totale silenziamento dell espressione di Sam68 raggiunto con il costrutto lentivirale (Figura 23). Saggio di migrazione Karpas299 Karpas-CTR Karpas-H2 Figura 23. Effetto del silenziamento di Sam68 ottenuta con un costrutto lentivirale sulla migrazione delle cellule Karpas 299. La capacità di migrazione delle cellule Karpas 299, Karpas- CTR e Karpas-H2 è stata valutata analizzando il loro passaggio attraverso membrane di policarbonato Transwell. Il risultato è espresso come percentuale di migrazione rispetto al controllo (valore della migrazione delle cellule Karpas299 non transfettate, assunto come 100%) Effetti del silenziamento di Sam68 sull azione dei chemioterapici. Il silenziamento di Sam68 nelle cellule LNCaP, cellule androgeno-responsive derivate da carcinoma prostatico, è stato associato ad una maggiore sensibilizzazione all apoptosi indotta da chemioterapici (Busà, R. et al., 2007). Per valutare se un simile effetto è osservabile anche nei miei modelli sperimentali, le cellule Karpas- CTR e Karpas-H2 sono state coltivate per 24 ore e 48 ore in assenza o in presenza di cisplatino (concentrazioni finali di 10, 15 e 20 µm), prima di effettuare il test colorimetrico con MTT. In figura 24, relativa al trattamento per 24 ore, si può apprezzare l effetto citotossico dose-dipendente del cis-platino sulle cellule di controllo. Dopo abolizione dell espressione di Sam68 si assiste, tuttavia, ad una drastica sensibilizzazione delle cellule al chemioterapico. Tale risultato suggerisce che questa proteina, la cui iper-espressione è stata osservata in diverse neoplasie 73

74 OD (% of control) umane, possa essere coinvolta con un meccanismo di adattamento con cui le cellule neoplastiche acquisiscano resistenza al trattamento con il chemioterapico. A SAGGIO DI CHEMIOSENSIBILITA' Karpas-CTR 20 0 NT 10μM 15μM 20μM B NT 10μM 15μM 20μM Karpas-H2 Figura 23. Figura 23. Sensibilità delle cellule Karpas299 al cis-platino dopo silenziamento di Sam68.. Le cellule Karpas-CTR (A) e Karpas-H2 (B) sono state trattate per 24 ore con cisplatino alle dosi indicate, prima di valutarne la vitalità tramite saggio colorimetrico MTT Il risultato è espresso come percentuale rispetto al controllo (cellule NT, non trattate). 74

75 4.4. Ruolo di p60 src sull attivazione di Sam68. Sam68 deve il suo nome al fatto di essere stata scoperta come substrato di p60 src durante la mitosi (Ellis, C. et al., 1990). L interazione diretta tra queste due proteine è stata successivamente dimostrata in molti studi su sistemi cellulari diversi (Wong, G. et al., 1992; Fumagalli, S. et al., 1994; Taylor, S. J. and Shalloway, D. 1994; Weng, L. et al., 1994). Nei linfociti T, la stimolazione del TCR e la conseguente attivazione di p56 lck e p59 fyn, membri della famiglia src, è associabile all aumento dei livelli di fosforilazione in tirosina di Sam68. Nelle cellule di carcinoma prostatico è stato dimostrato come l espressione della forma troncata del recettore c-kit promuove una forte attivazione di p60 src con conseguente aumento della fosforilazione di Sam68. In base a queste osservazioni, è stata suggerita la possibilità che la pathway p60 src /Sam68 possa esser coinvolta nella patogenesi di tale neoplasia (Paronetto, M.P. et al., 2004). La tirosina 979, presente sulla sequenza della chimera EGFR/ALK (corrispondente alla tirosina 418 di NPM/ALK, secondo la numerazione definita da Morris, S. W. Et al., 1994) è stata da noi precedentemente identificata come il residuo responsabile del reclutamento di p60 src. Infatti, l espressione del mutante EGFR/ALKY979F, nel quale la tirosina 979 è stata sostituita con fenilanalina in cellule NIH-3T3 (da qui in avanti denominate NIH-EGFR/ALKY979F) è correlata a perdita completa dell associazione p60 src -EGFR/ALK, anche dopo attivazione recettoriale. Inoltre tale mutazione, pur non determinando in vivo cambiamenti apprezzabili dell attività chinasica di ALK, si associa ad una drastica diminuzione della capacità di promuovere proliferazione in risposta all EGF, a sostegno del ruolo critico svolto da p60 src nella trasduzione ALK-mediata (Cussac, D. et al., 2004; Bacchiocchi, R et al., 2005). Esperimenti analoghi a quelli descritti in Figura 17 sono stati da me effettuati sulle cellule NIH-EGFR/ALKY979F, esprimenti in superficie un numero di recettori comparabile a quello delle cellule NIH-EGFR/ALK. Gli esperimenti condotti hanno dimostrato la completa assenza della fosforilazione in tirosina di Sam68 nelle cellule NIH-EGFR/ALKY979F, anche dopo stimolazione con EGF 100 ng/ml (Figura 24A). 75

