caratterizzazione nomenclatura gruppi

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "caratterizzazione nomenclatura gruppi"

Transcript

1 TASSONOMIA La branca della batteriologia che si occupa della caratterizzazione e della nomenclatura degli organismi e della organizzazione di questi in gruppi

2 Tassonomia Classificazione (in taxa) Nomenclatura Identificazione

3

4 CLASSIFICAZIONE Nella tassonomia dei microrganismi l unità tassonomica fondamentale è la specie (taxon più basso). Questa fa parte di gruppi più grandi in un ordinamento gerarchico senza sovrapposizioni. La specie è un insieme di ceppi che hanno in comune numerose proprietà stabili. Il ceppo è una popolazione che discende da un unico microrganismo o da un isolato in coltura pura.

5 CLASSIFICAZIONE Nell ambito di una specie i ceppi possono differire lievemente per alcuni aspetti : biovar (biotipi) morfovar (morfotipi) serovar (sierotipi) Ogni specie avrà un ceppo tipo, generalmente il primo ad essere studiato per una determinata specie.

6 Nomenclatura Dominio Phylum Classe Ordine Famiglia Genere Specie Bacteria Spirochaetes Spirochaetes Spirochaetales Spirochaetaceae Spirochaeta plicatilis

7 Nomenclatura Sistema binomiale (Limneo ) Escherichia coli epiteto generico corsivo epiteto specifico Codice Internazionale per la Nomenclatura dei batteri

8 Nomenclatura International Journal of Systematic and Evolutionary Microbiology (IJSEM) Bergey s Manual of Systematic Bacteriology

9 CLASSIFICAZIONE sistemi artificiali sistemi naturali o filogenetici fenotipo evoluzione

10 Lo sviluppo della tassonomia microbica 17 e 18 secolo. Primi microscopi: i procarioti sono considerati una singola specie che assume forme diverse 18 secolo: Muller distingue due generi: Monas e Vibrio 19 secolo: C. Eherember: Monas, Vibrio e batteri elicali. Pasteur, Cohn: diversità microbica Koch: un patogeno, una specie I edizione del Bergey s Manual of Determinative Bacteriology ma ancora manca un criterio oggettivo di classificazione Numerical Taxonomy : confronti tra ampi set di dati biochimici, morfologici e fisiologici inizio delle tecniche molecolari rdna (Woese).. Comparative genomics

11 CLASSIFICAZIONE sistemi artificiali (fenotipo) Utili caratteristiche distintive e di facile determinazione Gram Firmicutes e Actinobacteria + anche se i micoplasmi (gram ) appartengono ai Firmicutes (rrna 16s) Forma Le proprietà fenotipiche forniscono comunque informazioni che la filogenesi molecolare non può fornire. (es. ruolo nell ambiente)

12 TASSONOMIA NUMERICA Permette di confrontare batteri simili analizzando numerose caratteristiche alle quali viene dato un ugual peso. Utile per la classificazione di specie una volta determinate le relazioni filogenetiche Il coefficiente di similarità permette di confrontare ceppi simili. 2 m.o. appartengono a alla stesso fenone se SAB= a+b+c S > 50% frequentemente > 70% Coefficiente di Jaccard > 80% specie

13 TASSONOMIA NUMERICA Coefficienti di corrispondenza sono organizzati in una matrice di similarità e rappresentati graficamente in dendrogrammi ,70 3 0,44 1 0,42 4 0,38 0, batteri similarità ,

14 Classifying prokaryotes Classifying bacteria on the basis of their morphology is extremely difficult; bacteria are generally quite small and have simple shapes though there are some bacteria, notably the cyanobacteria and actinomycetes, with sufficiently complex morphology to permit classification by shape. In addition to shape, bacteria have traditionally been identified and classified on the basis of their biochemistry and the conditions under which they grow. The advent of molecular biology has made it possible to classify bacteria on the basis of similarities among DNA sequences, and has revolutionized thinking in bacterial systematics

15 Concetto di specie biologica Gruppo di organismi interfecondi che danno progenie fertile e che sono separati riproduttivamente dagli altri organismi

16 Il concetto di specie nei procarioti Il concetto di specie nei procarioti si è sviluppato parallelamente alle tecniche di laboratorio che hanno consentito l accesso alle informazioni La tassonomia microbica è recente Non esiste un concetto universale I concetti applicabili agli eucarioti non valgono per i procarioti

17 Definizione filogenetica della specie procariotica Specie batterica: è un raggruppamento monofiletico e geneticamente coerente di organismi che mostrano un elevato grado di somiglianza, rilevabile per mezzo di test indipendenti (Rossello-Mora &Aman 2001 FEMS Microbiol. Rev.)

18 Definizione di specie nei procarioti Approccio molecolare Mol% G+C content Differenze <5% DNA-DNA relatedness (% similarity) Similarity >70% 16S RNA Identità >97% Specie

19 Tassonomia dei procarioti Caratterizzazione degli isolati Approccio morfologico Approccio biochimico e fisiologico Approccio ecologico Approccio molecolare APPROCCIO POLIFASICO

20 Caratteristiche morfologiche: Forma della cellula Dimensioni della cellula Morfologia delle colonie Colorazione di Gram Meccanismo di motilità Forma e collocazione dell endospora

21 Caratteristiche fisiologiche e biochimiche: Sorgenti di carbonio e azoto Costituenti della parete cellulare Sorgenti di energia Prodotti della fermentazione Tipo di nutrizione Temperatura ottimale di crescita e range Luminescenza Meccanismi di conversione dell energia Tolleranza osmotica

22 Caratteristiche ecologiche: Cicli Biologici Natura delle relazioni simbiontiche Patogenicità Habitat (ph, O2.)

23 Approccio biochimico alla caratterizzazione dei procaroti I test miniaturizzati

24 Identificazione di un microrganismo Example of methods that would be used for identification of a newly isolated enteric bacterium, using classic microbiological methods (the example given shows the procedures that would be used for identifying Escherichia coli). Note that most of the analyses here require that the organisms be grown in pure culture and that solely phenotypic criteria be used in the identification.

25 Caratteristiche molecolari

26 Definizione di specie nei procarioti Approccio molecolare Mol% G+C content Differenze <5% DNA-DNA relatedness (% similarity) Similarity >70% 16S RNA Identità >97% Specie

27 Composizione di basi Hplc Temperatura di denaturazione (melting) Gradiente di densità di CsCl

28 Mol%G+C= G+C x100 G+C+A+T Ranges of DNA base composition of various organisms. Note that the greatest range exists with bacteria.

