MOTOR HALOPLEX: AN INNOVATIVE STRATEGY FOR THE MOLECULAR DIAGNOSIS OF MUSCULAR DISEASES MARCO SAVARESE

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "MOTOR HALOPLEX: AN INNOVATIVE STRATEGY FOR THE MOLECULAR DIAGNOSIS OF MUSCULAR DISEASES MARCO SAVARESE"

Transcript

1 MOTOR HALOPLEX: AN INNOVATIVE STRATEGY FOR THE MOLECULAR DIAGNOSIS OF MUSCULAR DISEASES MARCO SAVARESE SORRENTO, 22/11/2012

2 Muscular dystrophies Neuromuscular disorders; Progressive loss of motor function.

3 Phenotypic variability Necrosis Fibrosis Variations in fiber size Inflammation

4 Genetic heterogeneity

5 Genetic heterogeneity Items = 561 Number of genes = 283 Phenotypic convergence (CMT) Phenotypic divergence (LMNA)

6 Traditional diagnostic approach

7 Traditional diagnostic approach High number of sequenced genes High costs Time-consuming

8 Traditional diagnostic approach About 40% of patients don t obtain a molecular diagnosis High number of sequenced genes High costs Time-consuming

9 Next generation sequencing (NGS) Useful for the molecular diagnosis of extremely heterogeneous conditions

10 NGS for genetic diagnosis Easy analytic pipeline; High specificity and sensitivity; Timing; Ethical issues. Target resequencing of specific regions of interest is convenient if compared with genome or exome sequencing.

11 98 selected genes Group no. Description Analyzed genes (no.) Group1 Muscular dystrophies 24 Group2 Congenital muscular dystrophies 8 Group3 Congenital myopathies 12 Group4 Distal myopathies 2 Group5 Other myopathies 10 Group6 Myotonic syndromes 5 Group7 Ion channel muscle diseases 11 Group9 Metabolic myopathies 19 Group10 Group11 Hereditary Cardiomyopathies Congenital Myasthenic Syndromes Group12 Motor Neuron Diseases 2 Group13 Group14 Group15 Hereditary Ataxias Hereditary motor sensory neuropathies (HMSN) Hereditary Paraplegias Group16 Other neuromuscular disorders 3 Group17 Update Kaplan J-C, Neuromuscul Disord (2011) 21:

12 Gene by gene VS Haloplex Faster Easier Rapid molecular screening test, without increasing costs

13 Coverage (%) Predicted coverage In comparison with affinity capture probe strategy that is at ~85%, coverage is close to 100%

14 Inclusion criteria for patients from the Italian LGMD network living patients willing further testing a clinical diagnosis of limb-girdle muscular dystrophy aspecific pathology and no mutation identified so far severe course of disease DNA samples of good quality Availability of a muscle biopsy (possibly in RNAlater )

15 Inclusion criteria for patients from the Italian LGMD network living patients willing further testing a clinical diagnosis of limb-girdle muscular dystrophy aspecific pathology and no mutation identified so far DNA samples of good quality severe course of disease Availability of a muscle biopsy (possibly in RNAlater ) More than 200 samples recruited in 1 month. 420 samples to be investigated within 1 year.

16 Workflow Quality control Dilution Digestion POOLIN G

17 Pooling Poo 1 l patients

18 reads on target (%) Reads «on target» 100,00% 90,00% A1 B1 C1 D1 E1 F1 G1 H1 A2 B2 C2 D2 E2 F2 G2 H2 Pools

19 Pooling Poo 1 l patients

20 Control mutations A heterozygous mutation in one sample of a pool: 1/32 alleles= 3.12% of reads

21 Genes Coordinates Known Variants % pool mutation % other pool DYSF chr2: c.4024 C>T R1342W DYSF chr2: c.2706dupc K903Q fsx4 ANO5 chr11: c.155 A>G N52S ANO5 chr11: c.1640 G>A R547Q EDMD chrx: c. 237_238 insa E80R fsx13 SGCA chr17: c.524 T>C V175A DYSF chr2: c.4200insc I1401H fsx7 SGCA chr17: c.229c>t p. R77C CAPN3 chr15: c.1715 G>A R572Q TRIM32 chr9: c.558 G>C Q186M CAPN3 chr15: c.232 C>A P78T DYSF chr2: c.3059insc P1020P fs X11 DYSF chr2: c.1004 G>C G335A EMD chrx: c. 506_507 delct fsx39 CAPN3 chr15: c. 598_612del F200_L204del DYSF chr2: c.5813_5821del T1938_K1940del SCGA chr17: c.86insa 2,3% 3,1% 1,8% 1,7% 3,7% 3,6% 1,2% 1,0% 1,9% 2,5% 9,0% 9,6% 1,7% 3,6% - - 2,7% 2,3% 2,4% 2,2% 1,6% 1,7% - - 3,0% 3,4% 4,0% 4,5% 0,8% 0,7% 1,5% 1,7% 2,8% 3,7% 0,3% 0,1% 0,9% 0,1% 0,0% 0,4% 0,6% - 0,5% 0,4% 0,0% - 0,2% 0,1% 0,2% 0,0% 0,0%