76 Analoghi risultati sono stati ottenuti sulle cellule NIH-EGFR/ALK (dati non mostrati) e Karpas299 (Figura 24B) in seguito a inibizione farmacologica selettiva di p60 src con il composto PP2. A EGF: NIH-EGFR/ALK Y979F + IP: α-sam68 B Karpas299 PP2: + IP: α-sam68 WB: α-ptyr WB: α-ptyr IP: α-sam68 WB: α-sam68 IP: α-sam68 WB: α-sam68 Figura 24: Ruolo di p60 src nella fosforilazione di Sam68 mediata da ALK. Dopo la starvation le cellule NIH EGFR/ALK Y979F sono state cultivate in assenza (-) o presenza (+) di EGF 100 ng/ml per10 minuti a 37 C e sucessivamente lisate (A). Le cellule Karpas 299 sono state starvate e incubate con DMSO come controllo (-) o con PP2 1 μm per 30 minuti (+) e successivamente lisate. (B) (A,B) I lisati cellulari sono stati immunoprecipitati con l anticorpo anti-sam68; gli immunocomplessi sono stati separati per SDS-PAGE e analizzati per Western Blot utilizzando un anticorpo anti-fosfotirosina (pannello superiore) e anti Sam68 (pannello inferiore). Questi risultati suggeriscono l esistenza di una via di trasduzione nella quale l attivazione di ALK modulerebbe la fosforilazione di Sam68 attraverso meccanismo p60 src -dipendente Associazione Sam68/Vav1. Sebbene Sam68 sia principalmente localizzata nel nucleo, osservazioni sperimentali condotte su neuroni, fibroblasti e spermatociti infettati da virus, indicano la sua presenza anche a livello citoplasmatico (McBride, A. E. et al., 1998; Paronetto M. P. et al., 2006; Ben Fredj N. et al., 2006; Lazer G. et al., 2007). Un lavoro più recente ha dimostrato la localizzazione di Sam68 in prossimità della membrana plasmatica durante l invasione cellulare, in concomitanza della quale è rapidamente fosforilata in tirosina ed utilizzata come molecola adattatrice per modulare l attività di p60 src, consentendo in questo modo una appropriata 76




Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


Prof. Maria Alessandra Santucci

Prof. Maria Alessandra Santucci La famiglia Abl consiste di due isoforme Abl (1a e 1b ) e due isoforme Arg (1a e 1b). Le isoforme di tipo b contengono un sito di miristoilazione all N-teminale che manca nelle isoforme a. c-abl è una


Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come


Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari





RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)


Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di



MALATTIE UMANE LEGATE ALL UPP: IL MORBO DI PARKINSON MALATTIE UMANE LEGATE ALL UPP: IL MORBO DI PARKINSON La degradazione proteica è uno dei meccanismi essenziali che regolano i livelli di proteine cellulari, coinvolto in processi cellulari cruciali dal





RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.


La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:



ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio


- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi Ciclo Cellulare M --> G1--> S --> G2 --> M S, G2 e M hanno durata sempre uguale mentre la fase G1 (in media 10 ore) può subire enormi variazioni da tessuto a tessuto (fino a migliaia di ore per i neuroni).


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici Fattori estrinseci Ambiente Danno genotossico



DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac


Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,


Proliferazione e morte cellulare sono eventi fisiologici

Proliferazione e morte cellulare sono eventi fisiologici MORTE CELLULARE Proliferazione e morte cellulare sono eventi fisiologici Omeostasi tissutale (di tessuti dinamici) Sviluppo embrionale Eliminazione di strutture corporee inutili - Fasi di scultura/rimodellamento


scaricato da

scaricato da Recettori a tirosina chinasi I recettori a tirosina chinasi presentano vari domini Una regione di legame (extracellulare) Una regione transmembrana Una coda intracellulare con numerose tirosine scaricato


The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione


Recettori di superficie

Recettori di superficie Recettori di superficie Esistono 3 classi principali di recettori di superficie 1. Recettori annessi a canali ionici 2. Recettori accoppiati alle proteine G 3. Recettori associati ad enzimi Recettori


La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,


Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,


Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per


Uso di vettori lentivirali per trasdurre linee cellulari di adenocarcinoma colorettale con shrnas silenzianti il gene herg1

Uso di vettori lentivirali per trasdurre linee cellulari di adenocarcinoma colorettale con shrnas silenzianti il gene herg1 Uso di vettori lentivirali per trasdurre linee cellulari di adenocarcinoma colorettale con shrnas silenzianti il gene herg1 e loro applicazione in studi pre-clinici. Il trasferimento genico è una tecnologia


Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi


Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,


Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.




Her-2 nel carcinoma mammario

Her-2 nel carcinoma mammario Her-2 nel carcinoma mammario Piera Balzarini U.O. Anatomia Patologica Università degli Studi di Brescia Spedali Civili di Brescia Il gene ERBB2 dà origine ad un recettore tirosin-chinasico appartenente


Il TCR è un eterodimero costituito da due catene polipeptidiche chiamate catena α ecatenaβ legate insieme da un ponte disolfuro. Entrambe le catene

Il TCR è un eterodimero costituito da due catene polipeptidiche chiamate catena α ecatenaβ legate insieme da un ponte disolfuro. Entrambe le catene I linfociti T sono le cellule dell immunità adattativa responsabili della protezione verso le infezioni ad opera dei microbi intracellulari. Essi derivano da cellule staminali del midollo osseo che si


La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta



INFEZIONE DA HIV ED AIDS WWW.SLIDETUBE.IT INFEZIONE DA HIV ED AIDS HIV 1 ed HIV 2 appartengono alla famiglia dei Retroviridae, genere lentovirus. L infezione da HIV provoca nell ospite una progressiva compromissione delle difese immunitarie, soprattutto


Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello



REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)






MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e


Servizi di Ricerca a Terzi. Luglio 2015

Servizi di Ricerca a Terzi. Luglio 2015 Servizi di Ricerca a Terzi Luglio 2015 Chi siamo Vera Salus Ricerca S.r.l. (VSR) è una target discovery biotech company che mette a disposizione le proprie competenze e la propria strumentazione in qualità


Ricerca di bersagli per la terapia sistemica del mesotelioma

Ricerca di bersagli per la terapia sistemica del mesotelioma Ricerca di bersagli per la terapia sistemica del mesotelioma Searching for targets for the systemic therapy of mesothelioma Stahel RA, Weder W, Felley- Bosco E, Petrausch U, Curioni-Fontecedro A, Schmitt-Opitz


Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte


Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto


Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro

Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Le chinasi ATM e ATR sono coordinatrici di un fine meccanismo di controllo noto come checkpoint del


Cosa sono i Macatori Tumorali?

Cosa sono i Macatori Tumorali? Marcatori tumorali Cosa sono i Macatori Tumorali? Sostanze biologiche sintetizzate e rilasciate dalle cellule tumorali o prodotte dall ospite in risposta alla presenza del tumore Assenti o presenti in


C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni


Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule


Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno


Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale


Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro


Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti





Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,


Fattori di crescita FATTORI DI CRESCITA. Recettori

Fattori di crescita FATTORI DI CRESCITA. Recettori FATTORI DI CRESCITA FATTORI DI CRESCITA Fattori di crescita FATTORI DI CRESCITA Recettori FATTORI DI CRESCITA Proliferazione Differenziamento FATTORI DI CRESCITA? Come fa una interazione tra due molecole



MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza


Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi


Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO


La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:



EPITHELIAL TO MESENCHYMAL TRANSITION (EMT) IN DEVELOPMENT AND DISEASES. Cristina Valacca 18 Maggio 2012 EPITHELIAL TO MESENCHYMAL TRANSITION (EMT) IN DEVELOPMENT AND DISEASES Cristina Valacca 18 Maggio 2012 DEFINIZIONE L'EMT è un processo biologico che consente a una cellula epiteliale di iniziare numerosi


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli


Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e


Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione


Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra


Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula Mediatore chimico Recettore Trasduzione del segnale Risposta della cellula I mediatori chimici sono prodotti da cellule specializzate e sono diffusi nell organismo da apparati di distribuzione Sistemi


Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della


Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis


Meccanismi di controllo della proliferazione cellulare

Meccanismi di controllo della proliferazione cellulare Meccanismi di controllo della proliferazione cellulare Il ciclo cellulare è regolato dall azione di PROTOONCOGENI e (attivatori della proliferazione cellulare) GENI ONCOSOPPRESSORI (inibitori del ciclo








SEBASTIANO FILETTI. Dipartimento di Medicina Interna e Specialità Mediche. Università di Roma Sapienza, Roma

SEBASTIANO FILETTI. Dipartimento di Medicina Interna e Specialità Mediche. Università di Roma Sapienza, Roma SEBASTIANO FILETTI Dipartimento di Medicina Interna e Specialità Mediche Università di Roma Sapienza, Roma La malattia tiroidea è in aumento negli ultimi anni. Quali le ragioni? Dati epidemiologici provenienti


Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento


04/04/14. Fondamenti di biochimica Terza edizione. Le ghiandole principali del sistema endocrino. Capitolo 13 La segnalazione biochimica

04/04/14. Fondamenti di biochimica Terza edizione. Le ghiandole principali del sistema endocrino. Capitolo 13 La segnalazione biochimica Fondamenti di biochimica Terza edizione Donald Voet Judith G. Voet Charlotte W. Pratt La segnalazione biochimica Copyright 2013 Zanichelli editore S.p.A. Gli ormoni Conce& chiave 13.1 Gli ormoni endocrini


Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei


sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come


La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo


Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Riparazione del DNA ed insorgenza di tumori Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Danni al DNA e cancro Le cellule tumorali L importanza della stabilità


Citochine dell immunità specifica

Citochine dell immunità specifica Citochine dell immunità specifica Proprietà biologiche delle citochine Sono proteine prodotte e secrete dalle cellule in risposta agli antigeni Attivano le risposte difensive: - infiammazione (immunità





Si verificano in tutte le classi di vertebrati ed invertebrati

Si verificano in tutte le classi di vertebrati ed invertebrati Genetica dei tumori Si verificano in tutte le classi di vertebrati ed invertebrati Sarcomi e carcinomi sono stati riscontrati in alcune mummie egiziane e vengono descritti nei papiri. I Greci erano a conoscenza



DISTROFIA MIOTONICA TIPO 2 (DM2) DISTROFIA MIOTONICA TIPO 2 (DM2) Frequenza: si ritiene vi sia circa 1 caso su 100.000 persone. Purtroppo il valore reale della sua prevalenza è difficile da valutare essendo una malattia scoperta recentemente.


Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione


Diapositiva 3: CASPASI IAP inibitor of apoptosis

Diapositiva 3: CASPASI IAP inibitor of apoptosis Diapositiva 1: Diapositiva 2: Nella presente presentazione vengono trattate le correlazioni scoperte e studiate tra la tecnica dei microrna e l apoptosi. Innanzitutto l apoptosi è il processo che porta



COMUNICAZIONE INTERCELLULARE COMUNICAZIONE INTERCELLULARE Recettore Cellula segnalante Cellula target Molecola che segnala Cellula segnalante Recettore Cellula target SEGNALI INTERCELLULARI Recettori di superficie La molecola segnalante


Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche


IL-2R & IL-15R Alice Praduroux

IL-2R & IL-15R Alice Praduroux Università degli Studi di Torino Facoltà di Biotecnologie Molecolari Anno Accademico 2006/2007 Corso di Immunologia Molecolare IL-2R & IL-15R Alice Praduroux Classificazione Recettori appartenenti alla



V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una


Virus Oncogeni. Ciclo vitale litico. Per la maggior parte dei virus è vero: proteine virali. Replicazione Lisi Progenie virale

Virus Oncogeni. Ciclo vitale litico. Per la maggior parte dei virus è vero: proteine virali. Replicazione Lisi Progenie virale Virus Oncogeni Per la maggior parte dei virus è vero: Genoma proteine virali Replicazione Lisi Progenie virale Ciclo vitale litico 1 Virus Oncogeni Ciclo vitale latente Virus Cellula Integrazione (generalmente)


Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi generali Metodi mirati Scoperta e sviluppo di nuovi


DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti


IL 12R e IL 27R. Diego Alberti

IL 12R e IL 27R. Diego Alberti IL 12R e IL 27R Diego Alberti Caratteristiche generali IL 12R e IL 27R appartengono alla famiglia di citochine/recettori di tipo I La classe I di recettori è caratterizzata da 4 residui di cisteina conservati


Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi



