Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "BIOINFORMATICA: Cosa è?"



2 THE DEFINITIONS OF BIOINFORMATICS Bioinformatics is an integration of mathematical, statistical and computer methods to analyse biological, biochemical and biophysical data (Georgia Inst of Tech., USA) Bioinformatics is the study of biological information as is passes from its storage site in the genome to the various gene products in the cell. it involves the creating and development of advanced information and computational technologies for problems in molecular biology (Stanford University, USA) Bioinformatics specifically refers to the search and use of patterns and structure in biological data and the development of new methods for database access.. Computational biology is more frequently used to refer to physical and mathematical simulation of biological processes (Virginia Inst Tech., USA)

3 THE GENOMIC ERA The genomic era has produced a massive explosion in the amount of biological information Eukaryota 91 Bacteria 1155 Archaea 37

4 Perché nasce la Bioinformatica HGP: Iniziò formalmente nel 1990 e doveva durare 15 anni ma la rapidità degli avanzamenti tecnologici ne accelerarono il completamento al Il progetto genoma ha stimolato il miglioramento delle tecnologie di sequencing. Il costo e sceso, i tempi sono diminuiti: il numero di dati prodotti e esploso

5 Perché nasce la Bioinformatica Eukaryota 91 Bacteria 1155 Archaea 37 Chi si occupa di organizzare, analizzare e rendere accessibili tutti questi dati? BIOINFORMATICA Computers can be used to gather, store, analyse biological data

6 Contenere, Organizzare e Rendere accessibili i dati biologici Bioinformatics: DATABASES Memorizzazione accurata, organizzazione, indicizzazione e mantenimento di informazioni biologiche Comunicazione e integrazione fra database Aggiornamento dell informazione Esempi (Sequenze proteiche e nucleotidiche, genomi, strutture, malattie,...)

7 Contenere, Organizzare e Rendere accessibili i dati biologici Altre fonti di dati biologici cosiddette high-throughput Proteomica Trascrittomica Interattomica E poi: genomica strutturale, biologia dei sistemi...

8 Analizzare i dati biologici e costruire strumenti predittivi Bioinformatics: TOOLS ricerca di similarità tra sequenze (ricerca di omologia funzionale) ricerca di geni nelle sequenze di DNA (decifrazione) ricerca di motivi funzionali nel DNA (es. siti di binding per fattori di trascrizione) nel RNA (strutture secondarie) e nelle proteine (domini) analisi dei genomi e loro comparazione allineamento multiplo di sequenze e analisi filogenetica analisi di dati strutturali 3D di PROTEINE; predizione della struttura di proteine analisi dei risultati di esperimenti con microarray...

9 Cosa è la bioinformatica La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici con metodi informatici. Applicazione di metodiche informatiche per l acquisizione, la gestione e l analisi di dati biologici

10 BIOINFORMATICA: Un po di storia

11 It was born at the end of the 70 s when the first nucleotidic sequences were published The first databases End of 70 s: NBRF (National Biomedical Research Foundation) database: a collection of clusters of homologues proteins 1981: first release of the EMBL (European Molecular Biology Laboratory Heidelberg) database: A library of DNA and RNA sequences 1982: first release of the GeneBank (USA) database: A library of DNA and RNA sequences 1986: first release of the DDBJ (Japan) database: A library of DNA and RNA sequences Half of the 80 s: first specialized databases (PROSITE, PDB..) Nowadays: more than 1200 biological databases are available on the web

12 The first bioinformatics tools 1970: an algorithm for the research of the best global alignment of two sequences was published 1981: an algorithm for the research of the best local alignment of two sequences was published 1983: an algorithm for the research of similarities in databases was published 1985: FASTA 1990: BLAST Two of the most used programs for the search of sequence similarities Nowadays: a lot of algorithms were published 1) for sequence comparison 2) to build phylogenetic trees 3) to predict secondary and tertiary protein structures 4) to predict protein-protein, protein-inhibitor interactions


14 I database o o raccolgono informazioni e dati derivati dalla letteratura e da analisi effettuate in laboratorio oppure attraverso l applicazione di analisi bioinformatiche o analisi in silico. sono generalmente accessibili liberamente e possono essere consultati via web.

15 Archivio dati Prima di parlare di database introduciamo gli archivi dati Molte informazioni e molti dati necessità di memorizzarli e conservarli Prima dell avvento del PC le informazioni venivano memorizzate su supporti fisici quali la carta Come? predisponendo apposite strutture di conservazione dei dati Esempio: registri, quaderni di appunti limiti: la memorizzazione dei dati è sequenziale e non permette un ordinamento specifico Sistema più evoluto: Schedario L elemento principale è la scheda che caratterizza ogni elemento dell archivio

16 Bioinformatics in the post-sequence era Nature Genetics 33, (2003) M. Kanehisa & P. Bork

17 General types of databases Primary Raw and non-processed data Secondary Curated data chosen from criteria E.g non-redundance, fold Tertiary Data processed HMM profile

18 Banche dati di sequenze nucleotidiche Sono i contenitori di tutti i dati sperimentali prodotti nel mondo e resi disponibili alla comunità scientifica. i db di sequenze geniche contengono questi dati e informazioni generiche correlate (laboratorio dove è avvenuto il sequenziamento, data, specie, descrizione ) EMBL datalibrary GenBank DDBJ Europa USA Giappone I tre database si aggiornano quotidianamente scambiandosi i dati ricevuti durante la giornata, in modo che sia sufficiente interrogare solo uno dei tre.

19 Banche dati di sequenze proteiche These libraries collect both protein sequences obtained through experimental determination and protein sequences derived from the translation of nucleotide sequences (which were predicted or determined to codify for a protein) GeneBank DDBJ EMBL database Amino acid sequence determined through experimental analysis Nucleotide sequences databases Validated enriched of specific information Protein sequences databases PIR TrEMBL SWISSPROT

20 PIR (Protein Information Resource) Developed by the Georgetown University (USA) and the MIPS (Munich) Good quality of the annotations for proteins and good level of update but isolated from the other resources Before 2002 SWISSPROT Developed by the Swiss Institute of Bioinformatics (SIB) (Swizerland) data A high level of annotation, minimal level of redundancy and high level of integration with other databases TrEMBL (Translated EMBL Nucleotide Sequence Data Library) Developed by the EBI (UK) A computer-annotated supplement of Swiss-Prot that contains all the translations of EMBL nucleotide sequence entries not yet integrated in Swiss-Prot

21 PIR After 2002 People who curated the SWISSPROT (SIB) TrEMBL (EBI) joined their forces for the creation of UNIPROT Knowledgebase The Universal Protein resource The central database of protein sequences with accurate, consistent, rich sequence and functional annotation

22 The UNIPROT database structure The Swiss-Prot protein knowledgebase After manual revision The TrEMBL FEATURES: As much annotation information as possible (periodically update the annotations, make use of external experts of groups of proteins who report their comments) Minimal redundancy (Many databases contain for a given protein more than one entry, which correspond to different literature reports. In Swiss-Prot the data for a protein are merged into one entry) Integration with other databases (Integration with other nucleic, protein and structure databases is guaranteed: links to more than 50 different databases) Documentation which explains the database FEATURES: Automatic annotation (Infomation is transferred from the well characterized sequences in Swiss-prot to these entries) Redundancy removal (Sequences of the same organism with an Id=100% are merged)

23 Banche dati genomiche A genome sequences database collects data related to the genomic mapping and the genomic sequencing of one or more organisms. Three kinds of genome databases Databases which collect data of all the sequenced genomes Databases specific for one organism with sequenced genome i.e. Entrez_Genomes (NCBI) EBI_Genome (EBI) Databases which collect data of a category of organisms with sequenced genomes i.e. Bacterial genomes (Comprehensive microbial research at the TIGR database) i.e. GadFly or FlyBASE (Fruit Fly) MGD (mouse) RGD (rat) GDB and Ensemble (Human)

24 Useful addresses: Database Genome(s) Address Entrez_genome All sequenced genomes EBI_Genomes TIGR All sequenced genomes Sequenced bacterial genomes GadFly Fruit fly FlyBASE Fruit fly MGD Mouse RGD Rat Ensemble Human GDB Human

25 The common feature of genomic databases The possibility to download all the sequences (nucleic acids sequences) of the genome or a part of them (i.e. a specific chromosome) Most of the genomic databases developed also the correspondent proteomic resource (The complete ensemble of proteins obtained by the translation of the genome for a given organism)

26 Banche dati di strutture The PDB is the single worldwide repository for the processing and distribution of 3-D structure data of large biological molecules. Curated by The PDB is managed by the Research Collaboratory for Structural Bioinformatics (RCSB) consortium: Rutgers, the State University of New Jersey San Diego Supercomputer Center (SDSC) The accession numbers: 4 characters 1fbl, 12ca

27 PDB Statistics structures deposited

28 PDB redundancy Since any new solved structure can be deposited in the PDB, more than one structure can be available for the same protein (different resolution, different spectroscopic techniques) structures deposited Sequence Identity Number of nonredundant chains 90% % % 19241

29 PDB related sources MSD PDBsum MMDB

30 Quanti database ci sono? Nucleic Acids Research (NAR) pubblica tutti gli anni un numero dedicato ai database e mantiene un archivio di tutti i database a loro noti Dati 2006 Nel 2006 erano ca. 860 Nel 2010 sono 1230

31 I database proteicisecondari Contengono il risultato di analisi eseguite sulle sequenze contenute nei database primari per arricchire il dato di informazioni utili. Esempio. Da SWISSPROT, database primario di sequenze di aminoacidi, sono stati ricavati i database secondari Prosite e Pfam, nei quali si da maggior rilievo alla classificazione delle famiglie e dei domini proteici. Database of protein families and domains Protein families database of alignments and HMMs

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l


Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE


Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli Fonti e testi di riferimento Dan Graur: >courses > bioinformatics



DATABASE DI GENETICA E BIOLOGIA MOLECOLARE DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance in Man EntrezGene curated sequence and descriptive information about genetic loci GenCards HGMD dbsnp database of human genes,


II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance


Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Docente: Dr. Nicola Vitulo Dipartimento di Biologia, CRIBI Viale G.Colombo3, 35131 Padova


Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting


Whole genome SNPs comparison: SNPtree, NDtree, CSI Phylogeny and kmer-based analysis

Whole genome SNPs comparison: SNPtree, NDtree, CSI Phylogeny and kmer-based analysis Whole genome SNPs comparison: SNPtree, NDtree, CSI Phylogeny and kmer-based analysis Valeria Michelacci NGS course, June 2016 Webserver-based free pipelines available NCBI pipeline FDA GenomeTrakr CGE/DTU


Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,


Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle


Informatica Biomedica: Lezione 15. Informatica Biomedica. Other structure databanks. The Worldwide Protein Data Bank (wwpdb) Macromolecular structures

Informatica Biomedica: Lezione 15. Informatica Biomedica. Other structure databanks. The Worldwide Protein Data Bank (wwpdb) Macromolecular structures Informatica Biomedica: Lezione 15 Informatica Biomedica lezione15 Alberto*Paoluzzi Mauro*Ceccanti http : // paoluzzi/web/did/biomed/ Informatica e Automazione, "Roma Tre" Medicina Clinica,


e-science Bioinformatics

e-science Bioinformatics Luciano Milanesi Luciano Milanesi Institute of Biomedical Technology CNR ABSTRACT. The Bioinformatics community was an early adopter of the Internet and contributed to the e-science development by publishing


Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli Emanuele Pascariello Emanuele Pascariello Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email Emanuele Pascariello


Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia

Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Lorenzo Morelli Istituto di Microbiologia Facoltà di Agraria UCSC Piacenza In questa presentazione Peculiarità del genoma dei


strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine


We take care of your buildings

We take care of your buildings We take care of your buildings Che cos è il Building Management Il Building Management è una disciplina di derivazione anglosassone, che individua un edificio come un entità che necessita di un insieme


Formati di scambio dati

Formati di scambio dati Formati di scambio dati Genbank È il genetic sequence DataBase del NIH (National Institute of Health) Contiene sequenze (primarie) annotate di nucleotidi e di proteine I files sono ragguppati in divisioni


Banche Dati. Docente: Dr. Antinisca DI MARCO

Banche Dati. Docente: Dr. Antinisca DI MARCO Docente: Dr. Antinisca DI MARCO Email: La biologia molecolare produce una grande mole di dati che può essere memorizzata in database general-purpose o specialized (es. immunological):





Banche dati molti dati sulle proteine derivano dalle banche dati primarie

Banche dati molti dati sulle proteine derivano dalle banche dati primarie Banche dati Banche dati Si possono raggruppare in varie categorie in base al tipo di dato biologico che raccolgono e organizzano, ma ce ne sono alcune che sono da considerarsi fondamentali: - banche dati


Laboratorio di Bioinformatica I. Parte 2. Dott. Sergio Marin Vargas (2014 / 2015)

Laboratorio di Bioinformatica I. Parte 2. Dott. Sergio Marin Vargas (2014 / 2015) Laboratorio di Bioinformatica I Banche dati Parte 2 Dott. Sergio Marin Vargas (2014 / 2015) Google Scholar E un motore di ricerca di Google, specializzato nella ricerca di articoli


2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma L elettroforesi bidimensionale separa le proteine in base alla loro carica (come nella IEF) e dimensioni


Corso di Elementi di Bioinformatica

Corso di Elementi di Bioinformatica Corso di Elementi di Bioinformatica Laurea Triennale in Informatica I dati e le banche dati in Bioinformatica Anno Accademico 2015-2016 Docente del laboratorio: Raffaella Rizzi 1 Il DNA (oggetto biologico)


SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche.

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche. I due centri maggiori, EBI e NCBI hanno sviluppato sistemi dedicati di RETRIEVAL allo scopo di ottenere il massimo delle informazioni con il minimo sforzo da parte dell utente SRS (Sequence Retrieval System)


Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling


Basi di dati biologici

Basi di dati biologici Basi di dati biologici Materiale da: The GenBank Sequence Database, A. D. Baxevanis. In Bioinformatics A practical Guide to the Analysis of Genes and Proteins Wiley-Liss 1998 Introduzione alla Bioinformatica





PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma.

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma. PROTEOMA Si definisce proteoma il complemento tempo- e cellulo- specifico del genoma. Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse nello stesso momento in


Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina


Banche Dati Secondarie. geni trascritti proteine profili strutture

Banche Dati Secondarie. geni trascritti proteine profili strutture Banche Dati Secondarie geni trascritti proteine profili strutture definizione Banca dati il cui contenuto deriva da una banca dati primaria DB sec DB primario informazione PROSITE SWISS Prot patterns Profiles


Name on a passport, HANGTAG

Name on a passport, HANGTAG recagroup design architecture art cinema travel music food Name on a passport, HANGTAG A quick look at printing techniques for hangtags RECA GROUP The hangtag of a garment is its ID card, its passport,


ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor


Laurea Magistrale in. Stochastics and Data Science

Laurea Magistrale in. Stochastics and Data Science Laurea Magistrale in Stochastics and Data Science Dati e decisioni: la sfida della società moderna For Today s Graduate, Just One Word: Statistics E. Brynjolfsson, MIT Center for Digital Business Director,


Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione


Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of


Fiori di campo. Conoscere, riconoscere e osservare tutte le specie di fiori selvatici più note

Fiori di campo. Conoscere, riconoscere e osservare tutte le specie di fiori selvatici più note Fiori di campo. Conoscere, riconoscere e osservare tutte le specie di fiori selvatici più note M. Teresa Della Beffa Click here if your download doesn"t start automatically Fiori di campo. Conoscere, riconoscere


WELCOME. Go to the link of the official University of Palermo web site; Click on the box on the right side Login unico

WELCOME. Go to the link of the official University of Palermo web site; Click on the box on the right side Login unico WELCOME This is a Step by Step Guide that will help you to register as an Exchange for study student to the University of Palermo. Please, read carefully this guide and prepare all required data and documents.


PMBOK Guide 3 rd Edition 2004

PMBOK Guide 3 rd Edition 2004 PMBOK Guide 3 rd Edition 2004 Un modello di riferimento per la gestione progetti a cura di Tiziano Villa, PMP febbraio 2006 PMI, PMP, CAPM, PMBOK, PgMP SM, OPM3 are either marks or registered marks of





PATENTS. December 12, 2011

PATENTS. December 12, 2011 December 12, 2011 80% of world new information in chemistry is published in research articles or patents Source: Chemical Abstracts Service Sources of original scientific information in the fields of applied



LA STORIA STORY THE COMPANY ITI IMPRESA GENERALE SPA LA STORIA ITI IMPRESA GENERALE SPA nasce nel 1981 col nome di ITI IMPIANTI occupandosi prevalentemente della progettazione e realizzazione di grandi impianti tecnologici (termotecnici ed elettrici) in


TNCguide OEM Informativa sull introduzione di documentazione aggiuntiva nella TNCguide

TNCguide OEM Informativa sull introduzione di documentazione aggiuntiva nella TNCguide Newsletter Application 4/2007 OEM Informativa sull introduzione di documentazione aggiuntiva nella APPLICABILITÀ: CONTROLLO NUMERICO itnc 530 DA VERSIONE SOFTWARE 340 49x-03 REQUISITI HARDWARE: MC 420


Introduzione all ambiente di sviluppo

Introduzione all ambiente di sviluppo Laboratorio II Raffaella Brighi, a.a. 2005/06 Corso di Laboratorio II. A.A. 2006-07 CdL Operatore Informatico Giuridico. Introduzione all ambiente di sviluppo Raffaella Brighi, a.a. 2005/06 Corso di Laboratorio





Banche dati, citazioni e indici bibliometrici

Banche dati, citazioni e indici bibliometrici Banche dati, citazioni e indici bibliometrici di Bonaria Biancu Corso per dottorandi e assegnisti di ricerca del DISCO Università degli Studi di Milano-Bicocca Milano, 18 febbraio 2009 Valutare la scienza


why? what? when? where? who?

why? what? when? where? who? why? l azienda overview l innovazione innovation WeAGoo è un azienda italiana specializzata nella raccolta di informazioni turistiche brevi ed essenziali a carattere storico, artistico, culturale, naturalistico


Progetto Cluster. Sottoprogetto Bioinformatica

Progetto Cluster. Sottoprogetto Bioinformatica Progetto Cluster Sottoprogetto Bioinformatica CRS4 (Centro di Ricerca, Sviluppo e Studi Superiori in Sardegna) Società costituita nel 1990 svolge attività di ricerca e sviluppo basate sulle tecnologie


Debtags. Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini

Debtags. Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini Debtags Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini ( 1/14 Fondazioni teoretiche Classificazione a Faccette (sfaccettature) Scoperte del cognitivismo (capacità


Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse


26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale

26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale 26. Bioinformatica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Lo sviluppo delle Biotecnologie ha consentito di elevare


I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in


Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization Università degli Studi di Genova Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica Anno Accademico 2009/2010 Tesi di Laurea Specialistica Elaborazione di dati


100 consigli per vivere bene (Italian Edition)

100 consigli per vivere bene (Italian Edition) 100 consigli per vivere bene (Italian Edition) Raffaele Morelli Click here if your download doesn"t start automatically 100 consigli per vivere bene (Italian Edition) Raffaele Morelli 100 consigli per


Bioinformatica ed applicazioni di bioinformatica strutturale!

Bioinformatica ed applicazioni di bioinformatica strutturale! Bioinformatica ed applicazioni di bioinformatica strutturale! Bioinformatica! Le banche dati! Programmi per estrarre ed analizzare i dati! I numeri! Cellule nell uomo! Geni nell uomo! Genoma umano Il dogma


Copyright 2012 Binary System srl 29122 Piacenza ITALIA Via Coppalati, 6 P.IVA 01614510335 - http://www.binarysystem.

Copyright 2012 Binary System srl 29122 Piacenza ITALIA Via Coppalati, 6 P.IVA 01614510335 - http://www.binarysystem. CRWM CRWM (Web Content Relationship Management) has the main features for managing customer relationships from the first contact to after sales. The main functions of the application include: managing


Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E3101Q116) AA 2016/2017 I dati in Bioinformatica Docente del laboratorio: Raffaella Rizzi 1 Il DNA (oggetto biologico)


Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)


Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY)


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%


Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data


Basi di dati biologiche

Basi di dati biologiche Basi di dati biologiche Seminario per il corso di Basi di Dati II Luana Rinaldi AGENDA: Introduzione alla bioinformatica; Concetti Biologici; Banche dati biologiche; Collaborazioni



INFORMAZIONE AGLI UTENTI DI APPARECCHIATURE DOMESTICHE O PROFESSIONALI INFORMAZIONE AGLI UTENTI DI APPARECCHIATURE DOMESTICHE O PROFESSIONALI Ai sensi dell art. 13 del Decreto Legislativo 25 luglio 2005, n. 151 "Attuazione delle Direttive 2002/95/CE, 2002/96/CE e 2003/108/CE,


Corso di ricerca bibliografica

Corso di ricerca bibliografica Corso di ricerca bibliografica Trieste, 11 marzo 2015 Partiamo dai motori di ricerca Un motore di ricerca è un software composto da tre parti: 1.Un programma detto ragno (spider) che indicizza il Web:


Che cos e la bioinformatica. Bioinformatica lezione 1

Che cos e la bioinformatica. Bioinformatica lezione 1 Che cos e la bioinformatica Che cos e la bioinformatica La disciplina che studia gli aspetti molecolari della vita con metodi computazionali. Che cosa fa la bioinformatica Gestisce ed analizza i dati biologici


Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633


Get Instant Access to ebook Guida Agli Etf PDF at Our Huge Library GUIDA AGLI ETF PDF. ==> Download: GUIDA AGLI ETF PDF

Get Instant Access to ebook Guida Agli Etf PDF at Our Huge Library GUIDA AGLI ETF PDF. ==> Download: GUIDA AGLI ETF PDF GUIDA AGLI ETF PDF ==> Download: GUIDA AGLI ETF PDF GUIDA AGLI ETF PDF - Are you searching for Guida Agli Etf Books? Now, you will be happy that at this time Guida Agli Etf PDF is available at our online


Gasparini Alessandra BIM

Gasparini Alessandra BIM Gasparini Alessandra 592026-BIM Pfam è una banca dati di famiglie proteiche creata dal Wellcome Trust Sanger Institute a partire dal database Pfamseq basato su Uniprot. Le famiglie proteiche di Pfam sono


Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica


CHI SIAMO ABOUT US. Azienda giovane fresca e dinamica ottiene immediatamente un ottimo successo conseguendo tassi di crescita a doppia cifra

CHI SIAMO ABOUT US. Azienda giovane fresca e dinamica ottiene immediatamente un ottimo successo conseguendo tassi di crescita a doppia cifra CHI SIAMO Nel 1998 nasce AGAN, societa specializzata nei servizi di logistica a disposizione di aziende che operano nel settore food del surgelato e del fresco. Azienda giovane fresca e dinamica ottiene


New, Classic & Old, History, Concept car, Meeting Day, Lifestyle, for fans and members in the world

New, Classic & Old, History, Concept car, Meeting Day, Lifestyle, for fans and members in the world MercedesRoadster.IT New, Classic & Old, History, Concept car, Meeting Day, Lifestyle, for fans and members in the world Newspaper supplement Emmegi Magazine Independent unaffiliated / funded by Daimler


Dr Mila Milani. Comparatives and Superlatives

Dr Mila Milani. Comparatives and Superlatives Dr Mila Milani Comparatives and Superlatives Comparatives are particular forms of some adjectives and adverbs, used when making a comparison between two elements: Learning Spanish is easier than learning



CODI/21 PIANOFORTE II // CODI/21 PIANO II MASTER di II livello - PIANOFORTE // 2nd level Master - PIANO ACCESSO: possesso del diploma accademico di II livello o titolo corrispondente DURATA: 2 ANNI NUMERO ESAMI: 8 (escluso l esame di ammissione)


Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?


PIANO DI STUDI. Primo anno di corso

PIANO DI STUDI. Primo anno di corso PIANO DI STUDI Laurea in Economia, commercio internazionale e mercati finanziari (DM 270/04) L-33 Bachelor degree in Italian and in English (2 curricula in English) 1) CURRICULUM: Economia internazionale


Individuazione e classificazione dei rifiuti pericolosi

Individuazione e classificazione dei rifiuti pericolosi Individuazione e classificazione dei rifiuti pericolosi Paolo Pipere Responsabile Servizio Ambiente ed Ecosostenibilità Camera di Commercio di Milano Classificazione dei rifiuti I criteri di classificazione


Basi di dati biologici. GenBank. lezione 09 1

Basi di dati biologici. GenBank. lezione 09 1 Basi di dati biologici GenBank lezione 09 1 Esempio: GenBank Che cos è GenBank (NCBI HomePage.htm) n è il genetic sequence DataBase del NIH (National Institute of Health) n


Sezione 1 / Section 1. Elementi d identità: il marchio Elements of identity: the logo

Sezione 1 / Section 1. Elementi d identità: il marchio Elements of identity: the logo Sezione 1 / Section 1 2 Elementi d identità: il marchio Elements of identity: the logo Elements of identity: the logo Indice 2.01 Elementi d identità 2.02 Versioni declinabili 2.03 Versioni A e A1, a colori


Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the

Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the 1 2 3 Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the body scientists say these cells are pluripotent.