22 Data analysis MathLab with specific custom algorithms: Replicated in 2 pools coverage: at least 500 x frequency higher than 1.1% the other positions below 0.5% Position T G C A Pool

23 Data analysis MathLab with specific custom algorithms: 107 mutations confirmed by Sanger sequencing. SIFT PolyPhen Mutation Taster dbsnp 100% damaging 36% prob. damaging 32% poss. damaging 53% disease causing 24% listed

24 Data analysis Available tools: GATK, DREEP, CRISP, picall, SNVer, SNAPE, SPLINTER

25 Examples 1-2 Patient X1202 CPK=2,000 UI/L, calf hypertrophy, fatigue Possible consanguineity Affected brother Negative sequencing of LGMD2B and LGMD2A genes Negative at CGH array of neuromuscular genes (Motor Chip 3) Patient X843 onset at 35 years CPK=3,000 UI/L Negative sequencing of LGMD2B and GAA genes No FSH allele Negative at CGH array of neuromuscular genes (Motor Chip 3)

26 Our algorythm indicated a putative variation in both pools S69 and S79 X1202 chr11: homozygous ANO5 c.1619_1620 insa wt p.m543n fsx10 in patient X1202

27 Significative variation in both pools S72 and S78 chr11: homozygous ANO5 c.692g>t p.g231v in patient X893 X843 wt

28 NGS applications for the diagnosis of muscular dystrophies Targeted resequencing for the detection of mutations in well-known genes: rapid, effective and «scalable». Exome resequencing to identify novel causative genes; Targeted RNA sequencing for the detection and characterization of mutational effects on mrna expression and on its splicing.

29 Conclusions Preliminary results confirm the high heterogeneity of muscular dystrophies; Analytic procedures, based on NGS, are ready for their diagnostic use.

30 Acknowledgements Seconda Università di Napoli, Patologia Generale Prof. Vincenzo Nigro Giuseppina Di Fruscio, Teresa Giugliano, Michele Iacomino, Annalaura Torella, Arcomaria Garofalo, Cristina Pisano, Francesca Del Vecchio Blanco, Giulio Piluso TIGEM Margherita Mutarelli, Veer Singh Marwah, Manuela Dionisi CNR, Napoli Mario Guarracino, Maria Brigida Ferraro Italian LGMD network (coordinated by Giacomo Comi)

31 Thanks to: Mario Guarracino ICAR-CNR Margherita Mutarelli TIGEM-Bionformatic core Prof. Vincenzo Nigro Giuseppina Di Fruscio, Teresa Giugliano, Michele Iacomino, Annalaura Torella, Manuela Dionisi, Francesca Del Vecchio Blanco, Giulio Piluso

32 HaloPlex workflow 1. Digest and denature sample DNA 2. Hybridize oligonucleotide probe library 3. Purify and ligate targets 4. Amplify targeted fragments with PCR

33 Motor HaloPlex genes involved in neuromuscular disorders (muscular dystrophies, congenital myopathies, myotonic syndromes, ion channel muscle diseases, metabolic myopathies); 2,447 target regions corrisponding to 486,480 bp 98.7% coverage inside target regions 420 samples to be investigated within 1 year

34 NGS for genetic diagnosis Easy analytic pipeline; High specificity and sensitivity; Timing; Ethical issues.

35 Conclusions All the procedure is rapid, effective and «scalable», perfect for a diagnostic screening. Coverage is very high if compared to other publisched data. Control mutations have been correctly identified.

36 Applicazioni di nuova generazione per la diagnosi genetica di distrofie muscolari Exome resequencing per l identificazione di nuovi geni; Targeted resequencing per la diagnosi di mutazioni nei geni noti; Targeted RNA sequencing per l individuazione e la caratterizzazione dell effetto di mutazioni sull espressione e lo splicing dell mrna. Motor Chip Enhancer Chip

37 ANO5 Ereditarietà autosomica recessiva Asimmetria dei muscoli coinvolti Muscoli coinvolti: quadricipiti, bicipiti, i gastrocnemi.

38 ANO5: mutazioni identificate Paziente X843; Esordio a 35 anni; CK=3000 UI/L; Analizzato per la LGMD2B (DYSF), FSHD e Pompe disease (GAA); Giunto inizialmente per «Motor Chip».

39 chr11: X843 (PoolS72 PoolS78) ANO5 c.692g>t p.g231v X843 wt

40 ANO5: mutazioni identificate Paziente X1202; CPK=2000 UI/L, salienza dei polpacci e facile stancabilità; Probabile consanguineità tra i genitori; Fratello con iperckemia e sintomatologia simile al probando; Analizzato per la LGMD2B (DYSF).

41 Conclusioni (2) Occorre opportunamente mappare le regioni non coperte o con copertura insufficiente. E in corso l analisi bionformatica dei dati e la validazione del sistema di «pooling».

42 Obiettivi futuri Identificazione mutazioni già descritte e nuove (con caratterizzazione di queste ultime). Correlazione fenotipo/genotipo.

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling

Dettagli

Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

Diagnosi prenatale invasiva: presente e futuro

Diagnosi prenatale invasiva: presente e futuro Diagnosi prenatale invasiva: presente e futuro Gianluigi Pilu GynePro Medical Group Bologna, Italy www.gynepro.it Sintesi Frequenza delle anomalie cromosomiche I rischi delle diagnosi invasive Diagnosi

Dettagli

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi

Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi Marco Seri (sottotitolo preso in prestito dal Prof. R.

Dettagli

Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O.

Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O. Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O. Ospedali Galliera XVIII Congresso Nazionale Associazione Gulliver Monza 08 marzo

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance

Dettagli

IL NODULO ALLA MAMMELLA

IL NODULO ALLA MAMMELLA IL NODULO ALLA MAMMELLA SCUOLA REGIONALE DI FORMAZIONE SPECIFICA IN MEDICINA GENERALE 18.04.2012 Giancarlo Bisagni Dipartimento di Oncologia SERVIZIO SANITARIO REGIONALE EMILIA-ROMAGNA AZIENDA OSPEDALIERA

Dettagli

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance in Man EntrezGene curated sequence and descriptive information about genetic loci GenCards HGMD dbsnp database of human genes,

Dettagli

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS DIRECT SEQUENCING TTCACTGAGAGTCGC TCCCAATAAAAGTGACTCTCAGCGAGC TTCACTGAGAGTCGG TCCCAATAAAAGTGACTCTCAGCCAGC wt mut wt wt/mut mut The Sanger method 07_01.jpg

Dettagli

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Watson & Crick DNA 1953 Tappe della GENETICA UMANA G. Mendel leggi dell

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Biotecnologie Mediche Prevenzione Diagnostica

Dettagli

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

SCHEDA DEL DOCENTE - CV

SCHEDA DEL DOCENTE - CV Studi di Cagliari Corso di laurea INFORMAZIONI ANAGRAFICHE Nome: FEDERICA Cognome: INCANI Nato a:cagliari Il 19/10/1975 Indirizzo di Residenza: VIA BERNINI 6 CAGLIARI Tel.: Mail: feincani@yahoo.it Cell.:3284494008

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

RICERCA TRASNAZIONALE e TRASLAZIONALE

RICERCA TRASNAZIONALE e TRASLAZIONALE Roma, 3 dicembre 2012 RICERCA TRASNAZIONALE e TRASLAZIONALE Gianluca Gaidano, M.D., Ph.D Division of Hematology Department of Translational Medicine Amedeo Avogadro University of Eastern Piedmont Novara-Italy

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Settori Applicativi Field of Application

Settori Applicativi Field of Application ERIMAKI Brochure_23 Luglio_okDEFINITIVO_Layout 1 23/07/12 12.51 Pagina 1 Settori Applicativi Field of Application Trattamento Plastica Plastic treatment Legno e Vetro Wood and glass Stoccaggio Storage

Dettagli

Le distrofie muscolari

Le distrofie muscolari Le distrofie muscolari Maurizio Moggio UOD Malattie Neuromuscolari e Rare Fondazione IRCCS Ca Granda Ospedale Maggiore Policlinico Milano 34 Congresso Nazionale di Antibioticoterapia in età pediatrica

Dettagli

Rischio genetico delle neoplasie mammarie e correttezza del counselling Laura Cortesi

Rischio genetico delle neoplasie mammarie e correttezza del counselling Laura Cortesi Rischio genetico delle neoplasie mammarie e correttezza del counselling Laura Cortesi Programma di Epidemiologia e Prevenzione Oncologica (Responsabile Prof. M.Federico) Università di Modena e Reggio Emilia

Dettagli

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY) http://www.molecularstation.com/molecular-biology-images/data/502/human-genome-gene.png

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

We take care of your buildings

We take care of your buildings We take care of your buildings Che cos è il Building Management Il Building Management è una disciplina di derivazione anglosassone, che individua un edificio come un entità che necessita di un insieme

Dettagli

Malattia di Pompe. Inquadramento clinico. Dr. S. Zoccolella

Malattia di Pompe. Inquadramento clinico. Dr. S. Zoccolella Malattia di Pompe Inquadramento clinico Dr. S. Zoccolella Malattia di Pompe Estrema variabilità in termini di: Età d esordio Sede d esordio e quadro clinico Progressione/prognosi Malattia di Pompe Forma

