Dimensione: px
Iniziare la visualizzazioe della pagina:




2 Programma Banche dati proteiche. Interrogazione delle banche dati. Allineamento di sequenze proteiche. Matrici di sostituzione. Allineamento con gap. Allineamento globale e locale. BLAST e FASTA. Allineamento multiplo. Visualizzazione degli allineamenti. Applicazioni dei profili di multiallinemento. Ricerca di pattern e motivi funzionali nelle proteine. Banche dati dei profili proteici. Filogenesi molecolare. L orologio molecolare. Analisi della struttura primaria delle proteine. Struttura secondaria delle proteine. Strumenti per la predizione della struttura secondaria. Visualizzazione tridimensionale delle proteine. Strumenti per la proteomica. RasMol. Swiss PDB Viewer. Strumenti per la predizione della struttura tridimensionale. Homology modelling. Interazione tra proteine. Docking. Testi consigliati: G.Valle et al. Introduzione alla bioinformatica Zanichelli A.Tramontano Bioinformatica - Zanichelli

3 Cos è la bioinformatica E una scienza multidisciplinare che integra conoscenze informatiche, chimiche, matematiche, biologiche allo scopo di collezionare ed elaborare sistematicamente ogni informazione per ottenere la massima resa dalle ricerche sperimentali ma anche per sviluppare queste ultime in modo più mirato. Grazie alla bioinformatica è possibile avere uno sguardo d insieme su tutte le conoscenze scientifiche e da questo partire per ulteriori osservazioni sia mediante metodi informatici, sia mediante metodi sperimentali.

4 Chi si occupa di bioinformatica può appartenere a due categorie principali: SVILUPPATORI: coloro che si occupano di creare nuovi strumenti informatici per l analisi scientifica UTENTI: coloro che utilizzano gli strumenti bioinformatici per ottenere dati e da questi partire per l analisi sperimentale vera e propria. il programma che si utilizza può definirsi il metodo sperimantale della bioinformatica le banche dati posso definirsi il materiale sperimentale utilizzato dalla bioinformatica

5 Banche dati Si possono raggruppare in quattro categorie principali: - di biosequenze (dette anche primarie) - genomiche - di espressione genica - proteiche Nel corso verranno trattate le banche dati proteiche anche se non bisogna dimenticare che molti dati sulle proteine derivano dalle banche dati primarie, cioè quelle nucleotidiche.

6 Data una sequenza nucleotidica è possibile tradurla utilizzando tutti e tre i frame di lettura (+1, +2, +3) di entrambi i filamenti (senso e antisenso), allo scopo di individuare una Open Reading Frame (ORF) +1 cioè una sequenza proteica di lungheza adatta ad essere una proteina (non meno di residui). In questo modo, e con programmi appositi che scansionano tutto un genoma, è possibile trovare tantissime proteine PUTATIVE, cioè possibili ma non verificate Traduzione in silico T R M P L S L S M G M P I V H I H S N A N A S L S F D G Y A N C P H S L E R E C L S L F R W V C Q L S T F T R 1 gaacgcgaatgcctctctctctttcgatgggtatgccaattgtccacattcactcgt F A F A E R E K S P Y A L Q G C E S T R S H R E R K R H T H W N D V N V R V R I G R E R E I P I G I T W M * E

7 Il codice genetico Si definisce DEGENERATO e RIDONDANTE. E composto da 64 diversi codoni che codificano i 20 amino acidi. La tebella accanto mostra le varie degenerazioni dei codoni per ogni amino acido. Alanine Ala A GC[CATG] Cysteine Cys C TG[CT] Aspartic AciD Asp D GA[CT] Glutamic Acid Glu E GA[AG] Phenylalanine Phe F TT[CT] Glycine Gly G GG[CATG] Histidine His H CA[CT] Isoleucine Ile I AT[CAT] Lysine Lys K AA[AG] Leucine Leu L CT[CATG], TT[AG] Methionine Met M ATG AsparagiNe Asn N AA[CT] Proline Pro P CC[CATG] Glutamine Gln Q CA[AG] ARginine Arg R CG[CATG], AG[AG] Serine Ser S TC[CTAG], AG[CT] Threonine Thr T AC[CATG] Valine Val V GT[CATG] Tryptophan Trp W TGG TYrosine Tyr Y TA[CT] STOP - - TA[AG], TGA

8 Trascrizione Aminoacil-tRNA trna rrna mrna RBS----ATG AAA TAC TAA Struttura primaria Sintesi proteica Struttura secondaria Folding Struttura terziaria

9 Gli amino acidi Sono composti organici che presentano almeno un gruppo carbossilico (-COOH) a funzione acida e un gruppo aminico (-NH 2 ) a funzione basica Le proteine sono composte soltanto da alfa-amino acidi, legati tra loro mediante legami detti PEPTIDICI che si instaurano tra il COOH e l NH 2. Ciò che diversifica i vari amino acidi è la catena laterale legata al carbonio alfa, che può conferire all amino acido caratteristiche chimico-fisiche diverse.

