CONCLUSIONI DEL SEQUENZIAMENTO GENOMICO DI D. melanogaster: esistono tre putativi geni adiacenti quello per la porina

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "CONCLUSIONI DEL SEQUENZIAMENTO GENOMICO DI D. melanogaster: esistono tre putativi geni adiacenti quello per la porina"

Transcript

1 CONCLUSIONI DEL SEQUENZIAMENTO GENOMICO DI D. melanogaster: esistono tre putativi geni adiacenti quello per la porina l(2)k)08405 ATG TAA IA IB II III IV? CG17137 CG17139 CG17140

2 Le sequenze della porina (DmVDAC1) e quella codificata da CG17137 (DmVDAC2) presentano il 41% di identità e il 68% di similarità porin1 --MAPPSYSD LGKQARDIFS KGYNFGLWKL DLKTKTSSGI EFNTAGHSNQ 48 P+Y D LGK ARD+F +GY+ G+W++ D KT T+SGI EF T G ++Q porin2 MAAKTPTYPD LGKLARDLFK RGYHPGIWQI DCKTLTNSGI EFFTTGFASQ 50 porin1 ESGKVFGSLE TKYKVKDYGL TLTEKWNTDN TLFTEVAVQD QLLEGLKLSL KV GSL+ +KYK++D GL TLTE+WNT+N LF E+ +D +L +GL L++ porin2 DNSKVTGSLQ SKYKIEDQGL TLTERWNTEN WLFGEIMHRD KLAQGLMLAV 100 porin1 EGNFAPQSGN KNGKFKVAYG HENVKADSDV NIDLKGPLIN ASAVLGYQGW 148 E F P S +GNFK+ Y +N +D P++N S V+G++ + porin2 EAKFQPGSNE ADGKFKMGYA QDNFNFLADI GLNSE-PILN CSLVVGHKEF 149 porin1 LAGYQTAFDT QQSKLTTNNF ALGYTTKDFV LHTAVNDGQE FSGSIFQRTS 198 L G T FD ++L ALG+T + LH + +G + S+F + S porin2 LGGVGTEFDV GNTELKGWKV ALGWTNETAT LHGELKNGDT WLASLFYKAS 199 porin1 DKLDVGVQLS WASGTSNTKF A IGAKYQLDD DASVRAKVNN 239 +K+D+G++++ G +G Y L++ DA VRAKVNN porin2 EKIDAGIEVT KGAGGGEAAE GEQQGGDVVV NLGMIYHLEE DALVRAKVNN 249 porin1 ASQVGLGYQQ KLRTGVTLTL STLVDGKNFN AGGHKIGVGL ELEA GLGY+Q KLR G+T ++ S ++D NF G H+ GVG+ L+ porin2 LVELGLGYEQ KLRDGITASI SAVLDCNNFK DGNHRFGVGI ALQC 293

3 Il vettore di espressione eterologa pqe30 fonde all N-terminale di una sequenza codificante una coda di sei His

4 Amplificazione, mediante PCR, dei cdna da. utilizzare per il clonaggio nel vettore pb bp 1000 bp 1000 pb PRIMER ATG Bam HI forward TAA HIND III reverse SEQUENZA 5-3 TAGGGATCCATGGCCAAAA CACGACA TAGAAGCTTTTATATTGCCA TTATGAA GAA 800 bp pb Sequenza dei primers utilizzati nella reazione di amplificazione e recanti i siti di taglio per gli enzimi

5 L uso della resina Ni-NTA permette la purificazione con alte rese delle proteine che posseggono un tag di sei His

6 Purificazione della proteina DmVDAC2 da lisato di E.coli mediante cromatografia di affinità

7 DmVDAC1 DmVDAC2 5nS 1min Tracciato di conduttanza relativi alle porine ricombinanti di D.melanogaster ottenuti in 1M KCl: successo nella procedura di purificazione e refolding

8 Differenze di attività tra DmVDAC1 e DmVDAC2 Conduttanza 1M KCl PC/pA G/Go ±50mv G/Go ±80mv DmVDAC1 4nS 0,6 0,6 0,5 DmVDAC2 4nS 3,17 1,0 1,0

9 Differenze di struttura tra le due porine: composizione amminoacidica DmVDAC1 DmVDAC2 Glu Asp Lys Arg 4 7

10 Differenze di struttura tra le due porine: sequenza amminoacidica DmVDAC1 --MAPPSYSD LGKQARDIFS KGYNFGLWKL DLKTKTSSGI EFNTAGHSNQ DmVDAC2 MAAKTPTYPD LGKLARDLFK RGYHPGIWQI DCKTLTNSGI EFFTTGFASQ DmVDAC1 ESGKVFGSLE TKYKVKDYGL TLTEKWNTDN TLFTEVAVQD QLLEGLKLSL DmVDAC2 DNSKVTGSLQ SKYKIEDQGL TLTERWNTEN WLFGEIMHRD KLAQGLMLAV DmVDAC1 EGNFAPQSGN KNGKFKVAYG HENVKADSDV NIDLKGPLIN ASAVLGYQGW DmVDAC2 EAKFQPGSNE ADGKFKMGYA QDNFNFLADI GLNSE-PILN CSLVVGHKEF DmVDAC1 LAGYQTAFDT QQSKLTTNNF ALGYTTKDFV LHTAVNDGQE FSGSIFQRTS DmVDAC2 LGGVGTEFDV GNTELKGWKV ALGWTNETAT LHGELKNGDT WLASLFYKAS DmVDAC1 DKLDVGVQLS WASG TSNTKF AIGAKYQLDD DARVRAKVNN DmVDAC2 EKIDAGIEVT KGAGGGEAAE GEQQGGDVVV NLGMIYHLEE DALVRAKVNN DmVDAC1 ASQVGLGYQQ KLRDGVTLTL STLVDGKNFN AGGHKIGVGL ELEA DmVDAC2 LVELGLGYEQ KLRDGITASI SAVLDCNNFK DGNHRFGVGI Quattro Glu hanno sostituito quattro Lys nella DmVDAC2

11 Localizzazione predittiva di due acidi glutammici nella struttura 3D della porina E66 E

12 E66 E163

13 Strategia di mutagenesi con il kit Quik-change site directed mutagenesis (Stratagene): Permette la mutagenesi del DNA di interesse già clonato nel vettore

14 PRIMER E66K forward E66K reverse E163K forward E163K reverse SEQUENZA 5-3 AAGTACAAGATCAAGGACCAAGGCCTG CAGGCCTTGGTCCTTGATCTTGTACTT TGGCAACACCAAACTCAAGGG CCCTTGAGTTTGGTGTTGCCA

15 Mutagenesi sito-specifica di E66 ed E163: riportando due glutammati a lisina in DmVDAC2 si ripristinano le cartteristiche fisiologiche di DmVDAC1 Conduttanza 1M KCl PC/pA G/Go ±50mv G/Go ±80mv DmVDAC2 4nS 3,17 1,0 1,0 E66K 4nS 4,5 0,88 0,8 E163K 3nS 1,23 0,82 0,78 E66/163K 2.5nS 1,17 0,7 0,6

16

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

Mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione

Mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Mutazioni Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Le mutazioni possono essere spontanee oppure causate da agenti fisici, chimici

Dettagli

SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Purificazione degli acidi nucleici

Purificazione degli acidi nucleici A cosa serve? Purificazione degli acidi nucleici DNA genomico: per costruire librerie genomiche e/o usato nell analisi d ibridazione Southern. mrna: sintesi del cdna; analisi d ibridazione Northern, o

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010 PLASMIDI puc ALTRI TIPI DI VETTORI VETTORI λ (15-20 Kb) = vettori ottenuti apportando delle modifiche al genoma del batteriofago λ. COSMIDI (40-45 Kb) = plasmidi che contengono i siti cos di λ utili per

Dettagli

FASI SPERIMENTALI PRINCIPALI

FASI SPERIMENTALI PRINCIPALI FASI SPERIMENTALI PRINCIPALI 1: I dentificazione, isolamento e clonaggio gene codificante per proteina bersaglio ( BIOINFORMATICA) 2: espressione in sistema eterologo 3: purificazione e caratterizzazione

Dettagli

Clonaggio e mutagenesi sito-specifica di geni codificanti proteine respiratorie per la loro caratterizzazione strutturale e funzionale

Clonaggio e mutagenesi sito-specifica di geni codificanti proteine respiratorie per la loro caratterizzazione strutturale e funzionale Rendiconti Seminario Facoltà Scienze Università Cagliari Vol. 76, Fasc. 1-2 (2006) Clonaggio e mutagenesi sito-specifica di geni codificanti proteine respiratorie per la loro caratterizzazione strutturale

Dettagli

A cosa serve la mutagenesi del DNA?

A cosa serve la mutagenesi del DNA? MUTAGENESI DEL DNA A cosa serve la mutagenesi del DNA? 1. Studio delle sequenze nucleotidiche, delle funzioni dei geni e di particolari aminoacidi nelle proteine. 2. Ingegnerizzazione di proteine in modo

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo A COSA SERVE il

Dettagli

Strategie di mutagenesi

Strategie di mutagenesi Strategie di mutagenesi SELEZIONE GENETICA seleziono FENOTIPO determino GENOTIPO GENETICA INVERSA creo GENOTIPO determino FENOTIPO i.e., traduco una sequenza in una funzione Mutagenesi in vivo Phage display

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Indice. Introduzione alle metodologie biochimiche 1 (Martino Luigi Di Salvo, Roberto Contestabile)

Indice. Introduzione alle metodologie biochimiche 1 (Martino Luigi Di Salvo, Roberto Contestabile) VII Indice Prefazione XII Capitolo 1 Introduzione alle metodologie biochimiche 1 (Martino Luigi Di Salvo, Roberto Contestabile) 1.1 La Biochimica, una scienza sperimentale 1 1.2 Come si progetta, si esegue

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

CARATTERISTICHE DELLE TAG PIU USATE

CARATTERISTICHE DELLE TAG PIU USATE Proteine di fusione Proteine di fusione tag proteina Aumento stabilità Purificazione per affinità Metodo di identificazione spettrofotometria Saggio di legame anticorpo Esporto in compartimenti CARATTERISTICHE

Dettagli

Lezione IX-X martedì 25-X-2011

Lezione IX-X martedì 25-X-2011 Lezione IX-X martedì 25-X-2011 corso di genomica laurea magistrale Biotecnologia Industriale aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 non ci sarà lezione martedì 1 e giovedì 3 Novembre

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE

LA TECNOLOGIA DEL DNA RICOMBINANTE UNITÀ VET. DIDATTICA DI BIOLOGIA MOLECOLARE LA TECNOLOGIA DEL DNA RICOMBINANTE Roberto Giacominelli Stuffler 1. Gli enzimi di restrizione 2. La trascrittasi inversa 3. Il DNA ricombinante 4. La PCR 2 GLI

Dettagli

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 21/02/2011 Progetto di ricerca: Utilizzo di oligonucleotidi antisenso per correggere l effetto di mutazioni di splicing in pazienti

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo GENOMA di alcuni organismi viventi raffigurato come libri

Dettagli

Ingegneria Genetica e Microbiologia Applicata

Ingegneria Genetica e Microbiologia Applicata Corso di Laurea in Biotecnologie Anno Accademico 2009-2010 Ingegneria Genetica e Microbiologia Applicata Percorso n 3: Clonaggio di segmenti di DNA Settima esercitazione - 13 maggio 2010 F 1 1 1: taglio

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test U.O.C. di Epatologia Clinica e Biomolecolare Lotto N. DESCRIZIONE PRODOTTO Quantità annua richiesta Unità di misura Repertorio CND Codice Prodotto, Confezione Offerta e nome commerciale Prezzo unitario

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante 1 PROCARIOTI E. coli NON PATOGENO GRAM-NEGATIVO SEMPLICE DA COLTIVARE CRESCE VELOCEMENTE Termofili 45 90 Mesofili 10 45 Psicrofili -5 20 Psicrotrofi -5 35 Alcuni dei microrganismi

Dettagli

PURIFICAZIONE DI DNA

PURIFICAZIONE DI DNA PURIFICAZIONE DI DNA Esistono diverse metodiche per la purificazione di DNA da cellule microbiche, più o meno complesse secondo il grado di purezza e d integrità che si desidera ottenere. In tutti i casi

Dettagli

MUTAGENESI DEL DNA. A cosa serve la mutagenesi del DNA?

MUTAGENESI DEL DNA. A cosa serve la mutagenesi del DNA? A cosa serve la mutagenesi del DNA? MUTAGENESI DEL DNA 1. Studio delle sequenze nucleotidiche, delle funzioni dei geni e di particolari aminoacidi nelle proteine. 2. Ingegnerizzazione di proteine in modo

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA Sequenziamento del DNA Preparazione di librerie Library di cdna e di DNA genomico Analisi di librerie Sequenziamento del DNA 1) Metodo di Maxam&Gilbert (taglio chimico): il DNA viene marcato ad un estremità

Dettagli

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente Gli amminoacidi naturali sono α-amminoacidi : il gruppo amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente formula generale: gruppo funzionale carbossilico

Dettagli

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction)

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità

Dettagli

Come ordinare Geni sintetici Online

Come ordinare Geni sintetici Online Come ordinare Geni sintetici Online I geni sintetici di Eurofins MWG Operon possono essere ordinati online grazie all esclusivo software GENEius. Di seguito una guida dettagliata per effettuare la richiesta

Dettagli

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione in campo medico e biotecnologico Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione delle sequenze di acido nucleico Elena Comoglio Jacobacci & Partners S.p.A. Brevetti

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli

Produzione di proteine ricombinanti

Produzione di proteine ricombinanti Produzione di proteine ricombinanti Applicazioni principali delle proteine ricombinanti -STUDIO DELLA RELAZIONE TRA STRUTTURA E ATTIVITA.-PROTEINE DI INTERESSE TERAPEUTICO (anticorpi, insulina, ormone

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

Produzione di proteine ricombinanti

Produzione di proteine ricombinanti Produzione di proteine ricombinanti Applicazioni principali delle proteine ricombinanti -STUDIO DELLA RELAZIONE TRA STRUTTURA E ATTIVITA.-PROTEINE DI INTERESSE TERAPEUTICO (anticorpi, insulina, ormone

Dettagli

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010 Percorso nº 3: Clonaggio di segmenti di DNA 11-5-2010 I plasmidi: un mondo da esplorare. Elementi genetici capaci di replicarsi autonomamente

Dettagli

Rappresentazione dei Dati Biologici

Rappresentazione dei Dati Biologici Rappresentazione dei Dati Biologici CORSO DI BIOINFORMATICA C.d.L. Ingegneria Informatica e Biomedica Outline Proteine ed Amminoacidi Rappresentazione di Amminoacidi Rappresentazione delle strutture Proteiche

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi

Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Indice IX X Prefazione Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Capitolo 1 LA MANIPOLAZIONE GENICA, UNA TECNICA DALLE VASTE 1 APPLICAZIONI 1 Introduzione 1 Sequenziamento

Dettagli

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti

Dettagli

È necessario. 1. Isolare il segmento di DNA: 2. Moltiplicare il segmento di DNA: 3. Studiare la sequenza nucleotidica

È necessario. 1. Isolare il segmento di DNA: 2. Moltiplicare il segmento di DNA: 3. Studiare la sequenza nucleotidica 18. BIOTECNOLOGIE contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale DNA RICOMBINANTE permette di - ottenere brevi segmenti

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Continua. Peptidasi H 2 O

Continua. Peptidasi H 2 O Continua Peptidasi H 2 O Classificazione delle peptidasi 1. Meccanismo catalitico 2. Tipo di reazione catalizzata 3. Struttura molecolare e omologia 1. Meccanismo catalitico (mostrato per la chimotripsina)

Dettagli

Allineamento locale: BLAST

Allineamento locale: BLAST Allineamento locale: BLAST BLAST (Basic Local Alignment Search Tool) è il più diffuso programma di allineamento locale delle sequenze. Per vari anni il metodo FASTA (da non confondere con l omonimo formato)

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

Caratterizzazione dei geni coinvolti nelle nuove traslocazioni riguardanti la banda 14q32