29 Ibridazione degli acidi nucleici (% similarity) Genomic hybridization as a taxonomic tool. (a) DNA is isolated from test organisms. One of the DNAs is labeled (shown here as radioactive phosphate in the DNA of Organism 1).

30 Ibridazione degli acidi nucleici Actual hybridization experiment. All combinations are tried and excess unlabeled DNA is added in each experiment to prevent labeled DNA from reannealing with itself. Following hybridization, hybridized DNA is separated from unhybridized DNA before measuring radioactivity in the hybridized DNA only.

31 Ibridazione degli acidi nucleici Genomic hybridization as a taxonomic tool. (c) Results. Radioactivity in the control is taken as the 100% hybridization value.

32 rrna analysis rrna genes have been chosen as the molecular basis for phylogenetic reconstructions in the prokaryotic world The variations in the rrna primary structures among the prokaryotes reflects evolutionary distances among organisms Other molecular clocks: ATPase, cytochromes

33 In the late 1970s, Dr. Carl Woese (pictured above at left) spearheaded a study of evolutionary relationships among prokaryotes. Instead of physical characters, he relied on RNA sequences to determine how closely related these microbes were. He discovered that the prokaryotes were actually composed of two very different groups -- the Bacteria and a newly recognized group that he called Archaea. Each of these groups is as different from the other as they are from eukaryotes. These three groups are now recognized as three distinct domains of life, as shown above at right.

34 Il gene per l rrna 16 S è un cronometro molecolare E presente in ogni tipo di organismo, la sua sequenza è conservata. E essenziale alla sopravvivenza, funzione costante, non soggetta a influenza ambientale. Accumula mutazioni casualmente sulla sequenza La sequenza è sufficientemente lunga per accumulare mutazioni e sufficientemente corta per essere tutta sequenziata Riflette la distanza evolutiva tra microrganismi WOESE 1987, Microbiol. Rev, 51

35 Ribosomi procarioti ed eucarioti

36 Fig. 1. Bacterial variability map. E. coli 16S rrna gene sequence annotated with bacteria and "universal" priming sites and variable regions V1 V9. The sequence is colour coded to indicate bacterial sequence variability.

37 Struttura dell rrna 16S

38 Analisi del DNA ribosomale IGS 16S 0 IGS 23S trnaala, ile L operone ribosomale dei procarioti 5S 120

39 Bergey's Manual of Systematic Bacteriology, 2nd edition, volume I- V (2000~) Volume I : The Archaea, Cyanobacteria, Phototrophs, and Deeply Branching Genera. Sections I-XIV Volume II : The Proteobacteria. Sections XV-XIX XV: alpha subdivision XVI: beta subdivision XVII: gamma subdivision XVIII: delta subdivision XIX: epsilon subdivision Volume III : The Low G + C Gram Positives. Sections XX-XXII Volume IV : The High G + C Gram Positives. Sections XXIII-XXII Volume V : The Planctomycetes, Spirochaetes, Fibrobacteres, Bacteroides and Fusobacteria. Sections XXIV-XXXI

40 Relationship between 16S ribosomal RNA sequence similarity and genomic DNA hybridization between different pairs of organisms. These data are the results from several independent experiments with various species of the domain Bacteria. Points in the orange box represent combinations where 16S sequence similarity and genomic hybridization were both very high; thus, in each case, the two organisms tested were clearly the same species. By contrast, points in the green box represent combinations that indicate the two organisms tested were different species, and both methods show this. Points in the blue box indicate that the two test organisms were different species as measured by genomic DNA hybridization but not by 16S sequencing. Note how above 70% DNA hybridization, no 16S similarities were found of less than 97%. Data redrawn from Rosselló-Mora, R., and R. Amann FEMS Microbiol. Revs. 25:39 67.

41 La filogenesi batterica basata sul gene per l rrna 16S Database search

42 Definizione di specie nei procarioti Approccio molecolare Mol% G+C content Differenze <5% DNA-DNA relatedness (% similarity) Similarity >70% 16S RNA Identità >97% Specie

43 Estrazione del Dna Purificazione Precipitazione

44 moli%g+c= G+C x100 G+C+A+T Mol% G+C Hplc Temperatura di denaturazione (melting) Gradiente di densità di CsCl

45 HPLC cromatografia liquida ad alta prestazione (in inglese High Performance Liquid Chromatography) o cromatografia liquida ad alta pressione (High Pressure Liquid Chromatography) Si tratta di una tecnica cromatografica che permette di separare due o più composti presenti in un solvente sfruttando l'equilibrio di affinità tra una "fase stazionaria" posta all'interno della colonna cromatografica e una "fase mobile" che fluisce attraverso essa. Una sostanza più affine alla fase stazionaria rispetto alla fase mobile impiega un tempo maggiore a percorrere la colonna cromatografica (tempo di ritenzione), rispetto ad una sostanza con bassa affinità per la fase stazionaria ed alta per la fase mobile.

46

47

48

49

50

51 Marcatura calda : 32 P 14 C Endonucleasi S1 Dal JJ Perry ZANICHELLI

52 Struttura dell rrna 16S

53 La filogenesi batterica basata sul gene per l rrna 16S Database search

54 Progetto Database Ribosoma

55 RDP Home About Announcements Citation Contacts Resources Related Sites Tutorials Ribosomal Database Project: Release 10 Browsers Classifier LibCompare SeqMatch Probe Match Tree Builder Pyro Taxomatic seqcart AssignGen RDP Release 10, Update 24 :: Jan 13, 2011 :: 1,498,677 16S rrnas The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial and Archaeal smallsubunit 16S rrna sequences. RDP Release 10 brings two major changes to the RDP: RDP10 provides new Bacterial and Archaeal alignments with several significant enhancements over the previous RDP 9 alignments. Use of the Infernal secondary-structure based aligner that provides better support for short partial sequences and handles certain sequencing artifacts in a more intuitive manner.

56 Metodo della distanza evolutiva

57 ANALISI FILOGENETICA METODO DELLA DISTANZA EVOLUTIVA METODO DELLA MASSIMA PARSIMONIA La soluzione probabile è quella più semplice METODO DELLA MASSIMA PROBABILITA (probabilità di mutazioni)

58 Dal JJ Perry ZANICHELLI

59 Dal JJ Perry ZANICHELLI

60 ALBERI FILOGENETICI Riflettono le relazioni evolutive tra un gruppo di specie. A A B B I nodi rappresentano le specie I rami o ramificazioni la distanza evolutiva fra due specie C

61 Gruppi filogenetici o phyla

62 Universal phylogenetic tree as determined from comparative ribosomal RNA sequencing. Only a few key organisms or lineages are shown in each domain.

63 Albero filogenetico degli Eubatteri Ambientali non coltivabili

64 Albero filogenetico degli Eucarioti

65 Dal JJ Perry ZANICHELLI

66 L ipotesi endosimbiotica sull origine della cellula eucariotica Origin of modern eukaryotes by endosymbiotic events. Note how organelles originated from Bacteria rather than Archaea. Endosymbiosis was unlikely to have been a one-time event and probably occurred in various types of cells of the nuclear line of descent. Note, however, how some primitive eukaryotes either never underwent endosymbiotic events or permanently lost their symbionts, but otherwise maintained the basic properties of eukaryotic cells. Extant examples of such eukaryotes, all microbial, are known today. The increase in cell size in the nuclear line of descent allowed for larger genomes to evolve, but also likely led to the evolution of the nucleus to affect the orderly replication and partitioning of such genomes.

67 Isolamento ed identificazione di batteri dall ambiente Campione ambientale Diluizioni seriali Comunità mista ESTRAZIONE DNA Piastre Colture pure

68 Analisi del DNA ribosomale DNA batterio Estrazione del DNA totale 16S Gene per l RNA ribosomale 16S Amplificazione per PCR fd1 16S rd1 Reazione a catena della polimerasi Visualizzazione dell amplificato Sequenziamento

69 Visualizzazione per elettroforesi su gel di agarosio degli amplificati rdna 16S 100 bp ladder K- 100 bp ladder bp

70 Sequenziamento Dell rdna16s CACATGCAAGTCGAGCGGGCGTAGCAATACGTCAGCGGCAGACGGGTGAGTAACGCGTGG GAACGTACCTTTTGGTTCGGAACAACACAGGGAAACTTGTGCTAATACCGGATAAGCCCT TACGGGGAAAGATTTATCGCCGAAAGATCGGCCCGCGTCTGATTAGCTAGTTGGTGAGGT AATGGCTCACCAAGGCGACGATCAGTAGCTGGTCTGAGAGGATGATCAGCCACATTGGGA CTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGC AAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTG TGCGGGAAGATAATGACGGTACCGCAAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCC GCGGTAATACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGC

71 confronto della sequenza nucleotidica con la banca dati e allineamento Score = 1039 bits (524), Expect = 0.0 Identities = 542/549 (98%) Strand = Plus / Plus Vcas 108: 4 SjSa1: 3 Vcas 108: 64 atgcttaccgcgatcgat tacgaatggcgctagcta SjSa1: 63 aac nctggcggcaggctta acacatgcaagtcgaacgggcacttcggtgctagtggcaga 63 x x aac gctggcggcaggctta ncacatgcaagtcgaacgggcacttcggtgctagtggcaga 62 cgggtgagtaacacgtggga acgtaccttt c ggttcggaataat tcagggaaac t tggac 123 x cgggtgagtaacacgtggga acgtaccttt c ggttcggaataat ccagggaaac t tggac 122 Vcas 108: 124 taataccggata agcccttcggggg aaagatttatcgccgatagatcggcccgc gtctga 183 x SjSa1: 123 taataccggata cgcccttcggggg aaagatttatcgccgatagatcggcccgc gtctga 182 Vcas 108: 184 ttagctagtt ggtgaggtaatggctcacca aggcgacgatcagtagctggtctgagagga 243 SjSa1: 183 ttagctagtt ggtgaggtaatggctcacca aggcgacgatcagtagctggtctgagagga 242 Vcas 108: 244 tgatcagccacattgggactgagacacggcccaaactcctacgggaggcagcagtgggga 303 SjSa1: 243 tgatcagccacattgggactgagacacggcccaaactcctacgggaggcagcagtgggga 302 Vcas 108: 304 atattggacaatgggcgaaagcctgatccagccatgccgcgtg tgtgatgaaggccttag 363 x SjSa1: 303 atattggacaatgggcgaaagcctgatccagccatgccgcgtg agtgatgaaggccttag 362 Vcas 108: 364 ggttgtaaagc acttttgtccgggaagataatgactgtaccggaagaataagccccggct 423 x SjSa1: 363 ggttgtaaagc tcttttgtccgggaagataatgactgtaccggaagaataagccccggct 422 Vcas 108: 424 aacttcgtgccagcagccgcggtaatacgaagggggctagcgttgctcggaatcactggg 483 SjSa1: 423 aacttcgtgccagcagccgcggtaatacgaagggggctagcgttgctcggaatcactggg 482 Vcas 108: 484 cgtaaagggcgcgtaggcggactcttaagtcgggggtgaaagccca gggctcaaccctgg 543 x SjSa1: 483 cgtaaagggcgcgtaggcggactcttaagtcgggggtgaaagccca nggctcaaccctgg 542 Vcas 108: 544 aattgcctt 552 SjSa1: 543 aattgcctt 551

72

73 Metodo della distanza evolutiva Preparing a phylogenetic distance tree from 16S ribosomal RNA sequences. For illustrative purposes, only short sequences are shown. The evolutionary distance (ED) in (b) is calculated as the percentage of nonidentical sequences between the RNAs of any two organisms. The corrected ED is a statistical correction necessary to account for either back mutations to the original genotype or additional forward mutations at the same site that could have occurred. The tree (c) is ultimately generated by computer analysis of the data to give the best fit. The total length of the branches separating any two organisms is proportional to the calculated evolutionary distance between them.

74 Chemotaxonomy Fatty acid methyl ester (FAME) analysis in bacterial identification. (b) Procedure. Each peak from the gas chromatograph is due to one particular fatty acid methyl ester and the peak height is proportional to the amount.

75

76 Questioni aperte Variabilità intraspecifica: quanti genomi sequenziare per definire una specie? (core del genoma) Horizontal transfer Microrganismi non coltivabili???? Comparative genomics and microarrays techniques

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

Gi-Gi Art. 859 - User's Guide Istruzioni d'uso

Gi-Gi Art. 859 - User's Guide Istruzioni d'uso doc.4.12-06/03 Gi-Gi Art. 859 - User's Guide Istruzioni d'uso A belaying plate that can be used in many different conditions Una piastrina d'assicurazione che può essere utilizzata in condizioni diverse.

Dettagli

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM ALLEGATO 2 FULL PROJECT FORM FORM 1 FORM 1 General information about the project PROJECT SCIENTIFIC COORDINATOR TITLE OF THE PROJECT (max 90 characters) TOTAL BUDGET OF THE PROJECT FUNDING REQUIRED TO

Dettagli

Informazioni su questo libro

Informazioni su questo libro Informazioni su questo libro Si tratta della copia digitale di un libro che per generazioni è stato conservata negli scaffali di una biblioteca prima di essere digitalizzato da Google nell ambito del progetto

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Zeroshell come client OpenVPN

Zeroshell come client OpenVPN Zeroshell come client OpenVPN (di un server OpenVpn Linux) Le funzionalità di stabilire connessioni VPN di Zeroshell vede come scenario solito Zeroshell sia come client sia come server e per scelta architetturale,

Dettagli

Efficacia dei probio-ci nelle mala1e diges-ve

Efficacia dei probio-ci nelle mala1e diges-ve Efficacia dei probio-ci nelle mala1e diges-ve Le aree di incertezza nelle Cure Primarie: Quali sono le evidenze di efficacia dei probio-ci nelle patologie del tra9o gastrointes-nale? Edoardo Benede*o 1907

Dettagli

Il Form C cartaceo ed elettronico

Il Form C cartaceo ed elettronico Il Form C cartaceo ed elettronico Giusy Lo Grasso Roma, 9 luglio 2012 Reporting DURANTE IL PROGETTO VENGONO RICHIESTI PERIODIC REPORT entro 60 giorni dalla fine del periodo indicato all Art 4 del GA DELIVERABLES

Dettagli

Il test valuta la capacità di pensare?

Il test valuta la capacità di pensare? Il test valuta la capacità di pensare? Per favore compili il seguente questionario senza farsi aiutare da altri. Cognome e Nome Data di Nascita / / Quanti anni scolastici ha frequentato? Maschio Femmina

Dettagli

e-spare Parts User Manual Peg Perego Service Site Peg Perego [Dicembre 2011]

e-spare Parts User Manual Peg Perego Service Site Peg Perego [Dicembre 2011] Peg Perego Service Site Peg Perego [Dicembre 2011] 2 Esegui il login: ecco la nuova Home page per il portale servizi. Log in: welcome to the new Peg Perego Service site. Scegli il servizio selezionando

Dettagli

Principali prove meccaniche su materiali polimerici

Principali prove meccaniche su materiali polimerici modulo: Proprietà viscoelastiche e proprietà meccaniche dei polimeri Principali prove meccaniche su materiali polimerici R. Pantani Scheda tecnica di un materiale polimerico Standard per prove meccaniche

Dettagli

il materiale e Le forme evocano direttamente il corpo celeste, lo riproducono in ogni venatura. Proprio come avere una piccola luna tutta per sé.

il materiale e Le forme evocano direttamente il corpo celeste, lo riproducono in ogni venatura. Proprio come avere una piccola luna tutta per sé. il materiale e Le forme evocano direttamente il corpo celeste, lo riproducono in ogni venatura. Proprio come avere una piccola luna tutta per sé. COLLECTION luna material and shapes evoke the celestial

Dettagli

Editoriale VALUTAZIONE PER L E.C.M.: ANALISI DEI QUESTIONARI DI GRADIMENTO

Editoriale VALUTAZIONE PER L E.C.M.: ANALISI DEI QUESTIONARI DI GRADIMENTO Lo Spallanzani (2007) 21: 5-10 C. Beggi e Al. Editoriale VALUTAZIONE PER L E.C.M.: ANALISI DEI QUESTIONARI DI GRADIMENTO IL GRADIMENTO DEI DISCENTI, INDICATORE DI SODDISFAZIONE DELLE ATTIVITÀ FORMATIVE

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

group HIGH CURRENT MULTIPLEX NODE

group HIGH CURRENT MULTIPLEX NODE HIGH CURRENT MULTIPLEX NODE edizione/edition 04-2010 HIGH CURRENT MULTIPLEX NODE DESCRIZIONE GENERALE GENERAL DESCRIPTION L'unità di controllo COBO è una centralina elettronica Multiplex Slave ; la sua

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

Teoria della misurazione e misurabilità di grandezze non fisiche

Teoria della misurazione e misurabilità di grandezze non fisiche Teoria della misurazione e misurabilità di grandezze non fisiche Versione 12.6.05 Teoria della misurazione e misurabilità di grandezze non fisiche 1 Il contesto del discorso (dalla lezione introduttiva)

Dettagli

INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam.

INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam. Laurea in INFORMATICA INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 Dynamic Host Configuration Protocol fausto.marcantoni@unicam.it Prima di iniziare... Gli indirizzi IP privati possono essere

Dettagli

Present Perfect SCUOLA SECONDARIA I GRADO LORENZO GHIBERTI ISTITUTO COMPRENSIVO DI PELAGO CLASSI III C/D

Present Perfect SCUOLA SECONDARIA I GRADO LORENZO GHIBERTI ISTITUTO COMPRENSIVO DI PELAGO CLASSI III C/D SCUOLA SECONDARIA I GRADO LORENZO GHIBERTI ISTITUTO COMPRENSIVO DI PELAGO CLASSI III C/D Present Perfect Affirmative Forma intera I have played we have played you have played you have played he has played

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Guida ai Parametri di negoziazione dei mercati regolamentati organizzati e gestiti da Borsa Italiana

Guida ai Parametri di negoziazione dei mercati regolamentati organizzati e gestiti da Borsa Italiana Guida ai Parametri di negoziazione dei mercati regolamentati organizzati e gestiti da Borsa Italiana Versione 04 1/28 INTRODUZIONE La Guida ai Parametri contiene la disciplina relativa ai limiti di variazione

Dettagli

PROTOCOLLO DI STUDIO MEDIANTE TEST ALLA FLECAINIDE NELLA SINDROME DI BRUGADA

PROTOCOLLO DI STUDIO MEDIANTE TEST ALLA FLECAINIDE NELLA SINDROME DI BRUGADA PROTOCOLLO DI STUDIO MEDIANTE TEST ALLA FLECAINIDE NELLA SINDROME DI BRUGADA 2 La SINDROME DI BRUGADA è una malattia generalmente ereditaria, a trasmissione autosomica dominante, che coinvolge esclusivamente

Dettagli

tmt 15 Rimozione ecologica di metalli pesanti da acque reflue

tmt 15 Rimozione ecologica di metalli pesanti da acque reflue tmt 15 Rimozione ecologica di metalli pesanti da acque reflue Rimozione ecologica di metalli pesanti da acque reflue Il problema: metalli pesanti nelle acque reflue In numerosi settori ed applicazioni

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

I was not you were not he was not she was not it was not we were not you were not they were not. Was I not? Were you not? Was she not?

I was not you were not he was not she was not it was not we were not you were not they were not. Was I not? Were you not? Was she not? Il passato Grammar File 12 Past simple Il past simple inglese corrisponde al passato prossimo, al passato remoto e, in alcuni casi, all imperfetto italiano. Con l eccezione del verbo be, la forma del past

Dettagli

Rilascio dei Permessi Volo

Rilascio dei Permessi Volo R E P U B L I C O F S A N M A R I N O C I V I L A V I A T I O N A U T H O R I T Y SAN MARINO CIVIL AVIATION REGULATION Rilascio dei Permessi Volo SM-CAR PART 5 Approvazione: Ing. Marco Conti official of

Dettagli

Narrare i gruppi. Rivista semestrale pubblicata on-line dal 2006 Indirizzo web: www.narrareigruppi.it - Direttore responsabile: Giuseppe Licari

Narrare i gruppi. Rivista semestrale pubblicata on-line dal 2006 Indirizzo web: www.narrareigruppi.it - Direttore responsabile: Giuseppe Licari Narrare i gruppi Etnografia dell interazione quotidiana Prospettive cliniche e sociali ISSN: 2281-8960 Narrare i gruppi. Etnografia dell'interazione quotidiana. Prospettive cliniche e sociali è una Rivista

Dettagli

Il vostro sogno diventa realtà... Your dream comes true... Close to Volterra,portions for sale of "typical tuscan"

Il vostro sogno diventa realtà... Your dream comes true... Close to Volterra,portions for sale of typical tuscan Il vostro sogno diventa realtà... Vicinanze di Volterra vendita di porzione di fabbricato "tipico Toscano" realizzate da recupero di casolare in bellissima posizione panoramica. Your dream comes true...

Dettagli

L identificazione e la denominazione delle sostanze chimiche in ambito REACH

L identificazione e la denominazione delle sostanze chimiche in ambito REACH I DETERGENTI: COME CONIUGARE PRESTAZIONI ELEVATE E RISPETTO PER L AMBIENTE L identificazione e la denominazione delle sostanze chimiche in ambito REACH Resana, 5 ottobre 2007 FEDERICA CECCARELLI Ist. Sup.

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

DDS elettronica srl si riserva il diritto di apportare modifiche senza preavviso /we reserves the right to make changes without notice

DDS elettronica srl si riserva il diritto di apportare modifiche senza preavviso /we reserves the right to make changes without notice Maccarone Maccarone Maccarone integra 10 LED POWER TOP alta efficienza, in tecnologia FULL COLOR che permette di raggiungere colori e sfumature ad alta definizione. Ogni singolo led full color di Maccarone

Dettagli

Mod. VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES

Mod. VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES Mod VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES Mod VS/AM 65 1 2 VS/AM 65 STANDARD VS/AM 65 CON RACCORDI VS/AM 65

Dettagli

APPLICATION FORM 1. YOUR MOTIVATION/ LA TUA MOTIVAZIONE

APPLICATION FORM 1. YOUR MOTIVATION/ LA TUA MOTIVAZIONE APPLICATION FORM Thank you for your interest in our project. We would like to understand better your motivation in taking part in this specific project. So please, read carefully the form, answer the questions

Dettagli

Non solo benchmark: le prospettive nei modelli gestionali. Stefania Luzi Mefop Roma, 3 luglio 2013

Non solo benchmark: le prospettive nei modelli gestionali. Stefania Luzi Mefop Roma, 3 luglio 2013 Non solo benchmark: le prospettive nei modelli gestionali Stefania Luzi Mefop Roma, 3 luglio 2013 La cronistoria Pre 2009 Modello a benchmark basato su: Pesi delle asset class Benchmark costituito da indici

Dettagli

Presentazioni multimediali relative al senso del tatto DIMENSIONI LIVELLO INIZIALE LIVELLO INTERMEDIO LIVELLO AVANZATO

Presentazioni multimediali relative al senso del tatto DIMENSIONI LIVELLO INIZIALE LIVELLO INTERMEDIO LIVELLO AVANZATO PERCORSO DI INSEGNAMENTO/APPRENDIMENTO TIPO DI UdP: SEMPLICE (monodisciplinare) ARTICOLATO (pluridisciplinare) Progetto didattico N. 1 Titolo : Let s investigate the world with our touch! Durata: Annuale

Dettagli

SOL terra Marco Zanuso Jr, Christophe Mathieu 2014

SOL terra Marco Zanuso Jr, Christophe Mathieu 2014 SOL terra Marco Zanuso Jr, Christophe Mathieu 2014 MADE IN ITALY SOL - Marco Zanuso Jr, Christophe Mathieu 2013 Sol è un sistema basato interamente sull interpretazione di innovativi principi di calcolo

Dettagli

Lezione 12: La visione robotica

Lezione 12: La visione robotica Robotica Robot Industriali e di Servizio Lezione 12: La visione robotica L'acquisizione dell'immagine L acquisizione dell immagine Sensori a tubo elettronico (Image-Orthicon, Plumbicon, Vidicon, ecc.)

Dettagli

5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak

5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak Tipo: Type: 5 cabine (1 main deck+ 4 lower deck) 5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak Tessuti: Dedar Fanfara, Paola Lenti Fabrics: Dedar Fanfara,

Dettagli

Materia: INGLESE Data: 24/10/2004

Materia: INGLESE Data: 24/10/2004 ! VERBI CHE TERMINANO IN... COME COSTRUIRE IL SIMPLE PAST ESEMPIO e aggiungere -d live - lived date - dated consonante + y 1 vocale + 1 consonante (ma non w o y) cambiare y in i, poi aggiungere -ed raddoppiare

Dettagli

24V DC ±10% 0.5... 1 W. Fluido Fluid. 15 Nl/min

24V DC ±10% 0.5... 1 W. Fluido Fluid. 15 Nl/min elettropiloti 0 mm 0 mm solenoids Elettropilota Solenoid valve 0 mm 00.44.0 ACCESSORI - ACCESSORIES 07.049.0 Connettore per elettropilota 0 mm con cavetto rosso/nero, lunghezza 400 mm - connector for 0

Dettagli

LA VIOLENZA NEI LUOGHI DI LAVORO. CLAUDIO CORTESI cld.cortesi@gmail.com

LA VIOLENZA NEI LUOGHI DI LAVORO. CLAUDIO CORTESI cld.cortesi@gmail.com LA VIOLENZA NEI LUOGHI DI LAVORO CLAUDIO CORTESI cld.cortesi@gmail.com VIOLENZE NEI LUOGHI DI LAVORO: COSA SONO? any action, incident or behaviour, that departs from reasonable conduct in which a person

Dettagli

di4g: Uno strumento di clustering per l analisi integrata di dati geologici

di4g: Uno strumento di clustering per l analisi integrata di dati geologici di4g: Uno strumento di clustering per l analisi integrata di dati geologici Alice Piva 1, Giacomo Gamberoni 1, Denis Ferraretti 1, Evelina Lamma 2 1 intelliware snc, via J.F.Kennedy 15, 44122 Ferrara,

Dettagli

È un progetto di Project by Comune di Numana Ideazione

È un progetto di Project by Comune di Numana Ideazione LA CALETTA È proprio nell ambito del progetto NetCet che si è deciso di realizzare qui, in uno dei tratti di costa più belli della Riviera del Conero, un area di riabilitazione o pre-rilascio denominata

Dettagli

MODULO DI ISCRIZIONE - ENROLMENT FORM

MODULO DI ISCRIZIONE - ENROLMENT FORM Under the Patronage of Comune di Portofino Regione Liguria 1ST INTERNATIONAL OPERA SINGING COMPETITION OF PORTOFINO from 27th to 31st July 2015 MODULO DI ISCRIZIONE - ENROLMENT FORM Direzione artistica

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

Virtualizzazione con Microsoft Tecnologie e Licensing

Virtualizzazione con Microsoft Tecnologie e Licensing Microsoft Virtualizzazione con Microsoft Tecnologie e Licensing Profile Redirezione dei documenti Offline files Server Presentation Management Desktop Windows Vista Enterprise Centralized Desktop Application

Dettagli

Catalogo Trattamento dell Aria - Collezione 2009

Catalogo Trattamento dell Aria - Collezione 2009 Catalogo Trattamento dell Aria - Collezione 2009 SECCOTECH & S 8 SeccoTech & Secco Tecnologia al servizio della deumidificazione Technology at dehumidification's service Potenti ed armoniosi Seccotech

Dettagli

PMI. Management Maturity Model, OPM3 Second Edition 2008

PMI. Management Maturity Model, OPM3 Second Edition 2008 Nuovi standard PMI, certificazioni professionali e non solo Milano, 20 marzo 2009 PMI Organizational Project Management Maturity Model, OPM3 Second Edition 2008 Andrea Caccamese, PMP Prince2 Practitioner

Dettagli

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07.

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07. Istruzione N 62 Data creazione 18/ 12/2009 Versione N 00 Ultima modifica TIPO ISTRUZIONE ASSEMBLAGGIO COLLAUDO TRAINING MODIFICA TEST FUNZIONALE RIPARAZIONE/SOSTITUZIONE IMBALLO TITOLO DELL ISTRUZIONE

Dettagli

Smobilizzo pro-soluto di Lettere di Credito Import

Smobilizzo pro-soluto di Lettere di Credito Import definizione L operazione presuppone l emissione di una lettera di credito IMPORT in favore dell esportatore estero, con termine di pagamento differito (es. 180 gg dalla data di spedizione con documenti

Dettagli

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx. Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.com Avvertenza di Rischio: Il Margin Trading su forex e/o CFD comporta

Dettagli

CALDO SGUARDO GRECO PDF

CALDO SGUARDO GRECO PDF CALDO SGUARDO GRECO PDF ==> Download: CALDO SGUARDO GRECO PDF CALDO SGUARDO GRECO PDF - Are you searching for Caldo Sguardo Greco Books? Now, you will be happy that at this time Caldo Sguardo Greco PDF

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

unità B3. Le teorie sull evoluzione

unità B3. Le teorie sull evoluzione documentazione fossile è provata da embriologia comparata anatomia comparata biologia molecolare L evoluzione avviene per selezione naturale microevoluzione può essere macroevoluzione speciazione allopatrica

Dettagli

COMINCIAMO A SENTIRCI UNA FAMIGLIA

COMINCIAMO A SENTIRCI UNA FAMIGLIA COMINCIAMO A SENTIRCI UNA FAMIGLIA IL PRIMO GIORNO CON LA FAMIGLIA OSPITANTE FIRST DAY WITH THE HOST FAMILY Questa serie di domande, a cui gli studenti risponderanno insieme alle loro famiglie, vuole aiutare

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Castello di San Donato in Perano Matrimoni nel Chianti Weddings in Chianti

Castello di San Donato in Perano Matrimoni nel Chianti Weddings in Chianti Castello di San Donato in Perano Matrimoni nel Chianti Weddings in Chianti Sede di Rappresentanza: Castello di San Donato in Perano 53013 Gaiole in Chianti (Si) Tel. 0577-744121 Fax 0577-745024 www.castellosandonato.it

Dettagli

CATENE E COMPONENTI DI GRADO 8-10-INOX, BRACHE DI POLIESTERE E ANCORAGGI, BRACHE DI FUNE

CATENE E COMPONENTI DI GRADO 8-10-INOX, BRACHE DI POLIESTERE E ANCORAGGI, BRACHE DI FUNE CATENE E COMPONENTI DI GRADO 8-10-INOX, BRACHE DI POLIESTERE E ANCORAGGI, BRACHE DI FUNE L esperienza e la passione per l ingegneria sono determinanti per la definizione della nostra politica di prodotto,

Dettagli

Esercitazione su SQL

Esercitazione su SQL Esercizio 1. Esercitazione su SQL Si consideri la base di dati relazionale composta dalle seguenti relazioni: impiegato Matricola Cognome Stipendio Dipartimento 101 Sili 60 NO 102 Rossi 40 NO 103 Neri

Dettagli

PRESENT SIMPLE. Indicativo Presente = Presente Abituale. Tom s everyday life

PRESENT SIMPLE. Indicativo Presente = Presente Abituale. Tom s everyday life PRESENT SIMPLE Indicativo Presente = Presente Abituale Prerequisiti: - Pronomi personali soggetto e complemento - Aggettivi possessivi - Esprimere l ora - Presente indicativo dei verbi essere ed avere

Dettagli

WWW.TINYLOC.COM CUSTOMER SERVICE GPS/ RADIOTRACKING DOG COLLAR. T. (+34) 937 907 971 F. (+34) 937 571 329 sales@tinyloc.com

WWW.TINYLOC.COM CUSTOMER SERVICE GPS/ RADIOTRACKING DOG COLLAR. T. (+34) 937 907 971 F. (+34) 937 571 329 sales@tinyloc.com WWW.TINYLOC.COM CUSTOMER SERVICE T. (+34) 937 907 971 F. (+34) 937 571 329 sales@tinyloc.com GPS/ RADIOTRACKING DOG COLLAR MANUALE DI ISTRUZIONI ACCENSIONE / SPEGNERE DEL TAG HOUND Finder GPS Il TAG HOUND

Dettagli

Windows Compatibilità

Windows Compatibilità Che novità? Windows Compatibilità CODESOFT 2014 é compatibile con Windows 8.1 e Windows Server 2012 R2 CODESOFT 2014 Compatibilità sistemi operativi: Windows 8 / Windows 8.1 Windows Server 2012 / Windows

Dettagli

L OPPORTUNITÀ DEL RECUPERO DI EFFICIENZA OPERATIVA PUÒ NASCONDERSI NEI DATI DELLA TUA AZIENDA?

L OPPORTUNITÀ DEL RECUPERO DI EFFICIENZA OPERATIVA PUÒ NASCONDERSI NEI DATI DELLA TUA AZIENDA? OSSERVATORIO IT GOVERNANCE L OPPORTUNITÀ DEL RECUPERO DI EFFICIENZA OPERATIVA PUÒ NASCONDERSI NEI DATI DELLA TUA AZIENDA? A cura del Professor Marcello La Rosa, Direttore Accademico (corporate programs

Dettagli

Manuale BDM - TRUCK -

Manuale BDM - TRUCK - Manuale BDM - TRUCK - FG Technology 1/38 EOBD2 Indice Index Premessa / Premise............................................. 3 Il modulo EOBD2 / The EOBD2 module........................... 4 Pin dell interfaccia

Dettagli

Sistemi di gestione dei dati e dei processi aziendali. Information Technology General Controls

Sistemi di gestione dei dati e dei processi aziendali. Information Technology General Controls Information Technology General Controls Indice degli argomenti Introduzione agli ITGC ITGC e altre componenti del COSO Framework Sviluppo e manutenzione degli applicativi Gestione operativa delle infrastrutture

Dettagli

CROMATOGRAFIA SU COLONNA

CROMATOGRAFIA SU COLONNA 1 CROMATOGRAFIA SU COLONNA La cromatografia è una tecnica di migrazione differenziata che permette la separazione dei costituenti di una miscela di sostanze affini. La cromatografia può essere di tipo

Dettagli

Mario Sbriccoli, Ercole Sori. Alberto Grohmann, Giacomina Nenci, UNIVERSITÀ DEGLI STUDI DELLA REPUBBLICA DI SAN MARINO CENTRO SAMMARINESE

Mario Sbriccoli, Ercole Sori. Alberto Grohmann, Giacomina Nenci, UNIVERSITÀ DEGLI STUDI DELLA REPUBBLICA DI SAN MARINO CENTRO SAMMARINESE copertina univ. 21 11-04-2005 16:30 Pagina 1 A State and its history in the volumes 1-20 (1993-1999) of the San Marino Center for Historical Studies The San Marino Centre for Historical Studies came into

Dettagli

T H O R A F L Y. Sistemi di drenaggio toracico Thoracic drainage systems. Catalogo 2009 - Catalogue 2009 GRUPPO C GROUP C

T H O R A F L Y. Sistemi di drenaggio toracico Thoracic drainage systems. Catalogo 2009 - Catalogue 2009 GRUPPO C GROUP C T H O R A F L Y Sistemi di drenaggio toracico Thoracic drainage systems Catalogo 2009 - Catalogue 2009 GRUPPO C GROUP C SOMMARIO GRUPPO C (SUMMARY C GROUP) 1/C II SISTEMI DI DRENAGGIO TORACICO COMPLETI

Dettagli

Luca Lussardi - Universit` a Cattolica del Sacro Cuore Dalla citt` a ideale alle cellule: l ubiquit` a della matematica

Luca Lussardi - Universit` a Cattolica del Sacro Cuore Dalla citt` a ideale alle cellule: l ubiquit` a della matematica Lo studio della matematica costituisce un educazione formativa della mente. La matematica sviluppa tutte le facoltà dell ingegno, affina in particolare le facoltà logiche, educa e rende più retta l intuizione,

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office Gestione delle Architetture e dei Servizi IT con ADOit Un Prodotto della Suite BOC Management Office Controllo Globale e Permanente delle Architetture IT Aziendali e dei Processi IT: IT-Governance Definire

Dettagli

PRELIEVO DI TAMPONI SU SUPERFICI E CARCASSE SOMMARIO

PRELIEVO DI TAMPONI SU SUPERFICI E CARCASSE SOMMARIO Pag. 1/7 SOMMARIO 1. SCOPO E CAMPO DI APPLICAZIONE...2 2. RIFERIMENTI BIBLIOGRAFICI...2 3. MATERIALE NECESSARIO...3 4. MODALITA OPERATIVE...4 5. REGISTRAZIONE E ARCHIVIAZIONE...7 6. RESPONSABILITA...7

Dettagli

/*dichiarazioni*/ // le frasi sono contenute in stringhe, cioè array di char char f1[max]; int i, giusto,len;

/*dichiarazioni*/ // le frasi sono contenute in stringhe, cioè array di char char f1[max]; int i, giusto,len; /* Date in ingresso una frase, dire se una è palindroma */ #include #define MAX 100 int main() /*dichiarazioni*/ // le frasi sono contenute in stringhe, cioè array di char char f1[max]; int i,

Dettagli

Aggiornamenti CIO Rivista ufficiale del Club Italiano Osteosintesi

Aggiornamenti CIO Rivista ufficiale del Club Italiano Osteosintesi Aggiornamenti CIO Rivista ufficiale del Club Italiano Osteosintesi Istruzioni per gli Autori Informazioni generali Aggiornamenti CIO è la rivista ufficiale del Club Italiano Osteosintesi e pubblica articoli

Dettagli

1. Che cos è. 2. A che cosa serve

1. Che cos è. 2. A che cosa serve 1. Che cos è Il Supplemento al diploma è una certificazione integrativa del titolo ufficiale conseguito al termine di un corso di studi in una università o in un istituto di istruzione superiore corrisponde

Dettagli

LICEO DELLE SCIENZE UMANE LICEO ECONOMICO SOCIALE. PROGRAMMA ESAMI INTEGRATIVI/IDONEITA' DI INGLESE (1, 2, 3 e 4 anno) CLASSE PRIMA

LICEO DELLE SCIENZE UMANE LICEO ECONOMICO SOCIALE. PROGRAMMA ESAMI INTEGRATIVI/IDONEITA' DI INGLESE (1, 2, 3 e 4 anno) CLASSE PRIMA (1, 2, 3 e 4 anno) CLASSE PRIMA Simple del verbo to be in tutte le sue forme Il Present Simple del verbo to have (got) in tutte le sue forme I pronomi soggetto e complemento Gli aggettivi e pronomi possessivi

Dettagli

Business Process Management

Business Process Management Business Process Management Come si organizza un progetto di BPM 1 INDICE Organizzazione di un progetto di Business Process Management Tipo di intervento Struttura del progetto BPM Process Performance

Dettagli

Come si prepara una presentazione

Come si prepara una presentazione Analisi Critica della Letteratura Scientifica 1 Come si prepara una presentazione Perché? 2 Esperienza: Si vedono spesso presentazioni di scarsa qualità Evidenza: Un lavoro ottimo, presentato in modo pessimo,

Dettagli

trovando in loro, veramente ma non pomposamente, le leggi principali della nostra natura:

trovando in loro, veramente ma non pomposamente, le leggi principali della nostra natura: From : The principal object - To : notions in simple and unelaborated expressions. The principal object, then, proposed in these Poems was to choose incidents L oggetto principale, poi, proposto in queste

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

Alimentazione e salute dell intestino: siamo quello che mangiamo

Alimentazione e salute dell intestino: siamo quello che mangiamo Alimentazione e salute dell intestino: siamo quello che mangiamo La dieta, il microbiota intestinale e la salute digestiva sono intrecciati fra loro. Questi legami e il potenziale benefico dei probiotici

Dettagli

Lavorazione artigianale Italiana Handmade in Italy. da noi ogni sapone è unico. Authentically Made in Italy Florence

Lavorazione artigianale Italiana Handmade in Italy. da noi ogni sapone è unico. Authentically Made in Italy Florence Lavorazione artigianale Italiana Handmade in Italy da noi ogni sapone è unico alveare soap gori 1919 soap factory lavorazione artigianale italiana Handmade in Italy I nostri saponi sono il frutto di un

Dettagli

HIGH SPEED FIMER. HSF (High Speed Fimer)

HIGH SPEED FIMER. HSF (High Speed Fimer) HSF PROCESS HSF (High Speed Fimer) HIGH SPEED FIMER The development of Fimer HSF innovative process represent a revolution particularly on the welding process of low (and high) alloy steels as well as

Dettagli

La teoria dei vantaggi comparati. La teoria dei vantaggi comparati

La teoria dei vantaggi comparati. La teoria dei vantaggi comparati La teoria dei vantaggi comparati La teoria dei vantaggi comparati fu elaborata dall economista inglese David Ricardo (1772-1823) nella sua opera principale: On the Principles of Political Economy and Taxation

Dettagli

UBUNTU SERVER. Installazione e configurazione di Ubuntu Server. M. Cesa 1

UBUNTU SERVER. Installazione e configurazione di Ubuntu Server. M. Cesa 1 UBUNTU SERVER Installazione e configurazione di Ubuntu Server M. Cesa 1 Ubuntu Server Scaricare la versione deisiderata dalla pagina ufficiale http://www.ubuntu.com/getubuntu/download-server Selezioniare

Dettagli

Nota Informativa Relativa alla Circolare 2009/1

Nota Informativa Relativa alla Circolare 2009/1 Nota Informativa Relativa alla Circolare 2009/1 In merito alla nuova circolare del Sottosegretariato per il Commercio Estero del Primo Ministero della Repubblica di Turchia, la 2009/21, (pubblicata nella

Dettagli

zanzariera per porte - finestre flyscreen for french - doors

zanzariera per porte - finestre flyscreen for french - doors zanzariera per porte - finestre flyscreen for french - doors ZANZAR SISTEM si congratula con lei per l acquisto della zanzariera Plissè. Questa guida le consentirà di apprezzare i vantaggi di questa zanzariera

Dettagli

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza Simona Giampaoli, Anna Rita Ciccaglione Istituto Superiore di Sanità Prevalenza e carico dell infezione cronica da virus dell epatite

Dettagli

40 motivi per cui le puttane sono le mie eroine

40 motivi per cui le puttane sono le mie eroine 40 motivi per cui le puttane sono le mie eroine Le puttane sanno condividere le parti più private e delicate del corpo con perfetti sconosciuti. Le puttane hanno accesso a luoghi inaccessibili. Le puttane

Dettagli

PANNELLO FRONTALE: QUERCIA STYLE CANNELLA PROFILO: PINO NERO PIANO DI SERVIZIO E ZOCCOLO: AGGLOMERATO MEROPE

PANNELLO FRONTALE: QUERCIA STYLE CANNELLA PROFILO: PINO NERO PIANO DI SERVIZIO E ZOCCOLO: AGGLOMERATO MEROPE Una proposta dall estetica esclusiva, in cui tutti gli elementi compositivi sono ispirati dalla geometria più pura e dalla massima essenzialità del disegno per un progetto caratterizzato da semplicità

Dettagli

La Valutazione Euristica

La Valutazione Euristica 1/38 E un metodo ispettivo di tipo discount effettuato da esperti di usabilità. Consiste nel valutare se una serie di principi di buona progettazione sono stati applicati correttamente. Si basa sull uso

Dettagli

CARATTERISTICHE GENERALI / GENERAL FEATURES

CARATTERISTICHE GENERALI / GENERAL FEATURES OPZIONI» otori i versioe flagia;» Coessioi laterali o posteriori;» Albero: cilidrico o scaalato;» Coessioi metriche o BSPP;» Altre caratteristiche speciali OPTIONS» Flage mout;» Side ad rear ports;» Shafts-

Dettagli

Pila.h versione 6. class Pila { private: int marker; int * contenuto; public:

Pila.h versione 6. class Pila { private: int marker; int * contenuto; public: 1 Pila.h versione 6 struct Pila { private: int size; int defaultgrowthsize; int marker; int * contenuto; void cresci(int increment); public: Pila(int initialsize) ; Pila(); ~Pila() ; void copy(pila * to)

Dettagli

PerformAzioni International Workshop Festival 22nd February 3rd May 2013 LIV Performing Arts Centre Bologna, Italy APPLICATION FORM AND BANK DETAILS

PerformAzioni International Workshop Festival 22nd February 3rd May 2013 LIV Performing Arts Centre Bologna, Italy APPLICATION FORM AND BANK DETAILS PerformAzioni International Workshop Festival 22nd February 3rd May 2013 LIV Performing Arts Centre Bologna, Italy APPLICATION FORM AND BANK DETAILS La domanda di partecipazione deve essere compilata e

Dettagli

Parking su Sedo. Manuale d uso e lettura delle statistiche

Parking su Sedo. Manuale d uso e lettura delle statistiche Parking su Sedo Manuale d uso e lettura delle statistiche Indice Introduzione 1. Statistics 1.1 Select Domains 1.1.1 Selezione attraverso le lettere inziali 1.1.2 Domain contains 1.2 Domain List 1.3 Creazione

Dettagli