Bioinformatica. Marin Vargas, Sergio Paul

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Bioinformatica. Marin Vargas, Sergio Paul"

Transcript

1 Bioinformatica Marin Vargas, Sergio Paul 2013

2 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici.

3 La bioinformatica è la disciplina scientifica che cerca di risolvere problemi biologici mediante l elaborazione informatica dell informazione proveniente diretta o indirettamente da essere viventi. Tipi di informazione: Sequenze genomiche (DNA genomico: genomi, esomi o alcune regioni particolari del genoma). Sequenze proteiche (cdna cioè DNA retrotrascritto a partire da un mrna). Strutture 3D di proteine (NMR, Cristallografia), biologia strutturale. Immagini(RX,TAC,MRI,US,ecc). Concentrazioni di particelle nel sangue. Informazione di interazione tra molecole(systems biology). Informazione evoluzionistica. Pulsazioni, respiri, battiti cardiaci, ecc...

4

5 La genomica è una branca della biologia molecolare che si occupa dello studio del genoma degli organismi viventi. In particolare si occupa della struttura, contenuto, funzione ed evoluzione del genoma. È una scienza che si basa sulla bioinformatica per l'elaborazione e la visualizzazione dell'enorme quantità di dati che produce.

6 Estrazione e/o cattura di DNA da essere viventi. Sequenziamento del DNA con tecniche all avanguardia come NGS (Next Generation Sequencing). AssemblaggiodigenomiapartiredamilionidiframmentidiDNA. Ri-sequenziamento di genomi. Allineamento di frammenti di DNA a un genoma di riferimento. Annotazione di genomi. Annotazione funzionale di geni all interno di un genoma. Analisi di espressione genica mediante sequenziamento dei trascritti(rna-seq). GWAS (Genome Wide Association Studies). Analisi di varianti tra genomi (Variant calling o Chiamata delle varianti).

7 Ottimizzazione del protocollo bioinformatico per l annotazione di geni codificanti proteine in genomi complessi Marin Vargas, Sergio Paul 2012

8 Con l avvento del sequenziamento NGS a costi sempre più contenuti, il numero di genomi sequenziati si sta incrementando considerevolmente. Lo scopo di conoscere la sequenza genomica è principalmente indirizzato a capire la funzionalità dei geni. In passato l annotazione di un genoma era molto dispendiosa. Oggi con le nuove tecnologie, è diventata alla portata di un singolo laboratorio. Rimane comunque un compito molto impegnativo.

9 Annotare un genoma significa conoscere la localizzazione, la struttura e la funzionalità di tutti gli elementi che compongono l intero genoma: Geni codificanti proteine Geni non codificanti proteine Elementi regolatori Elementi ripetuti Pseudogeni Altri elementi

10 L annotazione dei geni codificanti proteine, viene suddivisa in: Annotazione funzionale, consiste nel caratterizzare ogni singolo gene, assegnando una funzione biologica a ogni proteina codificata dal gene stesso. Annotazione genica o semplicemente annotazione, consiste nel definire all interno del genoma: La localizzazione di ciascun gene. La struttura di ciascun gene (esoni, CDS, UTR). Gli eventuali trascritti alternativi.

11 Cap 5 mrna maturo 3 Poly-A AAAAAA UTR CDS UTR 5 3 Esone 1 Esone 2 Esone 3 3 ATG DNA STOP! 5

12 Un gene codificante proteine è composto da diversi elementi: Esone: regione che viene mantenuta dopo la maturazione. Introne: regione che viene eliminata durante la maturazione. mrna: RNA maturo, composto da esoni. CDS: regione codificante dell mrna. UTR: regione non tradotta dell mrna.

13

14 Metodi basati sull allineamento delle evidenze sperimentali. Metodi basati sulla predizione genica ab initio. Metodi basati sulla predizione genica ab initio guidata da evidenze sperimentali. Metodi basati sul confronto tra genomi. 5

15 Si possono utilizzare diverse evidenze sperimentali, che opportunamente elaborate e allineate al genoma permettono di identificare le regioni codificanti proteine: cdna full-length: sequenze di RNA maturi (mrna) retrotrascritti a cdna, quindi completo di UTR e CDS. EST (Expressed Sequence Tags): brevi frammenti parziali, tra bp, di mrna retrotrascritti a cdna. Proteine omologhe: sequenze aminoacidiche corrispondenti a proteine omologhe di organismi evolutivamente vicini. Tiling arrays: microarray con sonde equamente spaziate su tutto il genoma, permettono l identificazione di regione espresse mediante l ibridazione di campione marcati. MPSS: Massively Parallel Signature Sequencing, piattaforma che analizza il livello di espressione e identifica una regione di bp degli mrna tramite sequenziamento. RNA-seq: frammenti di cdna di lunghezza tra bp che derivano dal sequenziamento shotgun di un intero trascrittoma.

16 Sono dei brevi frammenti di lunghezza tra bp di cdna ottenuto dalla retrotrascrizione di un frammento di RNA maturo.

17 Dalla sequenza proteica delle proteine si può risalire alla sequenza nucleotidica e quindi alla zona codificante (CDS) del gene che l ha codificata.

18 Sono sequenze di lughezza tra bp che derivano dal sequenziamento shotgun di un intero trascrittoma, cioè dalla retro-trascrizione di tutto l RNA in cdna di un particolare momento cellulare, poi spezzato e sequenziato con tecnologie NGS.

19

20 Predittore Predizione ab initio Predizione di geni eucarioti Training in locale per nuovi genomi Utilizzo di EST e Proteine per la predizione Utilizzo di RNA-Seq per la predizione Predizione degli UTR Predizione dei trascritti alternativi Augustus SI SI SI SI SI SI SI Snap SI SI SI NO NO NO NO GeneMark-ES SI SI NO NO NO NO NO GeneID SI SI SI SI SI SI SI FGenesh SI SI SI NO NO NO NO Genescan SI SI NO SI SI SI NO MZEF SI SI NO NO NO NO NO mgene.ngs SI SI SI SI SI SI NO Contrast SI SI SI SI NO SI NO GrailExp SI SI NO SI NO SI NO TwinScan/N-Scan SI SI SI SI NO NO SI

21 Predizione genica ab initio: utilizza dati di training che potrebbero non essere rappresentativi di tutti i geni del genoma. Evidenze sperimentali: non coprono mai tutto il genoma, quindi non permettono l annotazione completa di tutti i geni codificanti proteine. I migliori metodi di predizione genica utilizzano una metodologia ibrida tra predizione genica ab initio e l utilizzo degli allineamenti delle evidenze sperimentali: cdna EST Proteine RNA-Seq

22 Creazione di un consensus utilizzando le evidenze sperimentali e le predizioni geniche. Ciascuna evidenza viene pesata dando un peso maggiore ai dati sperimentali rispetto alle predizioni. Principali programmi di integrazione: Evidence Modeller JIGSAW GAZE

23 Basate su automazione di programmi di predizione e allineamento esistenti. Vantaggio: relativamente semplici da utilizzare. Svantaggio: consentono un controllo limitato dei passaggi intermedi dell annotazione. Pipeline di annotazione più utilizzate: PASA MAKER

24 L ottimizzazione del protocollo bioinformatico per l annotazione dei geni codificanti proteine in genomi complessi. A questo scopo non verrà utilizzata una pipeline automatica di annotazione ma, attraverso la scelta di metriche adeguate, verrà valutato ogni singolo passaggio intermedio dell annotazione in modo da fornire una procedura ottimizzata sulla base delle evidenze sperimentali a disposizione.

25 Genoma dell organismo eucariote Vitis vinifera, versione V1 PN X del consorzio French-Italian Public Consortium for Grapevine Genome, con una dimensione di 487 Mb. Motivi di questa scelta: Il genoma è disponibile. Ci sono dati sperimentali disponibili (EST, 454, RNA-Seq, cdna full-length).

26 contig di cdna full-length prodotte dal consorzio French- Italian Public Consortium for Grapevine Genome 3752 cdna non ridondanti. Rimozione delle sequenze con ORF non completa sequenze. Le sequenze sono state suddivise in due gruppi in maniera del tutto casuale: 936 sequenze di cdna full-length training sequenze di cdna full-length test.

27 EST: sequenze EST pubbliche (NCBI, Sequenziamento banca dati del consorzio). Allineamento e generazione modelli genici con Gmap trascritti putativi ridondati ( non ridondanti). Proteine omologhe: Allineamento al genoma delle sequenze proteiche di tutto il database SWISSPROT utilizzando Blat, Blast e Genewise trascritti putativi ridondanti (5.808 non ridondanti). RNA-seq: reads RNA-seq sequenziati dal laboratorio di genomica dell Università di Verona (pool di 45 campioni provenienti da 15 tessuti e organi a diversi stadi di sviluppo). Allineamento e generazione modelli genici con suite Bowtie + Tophat + Cufflinks trascritti putativi ridondanti ( non ridondanti).