Caratterizzazione dei geni coinvolti nelle nuove traslocazioni riguardanti la banda 14q32 2 Workshop SIES di Ematologia traslazionale Verona, 21-22 Maggio 2009 Caratterizzazione dei geni coinvolti nelle nuove traslocazioni riguardanti la banda 14q32 Identificazione di una correlazione tra l'espressione

Dettagli

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica

Dettagli

Nozioni di base in biologia molecolare. Dott.ssa Daniela Fiocco

Nozioni di base in biologia molecolare. Dott.ssa Daniela Fiocco Nozioni di base in biologia molecolare Dott.ssa Daniela Fiocco Il DNA contiene l informazione genetica Griffith, 1928 esiste un principio trasformante, in grado di convertire ceppi innocui di Streptococcus

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

TRASFERIMENTO GENICO IN CELLULE VEGETALI: PIANTE TRANSGENICHE

TRASFERIMENTO GENICO IN CELLULE VEGETALI: PIANTE TRANSGENICHE TRASFERIMENTO GENICO IN CELLULE VEGETALI: PIANTE TRANSGENICHE Perché manipolare geneticamente le cellule vegetali Per studiare la funzione di geni e proteine tipici degli organismi vegetali Per produrre

Dettagli

Controllo ufficiale degli OGM nel settore agroalimentare

Controllo ufficiale degli OGM nel settore agroalimentare Controllo ufficiale degli OGM nel settore agroalimentare Ugo Marchesi Istituto Zooprofilattico Sperimentale Lazio e Toscana Centro di Referenza Nazionale per la ricerca di OGM ugo.marchesi@izslt.it ORGANISMI

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Analisi del DNA genomico mediante Southern Blot Hybridization

Analisi del DNA genomico mediante Southern Blot Hybridization Analisi del DNA genomico mediante Southern Blot Hybridization Permette la mappatura dei siti di restrizione attorno al frammento di DNA genomico per il quale si dispone di una sonda specifica a) Il DNA

Dettagli

ENZIMI DI RESTRIZIONE

ENZIMI DI RESTRIZIONE ENZIMI DI RESTRIZIONE La scoperta degli enzimi di restrizione e modificazione Intorno agli anni 50 si notò che talvolta l introduzione in E.coli di DNA esogeno, proveniente da un diverso ceppo di E.coli,

Dettagli

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia Capitolo 6 Trasferimento genetico e mappatura genetica nei batteri e nei batteriofagi 6.1 Circa 10 8 cellule di Escherichia coli appartenenti a un ceppo mutante vengono inoculate su un terreno colturale

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Biosintesi non ribosomiale di metaboliti peptidici bioattivi

Biosintesi non ribosomiale di metaboliti peptidici bioattivi Biosintesi non ribosomiale di metaboliti peptidici bioattivi Principali bersagli degli antibiotici Gli antibiotici derivano per la maggior parte da composti naturali Strutture di alcuni peptidi bioattivi

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

Fisiologia dell emostasi

Fisiologia dell emostasi 1 STRATEGIE DIAGNOSTICHE PER L EMOFILIA A DEL CANE Marco Caldin DVM, PhD, ECVCP Diplomate 2 Fisiologia dell emostasi 1 3 Fisiologia dell emostasi 4 Attivazione emostatica 2 5 Emostasi primaria 6 Emostasi

Dettagli

Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria

Dettagli

Tecniche per il sequenziamento degli acidi nucleici

Tecniche per il sequenziamento degli acidi nucleici Tecniche per il sequenziamento degli acidi nucleici Nel 1965 viene determinata la prima sequenza completa di un Acido Nucleico: il trna dell alanina di lievito (78 nucleotidi) 1971: prima mappa di restrizione

Dettagli

Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario

Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario Istituto di Biologia e Biotecnologia Agraria (IBBA) Tuesday, October

Dettagli

HITS & LEADS HIT LEAD

HITS & LEADS HIT LEAD HITS & LEADS HIT: struttura (molecola) non ottimizzata selezionata da un processo di selezione (screening) tramite un saggio. Spesso ha una debole affinità per il target ed ha probabilmente un profilo

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli