Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare"

Transcript

1 Insegnamento di Genomica Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare docenti: Silvia Fuselli Vincenza Colonna Inga Prokopenko Morena de Bastiani

2 Definizioni Genomica: Scienza che si interessa della determinazione e dello studio, a livello molecolare, dell intera sequenza di DNA di un organismo. Genoma: L intero contenuto genico di un organismo vivente

3

4 oggi Genetica Molecolare Collegamento tra DNA ed ereditarietà Struttura del DNA Codice genetico Sequenziamento DNA PCR Progetto genoma umano Informatica Primi computer Primo computer commerciale Chip Internet collega 4 università americane PC Internet collega tutto il mondo

5 Bioinformatica Informatica applicata alla biologia (molecolare) con diversi scopi: Generazione di dati: Interpretazione di dati di sequenziamento Assemblaggio di sequenze e genomi Organizzazione di dati: I dati sono memorizzati in banche dati di pubblico dominio Devono essere accessibili per parole chiave o comunque in modo semplice Devono essere collegati tra loro in modo logico: da un cromosoma devo potere risalire ai geni mappati sul cromosoma, dai geni alle proteine che codificano, e così via

6 Bioinformatica Ma anche analisi (alcuni esempi): Analisi delle sequenze nucleotidiche per la localizzazione di geni ed elementi di regolazione. Analisi delle sequenze proteiche allo scopo di riconoscerne la funzione biologica. Studio delle interazioni intermolecolari tra proteine e acidi nucleici allo scopo di riconoscerne la funzione e sviluppare nuovi farmaci. Studio dell evoluzione di geni e genomi per la loro classificazione funzionale e filogenetica Studio dell espressione dei geni in diverse condizioni Sviluppo di tecniche diagnostiche innovative Progettazione e applicazione di modelli che simulino i processi biologici cellulari

7 Genomica Determinazione e studio dell intera sequenza del DNA di un organismo. Identificazione e studio dell espressione dei geni (associati a malattie e non) in essa contenuti. Trascrittomica Identificazione, studio e analisi funzionale dell intero contenuto di mrna di una cellula. Proteomica Studio sistematico della struttura (primaria, secondaria, terziaria), della funzione e delle interazioni tra proteine. Reti metaboliche Studio di serie di processi biochimici legati tra loro da relazioni funzionali. Es:. Processi chimici e biochimici che portano alla morte cellulare nelle patologie tumorali

8 5 agosto 2005 da ensembl

9 5 maggio 2006 da ensembl

10 Ensembl release 53 - Mar 2009

11

12

13 Obiettivi fondamentali della Genomica Tutti i progetti genoma condividono un gruppo comune di scopi: Stabilire un database ed un interfaccia di ricerca, reciprocamente integrati e disponibili su Internet Ottenere e combinare mappe fisiche e genetiche del genoma Generare ed ordinare sequenze genomiche e sequenze di geni espressi (allineamento contig, segnali di sequenze espresse: EST) Identificare ed annotare tutti i geni codificati da un determinato genoma Costruire atlanti di espressione genica (analisi dei microarray) Accumulare dati funzionali, identificando le caratteristiche biochimiche, cellulare e fisiologiche dei geni (Genomica funzionale, Farmacogenomica). Caratterizzare la diversità di sequenza del DNA attraverso lo studio della distribuzione dei polimorfismi, analisi del LD (Genetica forense, Genetica delle popolazioni) Fornire le risorse per eseguire comparazioni tra i genomi (Genomica comparativa)

14 Programma Anatomia dei genomi I genomi dei procarioti I genomi degli eucarioti (I genomi nucleari, I genomi degli organelli) Studio dei genomi Enzimi (nucleasi,ligasi,ecc.), Clonazione, Vettori (BAC, YAC, ecc.), PCR La mappatura dei genomi Mappatura genetica (RFLP, SSLP, SNPs ecc.) Mappatura fisica (restrizione, FISH, STS, ecc.) Metodi per il sequenziamento del DNA Metodi di sequenziamento Assemblaggio dei contigua Funzionamento dei genomi I domini della cromatina Modificazioni della cromatina e l espressione del genoma Progetto Genoma umano Evoluzione dei Genomi