10 In base alla catena laterale si riconoscono 5 gruppi principali di amino acidi Acidi Basici Strutturali Polari non carichi Idrofobici Aromatici

11 I polimeri di alfa amino acidi (le proteine) sono influenzati dalle caratteristiche chimico-fisiche delle catane laterali e in base a principi di interazioni deboli di tipo idrofobico o elettrostatico si osservano dei ripiegamenti, fino al raggiungimento della minor energia termodinamica. Questo processo, denominato FOLDING, è alla base del funzionamento delle proteine, visto che solo se sono correttamente strutturate esse assumeranno la loro forma e soprattutto FUNZIONE definitiva. La strutturazione delle proteine dipende quindi principalmente dalla sequenza dei residui che la compongono, oltre che dall ambiente in cui si strutturano

12 Struttura delle proteine Il legame peptidico ha delle caratteristiche di doppio legame e costringe i due atomo adiacenti a giacere sullo stesso piano. La rotazione della molecola avviene intorno al carbonio alfa, ma non tutti gli angoli di rotazione sono permessi a causa degli ingombri sterici delle diverse catene laterali e dello scheletro stesso.

13 Il legame peptidico genera una polarità negli scheletri proteici per cui si vengono a formare PONTI IDROGENO tra gli idrogeni dei gruppi amidici e ossigeni dei carbonili. Queste interazioni deboli portano la struttura primaria della proteina (la sequenza dei suoi residui) a ripiegarsi in una STRUTTURA SECONDARIA in cui sono riconoscibili due formazioni 1- Alfa elica: struttura compatta avvolta in cui i legami idrogeno sono disposti parallelamente allo scheletro. 2 - Beta-strand: struttura rilassata in cui i ponti idrogeno si stabiliscono tra catene adiacenti che possono essere parallele o antiparallele, a formare dei foglietti beta.

14 Le varie strutture secondarie si collegano tra loro mediante anse (loop) in cui non ci sono ponti idrogeno intramolecolari e che quindi non hanno un organizzazione definita. In realtà alcune connessioni tra strutture secondarie sono conservate: es. per congiungere due beta-strands antiparalleli serve un connettore che permetta una curva molto stretta. La connessione HAIRPIN LOOP è un esempio. Strutture secondarie che si uniscono formano molto spesso delle strutture super-secondarie denominate MOTIVI

15 Beta-turn-beta up-down greca jelly-roll Alpha-turn-alpha super-barrel coiled-coil four helix bundle beta-alpha-beta fold di Rossmann

16 Alcune strutture terziarie Dominio singolo Dominio doppio Dominio triplo Dominio quadruplo

17 Strutture quaternarie simmetriche

18 Alcune osservazioni importanti 1) nello scrivere le proteine o i nucleotidi, usate sempre il carattere COURIER, non altri caratteri con spaziatura ineguale come il times, altrimenti succede questo: VILMA anzichè: VILMA e si perdono gli allineamenti VLLMA VLLMA 2) utilizzate sempre il blocco note o simili per editare le sequenze, in modo da non avere formattazioni impreviste. Il formato SOLO TESTO è il più adatto. 3) non copiate MAI a mano le sequenze, anche se brevi. Usate sempre il copia e incolla. Quindi: tenete i dati in formato elettronico, non cartaceo. 4) per modificare l aspetto delle sequenze, utilizzate programmi appositi, non fate nulla a mano. Un ottimo programma è il Sequence Manipulation Suite (SMS)


20 Banche dati

21 Nascita delle banche dati Inizio anni 70: nasce la tecnologia del DNA ricombinante, che permette di manipolare le sequenze nucleotidiche e di capire la struttura, la funzione e l organizzazione del DNA. Fine anni 70: pubblicazione dei primi dati genomici, con le prime sequenze nucleotidiche codificanti liberamente accessibili attraverso i rudimenti della rete disponibili a quel tempo tra le varie università. 2001: il Consorzio Pubblico Internazionale e la Celera Genomics forniscono dati del genoma umano completo, aprendo la strada ai progetti di sequenziamento a tappeto. Successivamente, l approccio biotecnologico ha fornito una serie imponente di dati di natura proteomica grazie all analisi spettrometrica e all elettroforesi 2-D, ed una serie altrettanto vasta di dati di trascrittomica grazie alla tecnologia dei microarrays.

22 Insieme ai dati nasce l esigenza di sistemi di archiviazione e di ritrovamento facili e esaustivi, in modo da averli a disposizione in ogni istante, dato che sebbene ci siano tantissime informazioni, ognuna deve essere validata e confermata, essendo per la maggior parte dati grezzi non rielaborati. Conoscere il dato non significa capire il dato, serve sempre un approccio sperimentale classico perchè questo sia veramente verificato. => una banca dati è il posto dove cercare i dati da cui partire per una ricerca, non il suo punto di arrivo.

23 I pionieri 1965: Margareth Dayhoff compila un atlante di proteine omologhe studiando le relazioni tra le sequenze primarie 1970: l atlante viene reso pubblico in versione elettronica nella banca dati NBRF nascita della prima banca dati proteica. Ancora non ci sono dati di sequenziamento nucleotidico nella banca, sono tutti dati di natura biochimica classica, ma l idea di rendere disponibili in modo libero dei dati accumulati e organizzati è alla base del concetto che muove gli organizzatori e i curatori delle banche dati, e che muove anche i fondi per la loro gestione

24 Banche dati primarie 1981: nasce nel Laboratorio Europeo di Biologia Molecolare ad Heidelberg (Germania) l EMBL-datalibrary, 519 entries con sequenze di DNA e RNA, autore Kurt Stueber 1982: nasce una banca dati simile negli USA, darà vità alla GenBank, autore Walter Goad 1986: nel National Institute of Genetics in Mishima (Giappone) nasce un mirror della GenBank, la DDBJ EMBL GenBank DDBJ => circa le stesse informazioni, organizzate in modo diverso

25 Infrastrutture principali EMBNet, nata nel 1988 come rete europea a supporto della ricerca bio-molecolare, oggi conta 41 nodi nazionali in paesi europei ed extraeuropei (In Italia il nodo è a Bari) APBioNet (Asian-Pacific Biologic Network), recentemente gemelleta con EMBNet, organizzazione analoga Oggi i due database primari più importanti sono nei centri EBI (Cambridge, UK) : EMBL data-library NCBI (USA) : GenBank

26 Organizzazione di un database biologico L oggetto principale è la ENTRY, una unità riconoscibile grazie ad un identificatore univoco, che possiede una descrizione organizzata in campi standardizzati riconoscibili grazie ad HEADERS univoci nella banca dati. es. Identificatore Autore Data ecc. Ogni banca dati presenta 2 versioni delle entries: Flat-file: un file di testo semplice, formattato, non interattivo HTML (o XML): interattivo, di facile consultazione

27 L interattività ha un ruolo centrale per una banca dati, perchè permette di navigare tra le sue entries e quelle di altri databases sia i flat-file sia le pagine XML sono ricchi di cross-references, riferimenti che mandano ad altre banche dati generiche o specializzate. Si ottiene così per ogni entry una serie di informazioni spesso ridondanti, tra cui è bene sapresi orientare, anche perchè alcune sembrano in contraddizione, es. - una proteina può avere dei riferimenti a sequenze codificanti diverse - una entry può avere più nomi per descriverla o può corrispondere a più autori

28 Un esempio di entry proteica EMBL (flat-file) 1: AAC orf, hypothetical...[gi: ] LOCUS AAC aa linear BCT 01-DEC-2000 DEFINITION orf, hypothetical protein [Escherichia coli K12]. ACCESSION AAC74054 VERSION AAC GI: DBSOURCE locus AE accession AE KEYWORDS. SOURCE Escherichia coli K12. ORGANISM Escherichia coli K12 Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae; Escherichia. REFERENCE 1 (residues 1 to 92) AUTHORS Blattner,F.R., Plunkett,G. III, Bloch,C.A., Perna,N.T., Burland,V., Riley,M., Collado-Vides,J., Glasner,J.D., Rode,C.K., Mayhew,G.F., Gregor,J., Davis,N.W., Kirkpatrick,H.A., Goeden,M.A., Rose,D.J., Mau,B. and Shao,Y. TITLE The complete genome sequence of Escherichia coli K-12 JOURNAL Science 277 (5331), (1997) MEDLINE PUBMED

29 REFERENCE 2 (residues 1 to 92) AUTHORS Blattner,F.R. TITLE Direct Submission JOURNAL Submitted (16-JAN-1997) Guy Plunkett III, Laboratory of Genetics, University of Wisconsin, 445 Henry Mall, Madison, WI 53706, USA. Phone: Fax: REFERENCE 3 (residues 1 to 92) AUTHORS Blattner,F.R. TITLE Direct Submission JOURNAL Submitted (02-SEP-1997) Guy Plunkett III, Laboratory of Genetics, University of Wisconsin, 445 Henry Mall, Madison, WI 53706, USA. Phone: Fax: REFERENCE 4 (residues 1 to 92) AUTHORS Plunkett,G. III. TITLE Direct Submission JOURNAL Submitted (13-OCT-1998) Laboratory of Genetics, University of Wisconsin, 445 Henry Mall, Madison, WI 53706, USA COMMENT This sequence was determined by the E. coli Genome Project at the University of Wisconsin-Madison (Frederick R. Blattner, director). Supported by NIH grants HG00301 and HG01428 (from the Human Genome

30 Project and NCHGR). The entire sequence was independently determined from E. coli K12 strain MG1655. Predicted open reading frames were determined using GeneMark software, kindly supplied by Mark Borodovsky, Georgia Institute of Technology, Atlanta, GA, [ Open reading frames that have been correlated with genetic loci are being annotated with CG Site Nos., unique ID nos. for the genes in the E. coli Genetic Stock Center (CGSC) database at Yale University, kindly supplied by Mary Berlyn. A public version of the database is accessible ( Annotation of the genome is an ongoing task whose goal is to make the genome sequence more useful by correlating it with other data. Comments to the authors are appreciated. Updated information will be available at the E. coli Genome Project's World Wide Web site ( *** The E. coli K12 sequence and its annotations are periodically updated; this is version M54. No sequence changes. Annotation updates: updated gene identifications and products; all new functional assignments courtesy of Monica Riley; added promoters, protein binding sites, and repeated sequences described in reference 1. The unique numeric identifiers beginning with a lowercase 'b' assigned to each gene (protein- or RNA-encoding) are now designated as gene synonyms instead of labels. This should allow them to be searched for in Entrez as gene names.

31 Method: conceptual translation. FEATURES Location/Qualifiers source /organism="escherichia coli K12" /strain="k12" /sub_strain="mg1655" /db_xref="taxon:83333" Protein /function="orf; Unknown" CDS /gene="b0968" /coded_by="ae : " /note="o93; 44 pct identical (2 gaps) to 85 residues from acylphosphatase, organ-common type isozyme, ACYO_CHICK SW:P07032 (98 aa)" /transl_table=11 ORIGIN 1 mskvciiawv ygrvqgvgfr yttqyeakrl gltgyaknld dgsvevvacg eegqveklmq 61 wlksggprsa rvervlseph hpsgeltdfr ir // Revised: July 5, 2002.

32 Ogni banca dati ha dei suoi codici di identificazione e definisce le sue entries secondo un rigido standard, imponendo a priori un certo numero di possibili campi contrassegnati da tag specifici. Nell esempio visto prima: ACCESSION AAC74054 indica il numero di accesso, ORGANISM Escherichia coli K12 Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae; Escherichia. indica l organismo a cui appartiene e la sua tassonomia. Qualsiasi cosa è standardizzata, dai tags agli spazi ed ai segni di punteggiatura. Questo permette ai programmi di RETRIEVAL, cioè di ricerca, di trovare rapidamente ciò che si cerca.

33 Banche dati dell EMBL

34 Banche dati dell NCBI

35 Banche dati proteiche più utilizzate UniProt raccoglie le informazioni dei database Swiss-prot, TrEMBL e PIR. Offre la possibilità di effettuare Text Search o Blast Search. Viene curato anche un database NON RIDONDANTE (UniRef). Molto curato e dattagliato, con annotazioni circa funzione, struttura, modificazioni e altre informazioni utili E la traduzione in silico di ogni entry codificante del database primario dell EMBL, non è accurato, ma è ricchissimo E il discendente diretto del database della Dayhoff, è curato a mano e le annotazioni sono molto ricche e precise

36 Banche dati proteiche più utilizzate E un database di famiglie e domini proteici comprensiva di pattern e motivi (signatures) che identificano e rendono riconoscibili e classificabili le proteine. La ricerca in prosite comprende anche altri database strutturali e di classificazione. una signature formattata, definita anche pattern.

37 Banche dati proteiche più utilizzate Pfam è una raccolta di proteine allineate e di profili generati con gli HMM che descrivono quasi tutte le famiglie e i domini proteici conosciuti. Da qui è possibile una analisi dettagliata sfruttando le risorse disponibili nel server del Sanger Institute per l analisi familiare delle proteine. Il Proteome Analysis Database è una immensa raccolta di proteine catalogate per organismo di appartenenza e permette analisi interproteomiche mediante opportuni programmi di confronto.

38 Banche dati proteiche più utilizzate Database di Protein Fingerprints, cioè pattern caratteristici di certe famiglie proteihce Database di domini proteici generato in modo automatico da Swiss-Prot e TrEMBL Database di architetture proteiche annotate per organismo e per famiglia Database di strutture tridimensionali di proteiene altre componenti proteiche

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l


amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente Gli amminoacidi naturali sono α-amminoacidi : il gruppo amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente formula generale: gruppo funzionale carbossilico


Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,


Rappresentazione dei Dati Biologici

Rappresentazione dei Dati Biologici Rappresentazione dei Dati Biologici CORSO DI BIOINFORMATICA C.d.L. Ingegneria Informatica e Biomedica Outline Proteine ed Amminoacidi Rappresentazione di Amminoacidi Rappresentazione delle strutture Proteiche


Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


Il dogma centrale della biologia

Il dogma centrale della biologia Il dogma centrale della biologia Aminoacil-tRNA trna Sintesi proteica rrna mrna RBS ATG AAA TAC TAA Trascrizione Struttura primaria Folding Struttura terziaria Struttura secondaria Il dogma centrale della



REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma


Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.


I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica Gli aminoacidi NOMENCLATURA Aminoacido Abbr. tre lettere Abbr. una lettera Aminoacido Abbr. tre lettere Abbr. una lettera Alanina ALA A Lisina LYS K Arginina ARG R Metionina MET M Asparagina ASN N Fenilalanina


SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche.

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche. I due centri maggiori, EBI e NCBI hanno sviluppato sistemi dedicati di RETRIEVAL allo scopo di ottenere il massimo delle informazioni con il minimo sforzo da parte dell utente SRS (Sequence Retrieval System)



AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE Vengono chiamate amminoacidi quelle molecole organiche in cui sono contemporaneamente presenti sia un gruppo acido carbossilico -COO che un gruppo amminico -N2. Una molecola appartenente


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata Ammino acidi Composto che contiene una funziome acida e amminica. Usualmente però con amminoacidi si intendono gli alfa- amminoacidi. Tra questi composti ve ne sono 20 che vengono definiti geneticamente





Le proteine. Polimeri composto da 20 diversi aminoacidi

Le proteine. Polimeri composto da 20 diversi aminoacidi Le proteine Polimeri composto da 20 diversi aminoacidi (D. Voet, J.G. Voet, Biochemistry, 3 ed., John Wiley & Sons, 2004) PROTEINE come ATTUATORI nella cellula Trasporto elettronico Trasporto di ioni e


Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo


Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.


Macromolecole Biologiche. I domini (III)

Macromolecole Biologiche. I domini (III) I domini (III) Domini α/β La cross over connection è l unità costitutiva su cui si basa la topologia di 3 tipi di domini α/β osservati nelle proteine: - α/β barrel - motivi ricchi di Leu (fold a ferro


Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,


strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine


Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione

Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione Informatica Lezione VIII Visualizzazione 3D di proteine Visualizzazioni 3D Rappresentazione di strutture/oggetti tridimensionali Risultato di un esperimento modello teorico dati fisici astrazione 1 Lezione


Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti Le Biomolecole I parte Lezioni d'autore di Giorgio Benedetti LE BIOMOLECOLE Le biomolecole, presenti in tutti gli esseri viventi, sono molecole composte principalmente da carbonio, idrogeno, azoto e ossigeno.



PROTEINE. sono COMPOSTI ORGANICI QUATERNARI PROTEINE sono COMPOSTI ORGANICI QUATERNARI Unione di elementi chimici diversi Il composto chimico principale è il C (carbonio) Sono quattro gli elementi chimici principali che formano le proteine : C (carbonio),



LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole


Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,



STRUTTURA E FUNZIONE DELLE PROTEINE STRUTTURA E FUNZIONE DELLE PROTEINE Le PROTEINE sono i biopolimeri maggiormente presenti all interno delle cellule, dal momento che costituiscono dal 40 al 70% del peso secco. Svolgono funzioni biologiche


Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica


E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale.

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale. Homology modelling L omology modeling delle proteine è il tipo di predizione di struttura terziaria più semplice ed affidabile. Viene richiesta soltanto una (o più) sequenze di riferimento su cui modellare





Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)


Gli amminoacidi Il legame peptidico Motivi strutturali classificazione, architettura topologia delle strutture tridimensionali di proteine.

Gli amminoacidi Il legame peptidico Motivi strutturali classificazione, architettura topologia delle strutture tridimensionali di proteine. Struttura di proteine Gli amminoacidi Il legame peptidico Motivi strutturali classificazione, architettura topologia delle strutture tridimensionali di proteine. Correlazioni struttura-funzione Gli amminoacidi


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze


Macromolecole Biologiche. I domini (I)

Macromolecole Biologiche. I domini (I) I domini (I) I domini I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I domini sono definiti come una


Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale:

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: N 2 Il nome ordinario degli amminoacidi prevale su quello della nomenclatura IUPA. Si possono avere α-amminoacidi,


Prof. Fulvio Ursini Dipartimento di Chimica Biologica (Vallisneri IV piano Nord) Viale G. Colombo, Padova. Tel.

Prof. Fulvio Ursini Dipartimento di Chimica Biologica (Vallisneri IV piano Nord) Viale G. Colombo, Padova. Tel. Prof. Fulvio Ursini Dipartimento di Chimica Biologica (Vallisneri IV piano Nord) Viale G. Colombo, 3-35121 Padova. Tel.:+39-049-8276104 Fax.:+39-049-8073310 E-mail: Funzioni delle


I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici La seta della tela di ragno è un insieme di macromolecole, dette proteine. Sono le caratteristiche fisico-chimiche di queste


Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli


Struttura delle Proteine

Struttura delle Proteine Chimica Biologica A.A. 2010-2011 Struttura delle Proteine Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano Macromolecole Biologiche Struttura Proteine Proteine:



NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato



INTRODUZIONE ALLA PROTEINE BCP 1-2 INTRODUZIONE ALLA BIOCHIMICA DELLE PROTEINE BCP 1-2 Pietre miliari Lehninger 1973 Biochemistry Proteine ricombinanti Protein engineering Cristallografia, NMR, EM, MS, spettroscopie... Computing Bioinformaticai


Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi


MACROMOLECOLE. Polimeri (lipidi a parte)

MACROMOLECOLE. Polimeri (lipidi a parte) MACROMOLECOLE Monomeri Polimeri (lipidi a parte) Le caratteristiche strutturali e funzionali di una cellula o di un organismo sono determinate principalmente dalle sue proteine. Ad esempio: Le proteine


Prof. Maria Nicola GADALETA

Prof. Maria Nicola GADALETA Prof. Maria Nicola GADALETA Email: Facoltà di Scienze Biotecnologiche Corso di Laurea in Biotecnologie Sanitarie e Farmaceutiche Biochimica e Biotecnologie Biochimiche DISPENSA


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta


Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE


Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli Fonti e testi di riferimento Dan Graur: >courses > bioinformatics


Le idee della chimica

Le idee della chimica G. Valitutti A.Tifi A.Gentile Seconda edizione Copyright 2009 Zanichelli editore Capitolo 25 Le basi della biochimica 1. I carboidrati 2. I lipidi 3. Gli amminoacidi, i peptidi e le proteine 4. La struttura





Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle


proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R unità 1. La funzione del DN negli organismi La funzione del DN L acido desossiribonucleico o DN (dall inglese deoxyribonucleic acid) è la molecola informazionale delle cellule. Essa contiene e trasmette


Dipartimento Di Scienze Della Vita STRUTTURA DELLE PROTEINE



Predizione della struttura terziaria

Predizione della struttura terziaria Predizione della struttura terziaria Metodi di predizione La predizione della struttura tridimensionale è di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi


Aminoacidi e proteine

Aminoacidi e proteine Prof. Giorgio Sartor Aminoacidi e proteine Copyright 2001-2012 by Giorgio Sartor. Versione 1.7.1 mar 2012 All rights reserved. Le cellule V.1.7.1 gsartor 2001-2012 Aminoacidi e proteine -2- Aminoacidi


ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor


Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,


Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 7 La struttura delle proteine Concetti chiave: La struttura terziaria di una proteina descrive il ripiegamentodei suoi elementi


Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi


Progetto Cluster. Sottoprogetto Bioinformatica

Progetto Cluster. Sottoprogetto Bioinformatica Progetto Cluster Sottoprogetto Bioinformatica CRS4 (Centro di Ricerca, Sviluppo e Studi Superiori in Sardegna) Società costituita nel 1990 svolge attività di ricerca e sviluppo basate sulle tecnologie


AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali):

AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali): AMINOAIDI. Proteine (gr. pròtos = primo) > 50% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida (o alcalina) α-aminoacidi Struttura generale degli α-aminoacidi primari (standard,


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere



BIOINFORMATICA: Cosa è? BIOINFORMATICA: Cosa è? THE DEFINITIONS OF BIOINFORMATICS Bioinformatics is an integration of mathematical, statistical and computer methods to analyse biological, biochemical and biophysical data (Georgia


Continua. Peptidasi H 2 O

Continua. Peptidasi H 2 O Continua Peptidasi H 2 O Classificazione delle peptidasi 1. Meccanismo catalitico 2. Tipo di reazione catalizzata 3. Struttura molecolare e omologia 1. Meccanismo catalitico (mostrato per la chimotripsina)


Banche Dati Secondarie. geni trascritti proteine profili strutture

Banche Dati Secondarie. geni trascritti proteine profili strutture Banche Dati Secondarie geni trascritti proteine profili strutture definizione Banca dati il cui contenuto deriva da una banca dati primaria DB sec DB primario informazione PROSITE SWISS Prot patterns Profiles


Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi


2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma L elettroforesi bidimensionale separa le proteine in base alla loro carica (come nella IEF) e dimensioni


Caratteristiche generali

Caratteristiche generali AMMINOACIDI Gli amminoacidi sono le unità costruttive (building blocks) delle proteine. Come dice il termine, gli amminoacidi naturali sono costituiti da un gruppo amminico (-NH 2 ) e da un gruppo carbossilico


II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance


Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi Università degli Studi di Milano Polo Didattico e di Ricerca di Crema Facoltà di Scienze Matematiche, Fisiche e Naturali Corso di Geometria Computazionale Determinazione della struttura di una molecola


Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione


Macromolecole Biologiche. I domini (II)

Macromolecole Biologiche. I domini (II) I domini (II) Domini β Nonostante l elevato numero di possibili disposizioni di filamenti β (a costituire foglietti β antiparalleli) connessi da tratti di loop, i domini β più frequentemente osservati


Vittoria Patti MACROMOLECOLE BIOLOGICHE. 4. proteine

Vittoria Patti MACROMOLECOLE BIOLOGICHE. 4. proteine Vittoria Patti MACROMOLECOLE BIOLOGICHE 4. proteine 1 Funzioni principali delle proteine funzione cosa significa esempi ENZIMATICA STRUTTURALE TRASPORTO MOVIMENTO DIFESA IMMUNITARIA ORMONALE catalizzare


Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse


Amminoacidi e Proteine

Amminoacidi e Proteine Amminoacidi e Proteine Struttura generale di un α-amminoacido R = catena laterale AMMINOACIDI (AA) CELLULARI Gli amminoacidi presenti nella cellula possono essere il prodotto di idrolisi delle proteine


Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli


Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa

Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa Gli amminoacidi Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa classe di molecole: p. es. la catalisi delle


Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine



AMINOACIDI - 1 AMINOACIDI - 2 AMINOAIDI - 1 Proteine (gr. pròtos = primo) 50-80% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida o alcalina α-aminoacidi proteasi Struttura generale degli α-aminoacidi primari


Basi di dati biologiche

Basi di dati biologiche Basi di dati biologiche Seminario per il corso di Basi di Dati II Luana Rinaldi AGENDA: Introduzione alla bioinformatica; Concetti Biologici; Banche dati biologiche; Collaborazioni


la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui

la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui Durante la traduzione l informazione di ripiegamento codificata nella sequenza aminoacidica diventa disponibile in maniera vettoriale la struttura tridimensionale può essere ottenuta solo per Un intero


E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento


La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA


I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini.

I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I domini sono definiti come una catena polipeptidica


Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Docente: Dr. Nicola Vitulo Dipartimento di Biologia, CRIBI Viale G.Colombo3, 35131 Padova



V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una


Ogni tipo ha il suo alfabeto di riferimento, e metodi specifici, nonché metodi per la conversione da un tipo all altro (trascrizione, traduzione)

Ogni tipo ha il suo alfabeto di riferimento, e metodi specifici, nonché metodi per la conversione da un tipo all altro (trascrizione, traduzione) BioPython Descrizione Il progetto BioPython è un associazione di sviluppatori di codice Python liberamente disponibile per bioinformatica La homepage del progetto è Il codice viene


Bioinformatica: Allineamento di Sequenze di Aminoacidi di Bandiera Roberto

Bioinformatica: Allineamento di Sequenze di Aminoacidi di Bandiera Roberto Bioinformatica: Allineamento di Sequenze di Aminoacidi di Bandiera Roberto La Bioinformatica è una disciplina che si occupa dell applicazione dell informatica nell ambito biologico per consentire lo studio


delegate a conservare e trasmettere l'informazione genetica. Oggi é noto che sono gli acidi

delegate a conservare e trasmettere l'informazione genetica. Oggi é noto che sono gli acidi 8. Le proteine Il termine "proteina" (dal greco προτειος: di primaria importanza) fu coniato nel 1838 dal chimico svedese J. Berzelius 1 quando ancora si riteneva che le proteine fossero le molecole delegate


Relazione struttura-funzione

Relazione struttura-funzione Biotecnologie applicate alla progettazione e sviluppo di molecole biologicamente attive A.A. 2010-2011 Modulo di Biologia Strutturale Relazione struttura-funzione Marco Nardini Dipartimento di Scienze


Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4 Indice Prefazione XIII Protein Data Bank: una nota degli autori XIV Nota all edizione italiana XV Ringraziamenti XVI CAPITOLO 1 Dalla sequenza alla struttura 1.0 Visione d insieme: funzione e architettura



3.3. UMAMI NEGLI ALIMENTI 3.3. UMAMI NEGLI ALIMENTI In questo capitolo saranno esaminati i vari cibi, ad esclusione di quelli ittici che verranno presi in considerazione successivamente, allo scopo di scoprire se in essi è presente,


Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario Il DN e la duplicazione cellulare Il DN, materiale ereditario Struttura del DN Replicazione del DN Dal DN alla proteina Il odice genetico iclo cellulare Mitosi Meiosi Da Figura 8-11 ampbell & Reece cidi



DATABASE DI GENETICA E BIOLOGIA MOLECOLARE DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance in Man EntrezGene curated sequence and descriptive information about genetic loci GenCards HGMD dbsnp database of human genes,




Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of


Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami


LE PROTEINE. SONO Polimeri formati dall unione di AMMINOACIDI (AA) Rende diversi i 20 AA l uno dall altro UN ATOMO DI C AL CENTRO

LE PROTEINE. SONO Polimeri formati dall unione di AMMINOACIDI (AA) Rende diversi i 20 AA l uno dall altro UN ATOMO DI C AL CENTRO LE PROTEINE SONO Polimeri formati dall unione di ATOMI DI C, H, N, O CHE SONO AMMINOACIDI (AA) Uniti tra loro dal Legame peptidico 20 TIPI DIVERSI MA HANNO STESSA STRUTTURA GENERALE CON Catene peptidiche


4x4x4=4 3 =64 codoni. 20 aminoacidi

4x4x4=4 3 =64 codoni. 20 aminoacidi 4x4x4=4 3 =64 codoni 20 aminoacidi 1 Le 20 diverse catene laterali (gruppo R) che costituiscono gli aminoacidi si differenziano considerevolmente per dimensioni, volume e per le loro caratteristiche fisico-chimiche,



BIOMOLECOLE STRUTTURA E FUNZIONE BIOMOLECOLE STRUTTURA E FUNZIONE Lo studio delle relazioni tra struttura e funzione nelle biomolecole è uno degli aspetti più importanti per la comprensione del funzionamento dei processi biologici La


Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la