Dettagli

MALATTIA TROMBOEMBOLICA VENOSA 2014 : NUOVI FARMACI = NUOVI PERCORSI? Rino Migliacci

MALATTIA TROMBOEMBOLICA VENOSA 2014 : NUOVI FARMACI = NUOVI PERCORSI? Rino Migliacci MALATTIA TROMBOEMBOLICA VENOSA 2014 : NUOVI FARMACI = NUOVI PERCORSI? Rino Migliacci Choice of Initial Anticoagulant Regimen in Patients With Proximal DVT In patients with acute DVT of the leg, we

Dettagli

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica Corso postcongressuale XV congresso SIGU Come refertare e comunicare varianti genomiche Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla

Dettagli

Prospettive e funzioni dell Informatica avanzata nel settore delle biotecnologie

Prospettive e funzioni dell Informatica avanzata nel settore delle biotecnologie Prospettive e funzioni dell Informatica avanzata nel settore delle biotecnologie Roberta Gioia Celano Auditorium 20 November 2014 Company profile Ylichron, Spin Off dell ENEA, è stata costituita nel 2005

Dettagli

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM ALLEGATO 2 FULL PROJECT FORM FORM 1 FORM 1 General information about the project PROJECT SCIENTIFIC COORDINATOR TITLE OF THE PROJECT (max 90 characters) TOTAL BUDGET OF THE PROJECT FUNDING REQUIRED TO

Dettagli

ENPCOM European network for the promotion of the Covenant of Mayors

ENPCOM European network for the promotion of the Covenant of Mayors ENPCOM European network for the promotion of the Covenant of Mayors Censimento e monitoraggio dei consumi energetici e comportamento dei cittadini Controllo Energetico dei Consumi degli Edifici Monitoraggio

Dettagli

GLI ANDAMENTI TEMPORALI DELLA PATOLOGIA ONCOLOGICA IN ITALIA

GLI ANDAMENTI TEMPORALI DELLA PATOLOGIA ONCOLOGICA IN ITALIA e&p GLI ANDAMENTI TEMPORALI DELLA PATOLOGIA ONCOLOGICA IN ITALIA Linfomi: linfomi di Hodgkin e linfomi non Hodgkin Lymphomas: Hodgkin and non-hodgkin Lymphomas Massimo Federico, 1 Ettore M. S. Conti (

Dettagli

Variabilità dei ceppi di HIV nelle comunità di migranti. Stefano Buttò Istituto Superiore di Sanità

Variabilità dei ceppi di HIV nelle comunità di migranti. Stefano Buttò Istituto Superiore di Sanità Variabilità dei ceppi di HIV nelle comunità di migranti Stefano Buttò Istituto Superiore di Sanità XIII Convegno dell NFP: «Salute e migrazione: nuovi scenari internazionali e nazionali» Istituto Superiore

Dettagli

Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633

Dettagli

Prof. Gustavo Piga EBRD International Master in Public Procurement Management, Director University of Rome Tor Vergata www.gustavopiga.

Prof. Gustavo Piga EBRD International Master in Public Procurement Management, Director University of Rome Tor Vergata www.gustavopiga. Appaltipubblicie professionalità. Il Master BERS-Tor Vergata Public Procurement in EBRD Projects September 26 th 2012 Chamber of Commerce of Trieste Trieste, Italy Prof. Gustavo Piga EBRD International

Dettagli

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale L evoluzione della professione tecnica tra robotica, automazione e nuove tecnologie

Dettagli

La next generation sequencing è entrata nella pratica pediatrica?

La next generation sequencing è entrata nella pratica pediatrica? Aprile-Giugno 2015 Vol. 45 N. 178 Pp. 137-142 Prospettive in Pediatria Frontiere La next generation sequencing è entrata nella pratica pediatrica? Vincenzo Nigro Dipartimento di Biochimica, Biofisica e

Dettagli

DAI TEST GENETICI AL RISCHIO DI MALATTIA

DAI TEST GENETICI AL RISCHIO DI MALATTIA DAI TEST GENETICI AL RISCHIO DI MALATTIA Conosciamo il nostro Genoma Varese, 20 aprile 2013 Elisabetta Lenzini LE TAPPE DELLA 1953 Watson and Crick Struttura del DNA 1956 Tijo e Levan Cariotipo 46 cr 1959

Dettagli

Bruno Meduri. Radioterapia Oncologica - A.O.U. Policlinico di Modena. Associazione Italiana di Radioterapia Oncologica

Bruno Meduri. Radioterapia Oncologica - A.O.U. Policlinico di Modena. Associazione Italiana di Radioterapia Oncologica Bruno Meduri Radioterapia Oncologica - A.O.U. Policlinico di Modena Associazione Italiana di Radioterapia Oncologica Follow up condiviso Il follow-up attivo della donna trattata è parte integrante del

