caratterizzazione nomenclatura gruppi

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "caratterizzazione nomenclatura gruppi"

Transcript

1 TASSONOMIA La branca della batteriologia che si occupa della caratterizzazione e della nomenclatura degli organismi e della organizzazione di questi in gruppi

2 Tassonomia Classificazione (in taxa) Nomenclatura Identificazione

3

4 CLASSIFICAZIONE Nella tassonomia dei microrganismi l unità tassonomica fondamentale è la specie (taxon più basso). Questa fa parte di gruppi più grandi in un ordinamento gerarchico senza sovrapposizioni. La specie è un insieme di ceppi che hanno in comune numerose proprietà stabili. Il ceppo è una popolazione che discende da un unico microrganismo o da un isolato in coltura pura.

5 CLASSIFICAZIONE Nell ambito di una specie i ceppi possono differire lievemente per alcuni aspetti : biovar (biotipi) morfovar (morfotipi) serovar (sierotipi) Ogni specie avrà un ceppo tipo, generalmente il primo ad essere studiato per una determinata specie.

6 Nomenclatura Dominio Phylum Classe Ordine Famiglia Genere Specie Bacteria Spirochaetes Spirochaetes Spirochaetales Spirochaetaceae Spirochaeta plicatilis

7 Nomenclatura Sistema binomiale (Limneo ) Escherichia coli epiteto generico corsivo epiteto specifico Codice Internazionale per la Nomenclatura dei batteri

8 Nomenclatura International Journal of Systematic and Evolutionary Microbiology (IJSEM) Bergey s Manual of Systematic Bacteriology

9 CLASSIFICAZIONE sistemi artificiali sistemi naturali o filogenetici fenotipo evoluzione

10 Lo sviluppo della tassonomia microbica 17 e 18 secolo. Primi microscopi: i procarioti sono considerati una singola specie che assume forme diverse 18 secolo: Muller distingue due generi: Monas e Vibrio 19 secolo: C. Eherember: Monas, Vibrio e batteri elicali. Pasteur, Cohn: diversità microbica Koch: un patogeno, una specie I edizione del Bergey s Manual of Determinative Bacteriology ma ancora manca un criterio oggettivo di classificazione Numerical Taxonomy : confronti tra ampi set di dati biochimici, morfologici e fisiologici inizio delle tecniche molecolari rdna (Woese).. Comparative genomics

11 CLASSIFICAZIONE sistemi artificiali (fenotipo) Utili caratteristiche distintive e di facile determinazione Gram Firmicutes e Actinobacteria + anche se i micoplasmi (gram ) appartengono ai Firmicutes (rrna 16s) Forma Le proprietà fenotipiche forniscono comunque informazioni che la filogenesi molecolare non può fornire. (es. ruolo nell ambiente)

12 TASSONOMIA NUMERICA Permette di confrontare batteri simili analizzando numerose caratteristiche alle quali viene dato un ugual peso. Utile per la classificazione di specie una volta determinate le relazioni filogenetiche Il coefficiente di similarità permette di confrontare ceppi simili. 2 m.o. appartengono a alla stesso fenone se SAB= a+b+c S > 50% frequentemente > 70% Coefficiente di Jaccard > 80% specie

13 TASSONOMIA NUMERICA Coefficienti di corrispondenza sono organizzati in una matrice di similarità e rappresentati graficamente in dendrogrammi ,70 3 0,44 1 0,42 4 0,38 0, batteri similarità ,

14 Classifying prokaryotes Classifying bacteria on the basis of their morphology is extremely difficult; bacteria are generally quite small and have simple shapes though there are some bacteria, notably the cyanobacteria and actinomycetes, with sufficiently complex morphology to permit classification by shape. In addition to shape, bacteria have traditionally been identified and classified on the basis of their biochemistry and the conditions under which they grow. The advent of molecular biology has made it possible to classify bacteria on the basis of similarities among DNA sequences, and has revolutionized thinking in bacterial systematics

15 Concetto di specie biologica Gruppo di organismi interfecondi che danno progenie fertile e che sono separati riproduttivamente dagli altri organismi

16 Il concetto di specie nei procarioti Il concetto di specie nei procarioti si è sviluppato parallelamente alle tecniche di laboratorio che hanno consentito l accesso alle informazioni La tassonomia microbica è recente Non esiste un concetto universale I concetti applicabili agli eucarioti non valgono per i procarioti

17 Definizione filogenetica della specie procariotica Specie batterica: è un raggruppamento monofiletico e geneticamente coerente di organismi che mostrano un elevato grado di somiglianza, rilevabile per mezzo di test indipendenti (Rossello-Mora &Aman 2001 FEMS Microbiol. Rev.)

18 Definizione di specie nei procarioti Approccio molecolare Mol% G+C content Differenze <5% DNA-DNA relatedness (% similarity) Similarity >70% 16S RNA Identità >97% Specie

19 Tassonomia dei procarioti Caratterizzazione degli isolati Approccio morfologico Approccio biochimico e fisiologico Approccio ecologico Approccio molecolare APPROCCIO POLIFASICO

20 Caratteristiche morfologiche: Forma della cellula Dimensioni della cellula Morfologia delle colonie Colorazione di Gram Meccanismo di motilità Forma e collocazione dell endospora

21 Caratteristiche fisiologiche e biochimiche: Sorgenti di carbonio e azoto Costituenti della parete cellulare Sorgenti di energia Prodotti della fermentazione Tipo di nutrizione Temperatura ottimale di crescita e range Luminescenza Meccanismi di conversione dell energia Tolleranza osmotica

22 Caratteristiche ecologiche: Cicli Biologici Natura delle relazioni simbiontiche Patogenicità Habitat (ph, O2.)

23 Approccio biochimico alla caratterizzazione dei procaroti I test miniaturizzati

24 Identificazione di un microrganismo Example of methods that would be used for identification of a newly isolated enteric bacterium, using classic microbiological methods (the example given shows the procedures that would be used for identifying Escherichia coli). Note that most of the analyses here require that the organisms be grown in pure culture and that solely phenotypic criteria be used in the identification.

25 Caratteristiche molecolari

26 Definizione di specie nei procarioti Approccio molecolare Mol% G+C content Differenze <5% DNA-DNA relatedness (% similarity) Similarity >70% 16S RNA Identità >97% Specie

27 Composizione di basi Hplc Temperatura di denaturazione (melting) Gradiente di densità di CsCl

28 Mol%G+C= G+C x100 G+C+A+T Ranges of DNA base composition of various organisms. Note that the greatest range exists with bacteria.

29 Ibridazione degli acidi nucleici (% similarity) Genomic hybridization as a taxonomic tool. (a) DNA is isolated from test organisms. One of the DNAs is labeled (shown here as radioactive phosphate in the DNA of Organism 1).

30 Ibridazione degli acidi nucleici Actual hybridization experiment. All combinations are tried and excess unlabeled DNA is added in each experiment to prevent labeled DNA from reannealing with itself. Following hybridization, hybridized DNA is separated from unhybridized DNA before measuring radioactivity in the hybridized DNA only.

31 Ibridazione degli acidi nucleici Genomic hybridization as a taxonomic tool. (c) Results. Radioactivity in the control is taken as the 100% hybridization value.

32 rrna analysis rrna genes have been chosen as the molecular basis for phylogenetic reconstructions in the prokaryotic world The variations in the rrna primary structures among the prokaryotes reflects evolutionary distances among organisms Other molecular clocks: ATPase, cytochromes

33 In the late 1970s, Dr. Carl Woese (pictured above at left) spearheaded a study of evolutionary relationships among prokaryotes. Instead of physical characters, he relied on RNA sequences to determine how closely related these microbes were. He discovered that the prokaryotes were actually composed of two very different groups -- the Bacteria and a newly recognized group that he called Archaea. Each of these groups is as different from the other as they are from eukaryotes. These three groups are now recognized as three distinct domains of life, as shown above at right.

34 Il gene per l rrna 16 S è un cronometro molecolare E presente in ogni tipo di organismo, la sua sequenza è conservata. E essenziale alla sopravvivenza, funzione costante, non soggetta a influenza ambientale. Accumula mutazioni casualmente sulla sequenza La sequenza è sufficientemente lunga per accumulare mutazioni e sufficientemente corta per essere tutta sequenziata Riflette la distanza evolutiva tra microrganismi WOESE 1987, Microbiol. Rev, 51

35 Ribosomi procarioti ed eucarioti

36 Fig. 1. Bacterial variability map. E. coli 16S rrna gene sequence annotated with bacteria and "universal" priming sites and variable regions V1 V9. The sequence is colour coded to indicate bacterial sequence variability.

37 Struttura dell rrna 16S

38 Analisi del DNA ribosomale IGS 16S 0 IGS 23S trnaala, ile L operone ribosomale dei procarioti 5S 120

39 Bergey's Manual of Systematic Bacteriology, 2nd edition, volume I- V (2000~) Volume I : The Archaea, Cyanobacteria, Phototrophs, and Deeply Branching Genera. Sections I-XIV Volume II : The Proteobacteria. Sections XV-XIX XV: alpha subdivision XVI: beta subdivision XVII: gamma subdivision XVIII: delta subdivision XIX: epsilon subdivision Volume III : The Low G + C Gram Positives. Sections XX-XXII Volume IV : The High G + C Gram Positives. Sections XXIII-XXII Volume V : The Planctomycetes, Spirochaetes, Fibrobacteres, Bacteroides and Fusobacteria. Sections XXIV-XXXI

40 Relationship between 16S ribosomal RNA sequence similarity and genomic DNA hybridization between different pairs of organisms. These data are the results from several independent experiments with various species of the domain Bacteria. Points in the orange box represent combinations where 16S sequence similarity and genomic hybridization were both very high; thus, in each case, the two organisms tested were clearly the same species. By contrast, points in the green box represent combinations that indicate the two organisms tested were different species, and both methods show this. Points in the blue box indicate that the two test organisms were different species as measured by genomic DNA hybridization but not by 16S sequencing. Note how above 70% DNA hybridization, no 16S similarities were found of less than 97%. Data redrawn from Rosselló-Mora, R., and R. Amann FEMS Microbiol. Revs. 25:39 67.

41 La filogenesi batterica basata sul gene per l rrna 16S Database search

42 Definizione di specie nei procarioti Approccio molecolare Mol% G+C content Differenze <5% DNA-DNA relatedness (% similarity) Similarity >70% 16S RNA Identità >97% Specie

43 Estrazione del Dna Purificazione Precipitazione

44 moli%g+c= G+C x100 G+C+A+T Mol% G+C Hplc Temperatura di denaturazione (melting) Gradiente di densità di CsCl

45 HPLC cromatografia liquida ad alta prestazione (in inglese High Performance Liquid Chromatography) o cromatografia liquida ad alta pressione (High Pressure Liquid Chromatography) Si tratta di una tecnica cromatografica che permette di separare due o più composti presenti in un solvente sfruttando l'equilibrio di affinità tra una "fase stazionaria" posta all'interno della colonna cromatografica e una "fase mobile" che fluisce attraverso essa. Una sostanza più affine alla fase stazionaria rispetto alla fase mobile impiega un tempo maggiore a percorrere la colonna cromatografica (tempo di ritenzione), rispetto ad una sostanza con bassa affinità per la fase stazionaria ed alta per la fase mobile.

