Renata Bocciardi DINOGMI - Università degli Studi di Genova U.O.C. Genetica Medica - Istituto G. Gaslini. Genova, 3/02/2015 Teatro della Gioventù

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Renata Bocciardi DINOGMI - Università degli Studi di Genova U.O.C. Genetica Medica - Istituto G. Gaslini. Genova, 3/02/2015 Teatro della Gioventù"


1 1. Do you think genome sequencing will impact on your future life? Give examples of what you would want and what you would not want to happen because of genome sequencing. or 2. How can you explain human complexity when we have so few protein coding genes, e.g. about 5,000 less than a cucumber? Renata Bocciardi DINOGMI - Università degli Studi di Genova U.O.C. Genetica Medica - Istituto G. Gaslini Genova, 3/02/2015 Teatro della Gioventù

2 Do you think genome sequencing will impact on your future life? Che cosa conosciamo del nostro genoma? In che modo possono essere utili queste conoscenze? Chi può avere accesso a queste informazioni e perché? Conoscere o non conoscere? I test genetici al consumatore

3 Cosa sappiamo del nostro genoma? L inizio Alla fine degli anni 90 viene ufficialmente lanciato il Progetto Genoma Umano; nel 2001 viene pubblicata la prima bozza della Sequenza di riferimento del nostro genoma; nel 2003 il Progetto viene considerato ufficialmente concluso Determinare la sequenza di riferimento del Genoma Umano e identificare i geni che lo compongono Depositare ed organizzare i risultati in apposite banche dati Migliorare gli strumenti di analisi Trasferire le tecnologie correlate a questo progetto in altri settori Sequenziare 5 organismi modello (Escherichia coli, Saccharomyces cereviasiae, Caenorhabditis elegans, Drosophila melanogaster, Mus musculus) Affrontare le questioni etiche, legali e sociali connesse alla realizzazione del progetto U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

4 Cosa sappiamo del nostro genoma? L inizio Il Progetto Genoma Umano: Partecipanti Settore Pubblico Consorzio Internazionale per il Progetto Genoma oltre 20 centri di ricerca nel mondo Settore Privato DNA di donatori anonimi Celera di C. Venter Sequ di cloni già mappati DNA di 5 donatori, tra i quali J.C. Venter Sequ di entrambi gli estremi di cloni ancora da mappare James Watson J. Craig Venter Francis Collins

5 Cosa sappiamo del nostro genoma? L inizio Il Progetto Genoma Umano: Risultati The National Center for Biotechnology Information (NCBI) University of California Santa Cruz UCSC Genome Browser ENSEMBL Genome Browser Febbraio 2001

6 Il Progetto Genoma Umano: Risultati Il Genoma Umano contiene ~3 miliardi di basi azotate (A, C, G, T) Mediamente un gene è formato da 3000 basi, ma le dimensioni variano molto. Il più grande gene conosciuto è quello della Distrofina con 2.4 milioni di basi Il numero totale di geni è intorno ai , quindi molto inferiore a quello stimato in precedenza ( ). Circa il 50% dei geni scoperti ha funzione sconosciuta. Meno del 2% del nostro genoma codifica per proteine! Quasi il 99.9% delle basi nucleotidiche è identico in tutti gli individui Sono state identificate variazioni e mutazioni nel nostro DNA (ad es. circa 3 milioni di differenze di una singola base, ovvero polimorfismi o varianti a singolo nucleotide, SNP o SNV) U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

7 Il Progetto Genoma Umano: cosa abbiamo imparato Organismo Dimensioni Genoma (n basi) N di geni stimato Human (Homo sapiens) 3 billion 30,000 Laboratory mouse (M. musculus) 2.6 billion 30,000 Mustard weed (A. thaliana) 100 million 25,000 Roundworm (C. elegans) 97 million 19,000 Fruit fly (D. melanogaster) 137 million 13,000 Yeast (S. cerevisiae) 12.1 million 6,000 Bacterium (E. coli) 4.6 million 3,200 Human immunodeficiency virus (HIV) L uomo è un organismo complesso: stesso numero di geni di organismi più semplici e un numero tre volte superiore di proteine! Ogni gene ha più trascritti (splicing o processamenti alternativi dell RNA)...

8 Il Progetto Genoma Umano: Risultati Il Genoma Umano contiene ~3 miliardi di basi azotate (A, C, G, T) Mediamente un gene è formato da 3000 basi, ma le dimensioni variano molto. Il più grande gene conosciuto è quello della Distrofina con 2.4 milioni di basi Il numero totale di geni è intorno ai , quindi molto inferiore a quello stimato in precedenza ( ). Circa il 50% dei geni scoperti ha funzione sconosciuta. Meno del 2% del nostro genoma codifica per proteine! Quasi il 99.9% delle basi nucleotidiche è identico in tutti gli individui Sono state identificate variazioni e mutazioni nel nostro DNA (ad es. circa 3 milioni di differenze di una singola base, ovvero polimorfismi o varianti a singolo nucleotide, SNP o SNV) U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

9 Esplorare la variabilità tra gli individui: oltre il Progetto Genoma HapMap Project Personal Genome Project Progetto Genoma Umano Variabilità come materia prima per l evoluzione, per la determinazione delle caratteristiche individuali...possibilità di sequenziare l intero genoma di un individuo come enorme risorsa

10 ...dal 2003 ad oggi Sviluppo di nuove tecnologie per il sequenziamento completo del genoma in tempi sempre più brevi (Next Generation Sequencing, NGS o Sequenziamento di Nuova Generazione) e a costi sempre più contenuti

11 Evoluzione dei costi per il sequenziamento del genoma di una persona Topol EJ - Cell 157 (1): , 2014

12 Il Sequenziamento di Nuova Generazione (Next Generation Sequencing, NGS) Preparazione dei campioni per il sequenziamento (Intero genoma, esoma, pannelli di geni selezionati) Tempo macchina Elaborazione dei dati, analisi di qualità, chiamata delle varianti, filtraggi successivi delle varianti, lista varianti candidate in relazione al quesito diagnostico Necessità di un importante infrastruttura informatica

13 Stima della variabilità ereditabile Il numero in continua crescita dei genomi analizzati ci consente di cominciare a stimare la quota di variabilità che ci caratterizza con una precisione sempre maggiore Quasi il 99.9% delle basi nucleotidiche è identico in tutti gli individui Nel genoma di un singolo individuo troviamo circa 3-4 milioni di varianti (SNV) e cambiamenti strutturali di entità diversa (delezioni, inserzioni, inversioni) si trovano in esoni codificanti provocano cambiamenti nella proteina (variazioni non sinonime)... 90% di queste varianti sono cosiddette COMUNI (frequenza >5%). Le restanti sono rare o rarissime, addirittura in alcuni casi si parla di varianti private, ovvero che si trovano soltanto nei membri appartenenti allo stesso gruppo familiare

14 Ma come facciamo a focalizzare l attenzione sulle varianti che VERAMENTE influenzano il fenotipo di una persona, le sue caratteristiche fisiche e comportamentali, la predisposizione alla malattia, la risposta ai farmaci, la risposta all alimentazione... La risposta sarà anche nel nostro DNA, il problema è che bisogna saper porre la domanda e poi saper interpretare la risposta...

15 Quesito diagnostico Ricerca del difetto molecolare alla base di una malattia genetica monogenica o monofattoriale (difetto in un singolo gene = malattia) Selezione dei pazienti Sequenziamento esoma/genoma Filtraggio delle varianti (troppo comuni, riportate in soggettti normali etc) Selezione delle varianti con le caratteristiche opportune in base al tipo di trasmissione della malattia, comuni a più soggetti affetti dalla malattia Verifica della varianti candidate

16 Quesito diagnostico Ricerca del difetto molecolare alla base di una malattia complessa o multifattoriale (più geni coinvolti, contributo dell ambiente difetto = malattia) Selezione dei pazienti e individui di controllo (necessità di grossi numeri) Sequenziamento esoma/genoma Filtraggio delle varianti (comuni, riportate in soggettti normali etc) Selezione delle varianti con le caratteristiche opportune (Varianti comuni, calcolo delle frequenze relative nei controlli e nei pazienti, studio di associazione) Verifica della varianti candidate

17 Quesito diagnostico: nessuno specifico, voglio conoscere il mio genoma...

18 Sequenziamento del genoma individuale: esempi celebri



21 James Watson s genome 342 varianti a carico di geni schedati in Human Gene Mutation Database (HGMD) 32 con mutazioni descritte 12 in geni resposabili di patologie recessive (portatore) Sequenziamento genoma & malattie monogeniche Informazioni riguardanti il nostro stato di portatori di una condizione autosomica recessiva, di una malattia do,minante ad esordio tardivo

22 Sequenziamento genoma & malattie multifattoriali Informazioni riguardanti la nostra eventuale predisposizione a sviluppare malattie multifattoriali (malattie cardiovascolari, neurodegenerative, diabete, condizioni metaboliche etc.), a contrarre infezioni etc

23 James Watson e l ipertensione Mr Watson soffre di ipertensione, condizione molto comune specialmente dopo una certa età... Assume dei farmaci anti-ipertensivi tra i quali dei beta-bloccanti, ma il risultato non è ottimale, la pressione non è sempre sotto controllo, inoltre l assunzione pur necessaria di questi farmaci ha fastidiosi effetti collaterali Con il sequenziamento del suo genoma è stato possibile analizzare lo stato di almeno 6 geni che intervengono nel metabolismo dei farmaci Tra questi Mr Watson è risultato omozigote per una particolare variante del gene CYP2D6, codificante per un enzima che interviene nel metabolismo di numerosi farmaci (beta-bloccanti, anti aritmici, antipsicotci d alcuni anti-depressivi) L allele CYP2D6*1A codifica per un enzima non funzionale Mr Watson è un cosiddetto metabolizzatore lento, è necessario cambiare completamente classe di farmaci

24 Genotipizzazione del gene CYP2D6 metabolizzatori lenti (Poor Metabolizer ): sono pazienti che presentano una mutazione in entrambi gli alleli del gene, cioe presentano due alleli non funzionali del gene CYP2D6 Capacità d attivazione dei farmaci estremamente ridotta o assente, ridotta capacità metabolica per numerosi composti, tenderanno ad accumulare o ad eliminare più lentamente i substrati o i farmaci che sono maggiormente metabolizzati dal CYP2D6, più frequentemente esposti ad effetti indesiderati se trattati con dosi standard di questi composti. metabolizzatori intermedi sono pazienti portatori in eterozigosi di una mutazione, cioe presentano un allele normale del gene CYP2D6 ed uno non funzionale, per conseguire un azione terapeutica ottimale, un dosaggio farmacologico inferiore alla norma. metabolizzatori estesi sono persone dotate di un normale metabolismo farmacologico. metabolizzatori rapidi (Ultra-Metabolizer): sono persone con un aumentata espressione del gene CYP2D6, dovuta alla presenza di tre o più alleli funzionali (*XN), a causa di una duplicazione o multiduplicazione di un allele funzionale. I metabolizzatori rapidi possono richiedere, per un azione terapeutica ottimale, un dosaggio farmacologico superiore alla norma.

25 Sequenziamento genoma & Farmacogenomica* Informazioni utili a predire la risposta individuale ai farmaci, possibilità di terapie mirate e di sviluppo di classi di farmaci che tengano conto di questa variabilità *Farmacogenetica/farmacogenomica ovvero come predire la propria risposta ai farmaci a partire dal nostro profilo genetico


27 Venter s genome

28 Venter s genome La genotipizzazione e l analisi di raggruppamento di 750 SNP unici suggerisce che Mr Venter è per il 99.5% simile ad individui di discendenza Europea Sequenziamento del genoma: le nostre origini & antropologia & evoluzione Attenzione però in genetica parliamo di popolazioni, non esiste alcuna base scientifica e genetica alla categorizzazione delle cosiddette razze

29 Tra l altro, Mr Venter risulta eterozigote per due varianti APOE SNP rs (T/C) e APOC1 SNP rs (A/G) che lo pongono ad alto rischio nella predisposizione allo sviluppo della malattia di Alzheimer ad esordio tardivo (LOAD)

30 Inoltre, Mr Venter è portatore di alcune varianti che potrebbero predisporlo al melanoma ed al altri tumori della pelle

31 Sequenziamento genoma & predisposizione a malattie neurodegenerative (per lo più incurabili allo stato attuale) o a particolari forme di cancro (prevenzione) Inoltre, cominciamo a riflettere Mr Watson ha dato il proprio assenso a che i dati riguardanti il sequenziamento del proprio genoma fossero condivisi pubblicamente, ma ha chiesto esplicitamente che i dati riguardanti alcuni geni le cui varianti potrebbero predire la predisposizione allo sviluppo di malattie neurodegenerative (e in particolare l Alzheimer) fossero eliminati

32 Ampliare e migliorare le capacità diagnostiche nelle malattie, per trattare ove possibile, prevenire... Possibilità di identificare la predisposizione genetica a malattie complesse e condizioni parafisiologiche Possibilità di predire la risposta individuale ai farmaci, all alimentazione, all esercizio fisico/attività sportiva... Possibilità di predire caratteristiche fisiche, fisiologiche, comportamentali U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

33 Sequenziamento del Genoma e medicina personalizzata Ampliare e migliorare le capacitè diagnostiche nelle malattie Topol EJ - Cell 157 (1): , 2014 Possibilità di identificare la predisposizione genetica ad alcune malattie e condizioni parafisiologiche (prevenzione...) Disegnare farmaci personalizzati sulla base del profilo genetico (farmacogenetica e farmacogenomica)

34 Medicina Molecolare Genomica microbica, patologia e ambiente Genetica Forense BioArcheologia, Antropologia, Evoluzione e migrazioni Agricoltura, Allevamento, conservazione delle specie U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

35 Do you think genome sequencing will impact on your future life? Yes, but... Il fatto di essere portatori di una o alcune varianti predisponenti non significa che svilupperemo la data malattia (necessità di altri eventi molecolari, effetto dell ambiente...) In molti casi l associazione di varianti con alcune situazioni patologiche o parafisiologiche non sono state confermate e non ci sono prove biologiche che abbiamo veramente un impatto funzionale Per moltissime varianti non sappiamo che conclusioni trarre... Inoltre...

36 Informazione genetica privata e confidenziale Impatto psicologico, pericolo di stigmatizzazioni e discriminazioni Impatto sulle scelte riproduttive Politiche sanitarie e assistenziali Impatto in sanità pubblica e privata (formazione professionisti, standard di qualità, accesso ai test, utilità dei test) Aspetti sanitari e ambientali (OGM) Aspetti etici, legali e sociali Implicazioni filosofiche, responsabilità Commercializzazione delle tecnologie e dei test. Gestione e accesso ai risultati U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003


38 Il Genetic Information Nondiscrimination Act (anche detto GINA) è una legge adottata dal Congresso degli Stati Uniti che proibisce l'utilizzo di informazioni genetiche nell assicurazione sanitaria e nel contratto di lavoro. Essa vieta di negare la copertura sanitaria ad un individuo sano o di imporgli costi più elevati esclusivamente sulla base di una predisposizione genetica allo sviluppo di una malattia. Vieta inoltre ai datori di lavoro di servirsi di informazioni genetiche di un individuo per assumere, licenziare, trasferire o promuovere il dipendente. I La legge contiene emendamenti all'employee Retirement Income Security del 1974 ed all'internal Revenue Code del Il decreto è passato all'unanimità in Senato (95 a 0), e all'unanimità meno un voto, quello del senatore Ron Paul, alla Camera dei rappresentanti il 24 aprile

39 Quindi...cosa vorresti sapere e cosa no? Immagina di avere fatto sequenziare il tuo genoma Tutti i risultati, nessuno escluso Solo i dati relativi a varianti per le quali c è estesa documentazione scientifica e conferme relativamente al loro valore funzionale, diagnostico, prognostico o predittivo Solo i dati scientificamente sicuri ma relativi a condizioni curabili o per i quali esiste un qualche tipo di intervento...

40 Il genoma a 1000 Euro...i siti per la genomica personalizzata * Cofondatrice Anne Wojcicki, moglie di Sergej Brin, inventore assieme a Larry Page di Google




44 Fine


ETTORE MARRE DIGITAL FOR BUSINESS USO ED ABUSO DEI FARMACI Venerdì 17 aprile 2015 Sala conferenze Digital for Business - Sesto San Giovanni (MI) ETTORE MARRE DIGITAL FOR BUSINESS Appropriatezza prescrittiva e


Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni


20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra


Lo stato dell'arte in Farmacogenetica e Farmacogenomica

Lo stato dell'arte in Farmacogenetica e Farmacogenomica Lo stato dell'arte in Farmacogenetica e Farmacogenomica Maria Cristina Rosatelli Dipartimento di Scienze Biomediche e Biotecnologie Università degli Studi di Cagliari XXXI Congresso nazionale Variabilità


Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la


Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi generali Metodi mirati Scoperta e sviluppo di nuovi



Quotidiano. Quotidiano 097156 Quotidiano 097156 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013


Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY)


Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche


Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini

Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini Analisi del genoma umano: possibilità e limiti Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini What is DNA? It's a history book - a narrative of the journey of our species


Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in


Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Watson & Crick DNA 1953 Tappe della GENETICA UMANA G. Mendel leggi dell


Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle



INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare


A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina



INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare


FINESTRA SUL CORTILE DI SANTA MARIA NUOVA. Genetica Medica. Elisabetta Pelo. SOS Genetica Medica P.O. Santa Maria Nuova

FINESTRA SUL CORTILE DI SANTA MARIA NUOVA. Genetica Medica. Elisabetta Pelo. SOS Genetica Medica P.O. Santa Maria Nuova FINESTRA SUL CORTILE DI SANTA MARIA NUOVA Genetica Medica Elisabetta Pelo SOS Genetica Medica P.O. Santa Maria Nuova Genetica classica: un gene = una malattia Genomica : Sistemi di geni = vie metaboliche


Farmacogenetica e farmacogenomica

Farmacogenetica e farmacogenomica Farmacogenetica e farmacogenomica Variabilità individuale nelle risposte alla terapia farmacologica Efficacia Effetti collaterali / reazioni avverse Variabilità individuale nella efficacia terapeutica


GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente


Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto



UNA RISORSA PER LA RICERCA SCIENTIFICA E PER LA SALUTE DELLA COMUNITA UNA RISORSA PER LA RICERCA SCIENTIFICA E PER LA SALUTE DELLA COMUNITA Progetto realizzato con il contributo di Cos è Trentino Biobank? Trentino Biobank è una struttura della Azienda Provinciale per i Servizi


Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE EREDITA MENDELIANA CLASSICA ~ 600 E C M 10.000 Enzimi


Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa


= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il


Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per


PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Test genetici per evidenziare il rischio di trombolfilia Il Fattore V della coagulazione è un cofattore essenziale per l attivazione della protrombina a trombina. La variante G1691A, definita variante


28-GIU-2015 da pag. 11 foglio 1

28-GIU-2015 da pag. 11 foglio 1 Dati rilevati dagli Enti certificatori o autocertificati Tiratura 04/2015: 218.471 Diffusione 04/2015: 168.074 Lettori I 2015: 889.000 Settimanale - Ed. nazionale Dir. Resp.: Roberto Napoletano 28-GIU-2015



MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso





Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale





Genetica post-mendeliana. Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti

Genetica post-mendeliana. Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti Genetica post-mendeliana Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti DOMINANZA INCOMPLETA GLI IBRIDI F 1 MANIFESTANO UN ASPETTO FENOTIPICO INTERMEDIO RISPETTO ALLE DUE VARIETÀ PARENTALI






EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA



LA DIAGNOSI PRENATALE : PRESENTE E FUTURO LA DIAGNOSI PRENATALE : PRESENTE E FUTURO LA CONSULENZA GENETICA PRENATALE Fare Dr. Renato clic per Scarinci modificare lo stile del sottotitolo dello schema GENETICA CLINICA Costituisce la parte applicativa



CAPITOLO 2 I TRATTI COMPLESSI CAPITOLO 2 I TRATTI COMPLESSI Tratti semplici e tratti complessi Come detto nel capitolo precedente, la genetica classica studia fondamentalmente i cosiddetti tratti mendeliani semplici, quelli in cui,



LA RETE DI GENETICA MEDICA IN EMILIA-ROMAGNA LA RETE DI GENETICA MEDICA IN EMILIA-ROMAGNA A cura del Nucleo di coordinamento per la rete regionale dei servizi di genetica medica dell Emilia-Romagna Con il contributo di Laura Biagetti (Azienda Ospedaliera-Universitaria


La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano

La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano SOC di Farmacologia Sperimentale e Clinica VI CONGRESSO NAZIONALE FITeLab Slow Medicine Laboratory: IT s the Future 1-2-3 Ottobre 2015 Ospedale Borgo Roma (Verona) La farmacogeneticanella gestione del


6 modulo didattico- Le malattie genetiche non mendeliane,

6 modulo didattico- Le malattie genetiche non mendeliane, 6 modulo didattico- Le malattie genetiche non mendeliane, diagnosi e terapia. CLASSIFICAZIONE DELLE MALATTIE GENETICHE Malattie monogeniche ( 1%) Autsomiche dominanti Autosomiche recessive Legate al sesso


II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Seconda Università di Napoli II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Gruppo di studio La Sbobba A cura di dodo e Ely24e 1) Introduzione alla Genetica Medica Pag. 2



MEDICAL DEVICE DAY MIMS13 MEDICAL DEVICE DAY MIMS13 Valentina Cesati Founder Gentras Milano, 12 Settembre 2014 GENTRAS DNA TRACING TECHNOLOGY L IDEA Il SEQUENZIAMENTO DEL GENOMA UMANO ha prodotto una grande mole d informazioni



LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 I Ricercatori del Centro di Genomica e Bioinformatica Traslazionale stanno lavorando a linee di ricerca legate a 1. Sclerosi Multipla 2. Tumore della Prostata


Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio


Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi


Argomenti di Medicina Generale, Biologia, Sanità.

Argomenti di Medicina Generale, Biologia, Sanità. UNI-A.T.E.Ne.O. Ivana Torretta Anno Accademico 11 12 Argomenti di Medicina Generale, Biologia, Sanità. 1. L omeopatia funziona davvero! 2. Ho dolori da tutte le parti. La fibromialgia. 3. La sindrome delle


6. Capacity Building, programma pubblico di interventi

6. Capacity Building, programma pubblico di interventi 6. Capacity Building, programma pubblico di interventi 6.1. Premessa Al fine di rendere più efficaci, efficienti e condivisi gli interventi e le azioni nel settore della Genomica in Sanità Pubblica, è


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione



COSA SONO? PERCHE? A CHI? QUALE?. E UNA VOLTA CHE ARRIVA IL RISULTATO? OS SONO? PERHE? HI? QULE?. E UN VOL HE RRIV IL RISULO??? Di cosa stiamo parlando.. Per test genetici si intendono comunemente le analisi di specifici geni, del loro prodotto o della loro funzione, nonché



STUDI SU MATERIALE GENETICO Istituto Oncologico Veneto Istituto di Ricovero e Cura a Carattere Scientifico Ospedale Busonera I.O.V. ISTITUTO ONCOLOGICO VENETO I.R.C.C.S. STUDI SU MATERIALE GENETICO Comitato Etico Istituto Oncologico



GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel



DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi





Genetica, malattie rare e contesto familiare

Genetica, malattie rare e contesto familiare XXV Anniversario IRCCS E. Medea La salute del bambino tra genetica e neuroscienze Bosisio Parini, 11 dicembre 2010 Genetica, malattie rare e contesto familiare La genetica negli ultimi 25 anni Sequenziamento



ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio


Biotecnologie Mediche. Cinzia Di Pietro 0953782055

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 Biotecnologie Mediche Cinzia Di Pietro 0953782055 Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Biotecnologie Mediche Prevenzione Diagnostica


Gangliosidosi GM1 e GM2

Gangliosidosi GM1 e GM2 Gangliosidosi GM1 e GM2 Le gangliosidosi appartengono ad un gruppo di malattie ereditarie conosciute come Lysosomal Storage Deseases (traducibile come malattie da stoccaggio lisosomale), in cui, a causa


Mappatura genetica. alberi genealogici (pedigree) stima del rischio genetico (counseling) analisi di linkage (lod score) Paolo Edomi - Genetica

Mappatura genetica. alberi genealogici (pedigree) stima del rischio genetico (counseling) analisi di linkage (lod score) Paolo Edomi - Genetica Mappatura genetica alberi genealogici (pedigree) stima del rischio genetico (counseling) analisi di linkage (lod score) Alberi genealogici Simbologia negli alberi genealogici Eredità autosomica recessiva



CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA2013/14 Prof Alberto Turco Lezioni 57 e 58 11.12.2013 Test Genetici Storiche date. 1865 1859 1953.momenti memorabili dell impresa intellettuale e scientifica


Crediti formativi 26 Partecipanti 50

Crediti formativi 26 Partecipanti 50 Corso di aggiornamento PROVIDER NAZIONALE 301 DIAGNOSTICA GENETICA ATTUALITA E PROSPETTIVE IL LABORATORIO DELLA GENETICA FORENSE 2015 Coordinamento scientifico Prof. Maurizio Margaglione Crediti formativi


Istituto Veneto di Scienze, Lettere ed Arti. 15 Marzo 2007

Istituto Veneto di Scienze, Lettere ed Arti. 15 Marzo 2007 Istituto Veneto di Scienze, Lettere ed Arti 15 Marzo 2007 Genoma umano: illusioni, realta, prospettive Giuseppe Borsani Universita' degli Studi di Brescia Il corpo umano e costitutito da circa 100 trilioni



CELIACHIA E TEST HLA RACCOMANDAZIONI CELIACHIA E TEST HLA RACCOMANDAZIONI a cura di Maria Cristina Mazzilli 1 Antonio Calabrò 2 Carlo Catassi 2 Luigi Greco 2 Riccardo Troncone 2 Umberto Volta 2 Valerio Misefari 3 Antonio Amoroso 4 Ettore


Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata


Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2 fenotipo Dominante o recessivo? Scala fenotipica fenotipo A 1 A 1 A 2 A 2 fenotipo A 1 A 2 A 1 dominante A 1 e A 2. codominanti A 2 dominante A 1 dominanza incompleta A 2 dominanza incompleta Nei casi


Ruolo della biologia molecolare nel carcinoma ovarico

Ruolo della biologia molecolare nel carcinoma ovarico Carcinoma ovarico avanzato: quali novità per il 2015? Ruolo della biologia molecolare nel carcinoma ovarico Anna Pesci Ospedale SC Don Calabria, Negrar TIPO I TIPO II Basso stadio


MyGenomics. Obiettivo di questo documento è illustrare il funzionamento e i benefici della analisi genomica

MyGenomics. Obiettivo di questo documento è illustrare il funzionamento e i benefici della analisi genomica Obiettivo di questo documento è illustrare il funzionamento e i benefici della analisi genomica Analisi genomica My Genomics Analisi genomica: scopo conoscere le proprie caratteristiche genetiche sapere


via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 21/02/2011 Progetto di ricerca: Utilizzo di oligonucleotidi antisenso per correggere l effetto di mutazioni di splicing in pazienti


Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI


REPORT FINALE DEL PROGETTO III Controllo di qualità nazionale per la valutazione delle mutazioni di RAS nel carcinoma del colon-retto -2014

REPORT FINALE DEL PROGETTO III Controllo di qualità nazionale per la valutazione delle mutazioni di RAS nel carcinoma del colon-retto -2014 REPORT FINALE DEL PROGETTO III Controllo di qualità nazionale per la valutazione delle mutazioni di RAS nel carcinoma del colon-retto -2014 Il Comitato Scientifico AIOM e SIAPEC-IAP ha organizzato per


PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita


La Genetica. Le leggi di Mendel

La Genetica. Le leggi di Mendel La Genetica Le leggi di Mendel Genetica: scienza che studia la trasmissione dei caratteri ereditari (che si trasmettono di generazione in generazione) Carattere: caratteristica esterna, interna o comportamentale


Test genetici a scopo medico

Test genetici a scopo medico Test genetici a scopo medico Test genetici a scopo medico Tutti abbiamo ereditato dai nostri genitori una combinazione unica di geni. Questa costituzione originale e l influenza di vari fattori ambientali


Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC Genetica umana Ramón Lucas Lucas, LC P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:


Verso la terapia personalizzata

Verso la terapia personalizzata Verso la terapia personalizzata M.G.Tibiletti Genetista Ospedale di Circolo-Università dell Insubria Varese Soroptimist Club Varese Varese 20 aprile 2013 Test genetici DIAGNOSTICI PRESINTOMATICI PREDITTIVI,


Progetto Genoma Umano

Progetto Genoma Umano Progetto Genoma Umano Perché il Progetto Genoma? La determinazione e la conoscenza dell intera sequenza genomica sembrano essere la condizione necessaria per comprendere la completa biologia di un determinato


4 modulo didattico - Modalità di trasmissione delle malattie

4 modulo didattico - Modalità di trasmissione delle malattie 4 modulo didattico - Modalità di trasmissione delle malattie monogeniche. L analisi dell albero genealogico: uno strumento indispensabile della genetica medica I SIMBOLI DELL ALBERO GENEALOGICO L ANEMIA


Che cos è la fibrosi cistica

Che cos è la fibrosi cistica La scoperta del gene responsabile della fibrosi cistica ha permesso la messa a punto di un test genetico per identificare il portatore sano del gene della malattia. Si è aperto quindi un importante dibattito





"Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple VIII Incontro-Convegno A.C.A.R 2006-2016: DIECI ANNI DI A.C.A.R. Montecatini Terme (PT), 16 Aprile 2016 A.C.A.R "Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"


Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica Corso postcongressuale XV congresso SIGU Come refertare e comunicare varianti genomiche Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla



OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata





A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,


Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.



BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...


Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling


Raccolta e analisi di letteratura scientifica su studi genomici di popolazioni umane con riguardo alla condivisione dei dati sperimentali

Raccolta e analisi di letteratura scientifica su studi genomici di popolazioni umane con riguardo alla condivisione dei dati sperimentali DEFINIZIONE DI UNA OPEN ACCESS POLICY PER GLI ISTITUTI SCIENTIFICI Raccolta e analisi di letteratura scientifica su studi genomici di popolazioni umane con riguardo alla condivisione dei dati sperimentali


La genomica nella prospettiva delle cure primarie

La genomica nella prospettiva delle cure primarie La genomica nella prospettiva delle cure primarie Dott. Enrico Ioverno Medico di Medicina Generale SIMG Vicenza Le cure primarie rappresentano il primo livello attraverso il quale gli individui, le famiglie


Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:


Un nuovo tassello per scoprire il lato oscuro del Genoma

Un nuovo tassello per scoprire il lato oscuro del Genoma Roma, 23 febbraio 2015 COMUNICATO STAMPA Un nuovo tassello per scoprire il lato oscuro del Genoma Un team del dipartimento di Biologia e Biotecnologie "Charles Darwin" della Sapienza, coordinato da Patrizio


La prevenzione delle Malattie Rare e la genetica

La prevenzione delle Malattie Rare e la genetica Centro di Riferimento Regionale per le Malattie Rare II Clinica Pediatrica Ospedale Regionale per le Microcitemie La prevenzione delle Malattie Rare e la genetica Dott.ssa Francesca Meloni Dott.ssa Paola





Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina


LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,


Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito


Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza


Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,


I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina


Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Ereditarietà delle PSE e counselling genetico Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Paraparesi