Dettagli

FORMATO EUROPEO PER IL CURRICULUM VITAE

FORMATO EUROPEO PER IL CURRICULUM VITAE Page 1 of 6 FORMATO EUROPEO PER IL CURRICULUM VITAE INFORMAZIONI PERSONALI Nome MUSUMECI OLIMPIA Telefono +39 (090) 221 2757 Fax 0902212789 E-mail OMUSUMECI@UNIME.IT Nazionalità ITALIANA Data di Nascita

Dettagli

Pavia, Giugno 2012. Gualtiero Palareti U.O. di Angiologia e Malattie della Coagulazione Policlinico S. Orsola-Malpighi Bologna

Pavia, Giugno 2012. Gualtiero Palareti U.O. di Angiologia e Malattie della Coagulazione Policlinico S. Orsola-Malpighi Bologna Pavia, Giugno 2012 Gualtiero Palareti U.O. di Angiologia e Malattie della Coagulazione Policlinico S. Orsola-Malpighi Bologna I principali problemi che vedo e il contributo delle ultime LG ACCP Diagnosi

Dettagli

Angelo Maurizio Clerici U.O.C. Neurologia Direttore Prof. Giorgio Bono Ospedale di Circolo e Fondazione Macchi Università degli Studi dell Insubria

Angelo Maurizio Clerici U.O.C. Neurologia Direttore Prof. Giorgio Bono Ospedale di Circolo e Fondazione Macchi Università degli Studi dell Insubria Angelo Maurizio Clerici U.O.C. Neurologia Direttore Prof. Giorgio Bono Ospedale di Circolo e Fondazione Macchi Università degli Studi dell Insubria Disease Oriented-Therapy (if available) Primarily life-prolongation

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

www.gimsi.it Registro GIMSI

www.gimsi.it Registro GIMSI www.gimsi.it Registro GIMSI Registro GIMSI Board: Ammirati if Badami A Brignole M (responsabile progetto) Casagranda I De Seta F Furlan R Registro multicentrico prospettico costituito dai pazienti valutati

Dettagli

star Antighiaccio - Antifrost PATENT PENDING

star Antighiaccio - Antifrost PATENT PENDING Antighiaccio - Antifrost il rubinetto d erogazione a sfera ha riscosso un successo a livello internazionale grazie agli indubbi vantaggi tecnici qualitativi proposti rispetto ai modelli tradizionali. Successo

Dettagli

Curriculum Vitae Europeo

Curriculum Vitae Europeo Curriculum Vitae Europeo Informazioni personali Cognome(i/)/Nome(i) Cittadinanza E-mail Data e luogo di nascita Sesso CF Comi Giacomo Pietro Italiana xxxxxxxxxxxxx xxxxxxxxxxxxx M xxxxxxxxxxxxxxxx Posizione

Dettagli

Sessione IV Ricerca e sviluppo per i programmi di screening

Sessione IV Ricerca e sviluppo per i programmi di screening Sessione IV Ricerca e sviluppo per i programmi di screening o L Adeguamento delle linee-guida dello screening del cervicocarcinoma o I Vaccini anti-hpv e gli Screening o Modelli di interazione tra screening

Dettagli

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Summer School 2015 Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Applicazioni della Next-Generation Sequencing con tecnologia Illumina Roberto Cusano 04-06

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

UNIVERSITÀ DEGLI STUDI DI PAVIA DIPARTIMENTO DI MEDICINA MOLECOLARE

UNIVERSITÀ DEGLI STUDI DI PAVIA DIPARTIMENTO DI MEDICINA MOLECOLARE Attività di Ricerca 2011-2012. Dott.ssa Paola De Filippi JMML (Leucemia Mielomonocitica Govanile). La JMML (OMIM 607785) è una rara forma di disordine clonale mieloproliferativo e mielodisplastico che

Dettagli

Strumenti della Genetica Molecolare Umana (3) Capitoli 6-7-8

Strumenti della Genetica Molecolare Umana (3) Capitoli 6-7-8 Strumenti della Genetica Molecolare Umana (3) Capitoli 6-7-8 PCR allele specifica-arms (equivalente a ASO) Trova applicazione per individuare specifiche e NOTE mutazioni patogene in un sistema che nel

Dettagli

Estendere Lean e Operational Excellence a tutta la Supply Chain

Estendere Lean e Operational Excellence a tutta la Supply Chain Estendere Lean e Operational Excellence a tutta la Supply Chain Prof. Alberto Portioli Staudacher www.lean-excellence.it Dipartimento Ing. Gestionale Politecnico di Milano alberto.portioli@polimi.it Lean

Dettagli

Senato della Repubblica Commissione Igiene e sanità Roma. 19 marzo 2014

Senato della Repubblica Commissione Igiene e sanità Roma. 19 marzo 2014 Riccardo Saccardi, Banca Sangue Placentare Firenze Roberta Destro, Banca Sangue Placentare Padova Michele Santodirocco, Banca Sangue Placentare S. Giovanni Rotondo Senato della Repubblica Commissione Igiene

Dettagli

How to use volunteers' inspections to set priorities for the management of hydraulic structures? (Check dams in mountain basins)

How to use volunteers' inspections to set priorities for the management of hydraulic structures? (Check dams in mountain basins) How to use volunteers' inspections to set priorities for the management of hydraulic structures? (Check dams in mountain basins) V. Juliette Cortes1, Simone Sterlacchini2, Thom Bogaard3, Simone Frigerio1,

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

PROSPETTO DEI SERVIZI PUBBLICITARI OFFERTI DA JULIET ART MAGAZINE CLIENT SPECS FOR JULIET ART MAGAZINE ADVERTISING SERVICES

PROSPETTO DEI SERVIZI PUBBLICITARI OFFERTI DA JULIET ART MAGAZINE CLIENT SPECS FOR JULIET ART MAGAZINE ADVERTISING SERVICES Juliet Art Magazine è una rivista fondata nel 1980 e dedicata all arte contemporanea in tutte le sue espressioni. Dal 2012, è anche e una rivista online con contenuti indipendenti. Juliet Art Magazine

Dettagli

HTA e screening. Paolo Giorgi Rossi AUSL Reggio Emilia

HTA e screening. Paolo Giorgi Rossi AUSL Reggio Emilia HTA e screening Paolo Giorgi Rossi AUSL Reggio Emilia L Aquila 20 Giugno 2012 Perchè? Obiettivi di un Sistema Sanitario Dare una risposta alle aspettative dei cittadini fornendo servizi di altà qualità

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013 La sindrome di Lynch Cancro colonrettale ereditario non poliposico o HNPCC G. A. Pablo Cirrone 1 Caratteristiche generali I HNPCC (Hereditary Non-Polyposis Colonrectal Cancer) è caratterizzato dalla comparsa,

Dettagli

NORME E GUIDE TECNICHE PROGRAMMA DI LAVORO PER INCHIESTE PRELIMINARI TECHNICAL STANDARDS AND GUIDES PROGRAMME OF WORKS FOR PRELIMINAR ENQUIRY

NORME E GUIDE TECNICHE PROGRAMMA DI LAVORO PER INCHIESTE PRELIMINARI TECHNICAL STANDARDS AND GUIDES PROGRAMME OF WORKS FOR PRELIMINAR ENQUIRY NORME E GUIDE TECNICHE PROGRAMMA DI LAVORO PER INCHIESTE PRELIMINARI TECHNICAL STANDARDS AND GUIDES PROGRAMME OF WORKS FOR PRELIMINAR ENQUIRY Il presente documento viene diffuso attraverso il sito del

Dettagli

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015 Next Generation Sequencers: from the bacterial culture to raw data Valeria Michelacci NGS course, June 2015 COSTS ASSOCIATED WITH DNA SEQUENCING 80-100 $ per Bacterial Genome!! Benefits from NGS Massive

Dettagli

Monitoring healthcare in Regione Liguria

Monitoring healthcare in Regione Liguria Regione Liguria Monitoring healthcare in Regione Liguria One Conference - Turin, may 30 th 2012 Piergiulio Maryni The strategy Three-year plan for the Ligurian Information Society Healthcare Section Defines

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

Il donatore di emocomponenti e di cellule staminali emopoietiche: attualità e prospettive Compatibilità nel trapianto di CSE e sistema HLA

Il donatore di emocomponenti e di cellule staminali emopoietiche: attualità e prospettive Compatibilità nel trapianto di CSE e sistema HLA Il donatore di emocomponenti e di cellule staminali emopoietiche: attualità e prospettive Compatibilità nel trapianto di CSE e sistema HLA Nicoletta Sacchi Italian Bone Marrow Donor Registry E.O. Ospedali

Dettagli

GstarCAD 2010 Features

GstarCAD 2010 Features GstarCAD 2010 Features Unrivaled Compatibility with AutoCAD-Without data loss&re-learning cost Support AutoCAD R2.5~2010 GstarCAD 2010 uses the latest ODA library and can open AutoCAD R2.5~2010 DWG file.

Dettagli

Università degli Studi di Ferrara

Università degli Studi di Ferrara Università degli Studi di Ferrara DOTTORATO DI RICERCA IN FARMACOLOGIA E ONCOLOGIA MOLECOLARE INDIRIZZO ONCOLOGICO XXV CICLO STUDIO DELL ESOMA MEDIANTE TECNOLOGIE DI GENOTIPIZZAZIONE AD ALTA EFFICIENZA:

Dettagli

La Genomica in Sanità Pubblica I Convegno Siciliano

La Genomica in Sanità Pubblica I Convegno Siciliano La Genomica in Sanità Pubblica I Convegno Siciliano Catania, 18 Dicembre 2014 Nuove tecnologiche nella genomica in sanità pubblica Marco Fichera Università di Catania A.O.U. Policlinico V.E. Catania 1

Dettagli

Bioinformatica (modulo bioinf. dei genomi moderni )

Bioinformatica (modulo bioinf. dei genomi moderni ) Bioinformatica (modulo bioinf. dei genomi moderni ) Dr. Marco Fondi Lezione # 5 Corso di Laurea in Scienze Biologiche, AA 2011-2012 giovedì 3 novembre 2011 1 Sequenziamento ed analisi di genomi: la genomica

Dettagli

A dissertation submitted to ETH ZURICH. for the degree of Doctor of Sciences. presented by DAVIDE MERCURIO

A dissertation submitted to ETH ZURICH. for the degree of Doctor of Sciences. presented by DAVIDE MERCURIO DISS. ETH NO. 19321 DISCRETE DYNAMIC EVENT TREE MODELING AND ANALYSIS OF NUCLEAR POWER PLANT CREWS FOR SAFETY ASSESSMENT A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented

Dettagli

La Consulenza Genetica nella prospettiva della medicina predittiva

La Consulenza Genetica nella prospettiva della medicina predittiva La Consulenza Genetica nella prospettiva della medicina predittiva Dr.ssa Licia Turolla U.O. di Genetica Medica ASL n. 9 del Veneto - Treviso www.ulss.tv.it/genetica medica I test genomici predittivi Treviso,

Dettagli

Aggiornamento dispositivo di firma digitale

Aggiornamento dispositivo di firma digitale Aggiornamento dispositivo di firma digitale Updating digital signature device Questo documento ha il compito di descrivere, passo per passo, il processo di aggiornamento manuale del dispositivo di firma

Dettagli

ISAC. Company Profile

ISAC. Company Profile ISAC Company Profile ISAC, all that technology can do. L azienda ISAC nasce nel 1994, quando professionisti con una grande esperienza nel settore si uniscono, e creano un team di lavoro con l obiettivo

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

La vita in gioco ed il gioco della vita. dell adolescente e psicopatologia)

La vita in gioco ed il gioco della vita. dell adolescente e psicopatologia) La vita in gioco ed il gioco della vita (comportamenti ti estremi dell adolescente e psicopatologia) p M. Vaggi Dipartimento Salute Mentale e Dipendenze Dipartimento Salute Mentale e Dipendenze ASL 3 Genovese

Dettagli

PAZIENTI CON DEMENZA E LORO CAREGIVER Progetto Sperimentale: dati preliminari

PAZIENTI CON DEMENZA E LORO CAREGIVER Progetto Sperimentale: dati preliminari VI Convegno IL CONTRIBUTO DELLE UNITA DI VALUTAZIONE ALZHEIMER (UVA)NELL ASSISTENZA DEI PAZIENTI CON DEMENZA Roma 16 novembre 2012 ASSISTENZA DOMICILIARE INTEGRATA ADI PER PAZIENTI CON DEMENZA E LORO CAREGIVER

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

PGD for single gene diseases. PGD per malattie monogeniche

PGD for single gene diseases. PGD per malattie monogeniche PGD for single gene diseases PGD per malattie monogeniche monogenic@tomalab.com In partnership con: Via F. Ferrer 25/27-21052 Busto Arsizio (VA) - Italy Tel +39 0331 652911 - Fax +39 0331 652919 - www.tomalab.com

Dettagli

Martedì dell Ordine 15 Aprile 2014. Laboratorio di Elettrofisiologia ed Elettrostimolazione, U.O. Cardiologia, A.O.U. di Parma

Martedì dell Ordine 15 Aprile 2014. Laboratorio di Elettrofisiologia ed Elettrostimolazione, U.O. Cardiologia, A.O.U. di Parma Diagnosi e Terapia delle Aritmie Cardiache: Ablazione transcatetere endoepicardica di Tachicardia Ventricolare in paziente con Malattia di Anderson-Fabry Martedì dell Ordine 15 Aprile 2014 Laboratorio

Dettagli

PROGETTO parte di Programma Strategico

PROGETTO parte di Programma Strategico ALLEGATO B1 PROGETTO parte di Programma Strategico FORM 1 FORM 1 General information about the project INSTITUTION PRESENTING THE STRATEGIC PROGRAM (DESTINATARIO ISTITUZIONALE PROPONENTE): TITLE OF THE

Dettagli

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV ADULTS AND CHILDREN ESTIMATED TO BE LIVING WITH HIV/AIDS,

Dettagli

Stem Cells. Medicine Biology. Bioethics

Stem Cells. Medicine Biology. Bioethics Stem Cells Medicine Biology Bioethics Dal DNA all organismo complesso Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico

Dettagli

Relazione autonoma del paziente: questionario di registrazione medica (II) Il registro internazionale delle disferlinopatie

Relazione autonoma del paziente: questionario di registrazione medica (II) Il registro internazionale delle disferlinopatie Il registro internazionale delle disferlinopatie Questionario II Pagina 1 / 8 Relazione autonoma del paziente: questionario di registrazione medica (II) Il registro internazionale delle disferlinopatie

Dettagli

Bell, Nature 421: 414, 2003. Tratta da lezioni di genetica Prof. PF Pignatti

Bell, Nature 421: 414, 2003. Tratta da lezioni di genetica Prof. PF Pignatti La scoperta della doppia elica mezzo secolo fa ha coinvolto la pratica medica con lentezza, ma sono probabili trasformazioni significative nei prossimi 50 anni. Bisogna cambiare la pratica medica e la

Dettagli

IL PERCORSO DI AMD PER LA MEDICINA DI GENERE: dalle differenze di genere alle pari opportunità

IL PERCORSO DI AMD PER LA MEDICINA DI GENERE: dalle differenze di genere alle pari opportunità 1 Giornata Nazionale del Gruppo Donna IL PERCORSO DI AMD PER LA MEDICINA DI GENERE: dalle differenze di genere alle pari opportunità Olbia, 16 e 17 marzo 2012 Mercure Olbia Hermaea Il Gruppo Donna di AMD:

Dettagli

A free and stand-alone tool integrating geospatial workflows to evaluate sediment connectivity in alpine catchments

A free and stand-alone tool integrating geospatial workflows to evaluate sediment connectivity in alpine catchments A free and stand-alone tool integrating geospatial workflows to evaluate sediment connectivity in alpine catchments S. Crema, L. Schenato, B. Goldin, L. Marchi, M. Cavalli CNR-IRPI Outline The evaluation

Dettagli

Zippo LED LAMPS - VANTAGGI

Zippo LED LAMPS - VANTAGGI WWW.ZPPOWEB.COM SPECFCHE TECNCHE TECHNCAL CHARACTERSTCS Nel confronto con le lampadine a incandescenza, la lampada a LED permette i piu elevati risparmi sull energia elettrica visti fino ad ora, senza

Dettagli

UNIVERSITÀ DEGLI STUDI DI TORINO. Instructions to apply for exams ONLINE Version 01 updated on 17/11/2014

UNIVERSITÀ DEGLI STUDI DI TORINO. Instructions to apply for exams ONLINE Version 01 updated on 17/11/2014 Instructions to apply for exams ONLINE Version 01 updated on 17/11/2014 Didactic offer Incoming students 2014/2015 can take exams of courses scheduled in the a.y. 2014/2015 and offered by the Department

Dettagli

Lezione 5. Next Generation Sequencing

Lezione 5. Next Generation Sequencing Lezione 5 Next Generation Sequencing Perchè Next Generation Sequencing Si possono generare centinaia di milioni di corte sequenze (35bp-250bp) in una sola corsa in un tempo breve con un basso prezzo per

Dettagli

CONTROVERSIE IN TEMA DI MANAGEMENT DEL PAZIENTE CON MRGE. USO ed ABUSO dei TEST DIAGNOSTICI

CONTROVERSIE IN TEMA DI MANAGEMENT DEL PAZIENTE CON MRGE. USO ed ABUSO dei TEST DIAGNOSTICI CONTROVERSIE IN TEMA DI MANAGEMENT DEL PAZIENTE CON MRGE USO ed ABUSO dei TEST DIAGNOSTICI G.Minoli Como 28 Aprile 2007 Appropriato uso di GASTROSCOPIA ph METRIA ACG Practice Guidelines: Esophageal Reflux

Dettagli

Diagnostica della Malattia di Pompe (Glicogenosi tipo II)

Diagnostica della Malattia di Pompe (Glicogenosi tipo II) Diagnostica della Malattia di Pompe (Glicogenosi tipo II) Dott.ssa Angela Amati Servizio di Neurofisiopatologia Azienda Ospedaliera-Universitaria Policlinico di Bari ESAMI DI LABORATORIO Dosaggio del CK

Dettagli

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

ENVIRONMENTAL CONTROL & LEAK DETECTION SYSTEM

ENVIRONMENTAL CONTROL & LEAK DETECTION SYSTEM ENVIRONMENTAL CONTROL & LEAK DETECTION SYSTEM YEAR: 2011 CUSTOMER: THE PROJECT Il Progetto S.E.I.C. developed the Environmental Control & Leak Detection System (ecolds) for Ferrara-Ravenna Pipeline located

Dettagli

Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini

Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini Analisi del genoma umano: possibilità e limiti Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini What is DNA? It's a history book - a narrative of the journey of our species

Dettagli

Lezioni di genetica medica. Specializzazioni 2014

Lezioni di genetica medica. Specializzazioni 2014 Lezioni di genetica medica Specializzazioni 2014 Programma, parte 1 genetica umana generale Il genoma umano: geni ed organizzazione Next generation sequencing (NGS), l'exoma Eterogeneità clinica ed eterogeneità

Dettagli

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione in campo medico e biotecnologico Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione delle sequenze di acido nucleico Elena Comoglio Jacobacci & Partners S.p.A. Brevetti

Dettagli