Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi"

Transcript

1 Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi Marco Seri (sottotitolo preso in prestito dal Prof. R. Hennekam: Next Generation Sequencing needs Next Generation Clinicians!)

2 Genetica Clinica L introduzione delle tecnologie avanzate stanno cambiando l approccio allo studio delle malattie genetiche mendeliane e conseguentemente anche l atteggiamento del genetista clinico.

3 Clinici di nuova generazione La Genetica Clinica sta diventando il nucleo di questo cambiamento, mettendo assieme le innovazioni tecnologiche e la ricerca alle competenze cliniche Proprio per questo il compito del Genetista Clinico non è mai stato così complesso come oggi: non è cosa semplice trasferire a livello clinico l enorme quantità di informazioni provenienti dall attività di ricerca.

4

5 MENDELIAN INHERITANCE IN MAN ( MIM ) 1^ edizione 1966: 1500 voci oggi: >20000 Dal 1998: solo in forma elettronica OMIM: On-lineMIM

6

7

8 Genetic Medicine Paradigm DNA RNA Modified Proteins Proteins Biological Function Y Y Transcription Genes Translation Post-Translation Modification > 1,000,000 Proteins Information: Critical to Understanding Disease Mechanisms

9 Geni e malattie: una nuova dimensione sano Malattia monofattoriale normale Variazione 1: Mutazione Variazione 2: polimorfismo Sano, ma con una proteina che funziona di più o di meno: suscettibilità

10

11 NGS DNA SEQUENCING EXPERIMENTAL DESIGNS TARGETED REGION TARGETED GENES WHOLE EXOME WHOLE GENOME X EXOME

12 Next Generation Sequencing e sue possibili applicazioni in campo clinico

13 NGS per Diagnostica

14 Eterogeneità Genetica Il concetto classico di Eterogeneità genetica implica il fatto che la stessa condizione può essere causata da mutazioni in geni differenti e questo sta divenendo un problema consistente in Genetica Medica Per alcune malattie il grado di eterogeneità genetica è tale che ci sono più di 100 geni che possono causare la stessa malattia

15 La Retinite Pigmentosa (RP) è un gruppo eterogeneo di malattie ereditarie caratterizzato dalla progressiva perdita della vista, cecità notturna e depositi di pigmento nella retina.

16

17 NGS per Ricerca

18 Geography of exome sequencing Schinzel-Giedion N a tg e n e t A pr 1 0 Miller syndrome Na t G e ne t N ov 0 9 HPMR N a tg e n e t A u g 1 0 Kabuki syndrome N a tg e n e t A ug 1 0 DFNB82 A m J H u m G e n e t J un 1 0 Perrault syndrome A m J Hu m G e n e t J ul 1 0 Brain Malformation N a tu re A u g 1 0

19 UNITED WE STAND

20 DE NOVO

21 COMPOUND HETEROZYGOSITY

22 HOMOZYGOSITY

23 Sindromi malformative

24

25 Malattie Mendeliane non Sindromiche

26 FA2H causes SPG35 and leukodystrophy

27 Two affected sibs from a consanguineous family carry a c.270+3a>t mutation in the FA2H gene exon 1 exon 2 L R G E Q Q G S M E N E P V L R G E Q Q V Q P G R G P P

28 Single Nucleotide Variants SNVs Sib1 Sib 2 Validated Transition to transversion ratio In dbsnp (94%) (94%) Heterozygous in dbsnp Homozygous in dbsnp Not in dbsnp 1240 (6%) 1414 (6%) Heterozygous not in dbsnp Homozygous not in dbsnp

29 Candidate variants filtering Cumulative total calls: ROHs in common: 28 No 1000 genomes: 8 NS, in UTRs, SS, nonsense: 28 Cumulative no dbsnps: NS (1 gene) damaging by at least one prediction tool (SNP&GO, Polyphen, SIFT) 1 altering SS by at least one prediction tool (NetGene2, GDB) +1bp del

30 A novel FA2H c.270+3a>t splice site mutation in an Italian consanguineous pedigree

31

32 Malattie legate al cromosoma X

33 TARGETED RESEQUENCING OF X CHROMOSOME EXONS Length (Mb) ~ 150 CCDS entries 1153 RefSeq entries 2036 OMIM loci/genes 716 Agilent SureSelect human X chromosome probes 7664 Probe/CCDS genomic regions overlap 95% Probe/RefSeq genomic regions overlap 94% I II

34 A CASE STUDIED WITH BOTH CLASSICAL AND NEXT GENERATION APPROACHES X-linked recurrence of a previously undescribed neurocutaneous phenotype ndividuals III-2 and III-4: microcephaly, neurodevelopmental delay, ichthyosis, epilepsy, tetraparesis and ACC Male fetus III-3: ACC callosum and hyperkeratosis of epidermis with desquamation at the autoptic examination after voluntary abortion ndividuals I-2, II-2 and II-3: mild ichthyosis limited to the extensor surfaces of Limbs compatible with a balanced chromosome X inactivation pattern

35 POSITIONAL CLONING OF A PAK3 VARIANT. Magini et al., submitted

36 NGS-BASED DETECTION OF A PAK3 VARIANT CHR BAND GEN E hg19 Xp22.31 STS Xp22.12 MAP3K15. Xq13.1 STARD8. Xq23 PAK3 CHANGE SANGER p.l515 P + LINKAG E? - p.p477t + - p.g582fs - - p.k389 N + +

37 NGS per Malattie Complesse Personal Geneticist

38 DISCOVERY STRATEGIES IN COMMON DISEASES

39

40 Patient Family history of vascular disease and early sudden death

41 Challenges Poche conoscenze della genetica da parte del paziente Nonostante l interpretazione corretta del genoma del paziente Un genoma è interpretato secondo le conoscenze attuali Se sono predette per ogni persona circa 100 mutazioni recanti un ipotetico rischio; Se impieghiamo 3 min per disordine occorrono circa 5 ore di consulenza diretta con il paziente. Come acquisire il consenso informato? Come trasferire con successo l informazione dei risultati? Come ricontattare il paziente per i cambiamenti che possono sopravvenire? Chi fa tutto ciò? Chi paga per tutto ciò?

42

43

44

45 Nuovi problemi per vecchie ricette Consulenza genetica asp e t t a ti v e a mi l i a re du b b i sentimenti e t s e i h c ri st o r i a f Obiettivo: Processo di comunicazione bidirezionale Non-direttivo ne o i z a e du c d i e r e d o à t i l i b p r o b a i l i ar i t à fam rischio individuale o pz io n i p r e v en t i ve mettere il paziente in condizione di compiere scelte informate e consapevoli

46 Genetic Counselling discuss the possibility that clinical assessment might uncover high risk of a serious disease, including some for which there is no treatment describe the reproductive implications of heterozygous status for autosomal recessive diseases such as cystic fibrosis, which might not be predictable from family history warn of increases or decreases in genetic risk for common diseases. note that most of the sequence information is difficult to interpret, and discuss error rates and validation processes discuss that risk alleles might be discovered that have reproductive or familial importance rather than personal importance (such as those for breast or ovarian cancer) address the possibility of discrimination on the basis of genetics

Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance

Dettagli

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance in Man EntrezGene curated sequence and descriptive information about genetic loci GenCards HGMD dbsnp database of human genes,

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling

Dettagli

Genetica, malattie rare e contesto familiare

Genetica, malattie rare e contesto familiare XXV Anniversario IRCCS E. Medea La salute del bambino tra genetica e neuroscienze Bosisio Parini, 11 dicembre 2010 Genetica, malattie rare e contesto familiare La genetica negli ultimi 25 anni Sequenziamento

Dettagli

Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini

Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini Analisi del genoma umano: possibilità e limiti Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini What is DNA? It's a history book - a narrative of the journey of our species

Dettagli

Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O.

Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O. Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O. Ospedali Galliera XVIII Congresso Nazionale Associazione Gulliver Monza 08 marzo

Dettagli

Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Biotecnologie Mediche Prevenzione Diagnostica

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA2013/14 Prof Alberto Turco Lezioni 57 e 58 11.12.2013 Test Genetici Storiche date. 1865 1859 1953.momenti memorabili dell impresa intellettuale e scientifica

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY) http://www.molecularstation.com/molecular-biology-images/data/502/human-genome-gene.png

Dettagli

Bruno Meduri. Radioterapia Oncologica - A.O.U. Policlinico di Modena. Associazione Italiana di Radioterapia Oncologica

Bruno Meduri. Radioterapia Oncologica - A.O.U. Policlinico di Modena. Associazione Italiana di Radioterapia Oncologica Bruno Meduri Radioterapia Oncologica - A.O.U. Policlinico di Modena Associazione Italiana di Radioterapia Oncologica Follow up condiviso Il follow-up attivo della donna trattata è parte integrante del

Dettagli

ANALISI DI LINKAGE (CONCATENAZIONE)

ANALISI DI LINKAGE (CONCATENAZIONE) ANALISI DI LINKAGE (CONCATENAZIONE) L analisi di linkage permette di determinare la posizione cromosomica di un locus responsabile di una determinata malattia/carattere genetico rispetto a marcatori polimorfici

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Watson & Crick DNA 1953 Tappe della GENETICA UMANA G. Mendel leggi dell

Dettagli

DAI TEST GENETICI AL RISCHIO DI MALATTIA

DAI TEST GENETICI AL RISCHIO DI MALATTIA DAI TEST GENETICI AL RISCHIO DI MALATTIA Conosciamo il nostro Genoma Varese, 20 aprile 2013 Elisabetta Lenzini LE TAPPE DELLA 1953 Watson and Crick Struttura del DNA 1956 Tijo e Levan Cariotipo 46 cr 1959

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita

Dettagli

RICERCA TRASNAZIONALE e TRASLAZIONALE

RICERCA TRASNAZIONALE e TRASLAZIONALE Roma, 3 dicembre 2012 RICERCA TRASNAZIONALE e TRASLAZIONALE Gianluca Gaidano, M.D., Ph.D Division of Hematology Department of Translational Medicine Amedeo Avogadro University of Eastern Piedmont Novara-Italy

Dettagli

NOVITA NELL INQUADRAMENTO GENETICO

NOVITA NELL INQUADRAMENTO GENETICO NOVITA NELL INQUADRAMENTO GENETICO Dott.ssa Angela Michelucci U.O. Laboratorio di Genetica Medica AOUP Definizione della Discinesia Ciliare Primaria (DCP) Gruppo di condizioni patologiche congenite, eterogenee

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

LUCIO LUZZATO. AIRTUM (Associazione Italiana Registri Tumori) Una vita dedicata alla Ricerca, alla Cultura ed al Dialogo tra popoli

LUCIO LUZZATO. AIRTUM (Associazione Italiana Registri Tumori) Una vita dedicata alla Ricerca, alla Cultura ed al Dialogo tra popoli LUCIO LUZZATO Una vita dedicata alla Ricerca, alla Cultura ed al Dialogo tra popoli AIRTUM (Associazione Italiana Registri Tumori) SABAUDIA, 21-23 Aprile 2010 Maurizio Ponz de Leon Dipartimento di Medicina

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA

Dettagli

SCHEDA DEL DOCENTE - CV

SCHEDA DEL DOCENTE - CV Studi di Cagliari Corso di laurea INFORMAZIONI ANAGRAFICHE Nome: FEDERICA Cognome: INCANI Nato a:cagliari Il 19/10/1975 Indirizzo di Residenza: VIA BERNINI 6 CAGLIARI Tel.: Mail: feincani@yahoo.it Cell.:3284494008

Dettagli

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Ereditarietà delle PSE e counselling genetico Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Paraparesi

Dettagli

Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Biobanca Genetica per Malattie Rare Scheletriche

Biobanca Genetica per Malattie Rare Scheletriche Biobanca Genetica per Malattie Rare Scheletriche Luca Sangiorgi S.S.D. di Genetica Medica e Malattie Rare Ortopediche, Istituto Ortopedico Rizzoli Bologna SSD di Genetica Medica IOR Roma, 25 settembre

Dettagli

SCHEDA INFORMATIVA E MODULO DI CONSENSO INFORMATO PER AMD genetic test 6

SCHEDA INFORMATIVA E MODULO DI CONSENSO INFORMATO PER AMD genetic test 6 SCHEDA INFORMATIVA E MODULO DI CONSENSO INFORMATO PER AMD genetic test 6 Approvato dalla Società Oftalmologica Italiana Luglio 2012 Che cos è un test genetico? Per test genetico si intende l'analisi del

Dettagli

Transmission capacity that is faster. Digital Network (ISDN) at 1.5 or 2.0

Transmission capacity that is faster. Digital Network (ISDN) at 1.5 or 2.0 Next Generation Networking Le tecnologie per l accesso ultrabroadband Università degli Studi di Roma Tor Vergata Villa Mondragone 31 gennaio 2008 05/02/2008 Rocco Casale 1 Quattro rivoluzioni nelle reti

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

La Consulenza Genetica nella prospettiva della medicina predittiva

La Consulenza Genetica nella prospettiva della medicina predittiva La Consulenza Genetica nella prospettiva della medicina predittiva Dr.ssa Licia Turolla U.O. di Genetica Medica ASL n. 9 del Veneto - Treviso www.ulss.tv.it/genetica medica I test genomici predittivi Treviso,

Dettagli

Genetica dell autismo: il percorso diagnostico e le nuove tecnologie di indagine molecolare

Genetica dell autismo: il percorso diagnostico e le nuove tecnologie di indagine molecolare Genetica dell autismo: il percorso diagnostico e le nuove tecnologie di indagine molecolare Dr.Rosario Casalone SSD Genetica Azienda Ospedaliera Universitaria Ospedale di Circolo e Fondazione Macchi Varese

Dettagli

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica Corso postcongressuale XV congresso SIGU Come refertare e comunicare varianti genomiche Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla

Dettagli

E BRIANZA SOLIDALE. AIAS Città di Monza ONLUS Brianza Solidale - 09 novembre 2015 Dott. Gaetano Santonocito

E BRIANZA SOLIDALE. AIAS Città di Monza ONLUS Brianza Solidale - 09 novembre 2015 Dott. Gaetano Santonocito A.I.A.S. E BRIANZA SOLIDALE? MISSION Assistenza sanitaria e sociale a favore delle persone disabili ed in particolare di quelle affette da patologie encefaliche svolgendo ogni possibile azione che miri

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Researchers C Di Pietro Slides http://www.bgbunict.it/ Researchers C Di Pietro Articoli Studenti COSA SONO LE

Dettagli

Jazz e DNA. Paolo Vineis Imperial College London. con Paolo Fresu e Luca Carra

Jazz e DNA. Paolo Vineis Imperial College London. con Paolo Fresu e Luca Carra Jazz e DNA Paolo Vineis Imperial College London con Paolo Fresu e Luca Carra Charlie Parker Qualche notizia sugli avanzamenti della genetica molecolare: - il dogma un gene-una proteina non e piu vero:

Dettagli

"Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là".

Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là. Lentamente muore chi diventa schiavo dell'abitudine, ripetendo ogni giorno gli stessi percorsi, chi non cambia la marca, chi non rischia e cambia colore dei vestiti, chi non parla a chi non conosce. Muore

Dettagli

Paraplegie Spastiche Ereditarie - PSE

Paraplegie Spastiche Ereditarie - PSE LE PARAPLEGIE SPASTICHE EREDITARIE: Una malattia, molti geni e molti ancora da scoprire E. Storti A. Tessa F. M. Santorelli Paraplegie Spastiche Ereditarie - PSE Cos è una paraparesi spastica ereditaria

Dettagli

Verso la terapia personalizzata

Verso la terapia personalizzata Verso la terapia personalizzata M.G.Tibiletti Genetista Ospedale di Circolo-Università dell Insubria Varese Soroptimist Club Varese Varese 20 aprile 2013 Test genetici DIAGNOSTICI PRESINTOMATICI PREDITTIVI,

Dettagli

MOTOR HALOPLEX: AN INNOVATIVE STRATEGY FOR THE MOLECULAR DIAGNOSIS OF MUSCULAR DISEASES MARCO SAVARESE

MOTOR HALOPLEX: AN INNOVATIVE STRATEGY FOR THE MOLECULAR DIAGNOSIS OF MUSCULAR DISEASES MARCO SAVARESE MOTOR HALOPLEX: AN INNOVATIVE STRATEGY FOR THE MOLECULAR DIAGNOSIS OF MUSCULAR DISEASES MARCO SAVARESE SORRENTO, 22/11/2012 Muscular dystrophies Neuromuscular disorders; Progressive loss of motor function.

Dettagli

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS DIRECT SEQUENCING TTCACTGAGAGTCGC TCCCAATAAAAGTGACTCTCAGCGAGC TTCACTGAGAGTCGG TCCCAATAAAAGTGACTCTCAGCCAGC wt mut wt wt/mut mut The Sanger method 07_01.jpg

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

Ruolo della biologia molecolare nel carcinoma ovarico

Ruolo della biologia molecolare nel carcinoma ovarico Carcinoma ovarico avanzato: quali novità per il 2015? Ruolo della biologia molecolare nel carcinoma ovarico Anna Pesci Ospedale SC Don Calabria, Negrar anna.pesci@sacrocuore.it TIPO I TIPO II Basso stadio

Dettagli

RAPPORTO DEL MEDICO DI FAMIGLIA PRIVATE MEDICAL ATTENDANT S REPORT. Compilare in stampatello

RAPPORTO DEL MEDICO DI FAMIGLIA PRIVATE MEDICAL ATTENDANT S REPORT. Compilare in stampatello RAPPORTO DEL MEDICO DI FAMIGLIA PRIVATE MEDICAL ATTENDANT S REPORT Si prega il medico di famiglia di rispondere con accuratezza ad ogni singola domanda The Medical Attendant is requested to take particular

Dettagli

IL NODULO ALLA MAMMELLA

IL NODULO ALLA MAMMELLA IL NODULO ALLA MAMMELLA SCUOLA REGIONALE DI FORMAZIONE SPECIFICA IN MEDICINA GENERALE 18.04.2012 Giancarlo Bisagni Dipartimento di Oncologia SERVIZIO SANITARIO REGIONALE EMILIA-ROMAGNA AZIENDA OSPEDALIERA

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

GENETICA DEL TUMORE DEL COLON-RETTO

GENETICA DEL TUMORE DEL COLON-RETTO GENETICA DEL TUMORE DEL COLON-RETTO EPIDEMIOLOGIA In tutto l'occidente, il cancro del colon-retto occupa, per incidenza, il secondo posto tra i tumori maligni, preceduto dal tumore al polmone nell'uomo

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Lo sviluppo della genetica tra realtà e immaginazione

Lo sviluppo della genetica tra realtà e immaginazione Bruno Dallapiccola Dipartimento di Medicina Sperimentale Sezione di Genetica Medica, Università La Sapienza Istituto CSS-Mendel, Roma Lo sviluppo della genetica tra realtà e immaginazione Geneticization

Dettagli

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in

Dettagli

La predisposizione genetica ai tumori

La predisposizione genetica ai tumori La predisposizione genetica ai tumori Il Cancro è una malattia genetica Il sillogismo aristotelico nell era del DNA Socrate è un uomo. Gli uomini sono mortali. Socrate è mortale. Socrate è mortale. Il

Dettagli

Bruno Dallapiccola. Perché parlare di malattie rare?

Bruno Dallapiccola. Perché parlare di malattie rare? Bruno Dallapiccola Perché parlare di malattie rare? Perché parlare di malattie rare? «La storia ci ha insegnato che una parte significativa delle conoscenze della medicina è stata acquisita attraverso

Dettagli

X-FILES in NUTRIZIONE. CLINICA ed ARTIFICIALE

X-FILES in NUTRIZIONE. CLINICA ed ARTIFICIALE Onconutrizione: La ricerca in chemioprevenzione Ulrich Pfeffer U.O.C. Patologia Molecolare ntegrata RCCS Azienda Ospedaliera Universitaria San Mar6no ST s6tuto Nazionale per la Ricerca sul Cancro La prevenzione

Dettagli

SCREENING PER LA PREVENZIONE DEL TUMORE DELLA MAMMELLA

SCREENING PER LA PREVENZIONE DEL TUMORE DELLA MAMMELLA SCREENING PER LA PREVENZIONE DEL TUMORE DELLA MAMMELLA Controversie sullo screening mammografico: pro e contro Edda Simoncini Breast Unit A.O.Spedali Civili Brescia Spedali Civili di Brescia Azienda Ospedaliera

Dettagli

La next generation sequencing è entrata nella pratica pediatrica?

La next generation sequencing è entrata nella pratica pediatrica? Aprile-Giugno 2015 Vol. 45 N. 178 Pp. 137-142 Prospettive in Pediatria Frontiere La next generation sequencing è entrata nella pratica pediatrica? Vincenzo Nigro Dipartimento di Biochimica, Biofisica e

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

La prevenzione: un piano regionale per la Puglia. Perché?

La prevenzione: un piano regionale per la Puglia. Perché? La prevenzione: un piano regionale per la Puglia. Perché? Rita Fischetto Referente Genetica Clinica U.O.C. Malattie Metaboliche Diabetologia A.O.U. Policlinico-Giovanni XXIII Bari -CRESCITA CONOSCENZE

Dettagli

6. Capacity Building, programma pubblico di interventi

6. Capacity Building, programma pubblico di interventi 6. Capacity Building, programma pubblico di interventi 6.1. Premessa Al fine di rendere più efficaci, efficienti e condivisi gli interventi e le azioni nel settore della Genomica in Sanità Pubblica, è

Dettagli

F O R M A T O E U R O P E O P E R I L INFORMAZIONI PERSONALI DRERA BRUNO ANGELO. Indirizzo Telefono E-mail. Data di nascita ISTRUZIONE E FORMAZIONE

F O R M A T O E U R O P E O P E R I L INFORMAZIONI PERSONALI DRERA BRUNO ANGELO. Indirizzo Telefono E-mail. Data di nascita ISTRUZIONE E FORMAZIONE F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Indirizzo Telefono E-mail Nazionalità Data di nascita DRERA BRUNO ANGELO ITALIANA ISTRUZIONE E FORMAZIONE

Dettagli

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013 La sindrome di Lynch Cancro colonrettale ereditario non poliposico o HNPCC G. A. Pablo Cirrone 1 Caratteristiche generali I HNPCC (Hereditary Non-Polyposis Colonrectal Cancer) è caratterizzato dalla comparsa,

Dettagli

Variazioni del genoma possono determinare:

Variazioni del genoma possono determinare: Variazioni del genoma possono determinare: Insorgenza di malattie genetiche Differente predisposizione a determinate patologie Differente risposta a specifiche terapie Differente risposta a stress ambientali,

Dettagli

FIRST INTERNATIONAL MEETING ON CDKL5 RARE DISEASE

FIRST INTERNATIONAL MEETING ON CDKL5 RARE DISEASE FIRST INTERNATIONAL MEETING ON CDKL5 RARE DISEASE Bologna, Italy April 27-29, 2012 Department of Human and General Physiology, University of Bologna, Piazza di Porta San Donato 2, Bologna Sede del convegno

Dettagli

B R O C H U R E D E I C O R S I

B R O C H U R E D E I C O R S I Scuola di Dottorato in Scienze della Vita e della Salute B R O C H U R E D E I C O R S I Dottorato in Sistemi Complessi per le Scienze della Vita Printed by Campusnet - 24/01/2016 06:15 Indice Indice Giornate

Dettagli

TITOLO DEL PROGETTO DONNE PORTATRICI DI MUTAZIONI NEI GENI BRCA1 E BRCA2: LA PRESA IN CARICO CLINICA E PSICOLOGICA.

TITOLO DEL PROGETTO DONNE PORTATRICI DI MUTAZIONI NEI GENI BRCA1 E BRCA2: LA PRESA IN CARICO CLINICA E PSICOLOGICA. PROGETTO ESECUTIVO PROGRAMMA CCM 2010 TITOLO DEL PROGETTO DONNE PORTATRICI DI MUTAZIONI NEI GENI BRCA1 E BRCA2: LA PRESA IN CARICO CLINICA E PSICOLOGICA. Capo progetto: Monica Zuradelli Dipartimento di

Dettagli

Endpointse disegni di studio nella malattia avanzata: valore clinico Vs valore statistico G. PAPPAGALLO

Endpointse disegni di studio nella malattia avanzata: valore clinico Vs valore statistico G. PAPPAGALLO Endpointse disegni di studio nella malattia avanzata: valore clinico Vs valore statistico G. PAPPAGALLO Endpoint surrogati e outcome nella malattia metastatica Giovanni L. Pappagallo Ufficio di Epidemiologia

Dettagli

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Brian J O Roak1, Pelagia Deriziotis2, Choli Lee1, Laura Vives1, Jerrod J Schwartz1, Santhosh Girirajan1, Emre

Dettagli

FINALITA : evidenziare la. cromosomiche fetali.

FINALITA : evidenziare la. cromosomiche fetali. Il Cariotipo Fetale Molecolare l (array-cgh) Il Cariotipo Fetale e TRADIZIONALE FINALITA : evidenziare la presenza di eventuali anomalie cromosomiche fetali. TECNICA: comporta la coltura delle cellule

Dettagli

Genetica: Lo studio dell eredità

Genetica: Lo studio dell eredità Genetica: Lo studio dell eredità Perché la progenie assomiglia ai genitori? Perché alcuni individui in una popolazione differiscono? Gregor Johann Mendel Austrian Monk, born in what is now Czech Republic

Dettagli

Psicogeriatria e Medicina

Psicogeriatria e Medicina 53 Congresso Nazionale Società Italiana di Gerontologia e Geriatria L Italia? Non è un paese per vecchi Firenze, 29 novembre 2008 Lettura AIP/SIGG Psicogeriatria e Medicina Marco Trabucchi Presidente Associazione

Dettagli

Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI

Dettagli

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente

Dettagli

Tumore della mammella rischio eredo-familiare

Tumore della mammella rischio eredo-familiare Università di Torino Dipartimento di Genetica Biologia e Biochimica barbara pasini Tumore della mammella rischio eredo-familiare problematiche linee guida ipotesi di progetto regionale Tumore della mammella

Dettagli

Il Counselling. Padova, 21 marzo 2016. Dr.ssa Stefania ZOVATO Istituto Oncologico Veneto (IOV) IRCCS Padova SSD Unità per i Tumori Ereditari

Il Counselling. Padova, 21 marzo 2016. Dr.ssa Stefania ZOVATO Istituto Oncologico Veneto (IOV) IRCCS Padova SSD Unità per i Tumori Ereditari Il Counselling Padova, 21 marzo 2016 Dr.ssa Stefania ZOVATO Istituto Oncologico Veneto (IOV) IRCCS Padova SSD Unità per i Tumori Ereditari Punti chiave del counselling Significato Scopo e limiti A chi

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

MALATTIA TROMBOEMBOLICA VENOSA 2014 : NUOVI FARMACI = NUOVI PERCORSI? Rino Migliacci

MALATTIA TROMBOEMBOLICA VENOSA 2014 : NUOVI FARMACI = NUOVI PERCORSI? Rino Migliacci MALATTIA TROMBOEMBOLICA VENOSA 2014 : NUOVI FARMACI = NUOVI PERCORSI? Rino Migliacci Choice of Initial Anticoagulant Regimen in Patients With Proximal DVT In patients with acute DVT of the leg, we

Dettagli

La malattia oligometastatica: clinica o biologia nella strategia terapeutica?

La malattia oligometastatica: clinica o biologia nella strategia terapeutica? La malattia oligometastatica: clinica o biologia nella strategia terapeutica? Lucia Del Mastro SS Sviluppo Terapie Innovative Bergamo 6 luglio 2014 IRCCS Azienda Ospedaliera Universitaria San Martino IST

Dettagli

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni L array-cgh: -riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni -ha un potere si risoluzione 100 volte superiore al cariotipo (100 Kb versus 10 Mb) Microarray-based

Dettagli

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali Milano Marittima 05/06/2010 Dr. Francesco Pigliapoco Lab. Citogenetica A.O.U.-Salesi- Ancona Le sindromi DiGeorge

Dettagli

Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema

Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed Fare clic per modificare lo stile del sottotitolo dello schema La Fondazione Neuromed è un organizzazione relativamente giovane, nata nel

Dettagli

Carta dei Servizi (v.1.4)

Carta dei Servizi (v.1.4) Carta dei Servizi (v.1.4) Cancer Genetic Test Laboratory (CGT Lab) Gentili Signori, Il Laboratorio Cancer Genetic Test (CGT Lab), Servizio di medicina di laboratorio specializzato senza punto di prelievo,

Dettagli

PGD for single gene diseases. PGD per malattie monogeniche

PGD for single gene diseases. PGD per malattie monogeniche PGD for single gene diseases PGD per malattie monogeniche monogenic@tomalab.com In partnership con: Via F. Ferrer 25/27-21052 Busto Arsizio (VA) - Italy Tel +39 0331 652911 - Fax +39 0331 652919 - www.tomalab.com

Dettagli

Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia

Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Lorenzo Morelli Istituto di Microbiologia Facoltà di Agraria UCSC Piacenza In questa presentazione Peculiarità del genoma dei

Dettagli

GENETICA (studio sul cheratocono)

GENETICA (studio sul cheratocono) GENETICA (studio sul cheratocono) Il cheratocono è un difetto visivo, clinicamente e geneticamente, eterogeneo. Esso può presentarsi in forma isolata oppure associato ad altri sintomi clinici tra cui la

Dettagli

Corso Integrato di Genetica e Biologia Molecolare GENETICA

Corso Integrato di Genetica e Biologia Molecolare GENETICA Corso Integrato di Genetica e Biologia Molecolare GENETICA a.a.2015-2016 Pier Franco Pignatti 7.10.2015 Lezioni N. 3 e 4 Ereditarietà mendeliana, malattie autosomiche dominanti (Neri-Genuardi cap.6) Segregazione

Dettagli

Quale ruolo della Psicologia nella crescente domanda di predittività?

Quale ruolo della Psicologia nella crescente domanda di predittività? Quale ruolo della Psicologia nella crescente domanda di predittività? Giovanna Ferrandes S.C. Psicologia Clinica e Psicoterapia Firenze, 11 aprile 2014 Cornelio de Wael (1592-1667) Ospedale di Pammatone

Dettagli

XIII CORSO RESIDENZIALE DALLA DIAGNOSI PRENATALE ALLA TERAPIA POSTNATALE NEFROLOGIA, DIAGNOSI PRENATALE NON INVASIVA, GENOMICA

XIII CORSO RESIDENZIALE DALLA DIAGNOSI PRENATALE ALLA TERAPIA POSTNATALE NEFROLOGIA, DIAGNOSI PRENATALE NON INVASIVA, GENOMICA XIII CORSO RESIDENZIALE DALLA DIAGNOSI PRENATALE ALLA TERAPIA POSTNATALE NEFROLOGIA, DIAGNOSI PRENATALE NON INVASIVA, GENOICA Carrara 23-24 ottobre 2014 Sindrome di Alport Alessandra Renieri U.O. Genetica

Dettagli