La next generation sequencing è entrata nella pratica pediatrica?

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La next generation sequencing è entrata nella pratica pediatrica?"

Transcript

1 Aprile-Giugno 2015 Vol. 45 N. 178 Pp Prospettive in Pediatria Frontiere La next generation sequencing è entrata nella pratica pediatrica? Vincenzo Nigro Dipartimento di Biochimica, Biofisica e Patologia Generale, Laboratorio di Genetica medica, Seconda Università degli Studi di Napoli, NGS Facility, Telethon Institute of Genetics and Medicine (TIGEM), Pozzuoli (NA) La next generation sequencing (NGS) è molto più che una nuova tecnica per leggere le sequenze di DNA. Produce sequenze con una processività parallela immensa che continua a crescere in modo esponenziale e oggi è nell ordine di centinaia di miliardi di basi di DNA per analisi. Questo fa sì che l NGS estenda le proprie opportunità di investimento in ogni settore delle scienze della vita che, con le nuove conoscenze prodotte, ne risulterà trasformato. Anche per la genetica umana è diventata una tecnologia insostituibile. L NGS sta rivoluzionando i test genetici diagnostici, sostituendo l approccio gene per gene con una strategia a pannelli di geni. Questi pannelli possono essere focalizzati ad un singolo o molteplici geni. Questo nuovo approccio è particolarmente promettente per la diagnosi di malattie pediatriche neuromuscolari, endocrinologiche, metaboliche, ecc., che sono caratterizzate da una forte eterogeneità clinica e genetica. Con la NGS è possibile effettuare un indagine genetica senza dover necessariamente ipotizzare un gene responsabile a priori, ma sequenziare un pannello molto ampio di geni o, per finalità di ricerca, tutto il genoma. Riassunto The next generation sequencing or NGS is much more than a new technique for reading the DNA sequence. It produces sequences with at a huge throughput that continues to grow exponentially and is now in the order of hundreds of billions of DNA bases for analysis. This causes the NGS to extend its investment opportunities in every field of life sciences which, with the new knowledge generated, will be transformed. Even for human genetics it has become a matchless technology. The NGS is revolutionizing genetic testing diagnostics, replacing the gene by gene strategy with a panel of genes. These panels can be focused on a single gene or widespread. This new approach is particularly promising for the diagnosis of pediatric neuromuscular diseases, endocrine, metabolic disorders, etc. that are characterized by a strong clinical and genetic heterogeneity. Using NGS it is possible to perform a genetic diagnosis without aiming at a single candidate gene, but to sequence a very large panel of genes or, for research purposes, the whole genome. Summary Metodologia della ricerca bibliografica effettuata La ricerca degli articoli rilevanti è stata effettuata tramite la banca bibliografica PubMed (http://www.ncbi. nlm.nih.gov/pubmed), utilizzando come parole chiave: next generation sequencing, whole exome sequencing, targeted sequencing Sono stati inclusi solo gli articoli in lingua inglese. La quasi totalità degli articoli sull argomento è stata pubblicata negli ultimi 4 anni; ad esempio la ricerca in Pubmed con la parola chiave whole exome sequencing ha prodotto 4789 articoli, di cui solo 70 (1,4%) prima del Introduzione: cosa significa NGS Il termine Next Generation Sequencing (d ora in avanti NGS) definisce differenti tecnologie di sequenziamento parallelo del DNA che consentono di analizzare DNA misti. Questa proprietà è una svolta epocale rispetto al sequenziamento tradizionale Sanger. Quest ultimo ha tre fasi: la prima che serve a preparare miliardi di copie identiche di ciascun fram- 137

2 V. Nigro mento di DNA per volta; la seconda fase che ricopia la sequenza delle basi di DNA con blocchi specifici causati da deossinucleotidi terminatori; la terza fase è l elettroforesi di frammenti di lunghezze discrete che fa identificare ciascuna base terminatrice. Nonostante ci sia stata negli anni un evoluzione del metodo Sanger, questa ha riguardato solo la velocizzazione della terza fase di separazione elettroforetica ad opera dei sequenziatori capillari. Poco è stato fatto per velocizzare le prime due fasi, molto più limitanti, di preparazione e di ricopiatura di frammenti individuali di DNA. La tecnologia NGS supera questo collo di bottiglia, consentendo di evitare i passaggi di amplificazione individuale, purificazione e ricopiatura di singoli segmenti di DNA omogenei. I vantaggi dell NGS sono ovviamente più evidenti quanto più numerosi sono i segmenti di DNA da analizzare e, nel campo delle malattie genetiche, quanto più numerosi e grandi sono i geni da studiare per una diagnosi molecolare. Ad esempio, con il Progetto Genoma Umano (basato su metodo Sanger) dal 1990 al 2003 sono stati coinvolti molti laboratori nel mondo per sequenziare un solo genoma, mentre con l NGS la stessa analisi è da considerarsi fattibile in circa 30 ore con uno sequenziatore di medie dimensioni. Evoluzione della NGS e delle tecniche di arricchimento L NGS negli ultimi 10 anni ha avuto un evoluzione dinamica con altrettanto rapida obsolescenza: il primo sistema (454 Sequencer) produceva 25 milioni di basi sequenziate per volta (Margulies et al., 2005), mentre il sistema più recente introduzione (Illumina HiSeq X Ten, legge miliardi di basi di DNA, cioè circa 1 milione di volte in più in soli 9 anni. L X Ten usa la tecnologia detta di patterned flow cell con cui è possibile amplificare e ripartire ogni singolo clone di molecole su un supporto fisico a micropozzetti: questo equivale a ripartire ciascun frammento di DNA in una tra miliardi di microprovette distinte. Parallelamente i costi di sequenza/bp si sono ridotti di oltre volte rispetto al 454 Sequencer e 5 milioni di volte rispetto al metodo Sanger. È però indispensabile precisare alcuni requisiti dei sistemi NGS: 1) meno costa sequenziare una base del DNA, più costano le apparecchiature; 2) è possibile sequenziare molti miliardi di basi di DNA ad un costo ridotto, ma, se non si sequenzia l intero genoma umano, si deve considerare il costo e l efficienza della cattura mirata delle sequenze da analizzare mediante le tecniche di arricchimento. Queste procedure servono a focalizzare il sequenziamento solo verso sequenze predeterminate. Anche in questo campo c è stata un importante evoluzione: la capacità di sintetizzare contemporaneamente decine di migliaia di differenti oligonucleotidi. Questo è utile sia per i protocolli più tradizionali di multiplex PCR ad alta processività (Fluidigm, Raindance, AmpliSeq), sia per altri due approcci senza PCR: il primo consiste nella cattura per ibridazione (Agilent SureSelect e NimbleGen/Roche SeqCap EZ), mentre il secondo nell ibridazione seguita da una fase di estensione (Haloplex da Agilent e TruSeq da Illumina). L uso di metodi di arricchimento sempre più precisi ed affidabili sta portando la NGS dal laboratorio di ricerca alla diagnostica di routine. La validazione su larga scala ne sta permettendo un impiego affidabile e a costi contenuti. Applicazioni e limiti dell NGS in genetica Grazie alle tecniche di arricchimento oltre al sequenziamento genomico (whole genome sequencing o WGS), sono stati sviluppati tre approcci più mirati quali il sequenziamento dell esoma (whole exome sequencing o WES) o il sequenziamento di pannelli di geni, noto anche come targeted sequencing (TS) che può essere focalizzato o esteso a molti geni (Tab. I). Il TS è principalmente utilizzato per indirizzare le regioni codificanti di un gruppo di geni, ma anche per il sequenziamento di ampie regioni genomiche non codificanti, con l arricchimento preliminare delle regioni da sequenziare. In entrambi i casi la conseguenza più immediata delle applicazioni NGS su larga scala è che i test genetici ci portano ad un livello superiore di complessità. Mentre la situazione ideale sarebbe quella di trovare una sola mutazione causativa, le difficoltà nascono dalla gestione di molteplici variazioni del DNA per paziente con significato apparentemente patogenetico in base alla letteratura scientifica. È importante chiarire che indipendentemente dall arricchimento, l NGS è semplicemente una tecnica molto potente di sequenziamento del DNA: produce sequenze più numerose e brevi e, per certi aspetti, meno accurate della metodica Sanger e non identifica categorie supplementari di varianti geniche (Tab. II). Pertanto quello che non è accertabile mediante sequenziamento Sanger è ancora più invisibile all NGS. In particolare, l NGS può risultare a bassa copertura se ci sono basi che hanno una profondità di copertura <20X, cioè la stessa sequenza letta meno di 20 volte. Questo implica che la profondità media dovrebbe essere molto superiore a 20X. Alcune regioni del DNA sono particolarmente inclini ad avere una bassa copertura a causa di regioni ricche in basi G/C ed in tali regioni le varianti, specie in eterozigosi, non sono identificabili. Inoltre, ampie delezioni e duplicazioni, come quelle alla base della distrofia muscolare di Duchenne, specie in eterozigosi, sono difficilmente identificabili. Ogni tentativo di analisi comparativa mediante software ha mostrato alte percentuali di insuccesso. La limitazione è dovuta ai passaggi di PCR previsti nei metodi di ar- 138

3 NGS in pediatria Tabella I. Dimensioni dei progetti di NGS in funzione del target (valori indicativi). Target Basi del DNA presenti nel target Copertura mediana richiesta Basi del DNA da sequenziare Varianti attese Costo minimo della sola NGS ** WGS (genoma) x > 120 Gb * WES (esoma) x 10 Gb Pannello esteso x 1 Gb Pannello focalizzato x 0.05 Gb * Gb = 1 miliardo di nucleotidi sequenziati ** I costi sono il minimo sul mercato e si riferiscono ai materiali per il solo sequenziamento senza considerare i costi accessori delle validazioni con metodica Sanger, l analisi bioinformatica dei dati e lo studio di altri parenti Tabella II. Identificazione delle varianti genomiche in base alla tecnica utilizzata. Varianti Sequenziamento Sanger* MLPA * NGS Array CGH Sostituzione di uno o pochi nucleotidi +++ +/ (SNP) Delezioni/duplicazioni di pochi nucleotidi Espansioni di triplette Delezioni /duplicazioni grandi come un intero esone Delezioni o duplicazioni di ampie regioni / cromosomiche(cnv) * Indagini mirate alla regione genomica mutata ricchimento che producono sbilanciamenti quantitativi tra ampliconi. Pertanto è consigliabile far precedere od associare tecniche quali MLPA o array CGH. Inoltre lunghe sequenze ripetute, come quelle osservabili nella sindrome dell X fragile sono ugualmente non valutabili. Infine, delezioni in sequenze ripetute come quelle alla base dell atrofia muscolare spinale (SMA) sono in sostanza non studiabili con NGS per problemi di ambiguità nell assegnazione delle corte sequenze prodotte. Inoltre c è un altra categoria di varianti del DNA che, seppure lette, non sono interpretabili e restano occultate tra migliaia di altre varianti di significato sconosciuto. Diagnosi molecolare mediante pannelli focalizzati di geni Questo tipo di applicazioni dell NGS è tra le più diffuse e di maggiore riscontro pratico immediato. L uso di pannelli di pochi geni non ha alcuna differenza con la diagnostica tradizionale sia per l interpretazione dei risultati sia per quanto riguarda i dilemmi etici. In genere l analisi si effettua solo sul propositus e poi si verifica la presenza nei genitori delle varianti riscontrate. Si sequenziano 1-20 geni specifici utilizzando piccoli strumenti NGS da banco, come Ion Torrent PGM o Illumina MiSeq. Moltissime pubblicazioni mostrano la buona affidabilità delle procedure con l identificazione delle mutazioni più rapida e più completa rispetto alle tecniche tradizionali. Ad esempio la tecnica NGS è stata già utilizzata con successo per la diagnosi di iperfenilalaninemia tramite l analisi dei geni PAH, PTS, QDPR, GCH1 e PCBD1 (Cao et al., 2014), per la diagnosi di neurofibromatosi di tipo I tramite l analisi del gene NF1 (Maruoka et al., 2014), per la diagnosi di sindrome di Stickler mediante l analisi dei geni COL11A1 ed COL11A2 (Acke et al., 2014), o in condizioni geneticamente più eterogenee come nella ciliopatia associata a nefronoftisi (Halbritter et al., 2012) o nell anemia di Fanconi (De Rocco et al., 2014). La tecnica va associata a metodologie per rilevare delezioni o duplicazioni che, se in eterozigosi, sono non correttamente rilevate dall analisi bioinformatica dei dati NGS. Un altra applicazione è nello screening neonatale, ad esempio di fibrosi cistica (Baker et al., 2015). Diagnosi molecolare con pannelli estesi I pannelli estesi non sostituiscono solo le tecniche diagnostiche tradizionali, ma offrono una visione d insieme di molte varianti geniche. Si ottengono selezio- 139

4 V. Nigro nando un numero di geni molto più ampio ( ), includendo geni anche molto grandi e geni candidati per gruppi selezionati di malattie genetiche. Ad esempio, un interessante applicazione riguarda tutte le malattie associate a disordini mitocondriali (Dames et al., 2013). Questi pannelli rappresentano un alternativa più efficiente e hanno necessità che la procedura di sequenziamento sia affidata a strumentazioni in grado di fornire, ad un costo/campione accettabile, almeno 0,5-3Gb di basi sequenziate per campione. Esistono due categorie di pannelli estesi: quelli a fini diagnostici, in cui i geni sono tutti attualmente noti come associati a malattie genetiche e quelli a scopo di ricerca in cui sono inclusi geni candidati scelti perché appartengono a pathways simili. Un esempio è dato dal pannello Haloplex per la sindrome di Usher (Aparisi et al., 2014) o del pannello di 891 geni che include i geni delle malattie da accumulo lisosomiale, dell autofagia e del pathway endocitico (Di Fruscio et al., 2015). Un altro esempio di pannello esteso è quello costituito da tutti i geni associati a malattie neuromuscolari (Savarese et al., 2014). Il vantaggio dei pannelli estesi è rappresentato dalla possibilità di un analisi più ampia di quella resa possibile dai pannelli focalizzati con un maggior numero di informazioni. Comporta però un maggior numero di varianti da interpretare. Rispetto al pannello focalizzato, l indagine prevede la necessità di analizzare contestualmente il DNA di entrambi i genitori. Questo per tre motivi, tutti vincolanti: l) la necessità di individuare le varianti de novo in una famiglia con genitori sani e figli affetti; 2) in alternativa, in caso di supposta trasmissione autosomica recessiva, la necessità di distinguere se due varianti sono presenti entrambe su uno stesso allele (in cis) o ciascuna deriva da un genitore (in trans); 3) l impossibilità tecnica di validare con tecnica Sanger centinaia o migliaia di varianti uniche. Un approccio ancora più estensivo è dato dal Clear- Seq Inherited Disease Panel (Agilent). Con questo pannello il sequenziamento è mirato a ben geni sinora coinvolti direttamente in malattie genetiche mendeliane. In sostanza questo tipo di pannello potrebbe diventare la soluzione di base per studiare casi sporadici, evitando il rischio dii ndividuare varianti in geni ignoti. Diagnosi con WES Gli esoni rappresentano circa 1,5% del genoma e si ritiene che contengano l 85% delle mutazioni che causano malattie genetiche. In alcuni laboratori si offre la possibilità di diagnosi genetica mediante WES. In media, la possibilità di identificare mutazioni causative con WES clinico è intorno al 26% (Lee et al., 2014). Un test negativo non implica necessariamente che nessuna variante causativa è presente nel DNA del paziente, ma può essere spiegato da problemi tecnici, difficoltà nell individuare specifiche mutazioni, o limitazioni interpretative. Quando il numero dei geni aumenta, in parallelo aumenta il numero di varianti nuove e di significato incerto. Questo fa sì che l analisi computazionale di WES richieda il confronto con un numero significativo di individui affetti. Un uso alternativo del WES è la ricerca di mutazioni de novo del DNA nel caso di trios, composti da un singolo bambino affetto ed entrambi i genitori non affetti o di quartet con un altro figlio (affetto o non affetto) (Lee et al., 2014). In realtà, l applicazione ideale del WES è scientifica e consiste nell identificazione di nuovi geni malattia, ma il WES ovviamente può essere usato ugualmente bene nello scoprire mutazioni note e prevedibili che sarebbero state comunque identificate con un metodo tradizionale mirato o con un pannello focalizzato, molto meno impegnativo e costoso, mentre per il targeted sequencing l applicazione ideale è nella diagnosi delle malattie genetiche eterogenee, riducendone l impegno ed i tempi di attesa rispetto ad un approccio tradizionale gene per gene. Diagnosi con WGS Già oggi esiste la possibilità di sequenziare i miliardi di basi di DNA di un WGS con costi di circa L idea di base è che sequenziare tutto il genoma significa avere un informazione completa che potrà essere utilizzata per molteplici scopi anche negli anni futuri, quando sarà più facile un analisi comparativa tra milioni di WGS. Tuttavia, anche se queste possibilità scientifiche sono affascinanti e ricevono sempre più l attenzione dell industria e importanti investimenti governativi e privati, sono ben oltre la portata di un esigenza diagnostica immediata e dall altro lato contengono alcuni rischi e difficoltà. La prima sorpresa è che il WGS ha circa il 25% di probabilità di identificare la cusa di una malattia genetica, valore molto deludente che indica quante varianti restano non sequenziate o non interpretate (Dewey et al., 2014). Tre decisioni prima di adottare l NGS L adozione dell NGS nella routine diagnostica pone tre principali questioni che devono essere affrontate e risolte prima di effettuare ogni procedura. 1) Il primo quesito è dato dalla scelta del pannello di geni. Questo potrà essere focalizzato ai singoli geni malattia o esteso, fino ad arrivare al WES o al WGS. Da questa decisione che incide sui tempi e sui costi del test dipende ogni altra considerazione successiva. Infatti, un test molto mirato è equivalente da un punto di vista etico alle tecniche tradizionali e spesso si conclude in un tempo accettabile con un referto di più semplice interpretazione. Tuttavia è evidente che più è ristretto il test minore è la possibilità di scoprire cause meno frequenti o nuove di malattia. 140

5 NGS in pediatria 2) La seconda decisione riguarda l analisi dei dati. Con differenti algoritmi si possono modulare le liste di varianti geniche riportate. Quest aspetto è di solito sottovalutato e lasciato al settore bioinformatico, ma dovrebbe essere valutato e concordato a priori. Infatti, c è la possibilità di richiedere valori di maggiore sensibilità a scapito della specificità o l inverso. Se la specificità è ridotta, le varianti potrebbero non essere confermate con sequenziamento tradizionale; se invece la sensibilità è ridotta alcune varianti causative potrebbero essere scartate all analisi. Anche questa scelta non è di facile soluzione. 3) La terza decisione riguarda soprattutto i pannelli che contengono molti geni, soprattutto il WES e il WGS: tra i dati potrebbero essere prodotte informazioni genetiche sensibili, non previste e non richieste. Queste riguardano varianti predittive di malattie che ancora non si sono manifestate clinicamente o varianti di suscettibilità allo sviluppo di neoplasie. Esiste una lista di geni prodotta dall American College dei genetisti medici (ACMG) in cui sono elencate tutte le possibili condizioni genetiche (Green et al., 2013) che è possibile diagnosticare incidentalmente tramite l utilizzo di WES. Considerato il tema della specificità, il dilemma è se cercare di fare una validazione per certificarne l esistenza o riportarle come tali o non indagarle. Cosa fare dopo l NGS Un punto cruciale per valutare l impatto di una variante genica è il confronto con banche dati di pazienti e controlli. Esistono databases on line che classificano varianti già riscontrate in patogeniche, di significato incerto o polimorfismi. Con tutte le riserve sulla qualità delle annotazioni di varianti patogeniche, è senz altro utile il confronto con l Human Gene Mutation Database (HGMD). Per stabilire le frequenze alleliche di ciascuna variante identificata è indispensabile la consultazione del sito web dell Exome Aggregation Consortium (EXAC, che riporta i dati relativi a individui. Altre iniziative internazionali, come Phenome Central (https:// phenomecentral.org/), mirano a fornire una piattaforma per la condivisione sicura dei dati. Il grande numero di geni e di trascritti alternativi dello stesso gene impone che nei referti diagnostici sia annotata la posizione univoca genomica della base mutata del DNA. Il riferimento universale è la sequenza denominata hg.19 e l annotazione dovrà indicare cromosoma: base. Ad esempio, la più nota variante patogenica alla base della fibrosi cistica (delta F508) sarà indicata come 7: ATCT/A. Pur tenendo conto della complessità interpretativa, l enorme potenziale dell NGS spiega perché queste stia diventando la metodica di prima scelta nei laboratori che si occupano di diagnostica molecolare (Vrijenhoek et al., 2015; Weiss et al., 2013). In futuro, inoltre, con molta probabilità,se saranno disponibili algoritmi di più facile interpretazione, la tecnologia NGS potrà essere applicata ai test di screening molecolari. Glossario genetico nell era dell NGS Il BAM è un file binario che corrisponde alla versione compressa di un file SAM. Il file BAM contiene le sequenze del DNA dopo l allineamento alla sequenza genomica di riferimento. Il file BAM contiene un intestazione (nome e lunghezza della sequenza) ed un allineamento che ne fornisce le specifiche di sequenza e qualità. I file BAM sono adatti per l analisi con un visualizzatore esterno come IGV o con il browser UCSC. Il Formato FASTQ è basato su caratteri di testo per l archiviazione di una sequenza associata a punteggi di qualità. Sia la sequenza sia il punteggio di qualità sono codificati con un singolo carattere ASCII. Recentemente è diventato lo standard dei dati NGS prodotti dai sequenziatori Illumina. Il formato Variant Call Format (VCF) serve a riportare i dati di sequenza in modo compatto, indicando solo le differenze rispetto alla sequenza di DNA di riferimento. Aplotipo: La combinazione di marcatori allelici consecutivi (può essere composta di polimorfismi o varianti rare) in una piccola regione cromosomica che difficilmente è separata da eventi di crossing-over. Copertura / profondità di copertura: il numero di sequenze indipendenti che leggono la stessa posizione nel genoma sequenziato. Target: sequenza di DNA selezionata dal genoma con tecniche di arricchimento. 141

6 V. Nigro Box di orientamento Cosa sapevamo prima Prima dell NGS si riteneva che alla base delle malattie genetiche vi fosse una mutazione in un solo gene e tutto il resto fosse più o meno stabile. Cosa sappiamo adesso Ogni individuo, sano o affetto, ha molte varianti patogeniche nel proprio genoma. Quali sviluppi si possono prevedere per il futuro La comprensione migliore della variabilità delle malattie genetiche e della suscettibilità genetica a malattie comuni. Bibliografia Acke FR, Malfait F, Vanakker OM, et al. Novel pathogenic COL11A1/COL11A2 variants in Stickler syndrome detected by targeted NGS and exome sequencing. Mol Genet Metab 2014;113: Aparisi MJ, Aller E, Fuster-García C, et al. Targeted next generation sequencing for molecular diagnosis of Usher syndrome. Orphanet J Rare Dis 2014;9:168. Baker MW, Atkins AE, Cordovado SK, et al. Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study. Genet Med. 2015;doi: / gim Cao YY, Qu YJ, Song F, et al. Fast clinical molecular diagnosis of hyperphenylalaninemia using next-generation sequencingbased on a custom AmpliSeq panel and Ion Torrent PGM sequencing. Mol Genet Metab 2014;113: Dames S, Chou LS, Xiao Y, et al. The development of next-generation sequencing assays for the mitochondrial genome and 108 nuclear genes associated with mitochondrial disorders. J Mol Diagn 2013;15: De Rocco D, Bottega R, Cappelli E, et al. Molecular analysis of Fanconi anemia: the experience of the Bone Marrow Failure Study Group of the Italian Association of Pediatric Onco-Hematology. Haematologica 2014;99: Dewey FE, Grove ME, Pan C, et al. Clinical interpretation and implications of whole-genome sequencing. JAMA 2014;311: Di Fruscio G, Schulz A, De Cegli R, et al. LYSOPLEX: an efficient toolkit to detect DNA sequence variations in the autophagy-lysosomal pathway. Autophagy 2015; in press. Green RC, Berg JS, Grody WW, et al. ACMG recommendations for reporting of incidental findings in clinical exome and genome sequencing. Genet Med 2013;15: Halbritter J, Diaz K, Chaki M, et al. High-throughput mutation analysis in patients with a nephronophthisis-associated ciliopathy applying multiplexed barcoded array-based PCR amplification and next-generation sequencing. J Med Genet 2012;49: Lee H, Deignan JL, Dorrani N, et al. Clinical exome sequencing for genetic identification of rare Mendelian disorders. JAMA 2014;312: Margulies M, Egholm M, Altman WE, et al. Genome sequencing in microfabricated high-density picolitre reactors. Nature 2005;437: Maruoka R, Takenouchi T, Torii C, et al. The use of next-generation sequencing in molecular diagnosis of neurofibromatosis type 1: a validation study. Genet Test Mol Biomarkers 2014;18: Savarese M, Di Fruscio G, Mutarelli M, et al. MotorPlex provides accurate variant detection across large muscle genes both in single myopathic patients and in pools of DNA samples. Acta Neuropathol Commun 2014;2:100. Vrijenhoek T, Kraaijeveld K, Elferink M, de Ligt J, et al. Next-generation sequencing-based genome diagnostics across clinical genetics centers: implementation choices and their effects. Eur J Hum Genet 2015;doi: / ejhg Weiss MM, Van der Zwaag B, Jongbloed JD, et al. Best practice guidelines for the use of next-generation sequencing applications in genome diagnostics: a national collaborative study of Dutch genome diagnostic laboratories. Hum Mutat 2013;34: Corrispondenza Vincenzo Nigro Dipartimento di Biochimica, Biofisica e Patologia Generale, Laboratorio di Genetica medica, Seconda Università degli Studi di Napoli, via Luigi De Crecchio 7, Napoli - NGS Facility, Telethon Institute of Genetics and Medicine (TIGEM), via Campi Flegrei 34, Pozzuoli (NA)

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale L evoluzione della professione tecnica tra robotica, automazione e nuove tecnologie

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Biotecnologie Mediche Prevenzione Diagnostica

Dettagli

Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica Corso postcongressuale XV congresso SIGU Come refertare e comunicare varianti genomiche Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA

Dettagli

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni L array-cgh: -riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni -ha un potere si risoluzione 100 volte superiore al cariotipo (100 Kb versus 10 Mb) Microarray-based

Dettagli

Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI

Dettagli

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY) http://www.molecularstation.com/molecular-biology-images/data/502/human-genome-gene.png

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Unità Operativa di GENETICA MEDICA

Unità Operativa di GENETICA MEDICA Unità Operativa di GENETICA MEDICA Direttore: Prof. Mario Savi LABORATORIO DI GENETICA MOLECOLARE Responsabile Prof. Tauro Neri. Servizi forniti: Definizione genotipica e diagnosi molecolare POSTNATALE

Dettagli

Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema

Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed Fare clic per modificare lo stile del sottotitolo dello schema La Fondazione Neuromed è un organizzazione relativamente giovane, nata nel

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

ANALISI GENETICHE. Biologia molecolare

ANALISI GENETICHE. Biologia molecolare ANALISI GENETICHE Biologia molecolare Via F. Ferrer 25/27-21052 Busto Arsizio (VA) - Italy Tel +39 0331 652911 - Fax +39 0331 652919 - www.tomalab.com TOMA_biologia_molecolare_scheda_CORR03.indd 1 06/04/2012

Dettagli

Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O.

Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O. Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O. Ospedali Galliera XVIII Congresso Nazionale Associazione Gulliver Monza 08 marzo

Dettagli

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica DSTB - Università degli Studi di Udine P.le Kolbe,1-33100 Udine - ITALIA

Dettagli

Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito

Dettagli

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE?

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? SCREENING NEONATALE GENETICO RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? Pietro Chiurazzi Istituto di Genetica Medica Facoltà di Medicina e Chirurgia Università Cattolica Associazione Culturale Giuseppe

Dettagli

Genetica, malattie rare e contesto familiare

Genetica, malattie rare e contesto familiare XXV Anniversario IRCCS E. Medea La salute del bambino tra genetica e neuroscienze Bosisio Parini, 11 dicembre 2010 Genetica, malattie rare e contesto familiare La genetica negli ultimi 25 anni Sequenziamento

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio

Dettagli

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS DIRECT SEQUENCING TTCACTGAGAGTCGC TCCCAATAAAAGTGACTCTCAGCGAGC TTCACTGAGAGTCGG TCCCAATAAAAGTGACTCTCAGCCAGC wt mut wt wt/mut mut The Sanger method 07_01.jpg

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA per l assegnazione di una borsa di studio a favore di candidati in possesso del Diploma di laurea specialistica o magistrale

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Watson & Crick DNA 1953 Tappe della GENETICA UMANA G. Mendel leggi dell

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Summer School 2015 Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Applicazioni della Next-Generation Sequencing con tecnologia Illumina Roberto Cusano 04-06

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

SCHEDA DEL DOCENTE - CV

SCHEDA DEL DOCENTE - CV Studi di Cagliari Corso di laurea INFORMAZIONI ANAGRAFICHE Nome: FEDERICA Cognome: INCANI Nato a:cagliari Il 19/10/1975 Indirizzo di Residenza: VIA BERNINI 6 CAGLIARI Tel.: Mail: feincani@yahoo.it Cell.:3284494008

Dettagli

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali Milano Marittima 05/06/2010 Dr. Francesco Pigliapoco Lab. Citogenetica A.O.U.-Salesi- Ancona Le sindromi DiGeorge

Dettagli

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Documento di indirizzo sull impiego di indagini prenatali non invasive

Documento di indirizzo sull impiego di indagini prenatali non invasive Documento di indirizzo sull impiego di indagini prenatali non invasive Premessa La diagnosi prenatale delle malattie monogeniche e delle aneuploidie è attualmente eseguita nel I-II trimestre di gravidanza

Dettagli

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica - Facoltà di Medicina e Chirurgia PUGD - Università degli Studi di Udine

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Verbale n. 4: Prove didattiche

Verbale n. 4: Prove didattiche Verbale n. 4: Prove didattiche Il giorno 25.10.2011 alle ore 8,30 presso la sede dell Università degli Studi Parthenope di Napoli, in Via Acton 38, si riunisce in quarta seduta la Commissione Giudicatrice,

Dettagli

Diagnosi delle aneuploidie

Diagnosi delle aneuploidie Diagnosi delle aneuploidie DIAGNOSI PRENATALE NON INVASIVA: UNA RIVOLUZIONE La diagnosi prenatale delle malattie monogeniche e delle aneuploidie Bologna, è attualmente 6 Giugno eseguita2014 nel I-II trimestre

Dettagli

Polymerase chain reaction (PCR)

Polymerase chain reaction (PCR) Polymerase chain reaction (PCR) La reazione a catena della polimerasi (PCR) ha di fatto rivoluzionato la genetica molecolare, con la possibilità di analizzare e clonare velocemente il DNA. E un metodo

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013 La sindrome di Lynch Cancro colonrettale ereditario non poliposico o HNPCC G. A. Pablo Cirrone 1 Caratteristiche generali I HNPCC (Hereditary Non-Polyposis Colonrectal Cancer) è caratterizzato dalla comparsa,

Dettagli

Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza

Dettagli

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE EREDITA MENDELIANA CLASSICA ~ 600 E C M 10.000 Enzimi

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Biobanca Genetica per Malattie Rare Scheletriche

Biobanca Genetica per Malattie Rare Scheletriche Biobanca Genetica per Malattie Rare Scheletriche Luca Sangiorgi S.S.D. di Genetica Medica e Malattie Rare Ortopediche, Istituto Ortopedico Rizzoli Bologna SSD di Genetica Medica IOR Roma, 25 settembre

Dettagli

Lezioni di genetica medica. Specializzazioni 2014

Lezioni di genetica medica. Specializzazioni 2014 Lezioni di genetica medica Specializzazioni 2014 Programma, parte 1 genetica umana generale Il genoma umano: geni ed organizzazione Next generation sequencing (NGS), l'exoma Eterogeneità clinica ed eterogeneità

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

Prospettive e funzioni dell Informatica avanzata nel settore delle biotecnologie

Prospettive e funzioni dell Informatica avanzata nel settore delle biotecnologie Prospettive e funzioni dell Informatica avanzata nel settore delle biotecnologie Roberta Gioia Celano Auditorium 20 November 2014 Company profile Ylichron, Spin Off dell ENEA, è stata costituita nel 2005

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

DAI TEST GENETICI AL RISCHIO DI MALATTIA

DAI TEST GENETICI AL RISCHIO DI MALATTIA DAI TEST GENETICI AL RISCHIO DI MALATTIA Conosciamo il nostro Genoma Varese, 20 aprile 2013 Elisabetta Lenzini LE TAPPE DELLA 1953 Watson and Crick Struttura del DNA 1956 Tijo e Levan Cariotipo 46 cr 1959

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

GUARDA OLTRE L'ARRAY

GUARDA OLTRE L'ARRAY GUARDA OLTRE L'ARRAY HaloPlex per l'arricchimento mirato in NGS Sonde SureFISH Microarray SurePrint CGH+SNP UNA SOLA AZIENDA, INFINITE APPLICAZIONI LEADER NELL'ANALISI MOLECOLARE E NELLA RICERCA SCIENTIFICA

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

La prevenzione: un piano regionale per la Puglia. Perché?

La prevenzione: un piano regionale per la Puglia. Perché? La prevenzione: un piano regionale per la Puglia. Perché? Rita Fischetto Referente Genetica Clinica U.O.C. Malattie Metaboliche Diabetologia A.O.U. Policlinico-Giovanni XXIII Bari -CRESCITA CONOSCENZE

Dettagli

www.analisicimatti.it

www.analisicimatti.it Il Laboratorio Cimatti da sempre attento alla innovazione tecnologica e allo sviluppo di Eccellenze nella diagnostica prenatale è partner di Bioscience Genomics, uno spin off accademico partecipato dall

Dettagli

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

"Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là".

Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là. Lentamente muore chi diventa schiavo dell'abitudine, ripetendo ogni giorno gli stessi percorsi, chi non cambia la marca, chi non rischia e cambia colore dei vestiti, chi non parla a chi non conosce. Muore

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

"Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple VIII Incontro-Convegno A.C.A.R 2006-2016: DIECI ANNI DI A.C.A.R. Montecatini Terme (PT), 16 Aprile 2016 A.C.A.R "Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Dettagli

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene eseguita su cellule

Dettagli

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Ereditarietà delle PSE e counselling genetico Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Paraparesi

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI SICURO: Eseguito su un semplice prelievo di sangue materno COMPLETO: Trisomia 21 (Sindrome di

Dettagli

Diagnosi prenatale di aneuploidie fetali da DNA fetale circolante nel plasma materno

Diagnosi prenatale di aneuploidie fetali da DNA fetale circolante nel plasma materno Diagnosi prenatale di aneuploidie fetali da DNA fetale circolante nel plasma materno Francesca Torricelli SOD Diagnostica Genetica AOU- Careggi Firenze torricellif@aou-careggi.toscana.it Pievesestina,

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633

Dettagli

UNIVERSITÀ DEGLI STUDI DI PAVIA Servizio Qualità della Didattica e Servizi agli Studenti

UNIVERSITÀ DEGLI STUDI DI PAVIA Servizio Qualità della Didattica e Servizi agli Studenti All. B al bando di ammissione pubblicato in data 16/11/2015 ART. 1 - TIPOLOGIA L Università degli Studi di Pavia attiva, per l a.a. 2015/2016, il Master Universitario di II livello in Genetica Oncologica,

Dettagli

Raccolta e analisi di letteratura scientifica su studi genomici di popolazioni umane con riguardo alla condivisione dei dati sperimentali

Raccolta e analisi di letteratura scientifica su studi genomici di popolazioni umane con riguardo alla condivisione dei dati sperimentali DEFINIZIONE DI UNA OPEN ACCESS POLICY PER GLI ISTITUTI SCIENTIFICI Raccolta e analisi di letteratura scientifica su studi genomici di popolazioni umane con riguardo alla condivisione dei dati sperimentali

Dettagli

Carta dei Servizi (v.1.4)

Carta dei Servizi (v.1.4) Carta dei Servizi (v.1.4) Cancer Genetic Test Laboratory (CGT Lab) Gentili Signori, Il Laboratorio Cancer Genetic Test (CGT Lab), Servizio di medicina di laboratorio specializzato senza punto di prelievo,

Dettagli

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott.

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott. CONSENSO INFORMATO PER DIAGNOSI GENETICA PRE-IMPIANTO (PGD)* PER MALATTIE GENETICHE EREDITARIE O ALTERAZIONI CROMOSOMICHE NUMERICHE E/O STRUTTURALI SBILANCIATE. *(Preimplantation Genetic Diagnosis) Ai

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

CATCH 22 altre indagini genetiche nel counceling dopo diagnosi di malformazioni fetali. Silvia Sansavini

CATCH 22 altre indagini genetiche nel counceling dopo diagnosi di malformazioni fetali. Silvia Sansavini CATCH 22 altre indagini genetiche nel counceling dopo diagnosi di malformazioni fetali Silvia Sansavini CATCH 22 FIBROSI CISTICA DISTROFIA MIOTONICA CATCH 22: microdelezione 22q11 Diagnosi Counceling Diagnosi

Dettagli