15 Diversi tessuti umani sono formati da cellule che si comportano in modo diverso (nel corpo umano ci sono circa 6x10 13 cellule) Ogni cellula contiene una esatta copia del genoma (che non è altro che l intera sequenza del DNA dell organismo) All interno del nucleo della cellula ci sono i cromosomi: 22 paia di autosomi e un paio di cromosomi sessuali XY Nei cromosomi si possono individuare porzioni di DNA codificante chiamati geni

16 Dogma Centrale L espressione dell informazione genetica raccolta nelle molecole di DNA, avviene in due stadi: (i) trascrizione, durante la quale il DNA è trascritto in mrna (ii) traduzione, durante la quale l mrna è tradotto per produrre la proteina associata DNA mrna proteine

17 Espressione Differenziale Se ogni cellula contiene una copia dell intero genoma, e le cellule sono di diversi tipi (cellule muscolari, cellule cardiache, cellule della pelle, cellule del sangue ), Che cosa le rende differenti? Espressione genica differenziale, cioè: quando, dove, e in che quantità ogni gene è espresso. Il controllo dell espressione genica può essere esercitato ad ogni tappa del processo che termina con la sintesi proteica ma avviene prevalentemente a livello della prima tappa, ovvero a livello della trascrizione del DNA in RNA messaggero.

18

19

20

21

22 Anatomia dei genomi

23 EUCARIOTI: nucleo, mitocondri (cloroplasti) piante animali funghi protozoi PROCARIOTI eubatteri (gram +, gram -, cianobatteri) archeobatteri

24

25 Anatomia dei genomi eucariotici

26 Componenti nucleari e mitocondrali del genoma umano Genoma nucleare: 3,2 Gb composto da 46 molecole di DNA lineare: La molecola più corta è di ~ 47Mb e la più lunga è di ~ 245 Mb Genoma mitocondriale: molecola di DNA circolare di bp; Ci sono ~ 800 mt per cellula e ~10 copie di mtdna per mitocondrio = 8000 molecole di mtdna

27 Il genoma mitocondriale umano Sequenziato nel 1981 (Anderson et al.) Control region bp

28 Il Genoma umano in numeri 23 paia di cromosomi; 2 metri di DNA; 3,200,000,000 bp (3,2 Gb; 3,200 Mb; 3,200,000 kb); 20,000-25,000 geni.???????????

29

30 Dicembre, 2003

31 Maggio, 2005 Maggio, 2004

32 10% di sequenze ripetute non assegnabili perché appartengono a telomeri, centromeri ecc.

33 Science Jun 21;272(5269): The complete 685-kilobase DNA sequence of the human beta T cell receptor locus. Rowen L, Koop BF, Hood L. Department of Molecular Biotechnology, University of Washington, Seattle , USA. The human beta T cell receptor (TCR) locus, comprising a complex family of genes, has been sequenced. The locus contains two types of coding elements-tcr elements (65 variable gene segments and two clusters of diversity, joining, and constant segments) and eight trypsinogen genes --that constitute 4.6 percent of the DNA. Genome-wide interspersed repeats and locusspecific repeats span 30 and 47 percent, respectively, of the 685-kilobase sequence. A comparison of the germline variable elements with their approximately 300 complementary DNA counterparts reveals marked differential patterns of variable gene expression, the importance of exonuclease activity in generating TCR diversity, and the predominant tendency for only functional variable elements to be present in complementary DNA libraries. 65 V ß ; 2 cluster DJC con 1 D ß, 6-7 J ß, 1 C ß

34 Un segmento del genoma umano Locus: Recettore ß delle cellule T 685 Kb 50 Kb Cromosoma 7

35 Cosa contiene questa regione di 50 kb, parte del locus che codifica il β T-cell receptor? un gene: TRY4 (5 esoni, 4 introni) due segmenti genici: V28 e V29-1, discontinui uno pseudogene: TRY5 52 genome-wide repeat sequences : 4 tipi tutti presenti (LINEs, SINEs, elementi LTR, trasposoni) due microsatelliti il rimanente 50% della sequenza è composto di DNA a singola copia, non genico e non ripetitivo, a funzione ignota