46

47

48

49

50

51 Marcatura calda : 32 P 14 C Endonucleasi S1 Dal JJ Perry ZANICHELLI

52 Struttura dell rrna 16S

53 La filogenesi batterica basata sul gene per l rrna 16S Database search

54 Progetto Database Ribosoma

55 RDP Home About Announcements Citation Contacts Resources Related Sites Tutorials Ribosomal Database Project: Release 10 Browsers Classifier LibCompare SeqMatch Probe Match Tree Builder Pyro Taxomatic seqcart AssignGen RDP Release 10, Update 24 :: Jan 13, 2011 :: 1,498,677 16S rrnas The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial and Archaeal smallsubunit 16S rrna sequences. RDP Release 10 brings two major changes to the RDP: RDP10 provides new Bacterial and Archaeal alignments with several significant enhancements over the previous RDP 9 alignments. Use of the Infernal secondary-structure based aligner that provides better support for short partial sequences and handles certain sequencing artifacts in a more intuitive manner.

56 Metodo della distanza evolutiva

57 ANALISI FILOGENETICA METODO DELLA DISTANZA EVOLUTIVA METODO DELLA MASSIMA PARSIMONIA La soluzione probabile è quella più semplice METODO DELLA MASSIMA PROBABILITA (probabilità di mutazioni)

58 Dal JJ Perry ZANICHELLI

59 Dal JJ Perry ZANICHELLI

60 ALBERI FILOGENETICI Riflettono le relazioni evolutive tra un gruppo di specie. A A B B I nodi rappresentano le specie I rami o ramificazioni la distanza evolutiva fra due specie C

61 Gruppi filogenetici o phyla

62 Universal phylogenetic tree as determined from comparative ribosomal RNA sequencing. Only a few key organisms or lineages are shown in each domain.

63 Albero filogenetico degli Eubatteri Ambientali non coltivabili

64 Albero filogenetico degli Eucarioti

65 Dal JJ Perry ZANICHELLI

66 L ipotesi endosimbiotica sull origine della cellula eucariotica Origin of modern eukaryotes by endosymbiotic events. Note how organelles originated from Bacteria rather than Archaea. Endosymbiosis was unlikely to have been a one-time event and probably occurred in various types of cells of the nuclear line of descent. Note, however, how some primitive eukaryotes either never underwent endosymbiotic events or permanently lost their symbionts, but otherwise maintained the basic properties of eukaryotic cells. Extant examples of such eukaryotes, all microbial, are known today. The increase in cell size in the nuclear line of descent allowed for larger genomes to evolve, but also likely led to the evolution of the nucleus to affect the orderly replication and partitioning of such genomes.

67 Isolamento ed identificazione di batteri dall ambiente Campione ambientale Diluizioni seriali Comunità mista ESTRAZIONE DNA Piastre Colture pure

68 Analisi del DNA ribosomale DNA batterio Estrazione del DNA totale 16S Gene per l RNA ribosomale 16S Amplificazione per PCR fd1 16S rd1 Reazione a catena della polimerasi Visualizzazione dell amplificato Sequenziamento

69 Visualizzazione per elettroforesi su gel di agarosio degli amplificati rdna 16S 100 bp ladder K- 100 bp ladder bp

70 Sequenziamento Dell rdna16s CACATGCAAGTCGAGCGGGCGTAGCAATACGTCAGCGGCAGACGGGTGAGTAACGCGTGG GAACGTACCTTTTGGTTCGGAACAACACAGGGAAACTTGTGCTAATACCGGATAAGCCCT TACGGGGAAAGATTTATCGCCGAAAGATCGGCCCGCGTCTGATTAGCTAGTTGGTGAGGT AATGGCTCACCAAGGCGACGATCAGTAGCTGGTCTGAGAGGATGATCAGCCACATTGGGA CTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGC AAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTG TGCGGGAAGATAATGACGGTACCGCAAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCC GCGGTAATACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGC

71 confronto della sequenza nucleotidica con la banca dati e allineamento Score = 1039 bits (524), Expect = 0.0 Identities = 542/549 (98%) Strand = Plus / Plus Vcas 108: 4 SjSa1: 3 Vcas 108: 64 atgcttaccgcgatcgat tacgaatggcgctagcta SjSa1: 63 aac nctggcggcaggctta acacatgcaagtcgaacgggcacttcggtgctagtggcaga 63 x x aac gctggcggcaggctta ncacatgcaagtcgaacgggcacttcggtgctagtggcaga 62 cgggtgagtaacacgtggga acgtaccttt c ggttcggaataat tcagggaaac t tggac 123 x cgggtgagtaacacgtggga acgtaccttt c ggttcggaataat ccagggaaac t tggac 122 Vcas 108: 124 taataccggata agcccttcggggg aaagatttatcgccgatagatcggcccgc gtctga 183 x SjSa1: 123 taataccggata cgcccttcggggg aaagatttatcgccgatagatcggcccgc gtctga 182 Vcas 108: 184 ttagctagtt ggtgaggtaatggctcacca aggcgacgatcagtagctggtctgagagga 243 SjSa1: 183 ttagctagtt ggtgaggtaatggctcacca aggcgacgatcagtagctggtctgagagga 242 Vcas 108: 244 tgatcagccacattgggactgagacacggcccaaactcctacgggaggcagcagtgggga 303 SjSa1: 243 tgatcagccacattgggactgagacacggcccaaactcctacgggaggcagcagtgggga 302 Vcas 108: 304 atattggacaatgggcgaaagcctgatccagccatgccgcgtg tgtgatgaaggccttag 363 x SjSa1: 303 atattggacaatgggcgaaagcctgatccagccatgccgcgtg agtgatgaaggccttag 362 Vcas 108: 364 ggttgtaaagc acttttgtccgggaagataatgactgtaccggaagaataagccccggct 423 x SjSa1: 363 ggttgtaaagc tcttttgtccgggaagataatgactgtaccggaagaataagccccggct 422 Vcas 108: 424 aacttcgtgccagcagccgcggtaatacgaagggggctagcgttgctcggaatcactggg 483 SjSa1: 423 aacttcgtgccagcagccgcggtaatacgaagggggctagcgttgctcggaatcactggg 482 Vcas 108: 484 cgtaaagggcgcgtaggcggactcttaagtcgggggtgaaagccca gggctcaaccctgg 543 x SjSa1: 483 cgtaaagggcgcgtaggcggactcttaagtcgggggtgaaagccca nggctcaaccctgg 542 Vcas 108: 544 aattgcctt 552 SjSa1: 543 aattgcctt 551

72

73 Metodo della distanza evolutiva Preparing a phylogenetic distance tree from 16S ribosomal RNA sequences. For illustrative purposes, only short sequences are shown. The evolutionary distance (ED) in (b) is calculated as the percentage of nonidentical sequences between the RNAs of any two organisms. The corrected ED is a statistical correction necessary to account for either back mutations to the original genotype or additional forward mutations at the same site that could have occurred. The tree (c) is ultimately generated by computer analysis of the data to give the best fit. The total length of the branches separating any two organisms is proportional to the calculated evolutionary distance between them.

74 Chemotaxonomy Fatty acid methyl ester (FAME) analysis in bacterial identification. (b) Procedure. Each peak from the gas chromatograph is due to one particular fatty acid methyl ester and the peak height is proportional to the amount.

75

76 Questioni aperte Variabilità intraspecifica: quanti genomi sequenziare per definire una specie? (core del genoma) Horizontal transfer Microrganismi non coltivabili???? Comparative genomics and microarrays techniques

LA TERRA E UN PIANETA.. FONDATO SULLE ATTIVITA MICROBICHE

LA TERRA E UN PIANETA.. FONDATO SULLE ATTIVITA MICROBICHE LA TERRA E UN PIANETA.. FONDATO SULLE ATTIVITA MICROBICHE CHI SONO I MICRORGANISMI? PERCHE E COME POSSONO AVERLI? CHE EFFETTI HANNO SULL AMBIENTE? I principali protagonisti, nel mondo microbico, sono i

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

e dei genotipi tossici

e dei genotipi tossici Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle

Dettagli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona

Dettagli

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in

Dettagli

Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the

Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the 1 2 3 Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the body scientists say these cells are pluripotent.

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Estendere Lean e Operational Excellence a tutta la Supply Chain

Estendere Lean e Operational Excellence a tutta la Supply Chain Estendere Lean e Operational Excellence a tutta la Supply Chain Prof. Alberto Portioli Staudacher www.lean-excellence.it Dipartimento Ing. Gestionale Politecnico di Milano alberto.portioli@polimi.it Lean

Dettagli

Informazioni generali e comunicazioni di servizio

Informazioni generali e comunicazioni di servizio P. Landini (paolo.landini@unimi.it) 4 piano torre B. Tel. 02-50315028 Corso di Microbiologia e Biotecnologia delle fermentazioni Unità Didattica di Microbiologia Anno accademico 2014-2015 Informazioni

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

La segreteria didattica. MICROBIOLOGIA GENERALE C. Mazzoni 05/1

La segreteria didattica. MICROBIOLOGIA GENERALE C. Mazzoni 05/1 La segreteria ricorda a tutti i docenti del primo quadrimestre che le lezioni del I ANNO inizieranno martedì 13 settembre e si terranno per la settimana che va dal 13 al 16 settembre nell'aula III di economia.

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

A dissertation submitted to ETH ZURICH. for the degree of Doctor of Sciences. presented by DAVIDE MERCURIO

A dissertation submitted to ETH ZURICH. for the degree of Doctor of Sciences. presented by DAVIDE MERCURIO DISS. ETH NO. 19321 DISCRETE DYNAMIC EVENT TREE MODELING AND ANALYSIS OF NUCLEAR POWER PLANT CREWS FOR SAFETY ASSESSMENT A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

METODI GENETICI NELLA IDENTIFICAZIONE DI

METODI GENETICI NELLA IDENTIFICAZIONE DI METODI GENETICI NELLA IDENTIFICAZIONE DI CIANOBATTERI Susanna Vichi, Simonetta Gemma, Emanuela Testai Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Convegno Cianobatteri

Dettagli

Metodi per la Ricostruzione Filogenetica. Giuliana Allegrucci riproduzione vietata

Metodi per la Ricostruzione Filogenetica. Giuliana Allegrucci riproduzione vietata Metodi per la Ricostruzione Filogenetica Ricostruire una filogenesi significa trovare la migliore stima delle relazioni evolutive storiche fra entità tassonomiche usando i dati disponibili. I dati di base

Dettagli

GerbView. 25 novembre 2015

GerbView. 25 novembre 2015 GerbView GerbView ii 25 novembre 2015 GerbView iii Indice 1 Introduzione a GerbView 2 2 Schermo principale 2 3 Top toolbar 3 4 Barra strumenti sinistra 4 5 Comandi nella barra del menu 5 5.1 File menu.......................................................

Dettagli

Gruppo di lavoro 1 Metadati e RNDT. Incontro del 22 luglio 2014

Gruppo di lavoro 1 Metadati e RNDT. Incontro del 22 luglio 2014 Gruppo di lavoro 1 Metadati e RNDT Incontro del 1 Piano di lavoro 1. Condivisione nuova versione guide operative RNDT 2. Revisione regole tecniche RNDT (allegati 1 e 2 del Decreto 10 novembre 2011) a)

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Esercizi Programming Contest

Esercizi Programming Contest Esercizi Programming Contest Alberto Montresor 22 maggio 2012 Alcuni degli esercizi che seguono sono associati alle rispettive soluzioni. Se il vostro lettore PDF lo consente, è possibile saltare alle

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

IBRIDAZIONE DNA:DNA. Tassonomia molecolare CHEMOTAXONOMY

IBRIDAZIONE DNA:DNA. Tassonomia molecolare CHEMOTAXONOMY IBRIDAZIONE DNA:DNA SOUTHERN blotting Hybridization Techniques Hybridization Techniques NOTHERN blotting FISH (Fluorescence In Situ Hybridization) FISH (Fluorescence In Situ Hybridization) The sample is

Dettagli

I NUMERI DI LEYLAND E LE SERIE DI FIBONACCI E DI PADOVAN

I NUMERI DI LEYLAND E LE SERIE DI FIBONACCI E DI PADOVAN Gruppo B. Riemann * I NUMERI DI LEYLAND E LE SERIE DI FIBONACCI E DI PADOVAN Francesco Di Noto, Michele Nardelli *Gruppo amatoriale per la ricerca matematica sui numeri primi, sulle loro congetture e sulle

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

Examples of chemical equivalence

Examples of chemical equivalence hemical equivalence Two spins are chemically equivalent if: There is a symmetry operation that exchange their positions, or There is a dynamic process between two or more energetically equivalent conformations

Dettagli

UNI EN ISO 12944-6. Corrosion protection of steel structures by protective paint systems. Laboratory performance test for

UNI EN ISO 12944-6. Corrosion protection of steel structures by protective paint systems. Laboratory performance test for via di Marmiceto, 6/C-56016 Ospeetto PISA P.IVA 01115340505 CCIAA Pi 101169 Report n 2050451/5 UNI EN ISO 12944-6 Corrosion protection of steel structures by protective paint systems Laboratory performance

Dettagli

AVVISO n.17252 25 Settembre 2007

AVVISO n.17252 25 Settembre 2007 AVVISO n.17252 25 Settembre 2007 Mittente del comunicato : Borsa Italiana Societa' oggetto : dell'avviso Oggetto : Modifiche alle Istruzioni al Regolamento IDEM: Theoretical Fair Value (TFV)/Amendments

Dettagli

RAPPORTO DEL MEDICO DI FAMIGLIA PRIVATE MEDICAL ATTENDANT S REPORT. Compilare in stampatello

RAPPORTO DEL MEDICO DI FAMIGLIA PRIVATE MEDICAL ATTENDANT S REPORT. Compilare in stampatello RAPPORTO DEL MEDICO DI FAMIGLIA PRIVATE MEDICAL ATTENDANT S REPORT Si prega il medico di famiglia di rispondere con accuratezza ad ogni singola domanda The Medical Attendant is requested to take particular

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Scritto da DEApress Lunedì 14 Aprile 2014 12:03 - Ultimo aggiornamento Martedì 26 Maggio 2015 09:34

Scritto da DEApress Lunedì 14 Aprile 2014 12:03 - Ultimo aggiornamento Martedì 26 Maggio 2015 09:34 This week I have been walking round San Marco and surrounding areas to find things that catch my eye to take pictures of. These pictures were of various things but majority included people. The reason

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

E-Business Consulting S.r.l.

E-Business Consulting S.r.l. e Rovigo S.r.l. Chi siamo Scenario Chi siamo Missione Plus Offerti Mercato Missionedi riferimento Posizionamento Metodologia Operativa Strategia Comunicazione Digitale Servizi Esempidi consulenza Clienti

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

Asset Management Bond per residenti in Italia

Asset Management Bond per residenti in Italia Asset Management Bond per residenti in Italia Agosto 2013 1 SEB Life International SEB Life International (SEB LI www.seb.ie) società irlandese interamente controllata da SEB Trygg Liv Holding AB, parte

Dettagli

Studio delle popolazioni microbiche riguardanti processi di fermentazione anaerobica in condizioni di mesofilia

Studio delle popolazioni microbiche riguardanti processi di fermentazione anaerobica in condizioni di mesofilia Agenzia Nazionale per le Nuove Tecnologie, l nergia e lo Sviluppo conomico Sostenibile RICRCA DI SISTMA LTTRICO Studio delle popolazioni microbiche riguardanti processi di fermentazione anaerobica in condizioni

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

Name on a passport, HANGTAG

Name on a passport, HANGTAG recagroup design architecture art cinema travel music food Name on a passport, HANGTAG A quick look at printing techniques for hangtags RECA GROUP The hangtag of a garment is its ID card, its passport,

Dettagli

Pezzi da ritagliare, modellare e incollare nell ordine numerico indicato.

Pezzi da ritagliare, modellare e incollare nell ordine numerico indicato. La nuova Treddì Paper è un prodotto assolutamente innovativo rispetto ai classici Kit per il découpage 3D. Mentre i classici prodotti in commercio sono realizzati in cartoncino, la Treddì è in carta di

Dettagli

Organizzazione del corso

Organizzazione del corso Organizzazione del corso Biotecnologi mercoledì lezioni 11-13 09 marzo 16 marzo 23 marzo 30 marzo Biologi mercoledì lezioni 11-13 09 marzo 16 marzo 23 marzo 30 marzo Tutti: venerdì 11 marzo, 09-11, aula

Dettagli

Combinazioni serie IL-MIL + MOT

Combinazioni serie IL-MIL + MOT Combinazioni tra riduttori serie IL-MIL e MOT Combined series IL-MIL + MOT reduction units Combinazioni serie IL-MIL + MOT Sono disponibili varie combinazioni tra riduttori a vite senza fine con limitatore

Dettagli

up date basic medium plus UPDATE

up date basic medium plus UPDATE up date basic medium plus UPDATE Se si potesse racchiudere il senso del XXI secolo in una parola, questa sarebbe AGGIORNAMENTO, continuo, costante, veloce. Con UpDate abbiamo connesso questa parola all

Dettagli

Caratterizzazione della comunità microbica

Caratterizzazione della comunità microbica Caratterizzazione della comunità microbica Monitoraggio biologico annuale dell impianto Dipartimento di Biologia Università di Pisa Monitoraggio biologico del reattore Monitoraggio biologico del prototipo

Dettagli

13-03-2013. Introduzione al Semantic Web Linguaggi per la rappresentazione di ontologie. L idea del Semantic Web.

13-03-2013. Introduzione al Semantic Web Linguaggi per la rappresentazione di ontologie. L idea del Semantic Web. Corso di Ontologie e Semantic Web Linguaggi per la rappresentazione di ontologie Prof. Alfio Ferrara, Prof. Stefano Montanelli Definizioni di Semantic Web Rilievi critici Un esempio Tecnologie e linguaggi

Dettagli

Get Instant Access to ebook Venditore PDF at Our Huge Library VENDITORE PDF. ==> Download: VENDITORE PDF

Get Instant Access to ebook Venditore PDF at Our Huge Library VENDITORE PDF. ==> Download: VENDITORE PDF VENDITORE PDF ==> Download: VENDITORE PDF VENDITORE PDF - Are you searching for Venditore Books? Now, you will be happy that at this time Venditore PDF is available at our online library. With our complete

Dettagli

Metodi molecolari per l identificazione di lieviti isolati dalle paste acide siciliane **

Metodi molecolari per l identificazione di lieviti isolati dalle paste acide siciliane ** Metodi molecolari per l identificazione di lieviti isolati dalle paste acide siciliane ** P. Giudici 1, A. Pulvirenti 1 1 Università degli Studi di Modena e Reggio Emilia, Via Kennedy, 17-42100 Reggio

Dettagli

3B BIO classe partecipante al progetto Generazione Web

3B BIO classe partecipante al progetto Generazione Web Anno scolastico 2012-13 ISTITUTO TECNICO SETTORE TECNOLOGICO INDIRIZZO CHIMICA, MATERIALI E BIOTECNOLOGIE (Articolazione: Biotecnologie sanitarie) PROGRAMMA PREVENTIVO MATERIA Biologia, Microbiologia e

Dettagli

Centro Interdipartimentale di Ricerca per l Innovazione in Viticoltura ed Enologia

Centro Interdipartimentale di Ricerca per l Innovazione in Viticoltura ed Enologia Il DNA come Elemento Tracciante in Spumantizzazione Centro Interdipartimentale di Ricerca per l Innovazione in Viticoltura ed Enologia Dr. Ileana Vigentini IL VINO SPUMANTE METODO CLASSICO (CHAMPENOISE

Dettagli

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Istituto Superiore di Sanità Roma 30 ottobre 2007 Rossella Briancesco Metodi tradizionali spesso poco sensibili Metodi

Dettagli

formati > formats Esagono 15 15x17 (6 x6.7 ) Esagono 5 5x5,7 (2 x2.2 ) Optical Mod. A 15x17 (6 x6.7 ) Optical Mod. B 15x17 (6 x6.

formati > formats Esagono 15 15x17 (6 x6.7 ) Esagono 5 5x5,7 (2 x2.2 ) Optical Mod. A 15x17 (6 x6.7 ) Optical Mod. B 15x17 (6 x6. Catalogo Catalogue >2 Assecondando l evoluzione della piastrella diamantata a rivestimento, è giunto il momento per ETRURIA design di pensare anche al pavimento. La prima idea è quella di portare il diamantato

Dettagli

Un nuovo approccio: la VEQ in biologia molecolare

Un nuovo approccio: la VEQ in biologia molecolare Un nuovo approccio: la VEQ in biologia molecolare Il crescente interesse nella biologia molecolare applicata alla diagnostica è il risultato dei profondi progressi ottenuti nelle conoscenze scientifiche

Dettagli

Copyright 2012 Binary System srl 29122 Piacenza ITALIA Via Coppalati, 6 P.IVA 01614510335 - info@binarysystem.eu http://www.binarysystem.

Copyright 2012 Binary System srl 29122 Piacenza ITALIA Via Coppalati, 6 P.IVA 01614510335 - info@binarysystem.eu http://www.binarysystem. CRWM CRWM (Web Content Relationship Management) has the main features for managing customer relationships from the first contact to after sales. The main functions of the application include: managing

Dettagli

Cluster Analysis. Paese Cereali (Ce) Riso (R) Patate (P) Zucchero (Z) Verdure (Ver) Vino (Vi) Carne (Ca) Latte (L) Burro (B) Uova (U)

Cluster Analysis. Paese Cereali (Ce) Riso (R) Patate (P) Zucchero (Z) Verdure (Ver) Vino (Vi) Carne (Ca) Latte (L) Burro (B) Uova (U) Analysis Esempio Stiamo studiando le abitudini alimentari nei Paesi europei. Sulla base dei dati a disposizione, ci chiediamo se si possano individuare sotto-aree con abitudini alimentari simili. Dati:

Dettagli

Stem Cells. Medicine Biology. Bioethics

Stem Cells. Medicine Biology. Bioethics Stem Cells Medicine Biology Bioethics Dal DNA all organismo complesso Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico

Dettagli

CAMBIO DATI PERSONALI - Italy

CAMBIO DATI PERSONALI - Italy CAMBIO DATI PERSONALI - Italy Istruzioni Per La Compilazione Del Modulo / Instructions: : Questo modulo è utilizzato per modificare i dati personali. ATTENZIONE! Si prega di compilare esclusivamente la

Dettagli

Classification of Financial Instrument(CFI)] quotazione si /no indicatore eventuale della quotazione

Classification of Financial Instrument(CFI)] quotazione si /no indicatore eventuale della quotazione Allegato 2 TRACCIATO DATI PER ANAGRAFICHE TITOLI INTERMEDIARI Per uniformare l invio delle informazioni sui titoli trattati presso gli internalizzatori sistematici si propone l invio di un file in formato

Dettagli

Università degli Studi di Palermo. Università degli Studi di Salerno. Corso di Aggiornamento BioMAc 2013

Università degli Studi di Palermo. Università degli Studi di Salerno. Corso di Aggiornamento BioMAc 2013 Università degli Studi di Napoli Federico II Università degli Studi di Palermo Università degli Studi di Salerno Corso di Aggiornamento Bioreattori a Membrane (MBR) per la depurazione delle Acque Caratteristiche

Dettagli

WELCOME. Go to the link of the official University of Palermo web site www.unipa.it; Click on the box on the right side Login unico

WELCOME. Go to the link of the official University of Palermo web site www.unipa.it; Click on the box on the right side Login unico WELCOME This is a Step by Step Guide that will help you to register as an Exchange for study student to the University of Palermo. Please, read carefully this guide and prepare all required data and documents.

Dettagli

Unità tecnica UTAGRI Laboratori INN e GEN

Unità tecnica UTAGRI Laboratori INN e GEN Unità tecnica UTAGRI Laboratori INN e GEN FOODFLAVOUR PL 77.2 Metodologie diagnostiche innovative per la caratterizzazione delle comunità microbiche Responsabile: Annamaria Bevivino Partecipanti: Patrizia

Dettagli

Definizione di segnale

Definizione di segnale Signal detection Laura Sottosanti Ugo Moretti Definizione di segnale Information that arises from one or multiple sources (including observations and experiments), which suggests a new potentially causal

Dettagli

UN IMMAGINE MIGLIORE PER CRESCERE MEGLIO BRAND DESIGN PACKAGING CORPORATE IDENTITY ADV STILL LIFE

UN IMMAGINE MIGLIORE PER CRESCERE MEGLIO BRAND DESIGN PACKAGING CORPORATE IDENTITY ADV STILL LIFE UN IMMAGINE MIGLIORE PER CRESCERE MEGLIO BRAND DESIGN PACKAGING CORPORATE IDENTITY ADV STILL LIFE Caminiti Graphic è un team di professionisti specializzati in progetti di Brand Design, Packaging, ADV,

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

AVVISO n.12437. 03 Luglio 2014 --- Mittente del comunicato : Borsa Italiana. Societa' oggetto dell'avviso

AVVISO n.12437. 03 Luglio 2014 --- Mittente del comunicato : Borsa Italiana. Societa' oggetto dell'avviso AVVISO n.12437 03 Luglio 2014 --- Mittente del comunicato : Borsa Italiana Societa' oggetto dell'avviso : -- Oggetto : Modifiche al Manuale delle Corporate Actions - Amendment to the Corporate Action -

Dettagli

PMBOK Guide 3 rd Edition 2004

PMBOK Guide 3 rd Edition 2004 PMBOK Guide 3 rd Edition 2004 Un modello di riferimento per la gestione progetti a cura di Tiziano Villa, PMP febbraio 2006 PMI, PMP, CAPM, PMBOK, PgMP SM, OPM3 are either marks or registered marks of

Dettagli

Jujube, progettata da 4P1B Design Studio, è una gamma completa di divani, poltrone, pouf e poltroncine ispirata a un design grafico leggero ma allo

Jujube, progettata da 4P1B Design Studio, è una gamma completa di divani, poltrone, pouf e poltroncine ispirata a un design grafico leggero ma allo indoor & outdoor _3 Jujube, progettata da 4P1B Design Studio, è una gamma completa di divani, poltrone, pouf e poltroncine ispirata a un design grafico leggero ma allo stesso tempo molto caratterizzante.

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

ATTESTATO DELL ATTIVITÀ DI VOLONTARIATO CERTIFICATE OF VOLUNTARY ACTIVITIES

ATTESTATO DELL ATTIVITÀ DI VOLONTARIATO CERTIFICATE OF VOLUNTARY ACTIVITIES ASSOCIAZIONE CONSORTI DIPENDENTI MINISTERO AFFARI ESTERI ATTESTATO DELL ATTIVITÀ DI VOLONTARIATO CERTIFICATE OF VOLUNTARY ACTIVITIES ASSOCIAZIONE CONSORT I DIPENDENTI MINISTE RO AFFARI ESTER I ATTESTATO

Dettagli

La reazione antigeneanticorpo

La reazione antigeneanticorpo La reazione antigeneanticorpo Natura della reazione FIGURE 6-1 - Four types of non-covalent forces operates over a very short distance ( generally 1 angstrom ) - The interaction depends on a very close

Dettagli

Babaoglu 2006 Sicurezza 2

Babaoglu 2006 Sicurezza 2 Key Escrow Key Escrow Ozalp Babaoglu! In many situations, a secret (key) is known to only a single individual " Private key in asymmetric cryptography " The key in symmetric cryptography or MAC where the

Dettagli

UNIVERSITÀ DI PISA FACOLTÀ DI INGEGNERIA

UNIVERSITÀ DI PISA FACOLTÀ DI INGEGNERIA UNIVERSITÀ DI PISA FACOLTÀ DI INGEGNERIA CORSO DI LAUREA IN INGEGNERIA DELLE TELECOMUNICAZIONI Tesi di Laurea Analisi statistica di propagazione di campo elettromagnetico in ambiente urbano. Relatori:

Dettagli

Prova finale di Ingegneria del software

Prova finale di Ingegneria del software Prova finale di Ingegneria del software Scaglione: Prof. San Pietro Andrea Romanoni: Francesco Visin: andrea.romanoni@polimi.it francesco.visin@polimi.it Italiano 2 Scaglioni di voto Scaglioni di voto

Dettagli

Tecniche biofisiche basate su nanopori

Tecniche biofisiche basate su nanopori Tecniche biofisiche basate su nanopori -Pori di dimensione nanometrica -Attraverso membrane lipidiche o inorganiche -Di natura proteica o scavati con tecnologie top-down Possono essere impiegati per -Studiare

Dettagli

PROGETTO DI CLASSE PARCHEGGI ON THE ROAD S.R.L.

PROGETTO DI CLASSE PARCHEGGI ON THE ROAD S.R.L. PROGETTO DI CLASSE PARCHEGGI ON THE ROAD S.R.L. Il progetto di classe della 5cp è inserito nel POF (piano offerta formativa) ed è obbligatorio. Tratta della realizzazione dei piani di sosta all interno

Dettagli

Guida utente User Manual made in Italy Rev0

Guida utente User Manual made in Italy Rev0 Guida utente User Manual Rev0 made in Italy Indice/Index Informazioni generali General Info... 3 Guida Rapida per messa in funzione Start Up procedure... 3 Login Login... 3 Significato dei tasti Botton

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

Le funzioni di gestione dell impresa: il marketing (2)

Le funzioni di gestione dell impresa: il marketing (2) Le funzioni di gestione dell impresa: il marketing (2) dott. Matteo Rossi La politica del prodotto Assume un ruolo centrale e prioritario nelle scelte di marketing. Appare caratterizzata da un elevato

Dettagli

T V A. Il processo analitico è costituito da tre fasi distinte: a) Estrazione - arricchimento b) Retrotrascrizione c) Amplificazione Real Time TM

T V A. Il processo analitico è costituito da tre fasi distinte: a) Estrazione - arricchimento b) Retrotrascrizione c) Amplificazione Real Time TM genedia DIVISIONE BIOMOLECOLARE DETERMINAZIONE QUANTITATIVA DI RNA HCV MEDIANTE HPA (HIGH PERFORMANCE AMPLIFICATION) T V A L HPA è un protocollo d amplificazione che coniuga le conoscenze acquisite con

Dettagli

Lezione 4. Il sequenziamento del DNA, Sanger

Lezione 4. Il sequenziamento del DNA, Sanger Lezione 4 Il sequenziamento del DNA, Sanger Schema della lezione Polymerase chain reaction (PCR) Dal prodotto di PCR al sequenziamento di Sanger Lettura dei prodotti di sequenziamento con sequenziatori

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing

Dettagli

Can virtual reality help losing weight?

Can virtual reality help losing weight? Can virtual reality help losing weight? Can an avatar in a virtual environment contribute to weight loss in the real world? Virtual reality is a powerful computer simulation of real situations in which

Dettagli

English-Medium Instruction: un indagine

English-Medium Instruction: un indagine English-Medium Instruction: un indagine Marta Guarda Dipartimento di Studi Linguistici e Letterari (DiSLL) Un indagine su EMI presso Unipd Indagine spedita a tutti i docenti dell università nella fase

Dettagli

Quality Certificates

Quality Certificates Quality Certificates Le più importanti certificazioni aziendali, di processo e di prodotto, a testimonianza del nostro costante impegno ed elevato livello di competenze. Qualità * certificata * Certified

Dettagli

Informazioni su questo libro

Informazioni su questo libro Informazioni su questo libro Si tratta della copia digitale di un libro che per generazioni è stato conservata negli scaffali di una biblioteca prima di essere digitalizzato da Google nell ambito del progetto

Dettagli

Usage guidelines. About Google Book Search

Usage guidelines. About Google Book Search This is a digital copy of a book that was preserved for generations on library shelves before it was carefully scanned by Google as part of a project to make the world s books discoverable online. It has

Dettagli

BIOINFORMATICA: Cosa è?

BIOINFORMATICA: Cosa è? BIOINFORMATICA: Cosa è? THE DEFINITIONS OF BIOINFORMATICS Bioinformatics is an integration of mathematical, statistical and computer methods to analyse biological, biochemical and biophysical data (Georgia

Dettagli

Rapporto sui risultati del Questionario sulla soddisfazione degli utenti di Technology Innovation - 2009

Rapporto sui risultati del Questionario sulla soddisfazione degli utenti di Technology Innovation - 2009 Rapporto sui risultati del Questionario sulla soddisfazione degli utenti di Technology Innovation - 2009 User satisfaction survey Technology Innovation 2009 summary of results Rapporto sui risultati del

Dettagli

dal laboratorio libri in presenza alla collaborazione online

dal laboratorio libri in presenza alla collaborazione online Centro Sovrazonale di Comunicazione Aumentativa Centro Sovrazonale di Comunicazione Aumentativa dal laboratorio libri in presenza alla collaborazione online a cura di Antonio Bianchi sommario L'impostazione

Dettagli

Sfrutta subito i Vantaggi! Validità 1 Aprile 30 Giugno 2005. Scopri la qualità e il risparmio!

Sfrutta subito i Vantaggi! Validità 1 Aprile 30 Giugno 2005. Scopri la qualità e il risparmio! www.eppendorf.com/advantage/32 Get Eppendorf quality today! Validità 1 Aprile 30 Giugno 2005 Sfrutta subito i Vantaggi! Scopri la qualità e il risparmio! www.eppendorf.com/advantage/32 Get Eppendorf quality

Dettagli

Manutenzione del software

Manutenzione del software del software Generalità Leggi dell evoluzione del software Classi di manutenzione Legacy systems Modelli di processo per la manutenzione 1 Generalità La manutenzione del software è il processo di modifica

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

INFORMATIVA EMITTENTI N. 18/12

INFORMATIVA EMITTENTI N. 18/12 INFORMATIVA EMITTENTI N. 18/12 Data: 10/02/2012 Ora: 15:05 Mittente: UniCredit S.p.A. Oggetto: Risultati definitivi dell aumento di capitale in opzione agli azionisti ordinari e di risparmio / Final results

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Molle per stampi DIE SPRINGS ISO 10243

Molle per stampi DIE SPRINGS ISO 10243 Molle per stampi DIE SPRIGS ISO 10243 2 Die springs Molle per stampi Located in Colnago, Milano TIPCOCIMA S.r.l. is a joint-venture between TIPCO Inc., a global supplier of pierce punches and die buttons

Dettagli