Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "BIOINFORMATICA: Cosa è?"



2 THE DEFINITIONS OF BIOINFORMATICS Bioinformatics is an integration of mathematical, statistical and computer methods to analyse biological, biochemical and biophysical data (Georgia Inst of Tech., USA) Bioinformatics is the study of biological information as is passes from its storage site in the genome to the various gene products in the cell. it involves the creating and development of advanced information and computational technologies for problems in molecular biology (Stanford University, USA) Bioinformatics specifically refers to the search and use of patterns and structure in biological data and the development of new methods for database access.. Computational biology is more frequently used to refer to physical and mathematical simulation of biological processes (Virginia Inst Tech., USA)

3 THE GENOMIC ERA The genomic era has produced a massive explosion in the amount of biological information Eukaryota 91 Bacteria 1155 Archaea 37

4 Perché nasce la Bioinformatica HGP: Iniziò formalmente nel 1990 e doveva durare 15 anni ma la rapidità degli avanzamenti tecnologici ne accelerarono il completamento al Il progetto genoma ha stimolato il miglioramento delle tecnologie di sequencing. Il costo e sceso, i tempi sono diminuiti: il numero di dati prodotti e esploso

5 Perché nasce la Bioinformatica Eukaryota 91 Bacteria 1155 Archaea 37 Chi si occupa di organizzare, analizzare e rendere accessibili tutti questi dati? BIOINFORMATICA Computers can be used to gather, store, analyse biological data

6 Contenere, Organizzare e Rendere accessibili i dati biologici Bioinformatics: DATABASES Memorizzazione accurata, organizzazione, indicizzazione e mantenimento di informazioni biologiche Comunicazione e integrazione fra database Aggiornamento dell informazione Esempi (Sequenze proteiche e nucleotidiche, genomi, strutture, malattie,...)

7 Contenere, Organizzare e Rendere accessibili i dati biologici Altre fonti di dati biologici cosiddette high-throughput Proteomica Trascrittomica Interattomica E poi: genomica strutturale, biologia dei sistemi...

8 Analizzare i dati biologici e costruire strumenti predittivi Bioinformatics: TOOLS ricerca di similarità tra sequenze (ricerca di omologia funzionale) ricerca di geni nelle sequenze di DNA (decifrazione) ricerca di motivi funzionali nel DNA (es. siti di binding per fattori di trascrizione) nel RNA (strutture secondarie) e nelle proteine (domini) analisi dei genomi e loro comparazione allineamento multiplo di sequenze e analisi filogenetica analisi di dati strutturali 3D di PROTEINE; predizione della struttura di proteine analisi dei risultati di esperimenti con microarray...

9 Cosa è la bioinformatica La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici con metodi informatici. Applicazione di metodiche informatiche per l acquisizione, la gestione e l analisi di dati biologici

10 BIOINFORMATICA: Un po di storia

11 It was born at the end of the 70 s when the first nucleotidic sequences were published The first databases End of 70 s: NBRF (National Biomedical Research Foundation) database: a collection of clusters of homologues proteins 1981: first release of the EMBL (European Molecular Biology Laboratory Heidelberg) database: A library of DNA and RNA sequences 1982: first release of the GeneBank (USA) database: A library of DNA and RNA sequences 1986: first release of the DDBJ (Japan) database: A library of DNA and RNA sequences Half of the 80 s: first specialized databases (PROSITE, PDB..) Nowadays: more than 1200 biological databases are available on the web

12 The first bioinformatics tools 1970: an algorithm for the research of the best global alignment of two sequences was published 1981: an algorithm for the research of the best local alignment of two sequences was published 1983: an algorithm for the research of similarities in databases was published 1985: FASTA 1990: BLAST Two of the most used programs for the search of sequence similarities Nowadays: a lot of algorithms were published 1) for sequence comparison 2) to build phylogenetic trees 3) to predict secondary and tertiary protein structures 4) to predict protein-protein, protein-inhibitor interactions


14 I database o o raccolgono informazioni e dati derivati dalla letteratura e da analisi effettuate in laboratorio oppure attraverso l applicazione di analisi bioinformatiche o analisi in silico. sono generalmente accessibili liberamente e possono essere consultati via web.

15 Archivio dati Prima di parlare di database introduciamo gli archivi dati Molte informazioni e molti dati necessità di memorizzarli e conservarli Prima dell avvento del PC le informazioni venivano memorizzate su supporti fisici quali la carta Come? predisponendo apposite strutture di conservazione dei dati Esempio: registri, quaderni di appunti limiti: la memorizzazione dei dati è sequenziale e non permette un ordinamento specifico Sistema più evoluto: Schedario L elemento principale è la scheda che caratterizza ogni elemento dell archivio

16 Bioinformatics in the post-sequence era Nature Genetics 33, (2003) M. Kanehisa & P. Bork

17 General types of databases Primary Raw and non-processed data Secondary Curated data chosen from criteria E.g non-redundance, fold Tertiary Data processed HMM profile

18 Banche dati di sequenze nucleotidiche Sono i contenitori di tutti i dati sperimentali prodotti nel mondo e resi disponibili alla comunità scientifica. i db di sequenze geniche contengono questi dati e informazioni generiche correlate (laboratorio dove è avvenuto il sequenziamento, data, specie, descrizione ) EMBL datalibrary GenBank DDBJ Europa USA Giappone I tre database si aggiornano quotidianamente scambiandosi i dati ricevuti durante la giornata, in modo che sia sufficiente interrogare solo uno dei tre.

19 Banche dati di sequenze proteiche These libraries collect both protein sequences obtained through experimental determination and protein sequences derived from the translation of nucleotide sequences (which were predicted or determined to codify for a protein) GeneBank DDBJ EMBL database Amino acid sequence determined through experimental analysis Nucleotide sequences databases Validated enriched of specific information Protein sequences databases PIR TrEMBL SWISSPROT

20 PIR (Protein Information Resource) Developed by the Georgetown University (USA) and the MIPS (Munich) Good quality of the annotations for proteins and good level of update but isolated from the other resources Before 2002 SWISSPROT Developed by the Swiss Institute of Bioinformatics (SIB) (Swizerland) data A high level of annotation, minimal level of redundancy and high level of integration with other databases TrEMBL (Translated EMBL Nucleotide Sequence Data Library) Developed by the EBI (UK) A computer-annotated supplement of Swiss-Prot that contains all the translations of EMBL nucleotide sequence entries not yet integrated in Swiss-Prot

21 PIR After 2002 People who curated the SWISSPROT (SIB) TrEMBL (EBI) joined their forces for the creation of UNIPROT Knowledgebase The Universal Protein resource The central database of protein sequences with accurate, consistent, rich sequence and functional annotation

22 The UNIPROT database structure The Swiss-Prot protein knowledgebase After manual revision The TrEMBL FEATURES: As much annotation information as possible (periodically update the annotations, make use of external experts of groups of proteins who report their comments) Minimal redundancy (Many databases contain for a given protein more than one entry, which correspond to different literature reports. In Swiss-Prot the data for a protein are merged into one entry) Integration with other databases (Integration with other nucleic, protein and structure databases is guaranteed: links to more than 50 different databases) Documentation which explains the database FEATURES: Automatic annotation (Infomation is transferred from the well characterized sequences in Swiss-prot to these entries) Redundancy removal (Sequences of the same organism with an Id=100% are merged)

23 Banche dati genomiche A genome sequences database collects data related to the genomic mapping and the genomic sequencing of one or more organisms. Three kinds of genome databases Databases which collect data of all the sequenced genomes Databases specific for one organism with sequenced genome i.e. Entrez_Genomes (NCBI) EBI_Genome (EBI) Databases which collect data of a category of organisms with sequenced genomes i.e. Bacterial genomes (Comprehensive microbial research at the TIGR database) i.e. GadFly or FlyBASE (Fruit Fly) MGD (mouse) RGD (rat) GDB and Ensemble (Human)

24 Useful addresses: Database Genome(s) Address Entrez_genome All sequenced genomes EBI_Genomes TIGR All sequenced genomes Sequenced bacterial genomes GadFly Fruit fly FlyBASE Fruit fly MGD Mouse RGD Rat Ensemble Human GDB Human

25 The common feature of genomic databases The possibility to download all the sequences (nucleic acids sequences) of the genome or a part of them (i.e. a specific chromosome) Most of the genomic databases developed also the correspondent proteomic resource (The complete ensemble of proteins obtained by the translation of the genome for a given organism)

26 Banche dati di strutture The PDB is the single worldwide repository for the processing and distribution of 3-D structure data of large biological molecules. Curated by The PDB is managed by the Research Collaboratory for Structural Bioinformatics (RCSB) consortium: Rutgers, the State University of New Jersey San Diego Supercomputer Center (SDSC) The accession numbers: 4 characters 1fbl, 12ca

27 PDB Statistics structures deposited

28 PDB redundancy Since any new solved structure can be deposited in the PDB, more than one structure can be available for the same protein (different resolution, different spectroscopic techniques) structures deposited Sequence Identity Number of nonredundant chains 90% % % 19241

29 PDB related sources MSD PDBsum MMDB

30 Quanti database ci sono? Nucleic Acids Research (NAR) pubblica tutti gli anni un numero dedicato ai database e mantiene un archivio di tutti i database a loro noti Dati 2006 Nel 2006 erano ca. 860 Nel 2010 sono 1230

31 I database proteicisecondari Contengono il risultato di analisi eseguite sulle sequenze contenute nei database primari per arricchire il dato di informazioni utili. Esempio. Da SWISSPROT, database primario di sequenze di aminoacidi, sono stati ricavati i database secondari Prosite e Pfam, nei quali si da maggior rilievo alla classificazione delle famiglie e dei domini proteici. Database of protein families and domains Protein families database of alignments and HMMs

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l


Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli Fonti e testi di riferimento Dan Graur: >courses > bioinformatics


Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE


Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Docente: Dr. Nicola Vitulo Dipartimento di Biologia, CRIBI Viale G.Colombo3, 35131 Padova


Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle


e-science Bioinformatics

e-science Bioinformatics Luciano Milanesi Luciano Milanesi Institute of Biomedical Technology CNR ABSTRACT. The Bioinformatics community was an early adopter of the Internet and contributed to the e-science development by publishing


Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,


Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.


Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting


ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli Emanuele Pascariello Emanuele Pascariello Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email Emanuele Pascariello


strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine


Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina


Basi di dati biologici

Basi di dati biologici Basi di dati biologici Materiale da: The GenBank Sequence Database, A. D. Baxevanis. In Bioinformatics A practical Guide to the Analysis of Genes and Proteins Wiley-Liss 1998 Introduzione alla Bioinformatica


Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione


Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse


Name on a passport, HANGTAG

Name on a passport, HANGTAG recagroup design architecture art cinema travel music food Name on a passport, HANGTAG A quick look at printing techniques for hangtags RECA GROUP The hangtag of a garment is its ID card, its passport,


Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello


Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo


I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in


Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633


Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of


26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale

26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale 26. Bioinformatica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Lo sviluppo delle Biotecnologie ha consentito di elevare


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%


Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling


PMBOK Guide 3 rd Edition 2004

PMBOK Guide 3 rd Edition 2004 PMBOK Guide 3 rd Edition 2004 Un modello di riferimento per la gestione progetti a cura di Tiziano Villa, PMP febbraio 2006 PMI, PMP, CAPM, PMBOK, PgMP SM, OPM3 are either marks or registered marks of


TNCguide OEM Informativa sull introduzione di documentazione aggiuntiva nella TNCguide

TNCguide OEM Informativa sull introduzione di documentazione aggiuntiva nella TNCguide Newsletter Application 4/2007 OEM Informativa sull introduzione di documentazione aggiuntiva nella APPLICABILITÀ: CONTROLLO NUMERICO itnc 530 DA VERSIONE SOFTWARE 340 49x-03 REQUISITI HARDWARE: MC 420


Debtags. Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini

Debtags. Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini Debtags Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini ( 1/14 Fondazioni teoretiche Classificazione a Faccette (sfaccettature) Scoperte del cognitivismo (capacità


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing


CHI SIAMO ABOUT US. Azienda giovane fresca e dinamica ottiene immediatamente un ottimo successo conseguendo tassi di crescita a doppia cifra

CHI SIAMO ABOUT US. Azienda giovane fresca e dinamica ottiene immediatamente un ottimo successo conseguendo tassi di crescita a doppia cifra CHI SIAMO Nel 1998 nasce AGAN, societa specializzata nei servizi di logistica a disposizione di aziende che operano nel settore food del surgelato e del fresco. Azienda giovane fresca e dinamica ottiene


WELCOME. Go to the link of the official University of Palermo web site; Click on the box on the right side Login unico

WELCOME. Go to the link of the official University of Palermo web site; Click on the box on the right side Login unico WELCOME This is a Step by Step Guide that will help you to register as an Exchange for study student to the University of Palermo. Please, read carefully this guide and prepare all required data and documents.


Ingegneria del Software Testing. Corso di Ingegneria del Software Anno Accademico 2012/2013

Ingegneria del Software Testing. Corso di Ingegneria del Software Anno Accademico 2012/2013 Ingegneria del Software Testing Corso di Ingegneria del Software Anno Accademico 2012/2013 1 Definizione IEEE Software testing is the process of analyzing a software item to detect the differences between


La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA



INFORMAZIONE AGLI UTENTI DI APPARECCHIATURE DOMESTICHE O PROFESSIONALI INFORMAZIONE AGLI UTENTI DI APPARECCHIATURE DOMESTICHE O PROFESSIONALI Ai sensi dell art. 13 del Decreto Legislativo 25 luglio 2005, n. 151 "Attuazione delle Direttive 2002/95/CE, 2002/96/CE e 2003/108/CE,


Copyright 2012 Binary System srl 29122 Piacenza ITALIA Via Coppalati, 6 P.IVA 01614510335 - http://www.binarysystem.

Copyright 2012 Binary System srl 29122 Piacenza ITALIA Via Coppalati, 6 P.IVA 01614510335 - http://www.binarysystem. CRWM CRWM (Web Content Relationship Management) has the main features for managing customer relationships from the first contact to after sales. The main functions of the application include: managing


Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,


PIANO DI STUDI. Primo anno di corso

PIANO DI STUDI. Primo anno di corso PIANO DI STUDI Laurea in Economia, commercio internazionale e mercati finanziari (DM 270/04) L-33 Bachelor degree in Italian and in English (2 curricula in English) 1) CURRICULUM: Economia internazionale


PATENTS. December 12, 2011

PATENTS. December 12, 2011 December 12, 2011 80% of world new information in chemistry is published in research articles or patents Source: Chemical Abstracts Service Sources of original scientific information in the fields of applied


SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche.

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche. I due centri maggiori, EBI e NCBI hanno sviluppato sistemi dedicati di RETRIEVAL allo scopo di ottenere il massimo delle informazioni con il minimo sforzo da parte dell utente SRS (Sequence Retrieval System)


Laurea Magistrale in. Stochastics and Data Science

Laurea Magistrale in. Stochastics and Data Science Laurea Magistrale in Stochastics and Data Science Dati e decisioni: la sfida della società moderna For Today s Graduate, Just One Word: Statistics E. Brynjolfsson, MIT Center for Digital Business Director,


Infrastruttura computazionale per l archiviazione e l analisi dei dati da microarray

Infrastruttura computazionale per l archiviazione e l analisi dei dati da microarray Infrastruttura computazionale per l archiviazione e l analisi dei dati da microarray Silvia Giuliani Andrew Emerson Elda Rossi 24/11/04 1 Storage and analysis of micro-array data Currently most researchers


Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica


Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data


Basi di dati biologiche

Basi di dati biologiche Basi di dati biologiche Seminario per il corso di Basi di Dati II Luana Rinaldi AGENDA: Introduzione alla bioinformatica; Concetti Biologici; Banche dati biologiche; Collaborazioni



LA STORIA STORY THE COMPANY ITI IMPRESA GENERALE SPA LA STORIA ITI IMPRESA GENERALE SPA nasce nel 1981 col nome di ITI IMPIANTI occupandosi prevalentemente della progettazione e realizzazione di grandi impianti tecnologici (termotecnici ed elettrici) in


Get Instant Access to ebook Venditore PDF at Our Huge Library VENDITORE PDF. ==> Download: VENDITORE PDF

Get Instant Access to ebook Venditore PDF at Our Huge Library VENDITORE PDF. ==> Download: VENDITORE PDF VENDITORE PDF ==> Download: VENDITORE PDF VENDITORE PDF - Are you searching for Venditore Books? Now, you will be happy that at this time Venditore PDF is available at our online library. With our complete


La passione per il proprio lavoro, la passione per l'innovazione e la ricerca

La passione per il proprio lavoro, la passione per l'innovazione e la ricerca La passione per il proprio lavoro, la passione per l'innovazione e la ricerca tecnologica insieme all'attenzione per il cliente, alla ricerca della qualità e alla volontà di mostrare e di far toccar con


CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi


Progetto Cluster. Sottoprogetto Bioinformatica

Progetto Cluster. Sottoprogetto Bioinformatica Progetto Cluster Sottoprogetto Bioinformatica CRS4 (Centro di Ricerca, Sviluppo e Studi Superiori in Sardegna) Società costituita nel 1990 svolge attività di ricerca e sviluppo basate sulle tecnologie


HarNoBaWi Udine, 09/03/2015

HarNoBaWi Udine, 09/03/2015 HarNoBaWi Udine, 09/03/2015 Armonizzazione del processo di notifica nell ambito dell economia dello smaltimento e recupero dei rifiuti nell Euroregione Carinzia FVG Veneto Interreg IV Italia Austria Programma



CODI/21 PIANOFORTE II // CODI/21 PIANO II MASTER di II livello - PIANOFORTE // 2nd level Master - PIANO ACCESSO: possesso del diploma accademico di II livello o titolo corrispondente DURATA: 2 ANNI NUMERO ESAMI: 8 (escluso l esame di ammissione)


why? what? when? where? who?

why? what? when? where? who? why? l azienda overview l innovazione innovation WeAGoo è un azienda italiana specializzata nella raccolta di informazioni turistiche brevi ed essenziali a carattere storico, artistico, culturale, naturalistico


Get Instant Access to ebook Guida Agli Etf PDF at Our Huge Library GUIDA AGLI ETF PDF. ==> Download: GUIDA AGLI ETF PDF

Get Instant Access to ebook Guida Agli Etf PDF at Our Huge Library GUIDA AGLI ETF PDF. ==> Download: GUIDA AGLI ETF PDF GUIDA AGLI ETF PDF ==> Download: GUIDA AGLI ETF PDF GUIDA AGLI ETF PDF - Are you searching for Guida Agli Etf Books? Now, you will be happy that at this time Guida Agli Etf PDF is available at our online


Siti Web utili per la conoscenza della Biologia

Siti Web utili per la conoscenza della Biologia Siti Web utili per la conoscenza della Biologia Aggiornamento: marzo 2010: Per avere una animazione della sintesi proteica visitare il sito: prodotta


Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?


Individuazione e classificazione dei rifiuti pericolosi

Individuazione e classificazione dei rifiuti pericolosi Individuazione e classificazione dei rifiuti pericolosi Paolo Pipere Responsabile Servizio Ambiente ed Ecosostenibilità Camera di Commercio di Milano Classificazione dei rifiuti I criteri di classificazione


Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the

Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the 1 2 3 Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the body scientists say these cells are pluripotent.


Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)


up date basic medium plus UPDATE

up date basic medium plus UPDATE up date basic medium plus UPDATE Se si potesse racchiudere il senso del XXI secolo in una parola, questa sarebbe AGGIORNAMENTO, continuo, costante, veloce. Con UpDate abbiamo connesso questa parola all



MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso



MS SQL SERVER 2005 - UPGRADING TO MICROSOFT SQL SERVER 2005 MS SQL SERVER 2005 - UPGRADING TO MICROSOFT SQL SERVER 2005 UN BUON MOTIVO PER [cod. E316] Lo scopo di questo corso non MOC è fornire ai database professionals che lavorano in realtà di tipo enterprise



ITALTRONIC SUPPORT XT SUPPORT XT SUPPORT XT 289 CARATTERISTICHE GENERALI Norme EN 60715 Materiale Blend (PC/ABS) autoestinguente GENERAL FEATURES Standard EN 60715 Material self-extinguishing Blend (PC/ABS) Supporti modulari per schede


Combinazioni serie IL-MIL + MOT

Combinazioni serie IL-MIL + MOT Combinazioni tra riduttori serie IL-MIL e MOT Combined series IL-MIL + MOT reduction units Combinazioni serie IL-MIL + MOT Sono disponibili varie combinazioni tra riduttori a vite senza fine con limitatore


4 6 7 7 8 8 9 10 11 14 15 17 21 25 Riassunto Realizzazione di un Sistema Informativo Territoriale per la sorveglianza sanitaria della fauna nel Parco Nazionale della Majella tramite software Open Source


ISO 9001:2015. Ing. Massimo Tuccoli. Genova, 27 Febbraio 2015

ISO 9001:2015. Ing. Massimo Tuccoli. Genova, 27 Febbraio 2015 ISO 9001:2015. Cosa cambia? Innovazioni e modifiche Ing. Massimo Tuccoli Genova, 27 Febbraio 2015 1 Il percorso di aggiornamento Le principali novità 2 1987 1994 2000 2008 2015 Dalla prima edizione all


Learning session: costruiamo insieme un modello per una campagna di marketing

Learning session: costruiamo insieme un modello per una campagna di marketing Learning session: costruiamo insieme un modello per una campagna di marketing Roberto Butinar Cristiano Dal Farra Danilo Selva 1 Agenda Panoramica sulla metodologia CRISP-DM (CRoss-Industry Standard Process


Servizi innovativi per la comunicazione Innovative communication services

Servizi innovativi per la comunicazione Innovative communication services Servizi innovativi per la comunicazione Innovative communication services ECCELLENZA NEI RISULTATI. PROGETTUALITÀ E RICERCA CONTINUA DI TECNOLOGIE E MATERIALI INNOVATIVI. WE AIM FOR EXCELLENT RESULTS


10. Previsione della struttura tridimensionale di una proteina

10. Previsione della struttura tridimensionale di una proteina 10. Previsione della struttura tridimensionale di una proteina Lo scopo di questa esercitazione è di comprendere la logica alla base della modellizzazione per omologia attraverso la previsione della struttura


Labss CNR Edulabss: Didattica e

Labss CNR Edulabss: Didattica e EduLabss Responsabile contenuti/formazione Federico CECCONI EduLabss c/o LABSS ISTC Cnr Via Palestro 32 00185 Roma Tel +39.06.49936410 email: Labss CNR Edulabss: Didattica e divulgazione


INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam.

INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam. Laurea in INFORMATICA INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 Dynamic Host Configuration Protocol Prima di iniziare... Gli indirizzi IP privati possono essere


Corsi di Laurea Magistrale/ Master Degree Programs

Corsi di Laurea Magistrale/ Master Degree Programs Corsi di Laurea Magistrale/ Master Degree Programs Studenti iscritti al I anno (immatricolati nell a.a. 2014-2015 / Students enrolled A. Y. 2014-2015) Piano di studi 17-27 Novembre 2014 (tramite web self-service)


A Solar Energy Storage Pilot Power Plant

A Solar Energy Storage Pilot Power Plant UNIONE DELLA A Solar Energy Storage Pilot Power Plant DELLA Project Main Goal Implement an open pilot plant devoted to make Concentrated Solar Energy both a programmable energy source and a distribution


Can virtual reality help losing weight?

Can virtual reality help losing weight? Can virtual reality help losing weight? Can an avatar in a virtual environment contribute to weight loss in the real world? Virtual reality is a powerful computer simulation of real situations in which



IL BREVETTO NEL SETTORE BIOTECNOLOGICO IL BREVETTO NEL SETTORE BIOTECNOLOGICO La protezione legale delle invenzioni biotecnologiche: Europa Stati Uniti Giappone Direttiva 98/44/CE sulla protezione legale delle invenzioni biotecnologiche Prima


Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine


Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.


Siti Web utili per la conoscenza della Biologia

Siti Web utili per la conoscenza della Biologia Siti Web utili per la conoscenza della Biologia Tramite questo indirizzo si accede all homepage di web-books, dove è possibile cliccare su: Contemporary Molecular Biology Web


formati > formats Esagono 15 15x17 (6 x6.7 ) Esagono 5 5x5,7 (2 x2.2 ) Optical Mod. A 15x17 (6 x6.7 ) Optical Mod. B 15x17 (6 x6.

formati > formats Esagono 15 15x17 (6 x6.7 ) Esagono 5 5x5,7 (2 x2.2 ) Optical Mod. A 15x17 (6 x6.7 ) Optical Mod. B 15x17 (6 x6. Catalogo Catalogue >2 Assecondando l evoluzione della piastrella diamantata a rivestimento, è giunto il momento per ETRURIA design di pensare anche al pavimento. La prima idea è quella di portare il diamantato


Prova finale di Ingegneria del software

Prova finale di Ingegneria del software Prova finale di Ingegneria del software Scaglione: Prof. San Pietro Andrea Romanoni: Francesco Visin: Italiano 2 Scaglioni di voto Scaglioni di voto


Newborn Upfront Payment & Newborn Supplement

Newborn Upfront Payment & Newborn Supplement ITALIAN Newborn Upfront Payment & Newborn Supplement Female 1: Ormai manca poco al parto e devo pensare alla mia situazione economica. Ho sentito dire che il governo non sovvenziona più il Baby Bonus.



TEST CENTER. TEST CENTER PRODUCT OVERVIEW TestCenter è il software di gestione dell intera gamma di macchine da test sviluppata dalla Step Lab e rappresenta un unica soluzione integrata e flessibile



ITALTRONIC CBOX CBOX 61 Contenitori per la Building Automation Materiale: PC/ABS autoestinguente Colore: Grigio scuro È un nuovo sistema PER L EQUIPAGGIAMENTO DI APPARECCHIATURE ELETTRONICHE su scatole elettriche a parete


Eco-REFITec: Seminary and Training course

Eco-REFITec: Seminary and Training course Eco-REFITec: Seminary and Training course About Eco-REFITec: Eco-REFITEC is a research project funded by the European Commission under the 7 th framework Program; that intends to support repair shipyards


Predizione della struttura terziaria

Predizione della struttura terziaria Predizione della struttura terziaria Metodi di predizione La predizione della struttura tridimensionale è di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi


Pubblicazioni COBIT 5

Pubblicazioni COBIT 5 Pubblicazioni COBIT 5 Marco Salvato CISA, CISM, CGEIT, CRISC, COBIT 5 Foundation, COBIT 5 Trainer 1 SPONSOR DELL EVENTO SPONSOR DI ISACA VENICE CHAPTER CON IL PATROCINIO DI 2 La famiglia COBIT 5 3 Aprile





La soluzione IBM per la Busines Analytics Luca Dalla Villa

La soluzione IBM per la Busines Analytics Luca Dalla Villa La soluzione IBM per la Busines Analytics Luca Dalla Villa Cosa fa IBM Cognos Scorecards & Dashboards Reports Real Time Monitoring Supporto? Decisionale Come stiamo andando? Percezione Immediate immediata





Le nuove frontiere della ricerca scientifica: le nuove forme di documento: dal data/text mining al web semantico

Le nuove frontiere della ricerca scientifica: le nuove forme di documento: dal data/text mining al web semantico Le nuove frontiere della ricerca scientifica: le nuove forme di documento: dal data/text mining al web semantico Maria Cassella Università di Torino Il workflow della comunicazione





Quality Certificates

Quality Certificates Quality Certificates Le più importanti certificazioni aziendali, di processo e di prodotto, a testimonianza del nostro costante impegno ed elevato livello di competenze. Qualità * certificata * Certified


Renzo Andrich

Renzo Andrich Gruppo di Studio SIGG La cura nella fase terminale della vita sostenuto da un contributo non condizionato della Fondazione Alitti SOSTENIBILITA DELLE CURE DI FINE VITA TRA CULTURA E ORGANIZZAZIONE Bologna


Tecniche biofisiche basate su nanopori

Tecniche biofisiche basate su nanopori Tecniche biofisiche basate su nanopori -Pori di dimensione nanometrica -Attraverso membrane lipidiche o inorganiche -Di natura proteica o scavati con tecnologie top-down Possono essere impiegati per -Studiare


linea Stampi per cioccolato ZIN GIANNI S.R.L. Catalogo Catalogue

linea Stampi per cioccolato ZIN GIANNI S.R.L. Catalogo Catalogue linea Stampi per cioccolato ZIN GIANNI S.R.L. Catalogo Catalogue 2008 IT ENG Il marchio per una politica aziendale di qualità. The trade-mark for a quality company policy. Il marchio per una politica


Programma svolto di Lingua Inglese A.S. 2014-15 Classe: 1F Docente: Federica Marcianò

Programma svolto di Lingua Inglese A.S. 2014-15 Classe: 1F Docente: Federica Marcianò Programma svolto di Lingua Inglese A.S. 2014-15 Classe: 1F Units 1-2 Pronomi personali soggetto be: Present simple, forma affermativa Aggettivi possessivi Articoli: a /an, the Paesi e nazionalità Unit



CAMBIO DATI PERSONALI - Italy CAMBIO DATI PERSONALI - Italy Istruzioni Per La Compilazione Del Modulo / Instructions: : Questo modulo è utilizzato per modificare i dati personali. ATTENZIONE! Si prega di compilare esclusivamente la






ANALISI BIOINFORMATICA DELLE PROTEINE. Matteo Ramazzotti ANALISI BIOINFORMATICA DELLE PROTEINE Matteo Ramazzotti Programma Banche dati proteiche. Interrogazione delle banche dati. Allineamento di sequenze proteiche. Matrici di sostituzione.


E-Business Consulting S.r.l.

E-Business Consulting S.r.l. e Rovigo S.r.l. Chi siamo Scenario Chi siamo Missione Plus Offerti Mercato Missionedi riferimento Posizionamento Metodologia Operativa Strategia Comunicazione Digitale Servizi Esempidi consulenza Clienti