36 GENOMI EUCARIOTI tutti sono suddivisi in 2 o + molecole lineari tutti gli eucarioti hanno anche genomi mitocondriali, alcuni anche cloroplastici le caratteristiche generali sono comuni, l unico aspetto molto variabile è la grandezza il n di cromosomi non è legato alla complessità della specie, né alla grandezza del genoma (es. salamandra ha un genoma 30 volte più grande dell uomo ed è distribuito su un n di cromosomi che è la metà di quello umano)

37

38

39 Contenuto in paia di basi del genoma aploide Le dimensioni dei genomi dei vari organismi sono molto variabili. L ordine di grandezza però coincide in un certo modo con la complessità dell organismo: eucarioti semplici (funghi) hanno genomi piccoli, eucarioti superiori (vertebrati o piante a fiore) hanno genomi grandi AMEBA?!?!? paradosso del valore C

40 Paradosso del valore C manca correlazione tra la complessità di un organismo e la grandezza del suo genoma La grandezza del genoma è correlata al numero di geni in esso contenuti???

41 Paradosso del numero dei geni es: genoma di lievito = 12 Mb genoma umano = 3200 Mb uomo ha ~ geni x genoma umano lievito dovrebbe avere x 0.004= 100 geni in realtà ne ha la correlazione tra le dimensioni del genoma di un organismo ed il numero di geni in esso contenuto non è affatto esatta!

42 Specie Dimensioni del genoma (Mb) N geni approssimativo Eucarioti S. Cerevisiae 12, C. elegans Arabitopsis thaliana (erba galletta) * D. Melanogaster Homo Sapiens Batteri Mycoplasma genitalium 0, Streptococcus pneumoniae 2, Vibrio cholerae EI Tor N , Mycobacterium tubercolosis H37Rv 4, Escherichia coli K12 4, Yersinia pestis CO92 4, Pseudomonas aeruginosa PA01 6, Archea Methanococcus jannaschii 1, Archaeoglobulus fulgidusla) 2, (*) circa 8000 geni sono specifici per la fotosintesi Ipotesi: i genomi più grossi presentano un numero di geni maggiore

43 Cr. 7 Cr. 3

44 rispetto a quello umano il segmento del genoma di lievito contiene più geni (26 per proteine e 2 per trna) i geni discontinui sono molto pochi: solo 239 introni in tot (nell uomo > di ) ci sono poche genome wide repeats: una LTR (Ty2) e 4 LTR troncate (sequenze delta). In questo caso LTR sono 16% del tot, ma in realtà, su tutto il genoma, sono solo il 3.4% (nell uomo il 44%, in drosofila il 12%)

45 soluzione: i genomi degli organismi meno complessi hanno i geni strettamente impacchettati, e per questo risultano più piccoli.

46 Sembra che le genome-wide repeats abbiano ruolo importante nel determinare il grado di compattezza di un genoma in mais sembrano costituire ~ 50% del genoma sta emergendo che nei genomi di alcune specie queste repeats hanno proliferato massicciamente questo spiegherebbe perché genomi di specie molto simili possono essere anche molto diversi per grandezza Riflette l eterogeneità degli eventi evolutivi che hanno portato al modellamento dei diversi genomi

47

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Mappe fisiche. Si basano sulla localizzazione fisica delle molecole di DNA

Mappe fisiche. Si basano sulla localizzazione fisica delle molecole di DNA Mappe fisiche Si basano sulla localizzazione fisica delle molecole di DNA Costruzione di una mappa fisica diversi metodi - Mappe a bassa risoluzione - Mappe ad alta risoluzione Risoluzione= distanza a

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Protocollo dei saperi imprescindibili

Protocollo dei saperi imprescindibili Protocollo dei saperi imprescindibili Ordine di scuola:professionale DISCIPLINA: Scienze integrate( Scienze della Terra e Biologia) RESPONSABILE: Meri Teti CLASSI SECONDE SEZIONE B INDIRIZZO: Grafico CONOSCENZE/CONTENUTI:

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 ASSE DISCIPLINA SCIENTIFICO TECNOLOGICO BIOTECNOLOGIE AGRARIE DOCENTE DARMAN ELENA 2 BIENNIO CLASSE 3 CORSO E SEZIONE TECNICA

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

CELLULE EUCARIOTICHE

CELLULE EUCARIOTICHE CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica, citoplasma, DNA e ribosomi (comuni a

Dettagli

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Seconda Università di Napoli II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Gruppo di studio La Sbobba A cura di dodo e Ely24e 1) Introduzione alla Genetica Medica Pag. 2

Dettagli

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010 PLASMIDI puc ALTRI TIPI DI VETTORI VETTORI λ (15-20 Kb) = vettori ottenuti apportando delle modifiche al genoma del batteriofago λ. COSMIDI (40-45 Kb) = plasmidi che contengono i siti cos di λ utili per

Dettagli

ISTITUTO TECNICO ECONOMICO MOSSOTTI

ISTITUTO TECNICO ECONOMICO MOSSOTTI SECONDE AFM - TUR UdA n. 1 Titolo: biosfera/evoluzione dei viventi/tassonomia Acquisire e decodificare concetto di complessità e di interdipendenza all'interno di un sistema biologico Generalità sulla

Dettagli

NUTRIGENOMICA :foresight bio-tecnologico Paolo Manzelli pmanzelli@gmail.com : www.egocreanet.it ; www.edscuola.it/lre.html

NUTRIGENOMICA :foresight bio-tecnologico Paolo Manzelli pmanzelli@gmail.com : www.egocreanet.it ; www.edscuola.it/lre.html NUTRIGENOMICA :foresight bio-tecnologico Paolo Manzelli pmanzelli@gmail.com : www.egocreanet.it ; www.edscuola.it/lre.html http://www.medicinalive.com/wp-content/uploads/2008/07/nutrigenomica.jpg Ippocrate

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento www.unitn.it/cibio

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization Università degli Studi di Genova Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica Anno Accademico 2009/2010 Tesi di Laurea Specialistica Elaborazione di dati

Dettagli

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA I.P.S.I.A. Bettino Padovano Senigallia INDIRIZZO CHIMICO BIOLOGICO 2009/10 ALUNNO:MATTEO BARBARINI CLASSE: 5 TECNICO CHIMICO-BIOLOGICO DOCENTE:PROF.SSA

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza

Dettagli

Basi Teoriche e Applicazioni delle Nuove Tecnologie Genomiche

Basi Teoriche e Applicazioni delle Nuove Tecnologie Genomiche Corsi di laurea magistrale in: Biotecnologie agrarie e ambientali (LM-7) Biologia cellulare e molecolare (LM-6) Sicurezza e qualitàagroalimentare (LM-69 & LM-70) insegnamento di Basi Teoriche e Applicazioni

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 Domande concettuali C1. Si potrebbe concludere che la donna porta una delezione nel gene che è riconosciuto dalla sonda. Per clonare questo gene, potresti iniziare

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015 1) I batteri sono organismi: a- bicellulari b- monocellulari c- pluricellulari 2) I virus: a- possono riprodursi solo nell acqua b- possono riprodursi solo sulla superficie di una cellula c- possono riprodursi

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici

Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici T.A. Brown Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici Chapter 2_Genome Anatomies http://www.ncbi.nlm.nih.gov/books/nbk21112/ Copyright Garland Science 2007 Capitolo 8: Genomi

Dettagli

Lezione 3. Genoma umano come esempio di genoma eucariote

Lezione 3. Genoma umano come esempio di genoma eucariote Lezione 3 Genoma umano come esempio di genoma eucariote 3.2 x 10 9 bp Genoma umano 22 autosomi + xx (femmina) o xy (maschio) Primo draft di sequenza: 2001 Genotipo: sequenza di DNA, sia nucleare che mitocondriale.

Dettagli

TECNICHE DI ANALISI BIOLOGICHE

TECNICHE DI ANALISI BIOLOGICHE TECNICHE DI ANALISI BIOLOGICHE VENERDÍ 15.12.2006 Flow chart: 1. struttura cellulare; 2. genesi cellulare; 3. organizzazione cellulare; 4. compartimentazione cellulare; 5. struttura del d.n.a.; 6. topografia

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli