Renata Bocciardi DINOGMI - Università degli Studi di Genova U.O.C. Genetica Medica - Istituto G. Gaslini. Genova, 3/02/2015 Teatro della Gioventù

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Renata Bocciardi DINOGMI - Università degli Studi di Genova U.O.C. Genetica Medica - Istituto G. Gaslini. Genova, 3/02/2015 Teatro della Gioventù"

Transcript

1 1. Do you think genome sequencing will impact on your future life? Give examples of what you would want and what you would not want to happen because of genome sequencing. or 2. How can you explain human complexity when we have so few protein coding genes, e.g. about 5,000 less than a cucumber? Renata Bocciardi DINOGMI - Università degli Studi di Genova U.O.C. Genetica Medica - Istituto G. Gaslini Genova, 3/02/2015 Teatro della Gioventù

2 Do you think genome sequencing will impact on your future life? Che cosa conosciamo del nostro genoma? In che modo possono essere utili queste conoscenze? Chi può avere accesso a queste informazioni e perché? Conoscere o non conoscere? I test genetici al consumatore

3 Cosa sappiamo del nostro genoma? L inizio Alla fine degli anni 90 viene ufficialmente lanciato il Progetto Genoma Umano; nel 2001 viene pubblicata la prima bozza della Sequenza di riferimento del nostro genoma; nel 2003 il Progetto viene considerato ufficialmente concluso Determinare la sequenza di riferimento del Genoma Umano e identificare i geni che lo compongono Depositare ed organizzare i risultati in apposite banche dati Migliorare gli strumenti di analisi Trasferire le tecnologie correlate a questo progetto in altri settori Sequenziare 5 organismi modello (Escherichia coli, Saccharomyces cereviasiae, Caenorhabditis elegans, Drosophila melanogaster, Mus musculus) Affrontare le questioni etiche, legali e sociali connesse alla realizzazione del progetto U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

4 Cosa sappiamo del nostro genoma? L inizio Il Progetto Genoma Umano: Partecipanti Settore Pubblico Consorzio Internazionale per il Progetto Genoma oltre 20 centri di ricerca nel mondo Settore Privato DNA di donatori anonimi Celera di C. Venter Sequ di cloni già mappati DNA di 5 donatori, tra i quali J.C. Venter Sequ di entrambi gli estremi di cloni ancora da mappare James Watson J. Craig Venter Francis Collins

5 Cosa sappiamo del nostro genoma? L inizio Il Progetto Genoma Umano: Risultati The National Center for Biotechnology Information (NCBI) University of California Santa Cruz UCSC Genome Browser ENSEMBL Genome Browser Febbraio 2001

6 Il Progetto Genoma Umano: Risultati Il Genoma Umano contiene ~3 miliardi di basi azotate (A, C, G, T) Mediamente un gene è formato da 3000 basi, ma le dimensioni variano molto. Il più grande gene conosciuto è quello della Distrofina con 2.4 milioni di basi Il numero totale di geni è intorno ai , quindi molto inferiore a quello stimato in precedenza ( ). Circa il 50% dei geni scoperti ha funzione sconosciuta. Meno del 2% del nostro genoma codifica per proteine! Quasi il 99.9% delle basi nucleotidiche è identico in tutti gli individui Sono state identificate variazioni e mutazioni nel nostro DNA (ad es. circa 3 milioni di differenze di una singola base, ovvero polimorfismi o varianti a singolo nucleotide, SNP o SNV) U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

7 Il Progetto Genoma Umano: cosa abbiamo imparato Organismo Dimensioni Genoma (n basi) N di geni stimato Human (Homo sapiens) 3 billion 30,000 Laboratory mouse (M. musculus) 2.6 billion 30,000 Mustard weed (A. thaliana) 100 million 25,000 Roundworm (C. elegans) 97 million 19,000 Fruit fly (D. melanogaster) 137 million 13,000 Yeast (S. cerevisiae) 12.1 million 6,000 Bacterium (E. coli) 4.6 million 3,200 Human immunodeficiency virus (HIV) L uomo è un organismo complesso: stesso numero di geni di organismi più semplici e un numero tre volte superiore di proteine! Ogni gene ha più trascritti (splicing o processamenti alternativi dell RNA)...

8 Il Progetto Genoma Umano: Risultati Il Genoma Umano contiene ~3 miliardi di basi azotate (A, C, G, T) Mediamente un gene è formato da 3000 basi, ma le dimensioni variano molto. Il più grande gene conosciuto è quello della Distrofina con 2.4 milioni di basi Il numero totale di geni è intorno ai , quindi molto inferiore a quello stimato in precedenza ( ). Circa il 50% dei geni scoperti ha funzione sconosciuta. Meno del 2% del nostro genoma codifica per proteine! Quasi il 99.9% delle basi nucleotidiche è identico in tutti gli individui Sono state identificate variazioni e mutazioni nel nostro DNA (ad es. circa 3 milioni di differenze di una singola base, ovvero polimorfismi o varianti a singolo nucleotide, SNP o SNV) U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

9 Esplorare la variabilità tra gli individui: oltre il Progetto Genoma HapMap Project Personal Genome Project Progetto Genoma Umano Variabilità come materia prima per l evoluzione, per la determinazione delle caratteristiche individuali...possibilità di sequenziare l intero genoma di un individuo come enorme risorsa

10 ...dal 2003 ad oggi Sviluppo di nuove tecnologie per il sequenziamento completo del genoma in tempi sempre più brevi (Next Generation Sequencing, NGS o Sequenziamento di Nuova Generazione) e a costi sempre più contenuti

11 Evoluzione dei costi per il sequenziamento del genoma di una persona Topol EJ - Cell 157 (1): , 2014

12 Il Sequenziamento di Nuova Generazione (Next Generation Sequencing, NGS) Preparazione dei campioni per il sequenziamento (Intero genoma, esoma, pannelli di geni selezionati) Tempo macchina Elaborazione dei dati, analisi di qualità, chiamata delle varianti, filtraggi successivi delle varianti, lista varianti candidate in relazione al quesito diagnostico Necessità di un importante infrastruttura informatica

13 Stima della variabilità ereditabile Il numero in continua crescita dei genomi analizzati ci consente di cominciare a stimare la quota di variabilità che ci caratterizza con una precisione sempre maggiore Quasi il 99.9% delle basi nucleotidiche è identico in tutti gli individui Nel genoma di un singolo individuo troviamo circa 3-4 milioni di varianti (SNV) e cambiamenti strutturali di entità diversa (delezioni, inserzioni, inversioni) si trovano in esoni codificanti provocano cambiamenti nella proteina (variazioni non sinonime)... 90% di queste varianti sono cosiddette COMUNI (frequenza >5%). Le restanti sono rare o rarissime, addirittura in alcuni casi si parla di varianti private, ovvero che si trovano soltanto nei membri appartenenti allo stesso gruppo familiare

14 Ma come facciamo a focalizzare l attenzione sulle varianti che VERAMENTE influenzano il fenotipo di una persona, le sue caratteristiche fisiche e comportamentali, la predisposizione alla malattia, la risposta ai farmaci, la risposta all alimentazione... La risposta sarà anche nel nostro DNA, il problema è che bisogna saper porre la domanda e poi saper interpretare la risposta...

15 Quesito diagnostico Ricerca del difetto molecolare alla base di una malattia genetica monogenica o monofattoriale (difetto in un singolo gene = malattia) Selezione dei pazienti Sequenziamento esoma/genoma Filtraggio delle varianti (troppo comuni, riportate in soggettti normali etc) Selezione delle varianti con le caratteristiche opportune in base al tipo di trasmissione della malattia, comuni a più soggetti affetti dalla malattia Verifica della varianti candidate

16 Quesito diagnostico Ricerca del difetto molecolare alla base di una malattia complessa o multifattoriale (più geni coinvolti, contributo dell ambiente difetto = malattia) Selezione dei pazienti e individui di controllo (necessità di grossi numeri) Sequenziamento esoma/genoma Filtraggio delle varianti (comuni, riportate in soggettti normali etc) Selezione delle varianti con le caratteristiche opportune (Varianti comuni, calcolo delle frequenze relative nei controlli e nei pazienti, studio di associazione) Verifica della varianti candidate

17 Quesito diagnostico: nessuno specifico, voglio conoscere il mio genoma...

18 Sequenziamento del genoma individuale: esempi celebri

19

20

21 James Watson s genome 342 varianti a carico di geni schedati in Human Gene Mutation Database (HGMD) 32 con mutazioni descritte 12 in geni resposabili di patologie recessive (portatore) Sequenziamento genoma & malattie monogeniche Informazioni riguardanti il nostro stato di portatori di una condizione autosomica recessiva, di una malattia do,minante ad esordio tardivo

22 Sequenziamento genoma & malattie multifattoriali Informazioni riguardanti la nostra eventuale predisposizione a sviluppare malattie multifattoriali (malattie cardiovascolari, neurodegenerative, diabete, condizioni metaboliche etc.), a contrarre infezioni etc

23 James Watson e l ipertensione Mr Watson soffre di ipertensione, condizione molto comune specialmente dopo una certa età... Assume dei farmaci anti-ipertensivi tra i quali dei beta-bloccanti, ma il risultato non è ottimale, la pressione non è sempre sotto controllo, inoltre l assunzione pur necessaria di questi farmaci ha fastidiosi effetti collaterali Con il sequenziamento del suo genoma è stato possibile analizzare lo stato di almeno 6 geni che intervengono nel metabolismo dei farmaci Tra questi Mr Watson è risultato omozigote per una particolare variante del gene CYP2D6, codificante per un enzima che interviene nel metabolismo di numerosi farmaci (beta-bloccanti, anti aritmici, antipsicotci d alcuni anti-depressivi) L allele CYP2D6*1A codifica per un enzima non funzionale Mr Watson è un cosiddetto metabolizzatore lento, è necessario cambiare completamente classe di farmaci

24 Genotipizzazione del gene CYP2D6 metabolizzatori lenti (Poor Metabolizer ): sono pazienti che presentano una mutazione in entrambi gli alleli del gene, cioe presentano due alleli non funzionali del gene CYP2D6 Capacità d attivazione dei farmaci estremamente ridotta o assente, ridotta capacità metabolica per numerosi composti, tenderanno ad accumulare o ad eliminare più lentamente i substrati o i farmaci che sono maggiormente metabolizzati dal CYP2D6, più frequentemente esposti ad effetti indesiderati se trattati con dosi standard di questi composti. metabolizzatori intermedi sono pazienti portatori in eterozigosi di una mutazione, cioe presentano un allele normale del gene CYP2D6 ed uno non funzionale, per conseguire un azione terapeutica ottimale, un dosaggio farmacologico inferiore alla norma. metabolizzatori estesi sono persone dotate di un normale metabolismo farmacologico. metabolizzatori rapidi (Ultra-Metabolizer): sono persone con un aumentata espressione del gene CYP2D6, dovuta alla presenza di tre o più alleli funzionali (*XN), a causa di una duplicazione o multiduplicazione di un allele funzionale. I metabolizzatori rapidi possono richiedere, per un azione terapeutica ottimale, un dosaggio farmacologico superiore alla norma.

25 Sequenziamento genoma & Farmacogenomica* Informazioni utili a predire la risposta individuale ai farmaci, possibilità di terapie mirate e di sviluppo di classi di farmaci che tengano conto di questa variabilità *Farmacogenetica/farmacogenomica ovvero come predire la propria risposta ai farmaci a partire dal nostro profilo genetico

26

27 Venter s genome

28 Venter s genome La genotipizzazione e l analisi di raggruppamento di 750 SNP unici suggerisce che Mr Venter è per il 99.5% simile ad individui di discendenza Europea Sequenziamento del genoma: le nostre origini & antropologia & evoluzione Attenzione però in genetica parliamo di popolazioni, non esiste alcuna base scientifica e genetica alla categorizzazione delle cosiddette razze

29 Tra l altro, Mr Venter risulta eterozigote per due varianti APOE SNP rs (T/C) e APOC1 SNP rs (A/G) che lo pongono ad alto rischio nella predisposizione allo sviluppo della malattia di Alzheimer ad esordio tardivo (LOAD)

30 Inoltre, Mr Venter è portatore di alcune varianti che potrebbero predisporlo al melanoma ed al altri tumori della pelle

31 Sequenziamento genoma & predisposizione a malattie neurodegenerative (per lo più incurabili allo stato attuale) o a particolari forme di cancro (prevenzione) Inoltre, cominciamo a riflettere Mr Watson ha dato il proprio assenso a che i dati riguardanti il sequenziamento del proprio genoma fossero condivisi pubblicamente, ma ha chiesto esplicitamente che i dati riguardanti alcuni geni le cui varianti potrebbero predire la predisposizione allo sviluppo di malattie neurodegenerative (e in particolare l Alzheimer) fossero eliminati

32 Ampliare e migliorare le capacità diagnostiche nelle malattie, per trattare ove possibile, prevenire... Possibilità di identificare la predisposizione genetica a malattie complesse e condizioni parafisiologiche Possibilità di predire la risposta individuale ai farmaci, all alimentazione, all esercizio fisico/attività sportiva... Possibilità di predire caratteristiche fisiche, fisiologiche, comportamentali U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

33 Sequenziamento del Genoma e medicina personalizzata Ampliare e migliorare le capacitè diagnostiche nelle malattie Topol EJ - Cell 157 (1): , 2014 Possibilità di identificare la predisposizione genetica ad alcune malattie e condizioni parafisiologiche (prevenzione...) Disegnare farmaci personalizzati sulla base del profilo genetico (farmacogenetica e farmacogenomica)

34 Medicina Molecolare Genomica microbica, patologia e ambiente Genetica Forense BioArcheologia, Antropologia, Evoluzione e migrazioni Agricoltura, Allevamento, conservazione delle specie U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

35 Do you think genome sequencing will impact on your future life? Yes, but... Il fatto di essere portatori di una o alcune varianti predisponenti non significa che svilupperemo la data malattia (necessità di altri eventi molecolari, effetto dell ambiente...) In molti casi l associazione di varianti con alcune situazioni patologiche o parafisiologiche non sono state confermate e non ci sono prove biologiche che abbiamo veramente un impatto funzionale Per moltissime varianti non sappiamo che conclusioni trarre... Inoltre...

36 Informazione genetica privata e confidenziale Impatto psicologico, pericolo di stigmatizzazioni e discriminazioni Impatto sulle scelte riproduttive Politiche sanitarie e assistenziali Impatto in sanità pubblica e privata (formazione professionisti, standard di qualità, accesso ai test, utilità dei test) Aspetti sanitari e ambientali (OGM) Aspetti etici, legali e sociali Implicazioni filosofiche, responsabilità Commercializzazione delle tecnologie e dei test. Gestione e accesso ai risultati U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

37

38 Il Genetic Information Nondiscrimination Act (anche detto GINA) è una legge adottata dal Congresso degli Stati Uniti che proibisce l'utilizzo di informazioni genetiche nell assicurazione sanitaria e nel contratto di lavoro. Essa vieta di negare la copertura sanitaria ad un individuo sano o di imporgli costi più elevati esclusivamente sulla base di una predisposizione genetica allo sviluppo di una malattia. Vieta inoltre ai datori di lavoro di servirsi di informazioni genetiche di un individuo per assumere, licenziare, trasferire o promuovere il dipendente. I La legge contiene emendamenti all'employee Retirement Income Security del 1974 ed all'internal Revenue Code del Il decreto è passato all'unanimità in Senato (95 a 0), e all'unanimità meno un voto, quello del senatore Ron Paul, alla Camera dei rappresentanti il 24 aprile

39 Quindi...cosa vorresti sapere e cosa no? Immagina di avere fatto sequenziare il tuo genoma Tutti i risultati, nessuno escluso Solo i dati relativi a varianti per le quali c è estesa documentazione scientifica e conferme relativamente al loro valore funzionale, diagnostico, prognostico o predittivo Solo i dati scientificamente sicuri ma relativi a condizioni curabili o per i quali esiste un qualche tipo di intervento...

40 Il genoma a 1000 Euro...i siti per la genomica personalizzata * Cofondatrice Anne Wojcicki, moglie di Sergej Brin, inventore assieme a Larry Page di Google

41

42

43

44 Fine

ETTORE MARRE DIGITAL FOR BUSINESS

ETTORE MARRE DIGITAL FOR BUSINESS USO ED ABUSO DEI FARMACI Venerdì 17 aprile 2015 Sala conferenze Digital for Business - Sesto San Giovanni (MI) ETTORE MARRE DIGITAL FOR BUSINESS www.digitalforacademy.com Appropriatezza prescrittiva e

Dettagli

20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi generali Metodi mirati Scoperta e sviluppo di nuovi

Dettagli

CAPITOLO 2 I TRATTI COMPLESSI

CAPITOLO 2 I TRATTI COMPLESSI CAPITOLO 2 I TRATTI COMPLESSI Tratti semplici e tratti complessi Come detto nel capitolo precedente, la genetica classica studia fondamentalmente i cosiddetti tratti mendeliani semplici, quelli in cui,

Dettagli

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA

Dettagli

DNA RICOMBINANTE E BIOTECNOLOGIE

DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

CELIACHIA E TEST HLA RACCOMANDAZIONI

CELIACHIA E TEST HLA RACCOMANDAZIONI CELIACHIA E TEST HLA RACCOMANDAZIONI a cura di Maria Cristina Mazzilli 1 Antonio Calabrò 2 Carlo Catassi 2 Luigi Greco 2 Riccardo Troncone 2 Umberto Volta 2 Valerio Misefari 3 Antonio Amoroso 4 Ettore

Dettagli

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Seconda Università di Napoli II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Gruppo di studio La Sbobba A cura di dodo e Ely24e 1) Introduzione alla Genetica Medica Pag. 2

Dettagli

Affidabilità nella diagnostica

Affidabilità nella diagnostica Affidabilità nella diagnostica Passione per la ricerca Research & Innovation è un laboratorio di medicina molecolare che esegue test genetici avanzati al servizio dei medici e delle strutture di diagnosi

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA2013/14 Prof Alberto Turco Lezioni 57 e 58 11.12.2013 Test Genetici Storiche date. 1865 1859 1953.momenti memorabili dell impresa intellettuale e scientifica

Dettagli

La genomica nella prospettiva delle cure primarie

La genomica nella prospettiva delle cure primarie La genomica nella prospettiva delle cure primarie Dott. Enrico Ioverno Medico di Medicina Generale SIMG Vicenza Le cure primarie rappresentano il primo livello attraverso il quale gli individui, le famiglie

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE EREDITA MENDELIANA CLASSICA ~ 600 E C M 10.000 Enzimi

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013

LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 I Ricercatori del Centro di Genomica e Bioinformatica Traslazionale stanno lavorando a linee di ricerca legate a 1. Sclerosi Multipla 2. Tumore della Prostata

Dettagli

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA I.P.S.I.A. Bettino Padovano Senigallia INDIRIZZO CHIMICO BIOLOGICO 2009/10 ALUNNO:MATTEO BARBARINI CLASSE: 5 TECNICO CHIMICO-BIOLOGICO DOCENTE:PROF.SSA

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita

Dettagli

I geni del metabolismo

I geni del metabolismo I geni del metabolismo Lezione 6 1 Premessa I Quello che interessa e individuare i geni che controllano le vie metaboliche. Per arrivare a questo risultato si possono usare diverse strategie (non tecniche:

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica Corso postcongressuale XV congresso SIGU Come refertare e comunicare varianti genomiche Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica DSTB - Università degli Studi di Udine P.le Kolbe,1-33100 Udine - ITALIA

Dettagli

LE EPATITI B e C. Verso una terapia personalizzata

LE EPATITI B e C. Verso una terapia personalizzata LE EPATITI B e C Verso una terapia personalizzata 3 L EPATITE B LE EPATITI B e C Le epatiti B e C rappresentano un campo molto complesso della Clinica Medica. La Medicina di Laboratorio propone nuove analisi

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

MALATTIA CELIACA. Il test HLA per la celiachia. Le malattie genetiche si distinguono tra monogeniche e multifattoriali

MALATTIA CELIACA. Il test HLA per la celiachia. Le malattie genetiche si distinguono tra monogeniche e multifattoriali MALATTIA CELIACA La ricerca della malattia celiaca si esegue evidenziando nel sangue e quindi nel DNA gli alleli che codificano per le molecole DQ2 DQ8. La presenza di questi determina la possibilità che

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Verso la terapia personalizzata

Verso la terapia personalizzata Verso la terapia personalizzata M.G.Tibiletti Genetista Ospedale di Circolo-Università dell Insubria Varese Soroptimist Club Varese Varese 20 aprile 2013 Test genetici DIAGNOSTICI PRESINTOMATICI PREDITTIVI,

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI 1953: scoperta del DNA (Watson e Crick) CENNI STORICI 1977: metodo di Sanger per il sequenziamento del DNA (pubblicazione della

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Lezione 11. Duplicazione genica ed espansione del genoma

Lezione 11. Duplicazione genica ed espansione del genoma Lezione 11 Duplicazione genica ed espansione del genoma Lynch Capitolo 9 Grauer and Li Capitolo 6 Modalità di duplicazione genica 1. Duplicazione intragenica 2. Duplicazione completa di un gene 3. Parziale

Dettagli

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi Patogenesi Terapia Diagnosi Dalla Genomica alla Medicina Molecolare Chimica Biochimica Biologia Biologia Molecolare Decodificazione Genoma Umano Post-Genomica Medicina Molecolare La CELLULA Nasce Si sviluppa

Dettagli

IL CONTROLLO GENETICO DELLA PARENTELA NEL CANE CON ANALISI DEL DNA Michele Polli, Loredana Holzer, Stefano Marelli, Luigi Guidobono Cavalchini

IL CONTROLLO GENETICO DELLA PARENTELA NEL CANE CON ANALISI DEL DNA Michele Polli, Loredana Holzer, Stefano Marelli, Luigi Guidobono Cavalchini IL CONTROLLO GENETICO DELLA PARENTELA NEL CANE CON ANALISI DEL DNA Michele Polli, Loredana Holzer, Stefano Marelli, Luigi Guidobono Cavalchini Università degli Studi di Milano - Istituto di Zootecnica

Dettagli

BIOLOGA e BIOLOGO MOLECOLARE

BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...

Dettagli

REPORT FINALE DEL PROGETTO III Controllo di qualità nazionale per la valutazione delle mutazioni di RAS nel carcinoma del colon-retto -2014

REPORT FINALE DEL PROGETTO III Controllo di qualità nazionale per la valutazione delle mutazioni di RAS nel carcinoma del colon-retto -2014 REPORT FINALE DEL PROGETTO III Controllo di qualità nazionale per la valutazione delle mutazioni di RAS nel carcinoma del colon-retto -2014 Il Comitato Scientifico AIOM e SIAPEC-IAP ha organizzato per

Dettagli

Dal test genetico al paziente

Dal test genetico al paziente La consulenza genetica Dal test genetico al paziente Devono essere considerati parti integranti di un test genetico la comunicazione e l'interpretazione dei risultati e la consulenza sulle loro possibili

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y L infertilità è considerata dall Organizzazione Mondiale della Sanità una patologia. Per infertilità si intende l assenza di concepimento dopo 12/24 mesi di rapporti mirati non protetti. Il fenomeno dell

Dettagli

Carta dei Servizi (v.1.4)

Carta dei Servizi (v.1.4) Carta dei Servizi (v.1.4) Cancer Genetic Test Laboratory (CGT Lab) Gentili Signori, Il Laboratorio Cancer Genetic Test (CGT Lab), Servizio di medicina di laboratorio specializzato senza punto di prelievo,

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

La Genetica. Le leggi di Mendel

La Genetica. Le leggi di Mendel La Genetica Le leggi di Mendel Genetica: scienza che studia la trasmissione dei caratteri ereditari (che si trasmettono di generazione in generazione) Carattere: caratteristica esterna, interna o comportamentale

Dettagli

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE Servizio Risorse Umane e Relazioni Sindacali delegato dal Direttore Generale dell Azienda con

Dettagli

La genetica della distonia

La genetica della distonia La genetica della distonia L'ipotesi che alcune forme di distonia siano ereditarie risale a molti decenni orsono. Tuttavia, soltanto nel 1990 Ozelius e coll. sono stati in grado di localizzare per la prima

Dettagli

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling

Dettagli

Lo sviluppo della genetica tra realtà e immaginazione

Lo sviluppo della genetica tra realtà e immaginazione Bruno Dallapiccola Dipartimento di Medicina Sperimentale Sezione di Genetica Medica, Università La Sapienza Istituto CSS-Mendel, Roma Lo sviluppo della genetica tra realtà e immaginazione Geneticization

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

IL PROGETTO GENOMA UMANO e le sue implicazioni nella nostra vita

IL PROGETTO GENOMA UMANO e le sue implicazioni nella nostra vita IL PROGETTO GENOMA UMANO e le sue implicazioni nella nostra vita Conferenza-Dibattito Relatore: Prof. Giuseppe Novelli Martedì 18 Gennaio 2005 Liceo Scientifico Nomentano Aula Magna Via della Bufalotta

Dettagli

LA RETE DI GENETICA MEDICA IN EMILIA-ROMAGNA

LA RETE DI GENETICA MEDICA IN EMILIA-ROMAGNA LA RETE DI GENETICA MEDICA IN EMILIA-ROMAGNA A cura del Nucleo di coordinamento per la rete regionale dei servizi di genetica medica dell Emilia-Romagna Con il contributo di Laura Biagetti (Azienda Ospedaliera-Universitaria

Dettagli

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Ad integrazione delle lezioni e del testo di studio Genetica Umana e Medica Neri- Genuardi 3a edizione 2014 Masson (www.mediquiz.it) GENETICA MEDICA

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013 La sindrome di Lynch Cancro colonrettale ereditario non poliposico o HNPCC G. A. Pablo Cirrone 1 Caratteristiche generali I HNPCC (Hereditary Non-Polyposis Colonrectal Cancer) è caratterizzato dalla comparsa,

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento Docente: ROSSI STEFANIA Qualifica: RICERCATORE Insegnamento: STATISTICA SSD: MED/42 o Definire gli aspetti fondamentali per la stesura di progetto/protocollo di ricerca: razionale; plausibilità biologica

Dettagli

Genomica e modelli animali di malattie umane

Genomica e modelli animali di malattie umane I giovedì della cultura scientifica Etica e sperimentazione animale nella ricerca biomedica Genomica e modelli animali di malattie umane Mariateresa Mancuso BIOTEC-MED Mus Musculus : organismo modello

Dettagli

UTILIZZO OTTIMALE DEI TEST DI II LIVELLO PER TALASSEMIA

UTILIZZO OTTIMALE DEI TEST DI II LIVELLO PER TALASSEMIA UTILIZZO OTTIMALE DEI TEST DI II LIVELLO PER TALASSEMIA Dr.ssa Anna Ravani Laboratorio di Genetica Molecolare Servizio di Genetica Medica Azienda Ospedaliera-Universitaria S.Anna FERRARA EMOGLOBINOPATIE:

Dettagli

La predisposizione genetica ai tumori

La predisposizione genetica ai tumori La predisposizione genetica ai tumori Il Cancro è una malattia genetica Il sillogismo aristotelico nell era del DNA Socrate è un uomo. Gli uomini sono mortali. Socrate è mortale. Socrate è mortale. Il

Dettagli

LA DEPRESSIONE NEGLI ANZIANI

LA DEPRESSIONE NEGLI ANZIANI LA DEPRESSIONE NEGLI ANZIANI Che cos è la depressione? Tutti noi ci possiamo sentire tristi a volte, tuttavia la depressione è una cosa seria. La malattia della depressione a volte denominata Depressione

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di GENETICA MEDICA Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di Perugia Centro Riferimento Regionale

Dettagli

Immunodiagnostica e Diagnostica Molecolare attualità e prospettive. Prof.ssa Anna Onofri Liceo Scientifico «Iris Versari» Maggio 2015

Immunodiagnostica e Diagnostica Molecolare attualità e prospettive. Prof.ssa Anna Onofri Liceo Scientifico «Iris Versari» Maggio 2015 Immunodiagnostica e Diagnostica Molecolare attualità e prospettive Prof.ssa Anna Onofri Liceo Scientifico «Iris Versari» Maggio 2015 DATI INFORMAZIONE CONOSCENZA La Diagnostica di Laboratorio permette

Dettagli

Obesità ed epigenetica: il ruolo del SIAN nella prevenzione. Antonio Romaniello Direttore U.O.C. SIAN ASL - Potenza

Obesità ed epigenetica: il ruolo del SIAN nella prevenzione. Antonio Romaniello Direttore U.O.C. SIAN ASL - Potenza Obesità ed epigenetica: il ruolo del SIAN nella prevenzione Antonio Romaniello Direttore U.O.C. SIAN ASL - Potenza IP E R N U T R IZ IO N EE N E R G E T IC A (O B E S IT A ') C R IT E R IC L IN IC I E

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Biobanca Genetica per Malattie Rare Scheletriche

Biobanca Genetica per Malattie Rare Scheletriche Biobanca Genetica per Malattie Rare Scheletriche Luca Sangiorgi S.S.D. di Genetica Medica e Malattie Rare Ortopediche, Istituto Ortopedico Rizzoli Bologna SSD di Genetica Medica IOR Roma, 25 settembre

Dettagli

Riepilogo del progetto

Riepilogo del progetto Riepilogo del progetto 1. Contesto e scopo della agenda strategica Le malattie neurodegenerative (MN) sono condizioni debilitanti e in gran parte incurabili, strettamente legate all'invecchiamento. Tra

Dettagli

INVECCHIAMENTO come PROCESSO FISIOLOGICO INVECCHIAMENTO DOVUTO ALL INSORGENZA DI PATOLOGIE. - malattie cardiovascolari - cancro

INVECCHIAMENTO come PROCESSO FISIOLOGICO INVECCHIAMENTO DOVUTO ALL INSORGENZA DI PATOLOGIE. - malattie cardiovascolari - cancro INVECCHIAMENTO come PROCESSO FISIOLOGICO INVECCHIAMENTO DOVUTO ALL INSORGENZA DI PATOLOGIE - malattie cardiovascolari - cancro Il processo di BIOSENESCENZA implica le caratteristiche seguenti: 1. è deleterio

Dettagli

Screening dei soggetti a rischio e diagnostica molecolare

Screening dei soggetti a rischio e diagnostica molecolare Screening dei soggetti a rischio e diagnostica molecolare Daniela Furlan U.O. Anatomia Patologica Varese, 3 luglio 2012 Il carcinoma pancreatico Patogenesi Suscettibilità genetica Implicazioni diagnostiche

Dettagli

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884)

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884) La trasmissione dei caratteri ereditari Le leggi di Mendel (1882-1884) Le leggi di Mendel studiano la trasmissione di caratteri qualitativi prodotti da un singolo gene Procedimento sperimentale di Mendel

Dettagli

IL GENOMA UMANO COME BENE COMUNE

IL GENOMA UMANO COME BENE COMUNE IL GENOMA UMANO COME BENE COMUNE IL PROGETTO GENOMA UMANO Il 26 giugno 2000, il Presidente degli Stati Uniti, Bill Clinton, e il Primo ministro di Sua Maestà Britannica, Tony Blair, organizzarono una conferenza

Dettagli

TEST GENETICI DI SUSCETTIBILITÀ E MEDICINA PERSONALIZZATA

TEST GENETICI DI SUSCETTIBILITÀ E MEDICINA PERSONALIZZATA TEST GENETICI DI SUSCETTIBILITÀ E MEDICINA PERSONALIZZATA ELABORATO DEL GRUPPO DI LAVORO MISTO, ESPRESSO DAL COMITATO NAZIONALE PER LA BIOETICA E DAL COMITATO NAZIONALE PER LA BIOSICUREZZA, LE BIOTECONOLOGIE

Dettagli

Implicazioni etiche, sociali, economiche e cliniche della diagnostica predittiva in Italia e all estero. Project Work

Implicazioni etiche, sociali, economiche e cliniche della diagnostica predittiva in Italia e all estero. Project Work Implicazioni etiche, sociali, economiche e cliniche della diagnostica predittiva in Italia e all estero. Programma Scienziati in Azienda - XII Edizione Stresa, 26 settembre 2011 27 luglio 2012 Project

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Riparazione del DNA ed insorgenza di tumori Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Danni al DNA e cancro Le cellule tumorali L importanza della stabilità

Dettagli