Combinazioni serie IL-MIL + MOT

Combinazioni serie IL-MIL + MOT Combinazioni tra riduttori serie IL-MIL e MOT Combined series IL-MIL + MOT reduction units Combinazioni serie IL-MIL + MOT Sono disponibili varie combinazioni tra riduttori a vite senza fine con limitatore


3. Confronto tra due sequenze

3. Confronto tra due sequenze 3. Confronto tra due sequenze Esercizio 1: uso di DotLet Il programma DotLet è accessibile dal sito, dove può essere utilizzato attraverso un interfaccia utente


Spettrometria di Massa applicata alla PROTEOMICA

Spettrometria di Massa applicata alla PROTEOMICA Spettrometria di Massa applicata alla PROTEOMICA 1. MALDI-TOF: Determinazione di mappe peptidiche mediante digestione in gel di spot separati su E-2D E da estratti proteici totali Identificazione rapida


Ingegneria del Software Testing. Corso di Ingegneria del Software Anno Accademico 2012/2013

Ingegneria del Software Testing. Corso di Ingegneria del Software Anno Accademico 2012/2013 Ingegneria del Software Testing Corso di Ingegneria del Software Anno Accademico 2012/2013 1 Definizione IEEE Software testing is the process of analyzing a software item to detect the differences between








Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,


StrumenJ semanjci per la ricerca applicata ai tram funzionali: sviluppo e applicabilità dei Thesauri

StrumenJ semanjci per la ricerca applicata ai tram funzionali: sviluppo e applicabilità dei Thesauri LifeWatch e-science European Infrastructure for Biodiversity and Ecosystem Research StrumenJ semanjci per la ricerca applicata ai tram funzionali: sviluppo e applicabilità dei Thesauri Caterina Bergami


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing


4 6 7 7 8 8 9 10 11 14 15 17 21 25 Riassunto Realizzazione di un Sistema Informativo Territoriale per la sorveglianza sanitaria della fauna nel Parco Nazionale della Majella tramite software Open Source


Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo


Una Ricerca Erboristica (Italian Edition)

Una Ricerca Erboristica (Italian Edition) Una Ricerca Erboristica (Italian Edition) Matteo Politi Click here if your download doesn"t start automatically Una Ricerca Erboristica (Italian Edition) Matteo Politi Una Ricerca Erboristica (Italian


formati > formats Esagono 15 15x17 (6 x6.7 ) Esagono 5 5x5,7 (2 x2.2 ) Optical Mod. A 15x17 (6 x6.7 ) Optical Mod. B 15x17 (6 x6.

formati > formats Esagono 15 15x17 (6 x6.7 ) Esagono 5 5x5,7 (2 x2.2 ) Optical Mod. A 15x17 (6 x6.7 ) Optical Mod. B 15x17 (6 x6. Catalogo Catalogue >2 Assecondando l evoluzione della piastrella diamantata a rivestimento, è giunto il momento per ETRURIA design di pensare anche al pavimento. La prima idea è quella di portare il diamantato



B R O C H U R E D E I C O R S I Scuola di Dottorato in Scienze della Vita e della Salute B R O C H U R E D E I C O R S I Dottorato in Sistemi Complessi per le Scienze della Vita Printed by Campusnet - 24/01/2016 06:15 Indice Indice Giornate


MACHINE LEARNING e DATA MINING Introduzione. a.a.2015/16 Jessica Rosati

MACHINE LEARNING e DATA MINING Introduzione. a.a.2015/16 Jessica Rosati MACHINE LEARNING e DATA MINING Introduzione a.a.2015/16 Jessica Rosati Apprendimento Automatico(i) Branca dell AI che si occupa di realizzare dispositivi artificiali capaci di


Advanced Molecular Systems BioMedicine And Complex Pathological Phenotypes

Advanced Molecular Systems BioMedicine And Complex Pathological Phenotypes The International School of Advanced Molecular, Genome and Complex Systems BioMedicine Advanced Molecular Systems BioMedicine And Complex Pathological Phenotypes Catania, Italy, june 18-20, 2014 Wassily


La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA





CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi


Tecniche biofisiche basate su nanopori

Tecniche biofisiche basate su nanopori Tecniche biofisiche basate su nanopori -Pori di dimensione nanometrica -Attraverso membrane lipidiche o inorganiche -Di natura proteica o scavati con tecnologie top-down Possono essere impiegati per -Studiare