28 Statistiche generali degli allineamenti delle evidenze sperimentali Statistiche generali EST Proteine omologhe RNA-seq Numero di modelli genici allineati Numero di modelli genici multi esonici Media della lunghezza dei modelli genici 1.034,12 874, ,89 N50 della lunghezza dei modelli genici Media del numero di esoni per modello genico 3,30 4,39 6,75 Distribuzione della percentuale di sovrapposizione di nucleotidi tra allineamenti e riferimento

29 Ho scelto i seguenti programmi di predizione genica, nei quali è stato realizzato il training con dati sperimentali di Vitis vinifera: Augustus: supporta suggerimenti da evidenze sperimentali. GeneID: supporta suggerimenti da evidenze sperimentali. SNAP: realizza solo predizione ab initio. Sono state realizzate le seguenti predizioni: Augustus ab initio GeneID ab initio SNAP ab initio Augustus con suggerimenti RNA-seq GeneID con suggerimenti RNA-seq I risultati delle predizioni sono state filtrati secondo: Eliminazione di tutte le predizioni di geni monoesonici (predizioni meno affidabili rispetto alle predizioni di geni multiesonici). Eliminazione di tutte le predizioni di geni con lunghezza della regione esonica inferiore a 200 basi.

30 Statistiche generali delle predizioni ab initio Statistiche generali Augustus ab initio GeneID ab initio SNAP ab initio Numero di geni predetti Media della lunghezza dei geni 1.122,73 977, ,27 N50 della lunghezza dei geni Media del numero di esoni per gene 4,44 4,34 6,14 Distribuzione della percentuale di sovrapposizione tra predizioni e riferimento

31 Statistiche generali delle predizioni guidate da evidenze sperimentali Statistiche generali Augustus con RNA-seq GeneID con RNA-seq Numero di geni predetti Media della lunghezza dei geni 1.134, ,43 N50 della lunghezza dei geni Media del numero di esoni per gene 4,74 4,30 Distribuzione della percentuale di sovrapposizione di nucleotidi tra predizioni e riferimento

32 Le statistiche generali da sole non consentono di valutare adeguatamente le differenze tra le predizioni, si rende quindi necessario fare una valutazione quantitativa dell accuratezza. Sensibilità(SN) ed Specificità(SP): Sensibilità misura quanto il predittore è in grado di fare predizioni. Specificità misura quanto il predittore predice in modo corretto. Accuratezza(AC): AC = (SN + SP) / 2

33 Tre livelli d indagine: Locus genico: misura la capacità dirilevarelapresenzadiunlocus. Regioni esoniche, misura la capacità di distinguere tra esoni e introni. Giunzioni esone-introne, misura la capacità di predire in maniera corretta la struttura dei geni.

34 Confronto degli allineamenti e delle predizioni contro il dataset di riferimento (loci genici) Evidenze EST 0,5680 0,6428 0,6054 Sensibilità Specificità Accuratezza Proteine omologhe 0,1872 0,6047 0,3960 RNA-seq 0,6140 0,7362 0,6751 Augustus ab initio 0,4612 0,5644 0,5128 GeneID ab initio 0,4852 0,4632 0,4742 SNAP ab initio 0,5640 0,4297 0,4969 Augustus con suggerimenti RNA-seq 0,5656 0,6727 0,6192 GeneID con suggerimenti RNA-seq 0,4884 0,4639 0,4762

35 Confronto degli allineamenti e delle predizioni contro il dataset di riferimento (r. esoniche) Evidenze Sensibilità Specificità Accuratezza EST 0,9342 0,6054 0,7698 Proteine omologhe 0,1732 0,9203 0,5468 RNA-seq 0,7334 0,6413 0,6874 Augustus ab initio 0,4489 0,8022 0,6256 GeneID ab initio 0,5245 0,7744 0,6495 SNAP ab initio 0,5459 0,6688 0,6074 Augustus con suggerimenti RNA-seq 0,5078 0,8502 0,6790 GeneID con suggerimenti RNA-seq 0,5296 0,7413 0,6355

36 Confronto degli allineamenti e delle predizioni contro il dataset di riferimento (giunzioni) Evidenze Sensibilità Specificità Accuratezza EST 0,5566 0,4747 0,5157 Proteine omologhe 0,2493 0,8794 0,5644 RNA-seq 0,8723 0,9507 0,9115 Augustus ab initio 0,6260 0,8347 0,7304 GeneID ab initio 0,6881 0,7536 0,7209 SNAP ab initio 0,5840 0,4538 0,5189 Augustus con suggerimenti RNA-seq 0,7875 0,9112 0,8494 GeneID con suggerimenti RNA-seq 0,6943 0,7521 0,7232

37 Annotazione finale realizzata con Evidence Modeller, che permette di combinare i risultati delle predizioni e delle evidenze sperimentali in un unica annotazione finale mediante l assegnazione di pesi. Livelli d indagine Pesi EVM assegnati Annotazione 1 Annotazione 2 Annotazione 3 EST Proteine RNA-seq Augustus ab initio GeneID ab initio SNAP ab initio Augustus con suggerimenti RNA-seq GeneID con suggerimenti RNA-seq Statistiche generali Annotazione 1 Annotazione 2 Annotazione 3 Numero di geni Media della lunghezza dei geni 1.119, , ,56 N50 della lunghezza dei geni Media dei numero di esoni per gene 4,34 4,77 4,72 Annotazione 1 Annotazione 2 Annotazione 3 Sensibilità Specificità Accuratezza Sensibilità Specificità Accuratezza Sensibilità Specificità Accuratezza Identificare i loci genici 0,4396 0,6276 0,5336 0,5620 0,6768 0,6194 0,5600 0,6760 0,6180 Identificare le regione esoniche 0,4119 0,8110 0,6115 0,5012 0,8492 0,6752 0,5008 0,8544 0,6776 Identificare le giunzioni esone-introne 0,5698 0,8383 0,7041 0,7768 0,9093 0,8431 0,7769 0,9132 0,8451

38 Le statistiche generali non sono sufficienti a valutare le differenze tra le diverse predizioni, è necessario valutarne l accuratezza. È importate definire metriche adeguate per valutare l accuratezza di una predizione sotto diversi aspetti. Predittori con accuratezza simile per alcuni aspetti, mostrano un grado di accuratezza completamente diverso per altri. Utilizzare RNA-Seq, che sono ottenibili a costi ridotti e in tempi brevi, come suggerimento per i predittori può migliorare sostanzialmente la predizione a seconda del software utilizzato. È possibile realizzare un annotazione finale con poche predizioni accurate, consentendo un significativo risparmio di tempo computazionale. Valutare ogni singolo passaggio del protocollo di annotazione permette di avere un annotazione finale ottimizzata.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Analisi dell intero trascrittoma (WTA)

Analisi dell intero trascrittoma (WTA) Analisi dell intero trascrittoma (WTA) Obiettivi Questa procedura ha l obiettivo di esplorare, tramite sequenziamento, in modo quantitativo e senza ipotesi a priori l intera popolazione dei lunghi RNA

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida

Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida Applicazione di tecniche innovative di RNA-Seq per lo studio dei meccanismi di azione di un biofungicida R.M. De Miccolis Angelini, D. Digiaro, C. Rotolo, S. Pollastro, F. Faretra Dipartimento di Scienze

Dettagli

Analisi di dati RNA-Seq. Alberto Ferrarini

Analisi di dati RNA-Seq. Alberto Ferrarini Analisi di dati RNA-Seq Alberto Ferrarini Il dogma centrale della biologia molecolare DNA Replicazione RNA Trascrizione Traduzione PROTEIN Geni sono trascritti da DNA ad mrnache lascia il nucleo e viene

Dettagli

strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà Bioinformatica Analisi del trascrittoma Dott. Alessandro Laganà Analisi del trascrittoma Regolazione dell espressione genica I microarray cdna microarray Oligo microarray Affymetrix Chip Analisi dei dati

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Elementi di Bioinformatica per lʼanalisi di dati NGS

Elementi di Bioinformatica per lʼanalisi di dati NGS Corso di Alta formazione in Elementi di Bioinformatica per lʼanalisi di dati NGS 21-23 Settembre 2011 Centro Didattico Morgagni Viale Morgagni 40, Firenze Presentazione del corso Il corso di alta formazione

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini Università di Bologna Dipartimento di Medicina Clinica Specialistica e Sperimentale Sezione di Microbiologia RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI

Dettagli

Caccia al gene della Fibrosi Cistica

Caccia al gene della Fibrosi Cistica Caccia al gene della Fibrosi Cistica Scenario e simulazione di consulenza genetica Siete un genetista medico e lavorate in un consultorio genetico. Si presenta da voi una coppia che richiede consulenza

Dettagli

scaricato da www.sunhope.it LA TECNOLOGIA DEI MICROARRAYS

scaricato da www.sunhope.it LA TECNOLOGIA DEI MICROARRAYS LA TECNOLOGIA DEI MICROARRAYS 1 8 anni dopo: 4162 riferimenti bibliografici sui microarrays I microarrays misurano il livello di espressione degli mrna trascritti dai geni del sistema biologico di interesse

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

TUTTI UGUALI, TUTTI DIVERSI Caccia al gene

TUTTI UGUALI, TUTTI DIVERSI Caccia al gene Centro Università di Milano-Scuola per la diffusione delle bioscienze e delle biotecnologie www.cusmibio.unimi.it TUTTI UGUALI, TUTTI DIVERSI Caccia al gene 1 Tutti uguali, tutti diversi Caccia al gene

Dettagli

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL Alcuni aspetti legati al calcolo bioinformatico su CRESCO Giuseppe Aprea UTMEA-CAL Principali attività bioinformatiche ENEA legate al calcolo Assemblaggio de Novo* Trascrittomica Analisi filogenetica Metagenomica*

Dettagli

BIOLOGA e BIOLOGO MOLECOLARE

BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

L espressione genica e il trascrittoma

L espressione genica e il trascrittoma L espressione genica e il trascrittoma Genoma Insieme delle informazioni genetiche che caratterizzano un organismo. Trascrittoma Insieme degli RNA messaggeri prodotti da una determinata popolazione cellulare.

Dettagli

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Sperimenta il BioLab

Sperimenta il BioLab Progetto Sperimenta il BioLab Centro Università di Milano - Scuola per le Bioscienze e le Biotecnologie http://www.cusmibio.unimi.it/ I laboratori del Cus-Mi-Bio dedicati a "SPERIMENTA IL BIOLAB" si trovano

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA per l assegnazione di una borsa di studio a favore di candidati in possesso del Diploma di laurea specialistica o magistrale

Dettagli

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Summer School 2015 Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Applicazioni della Next-Generation Sequencing con tecnologia Illumina Roberto Cusano 04-06

Dettagli

Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013

Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013 1. Tabella degli insegnamenti Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013 Insegnamento SSD CFU Risultati di apprendimento previsti Applicazioni Web per la Biomedicina MED/04

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA 1 I PROGETTI OMICI Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA Studia il contenuto in mrna di una cellula (in differenti fasi di sviluppo, in risposta a vari stimoli o a

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Analisi del DNA genomico mediante Southern Blot Hybridization

Analisi del DNA genomico mediante Southern Blot Hybridization Analisi del DNA genomico mediante Southern Blot Hybridization Permette la mappatura dei siti di restrizione attorno al frammento di DNA genomico per il quale si dispone di una sonda specifica a) Il DNA

Dettagli

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà Bioinformatica RNA non codificanti ed RNAi Dott. Alessandro Laganà Piccoli RNA non codificanti Struttura dell RNA RNA regolatore microrna RNAi e sirna 2 Bioinformatica: RNA non codificanti ed RNAi L RNA

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

Allineamento di sequenze di DNA e proteine: possibilità, limiti ed interpretazione

Allineamento di sequenze di DNA e proteine: possibilità, limiti ed interpretazione ATTENZIONE: lo sfondo giallo NON riguarda parti più importanti ma evidenzia solo parti di testo (frasi, paragrafi) aggiornate (correzioni, miglioramento dello stile, o aggiunta di note o esempi per chiarire

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare Facoltà di Ingegneria dell Informazione Laurea Specialistica e Magistrale in Ingegneria Informatica Facoltà di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica

Dettagli

IL RUOLO DELLE MOLECOLE DI RNA ANTISENSO NELLA REGOLAZIONE DELL ESPRESSIONE GENICA IN EUCARIOTI

IL RUOLO DELLE MOLECOLE DI RNA ANTISENSO NELLA REGOLAZIONE DELL ESPRESSIONE GENICA IN EUCARIOTI IL RUOLO DELLE MOLECOLE DI RNA ANTISENSO NELLA REGOLAZIONE DELL ESPRESSIONE GENICA IN EUCARIOTI Slide 9 I RIBOZIMI: La scoperta di RNA dotati di attività catalitica ha profondamente cambiato la visione

Dettagli

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences Il DNA e la cellula Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Biologi molecolari in classe BIOLOGIA IN EVOLUZIONE. Alters & Alters. Centro Università di Milano - Scuola per la diffusione delle Bioscienze

Biologi molecolari in classe BIOLOGIA IN EVOLUZIONE. Alters & Alters. Centro Università di Milano - Scuola per la diffusione delle Bioscienze Alters & Alters BIOLOGIA IN EVOLUZIONE Comprendere la vita Biologi molecolari in classe a cura di Giovanna Viale e Cinzia Grazioli Centro Università di Milano - Scuola per la diffusione delle Bioscienze

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli