ANALISI BIOINFORMATICA DELLE PROTEINE. Matteo Ramazzotti

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "ANALISI BIOINFORMATICA DELLE PROTEINE. Matteo Ramazzotti matteo.ramazzotti@unifi.it"

Transcript

1 ANALISI BIOINFORMATICA DELLE PROTEINE Matteo Ramazzotti

2 Programma Banche dati proteiche. Interrogazione delle banche dati. Allineamento di sequenze proteiche. Matrici di sostituzione. Allineamento con gap. Allineamento globale e locale. BLAST e FASTA. Allineamento multiplo. Visualizzazione degli allineamenti. Applicazioni dei profili di multiallinemento. Ricerca di pattern e motivi funzionali nelle proteine. Banche dati dei profili proteici. Filogenesi molecolare. L orologio molecolare. Analisi della struttura primaria delle proteine. Struttura secondaria delle proteine. Strumenti per la predizione della struttura secondaria. Visualizzazione tridimensionale delle proteine. Strumenti per la proteomica. RasMol. Swiss PDB Viewer. Strumenti per la predizione della struttura tridimensionale. Homology modelling. Interazione tra proteine. Docking. Testi consigliati: G.Valle et al. Introduzione alla bioinformatica Zanichelli A.Tramontano Bioinformatica - Zanichelli

3 Cos è la bioinformatica E una scienza multidisciplinare che integra conoscenze informatiche, chimiche, matematiche, biologiche allo scopo di collezionare ed elaborare sistematicamente ogni informazione per ottenere la massima resa dalle ricerche sperimentali ma anche per sviluppare queste ultime in modo più mirato. Grazie alla bioinformatica è possibile avere uno sguardo d insieme su tutte le conoscenze scientifiche e da questo partire per ulteriori osservazioni sia mediante metodi informatici, sia mediante metodi sperimentali.

4 Chi si occupa di bioinformatica può appartenere a due categorie principali: SVILUPPATORI: coloro che si occupano di creare nuovi strumenti informatici per l analisi scientifica UTENTI: coloro che utilizzano gli strumenti bioinformatici per ottenere dati e da questi partire per l analisi sperimentale vera e propria. il programma che si utilizza può definirsi il metodo sperimantale della bioinformatica le banche dati posso definirsi il materiale sperimentale utilizzato dalla bioinformatica

5 Banche dati Si possono raggruppare in quattro categorie principali: - di biosequenze (dette anche primarie) - genomiche - di espressione genica - proteiche Nel corso verranno trattate le banche dati proteiche anche se non bisogna dimenticare che molti dati sulle proteine derivano dalle banche dati primarie, cioè quelle nucleotidiche.

6 Data una sequenza nucleotidica è possibile tradurla utilizzando tutti e tre i frame di lettura (+1, +2, +3) di entrambi i filamenti (senso e antisenso), allo scopo di individuare una Open Reading Frame (ORF) +1 cioè una sequenza proteica di lungheza adatta ad essere una proteina (non meno di residui). In questo modo, e con programmi appositi che scansionano tutto un genoma, è possibile trovare tantissime proteine PUTATIVE, cioè possibili ma non verificate Traduzione in silico T R M P L S L S M G M P I V H I H S N A N A S L S F D G Y A N C P H S L E R E C L S L F R W V C Q L S T F T R 1 gaacgcgaatgcctctctctctttcgatgggtatgccaattgtccacattcactcgt F A F A E R E K S P Y A L Q G C E S T R S H R E R K R H T H W N D V N V R V R I G R E R E I P I G I T W M * E

7 Il codice genetico Si definisce DEGENERATO e RIDONDANTE. E composto da 64 diversi codoni che codificano i 20 amino acidi. La tebella accanto mostra le varie degenerazioni dei codoni per ogni amino acido. Alanine Ala A GC[CATG] Cysteine Cys C TG[CT] Aspartic AciD Asp D GA[CT] Glutamic Acid Glu E GA[AG] Phenylalanine Phe F TT[CT] Glycine Gly G GG[CATG] Histidine His H CA[CT] Isoleucine Ile I AT[CAT] Lysine Lys K AA[AG] Leucine Leu L CT[CATG], TT[AG] Methionine Met M ATG AsparagiNe Asn N AA[CT] Proline Pro P CC[CATG] Glutamine Gln Q CA[AG] ARginine Arg R CG[CATG], AG[AG] Serine Ser S TC[CTAG], AG[CT] Threonine Thr T AC[CATG] Valine Val V GT[CATG] Tryptophan Trp W TGG TYrosine Tyr Y TA[CT] STOP - - TA[AG], TGA

8 Trascrizione Aminoacil-tRNA trna rrna mrna RBS----ATG AAA TAC TAA Struttura primaria Sintesi proteica Struttura secondaria Folding Struttura terziaria

9 Gli amino acidi Sono composti organici che presentano almeno un gruppo carbossilico (-COOH) a funzione acida e un gruppo aminico (-NH 2 ) a funzione basica Le proteine sono composte soltanto da alfa-amino acidi, legati tra loro mediante legami detti PEPTIDICI che si instaurano tra il COOH e l NH 2. Ciò che diversifica i vari amino acidi è la catena laterale legata al carbonio alfa, che può conferire all amino acido caratteristiche chimico-fisiche diverse.

10 In base alla catena laterale si riconoscono 5 gruppi principali di amino acidi Acidi Basici Strutturali Polari non carichi Idrofobici Aromatici

11 I polimeri di alfa amino acidi (le proteine) sono influenzati dalle caratteristiche chimico-fisiche delle catane laterali e in base a principi di interazioni deboli di tipo idrofobico o elettrostatico si osservano dei ripiegamenti, fino al raggiungimento della minor energia termodinamica. Questo processo, denominato FOLDING, è alla base del funzionamento delle proteine, visto che solo se sono correttamente strutturate esse assumeranno la loro forma e soprattutto FUNZIONE definitiva. La strutturazione delle proteine dipende quindi principalmente dalla sequenza dei residui che la compongono, oltre che dall ambiente in cui si strutturano

12 Struttura delle proteine Il legame peptidico ha delle caratteristiche di doppio legame e costringe i due atomo adiacenti a giacere sullo stesso piano. La rotazione della molecola avviene intorno al carbonio alfa, ma non tutti gli angoli di rotazione sono permessi a causa degli ingombri sterici delle diverse catene laterali e dello scheletro stesso.

13 Il legame peptidico genera una polarità negli scheletri proteici per cui si vengono a formare PONTI IDROGENO tra gli idrogeni dei gruppi amidici e ossigeni dei carbonili. Queste interazioni deboli portano la struttura primaria della proteina (la sequenza dei suoi residui) a ripiegarsi in una STRUTTURA SECONDARIA in cui sono riconoscibili due formazioni 1- Alfa elica: struttura compatta avvolta in cui i legami idrogeno sono disposti parallelamente allo scheletro. 2 - Beta-strand: struttura rilassata in cui i ponti idrogeno si stabiliscono tra catene adiacenti che possono essere parallele o antiparallele, a formare dei foglietti beta.

14 Le varie strutture secondarie si collegano tra loro mediante anse (loop) in cui non ci sono ponti idrogeno intramolecolari e che quindi non hanno un organizzazione definita. In realtà alcune connessioni tra strutture secondarie sono conservate: es. per congiungere due beta-strands antiparalleli serve un connettore che permetta una curva molto stretta. La connessione HAIRPIN LOOP è un esempio. Strutture secondarie che si uniscono formano molto spesso delle strutture super-secondarie denominate MOTIVI

15 Beta-turn-beta up-down greca jelly-roll Alpha-turn-alpha super-barrel coiled-coil four helix bundle beta-alpha-beta fold di Rossmann

16 Alcune strutture terziarie Dominio singolo Dominio doppio Dominio triplo Dominio quadruplo

17 Strutture quaternarie simmetriche

18 Alcune osservazioni importanti 1) nello scrivere le proteine o i nucleotidi, usate sempre il carattere COURIER, non altri caratteri con spaziatura ineguale come il times, altrimenti succede questo: VILMA anzichè: VILMA e si perdono gli allineamenti VLLMA VLLMA 2) utilizzate sempre il blocco note o simili per editare le sequenze, in modo da non avere formattazioni impreviste. Il formato SOLO TESTO è il più adatto. 3) non copiate MAI a mano le sequenze, anche se brevi. Usate sempre il copia e incolla. Quindi: tenete i dati in formato elettronico, non cartaceo. 4) per modificare l aspetto delle sequenze, utilizzate programmi appositi, non fate nulla a mano. Un ottimo programma è il Sequence Manipulation Suite (SMS)

19

20 Banche dati

21 Nascita delle banche dati Inizio anni 70: nasce la tecnologia del DNA ricombinante, che permette di manipolare le sequenze nucleotidiche e di capire la struttura, la funzione e l organizzazione del DNA. Fine anni 70: pubblicazione dei primi dati genomici, con le prime sequenze nucleotidiche codificanti liberamente accessibili attraverso i rudimenti della rete disponibili a quel tempo tra le varie università. 2001: il Consorzio Pubblico Internazionale e la Celera Genomics forniscono dati del genoma umano completo, aprendo la strada ai progetti di sequenziamento a tappeto. Successivamente, l approccio biotecnologico ha fornito una serie imponente di dati di natura proteomica grazie all analisi spettrometrica e all elettroforesi 2-D, ed una serie altrettanto vasta di dati di trascrittomica grazie alla tecnologia dei microarrays.

22 Insieme ai dati nasce l esigenza di sistemi di archiviazione e di ritrovamento facili e esaustivi, in modo da averli a disposizione in ogni istante, dato che sebbene ci siano tantissime informazioni, ognuna deve essere validata e confermata, essendo per la maggior parte dati grezzi non rielaborati. Conoscere il dato non significa capire il dato, serve sempre un approccio sperimentale classico perchè questo sia veramente verificato. => una banca dati è il posto dove cercare i dati da cui partire per una ricerca, non il suo punto di arrivo.

23 I pionieri 1965: Margareth Dayhoff compila un atlante di proteine omologhe studiando le relazioni tra le sequenze primarie 1970: l atlante viene reso pubblico in versione elettronica nella banca dati NBRF nascita della prima banca dati proteica. Ancora non ci sono dati di sequenziamento nucleotidico nella banca, sono tutti dati di natura biochimica classica, ma l idea di rendere disponibili in modo libero dei dati accumulati e organizzati è alla base del concetto che muove gli organizzatori e i curatori delle banche dati, e che muove anche i fondi per la loro gestione

24 Banche dati primarie 1981: nasce nel Laboratorio Europeo di Biologia Molecolare ad Heidelberg (Germania) l EMBL-datalibrary, 519 entries con sequenze di DNA e RNA, autore Kurt Stueber 1982: nasce una banca dati simile negli USA, darà vità alla GenBank, autore Walter Goad 1986: nel National Institute of Genetics in Mishima (Giappone) nasce un mirror della GenBank, la DDBJ EMBL GenBank DDBJ => circa le stesse informazioni, organizzate in modo diverso

25 Infrastrutture principali EMBNet, nata nel 1988 come rete europea a supporto della ricerca bio-molecolare, oggi conta 41 nodi nazionali in paesi europei ed extraeuropei (In Italia il nodo è a Bari) APBioNet (Asian-Pacific Biologic Network), recentemente gemelleta con EMBNet, organizzazione analoga Oggi i due database primari più importanti sono nei centri EBI (Cambridge, UK) : EMBL data-library NCBI (USA) : GenBank

26 Organizzazione di un database biologico L oggetto principale è la ENTRY, una unità riconoscibile grazie ad un identificatore univoco, che possiede una descrizione organizzata in campi standardizzati riconoscibili grazie ad HEADERS univoci nella banca dati. es. Identificatore Autore Data ecc. Ogni banca dati presenta 2 versioni delle entries: Flat-file: un file di testo semplice, formattato, non interattivo HTML (o XML): interattivo, di facile consultazione

27 L interattività ha un ruolo centrale per una banca dati, perchè permette di navigare tra le sue entries e quelle di altri databases sia i flat-file sia le pagine XML sono ricchi di cross-references, riferimenti che mandano ad altre banche dati generiche o specializzate. Si ottiene così per ogni entry una serie di informazioni spesso ridondanti, tra cui è bene sapresi orientare, anche perchè alcune sembrano in contraddizione, es. - una proteina può avere dei riferimenti a sequenze codificanti diverse - una entry può avere più nomi per descriverla o può corrispondere a più autori

28 Un esempio di entry proteica EMBL (flat-file) 1: AAC orf, hypothetical...[gi: ] LOCUS AAC aa linear BCT 01-DEC-2000 DEFINITION orf, hypothetical protein [Escherichia coli K12]. ACCESSION AAC74054 VERSION AAC GI: DBSOURCE locus AE accession AE KEYWORDS. SOURCE Escherichia coli K12. ORGANISM Escherichia coli K12 Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae; Escherichia. REFERENCE 1 (residues 1 to 92) AUTHORS Blattner,F.R., Plunkett,G. III, Bloch,C.A., Perna,N.T., Burland,V., Riley,M., Collado-Vides,J., Glasner,J.D., Rode,C.K., Mayhew,G.F., Gregor,J., Davis,N.W., Kirkpatrick,H.A., Goeden,M.A., Rose,D.J., Mau,B. and Shao,Y. TITLE The complete genome sequence of Escherichia coli K-12 JOURNAL Science 277 (5331), (1997) MEDLINE PUBMED

29 REFERENCE 2 (residues 1 to 92) AUTHORS Blattner,F.R. TITLE Direct Submission JOURNAL Submitted (16-JAN-1997) Guy Plunkett III, Laboratory of Genetics, University of Wisconsin, 445 Henry Mall, Madison, WI 53706, USA. Phone: Fax: REFERENCE 3 (residues 1 to 92) AUTHORS Blattner,F.R. TITLE Direct Submission JOURNAL Submitted (02-SEP-1997) Guy Plunkett III, Laboratory of Genetics, University of Wisconsin, 445 Henry Mall, Madison, WI 53706, USA. Phone: Fax: REFERENCE 4 (residues 1 to 92) AUTHORS Plunkett,G. III. TITLE Direct Submission JOURNAL Submitted (13-OCT-1998) Laboratory of Genetics, University of Wisconsin, 445 Henry Mall, Madison, WI 53706, USA COMMENT This sequence was determined by the E. coli Genome Project at the University of Wisconsin-Madison (Frederick R. Blattner, director). Supported by NIH grants HG00301 and HG01428 (from the Human Genome

30 Project and NCHGR). The entire sequence was independently determined from E. coli K12 strain MG1655. Predicted open reading frames were determined using GeneMark software, kindly supplied by Mark Borodovsky, Georgia Institute of Technology, Atlanta, GA, [ Open reading frames that have been correlated with genetic loci are being annotated with CG Site Nos., unique ID nos. for the genes in the E. coli Genetic Stock Center (CGSC) database at Yale University, kindly supplied by Mary Berlyn. A public version of the database is accessible (http://cgsc.biology.yale.edu). Annotation of the genome is an ongoing task whose goal is to make the genome sequence more useful by correlating it with other data. Comments to the authors are appreciated. Updated information will be available at the E. coli Genome Project's World Wide Web site (http://www.genetics.wisc.edu). *** The E. coli K12 sequence and its annotations are periodically updated; this is version M54. No sequence changes. Annotation updates: updated gene identifications and products; all new functional assignments courtesy of Monica Riley; added promoters, protein binding sites, and repeated sequences described in reference 1. The unique numeric identifiers beginning with a lowercase 'b' assigned to each gene (protein- or RNA-encoding) are now designated as gene synonyms instead of labels. This should allow them to be searched for in Entrez as gene names.

31 Method: conceptual translation. FEATURES Location/Qualifiers source /organism="escherichia coli K12" /strain="k12" /sub_strain="mg1655" /db_xref="taxon:83333" Protein /function="orf; Unknown" CDS /gene="b0968" /coded_by="ae : " /note="o93; 44 pct identical (2 gaps) to 85 residues from acylphosphatase, organ-common type isozyme, ACYO_CHICK SW:P07032 (98 aa)" /transl_table=11 ORIGIN 1 mskvciiawv ygrvqgvgfr yttqyeakrl gltgyaknld dgsvevvacg eegqveklmq 61 wlksggprsa rvervlseph hpsgeltdfr ir // Revised: July 5, 2002.

32 Ogni banca dati ha dei suoi codici di identificazione e definisce le sue entries secondo un rigido standard, imponendo a priori un certo numero di possibili campi contrassegnati da tag specifici. Nell esempio visto prima: ACCESSION AAC74054 indica il numero di accesso, ORGANISM Escherichia coli K12 Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae; Escherichia. indica l organismo a cui appartiene e la sua tassonomia. Qualsiasi cosa è standardizzata, dai tags agli spazi ed ai segni di punteggiatura. Questo permette ai programmi di RETRIEVAL, cioè di ricerca, di trovare rapidamente ciò che si cerca.

33 Banche dati dell EMBL

34 Banche dati dell NCBI

35 Banche dati proteiche più utilizzate UniProt raccoglie le informazioni dei database Swiss-prot, TrEMBL e PIR. Offre la possibilità di effettuare Text Search o Blast Search. Viene curato anche un database NON RIDONDANTE (UniRef). Molto curato e dattagliato, con annotazioni circa funzione, struttura, modificazioni e altre informazioni utili E la traduzione in silico di ogni entry codificante del database primario dell EMBL, non è accurato, ma è ricchissimo E il discendente diretto del database della Dayhoff, è curato a mano e le annotazioni sono molto ricche e precise

36 Banche dati proteiche più utilizzate E un database di famiglie e domini proteici comprensiva di pattern e motivi (signatures) che identificano e rendono riconoscibili e classificabili le proteine. La ricerca in prosite comprende anche altri database strutturali e di classificazione. una signature formattata, definita anche pattern.

37 Banche dati proteiche più utilizzate Pfam è una raccolta di proteine allineate e di profili generati con gli HMM che descrivono quasi tutte le famiglie e i domini proteici conosciuti. Da qui è possibile una analisi dettagliata sfruttando le risorse disponibili nel server del Sanger Institute per l analisi familiare delle proteine. Il Proteome Analysis Database è una immensa raccolta di proteine catalogate per organismo di appartenenza e permette analisi interproteomiche mediante opportuni programmi di confronto.

38 Banche dati proteiche più utilizzate Database di Protein Fingerprints, cioè pattern caratteristici di certe famiglie proteihce Database di domini proteici generato in modo automatico da Swiss-Prot e TrEMBL Database di architetture proteiche annotate per organismo e per famiglia Database di strutture tridimensionali di proteiene altre componenti proteiche

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Domini nelle Proteine

Domini nelle Proteine Struttura secondaria, Motivi e Domini nelle Proteine Proprietà generali Le forme ioniche degli aminoacidi, senza considerare alcuna ionizzazione delle catene laterali. Proprietà generali Tutti gli aminoacidi

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

RefWorks Guida all utente Versione 4.0

RefWorks Guida all utente Versione 4.0 Accesso a RefWorks per utenti registrati RefWorks Guida all utente Versione 4.0 Dalla pagina web www.refworks.com/refworks Inserire il proprio username (indirizzo e-mail) e password NB: Agli utenti remoti

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Indicizzazione terza parte e modello booleano

Indicizzazione terza parte e modello booleano Reperimento dell informazione (IR) - aa 2014-2015 Indicizzazione terza parte e modello booleano Gruppo di ricerca su Sistemi di Gestione delle Informazioni (IMS) Dipartimento di Ingegneria dell Informazione

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

Formule di Struttura delle Molecole Organiche

Formule di Struttura delle Molecole Organiche Formule di Struttura delle Molecole Organiche Costituzione L ordine in cui gli atomi di una molecola sono connessi è chiamata costituzione o connettività. La costituzione di una molecola deve essere determinata

Dettagli

GESTIRE LA BIBLIOGRAFIA

GESTIRE LA BIBLIOGRAFIA GESTIRE LA BIBLIOGRAFIA STRUMENTI DI GESTIONE BIBLIOGRAFICA I software di gestione bibliografica permettono di raccogliere, catalogare e organizzare diverse tipologie di materiali, prendere appunti, formattare

Dettagli

CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE. un atomo compie all atto di formazione di un composto al fine di formare un maggior

CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE. un atomo compie all atto di formazione di un composto al fine di formare un maggior CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE L ibridizzazione o ibridazione è una ricombinazione dei propri orbitali atomici che un atomo compie all atto di formazione di un composto al fine

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi

EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi ENDNOTE WEB EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi EndNote Web consente di: importare informazioni

Dettagli

Informazioni su questo libro

Informazioni su questo libro Informazioni su questo libro Si tratta della copia digitale di un libro che per generazioni è stato conservata negli scaffali di una biblioteca prima di essere digitalizzato da Google nell ambito del progetto

Dettagli

RETI DI CALCOLATORI E APPLICAZIONI TELEMATICHE

RETI DI CALCOLATORI E APPLICAZIONI TELEMATICHE RETI DI CALCOLATORI E APPLICAZIONI TELEMATICHE Prof. PIER LUCA MONTESSORO Facoltà di Ingegneria Università degli Studi di Udine 1999 Pier Luca Montessoro (si veda la nota a pagina 2) 1 Nota di Copyright

Dettagli

ALLEGATO N. 2 STANDARD TECNICI DELL ARCHIVIO UNICO INFORMATICO

ALLEGATO N. 2 STANDARD TECNICI DELL ARCHIVIO UNICO INFORMATICO ALLEGATO N. 2 STANDARD TECNICI DELL ARCHIVIO UNICO INFORMATICO 1 INDICE 1) ASPETTI GENERALI 2) CONTENUTO DELL ARCHIVIO UNICO INFORMATICO 2.1) OPERAZIONI 2.2) RAPPORTI 2.3) LEGAMI TRA SOGGETTI 3) CRITERI

Dettagli

tmt 15 Rimozione ecologica di metalli pesanti da acque reflue

tmt 15 Rimozione ecologica di metalli pesanti da acque reflue tmt 15 Rimozione ecologica di metalli pesanti da acque reflue Rimozione ecologica di metalli pesanti da acque reflue Il problema: metalli pesanti nelle acque reflue In numerosi settori ed applicazioni

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Poniamo il carbonio al centro, tre idrogeni sono legati al carbonio direttamente e uno attraverso l ossigeno

Poniamo il carbonio al centro, tre idrogeni sono legati al carbonio direttamente e uno attraverso l ossigeno Strutture di Lewis E un metodo semplice per ottenere le formule di struttura di composti covalenti nota la formula molecolare, la configurazione elettronica del livello di valenza degli atomi e la connettività

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam.

INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam. Laurea in INFORMATICA INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 Dynamic Host Configuration Protocol fausto.marcantoni@unicam.it Prima di iniziare... Gli indirizzi IP privati possono essere

Dettagli

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp.

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. RECENSIONI&REPORTS recensione Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. 154, 12 «Il vasto e importante e molto

Dettagli

L ACQUA : STRUTTURA E PROPRIETA

L ACQUA : STRUTTURA E PROPRIETA L ACQUA : STRUTTURA E PROPRIETA 1. Sostanza più abbondante in tutti gli esseri viventi 2. Più del 70% del peso di tutti gli esseri viventi 3. Influenza la struttura e la proprietà di tutte le molecole

Dettagli

Come recuperare il Citation Index di un articolo o di un autore: breve guida

Come recuperare il Citation Index di un articolo o di un autore: breve guida Come recuperare il Citation Index di un articolo o di un autore: breve guida A cura del Gruppo Informazione e comunicazione della Biblioteca Biomedica Redazione: Tessa Piazzini Premessa: Solitamente parlando

Dettagli

e-spare Parts User Manual Peg Perego Service Site Peg Perego [Dicembre 2011]

e-spare Parts User Manual Peg Perego Service Site Peg Perego [Dicembre 2011] Peg Perego Service Site Peg Perego [Dicembre 2011] 2 Esegui il login: ecco la nuova Home page per il portale servizi. Log in: welcome to the new Peg Perego Service site. Scegli il servizio selezionando

Dettagli

Il Form C cartaceo ed elettronico

Il Form C cartaceo ed elettronico Il Form C cartaceo ed elettronico Giusy Lo Grasso Roma, 9 luglio 2012 Reporting DURANTE IL PROGETTO VENGONO RICHIESTI PERIODIC REPORT entro 60 giorni dalla fine del periodo indicato all Art 4 del GA DELIVERABLES

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

Gli asteroidi. Informazioni e contatti: http://vo-for-education.oats.inaf.it - iafrate@oats.inaf.it

Gli asteroidi. Informazioni e contatti: http://vo-for-education.oats.inaf.it - iafrate@oats.inaf.it Esempio sull'utilizzo dell'osservatorio Virtuale Gli asteroidi Informazioni e contatti: http://vo-for-education.oats.inaf.it - iafrate@oats.inaf.it Distribuzione degli asteroidi Il Sistema Solare è composto

Dettagli

DISCIPLINA IVA NEL SUBAPPALTO

DISCIPLINA IVA NEL SUBAPPALTO DISCIPLINA IVA NEL SUBAPPALTO L articolo 35, comma 5, D.L. n. 223/2006 ha aggiunto il seguente comma all articolo 17, D.P.R. n. 633/72: Le disposizioni di cui al comma precedente si applicano anche alle

Dettagli

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx. Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.com Avvertenza di Rischio: Il Margin Trading su forex e/o CFD comporta

Dettagli

Web of Science SM QUICK REFERENCE GUIDE IN COSA CONSISTE WEB OF SCIENCE? General Search

Web of Science SM QUICK REFERENCE GUIDE IN COSA CONSISTE WEB OF SCIENCE? General Search T TMTMTt QUICK REFERENCE GUIDE Web of Science SM IN COSA CONSISTE WEB OF SCIENCE? Consente di effettuare ricerche in oltre 12.000 riviste e 148.000 atti di convegni nel campo delle scienze, delle scienze

Dettagli

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office

Gestione delle Architetture e dei Servizi IT con ADOit. Un Prodotto della Suite BOC Management Office Gestione delle Architetture e dei Servizi IT con ADOit Un Prodotto della Suite BOC Management Office Controllo Globale e Permanente delle Architetture IT Aziendali e dei Processi IT: IT-Governance Definire

Dettagli

SCALA DEI PESI ATOMICI RELATIVI E MEDI

SCALA DEI PESI ATOMICI RELATIVI E MEDI SCALA DEI PESI ATOMICI RELATIVI E MEDI La massa dei singoli atomi ha un ordine di grandezza compreso tra 10-22 e 10-24 g. Per evitare di utilizzare numeri così piccoli, essa è espressa relativamente a

Dettagli

Campioni atomici al cesio

Campioni atomici al cesio Campioni atomici al cesio Introduzione Gli orologi con oscillatore a cristallo di quarzo, che si sono via via rivelati più affidabili e precisi degli orologi a pendolo, hanno iniziato a sostituire questi

Dettagli

5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak

5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak Tipo: Type: 5 cabine (1 main deck+ 4 lower deck) 5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak Tessuti: Dedar Fanfara, Paola Lenti Fabrics: Dedar Fanfara,

Dettagli

Gli alcool, i composti carbonilici e gli acidi carbossilici

Gli alcool, i composti carbonilici e gli acidi carbossilici Gli alcool, i composti carbonilici e gli acidi carbossilici Con questa unità didattica inizieremo a prendere in considerazione dei composti della chimica organica caratterizzati dal contenere oltre ai

Dettagli

Analisi dei requisiti e casi d uso

Analisi dei requisiti e casi d uso Analisi dei requisiti e casi d uso Indice 1 Introduzione 2 1.1 Terminologia........................... 2 2 Modello della Web Application 5 3 Struttura della web Application 6 4 Casi di utilizzo della Web

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

modulo: CHIMICA DEI POLIMERI

modulo: CHIMICA DEI POLIMERI CORSO PON Esperto nella progettazione, caratterizzazione e lavorazione di termoplastici modulo: CHIMICA DEI POLIMERI Vincenzo Venditto influenza delle caratteristiche strutturali, microstrutturali e morfologiche

Dettagli

Sostituzioni sull anello aromatico

Sostituzioni sull anello aromatico Sostituzioni sull anello aromatico Criteri per stabilire l esistenza di carattere aromatico 1. Il composto deve essere ciclico, planare e deve avere una nuvola ininterrotta di elettroni π sopra e sotto

Dettagli

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali:

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali: Gli enzimi Nel metabolismo energetico le cellule producono notevoli quantità di CO 2 che deve essere eliminata con l apparato respiratorio. Il trasferimento della CO 2 dalle cellule al sangue e da esso

Dettagli

F O R M A T O E U R O P E O

F O R M A T O E U R O P E O F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Indirizzo Laura Bacci, PMP Via Tezze, 36 46100 MANTOVA Telefono (+39) 348 6947997 Fax (+39) 0376 1810801

Dettagli

BPEL: Business Process Execution Language

BPEL: Business Process Execution Language Ingegneria dei processi aziendali BPEL: Business Process Execution Language Ghilardi Dario 753708 Manenti Andrea 755454 Docente: Prof. Ernesto Damiani BPEL - definizione Business Process Execution Language

Dettagli

How to Develop Accessible Linux Applications

How to Develop Accessible Linux Applications How to Develop Accessible Linux Applications Sharon Snider Copyright 2002 IBM Corporation v1.1, 2002-05-03 Diario delle Revisioni Revisione v1.1 2002-05-03 Revisionato da: sds Convertito in DocBook XML

Dettagli

Il test valuta la capacità di pensare?

Il test valuta la capacità di pensare? Il test valuta la capacità di pensare? Per favore compili il seguente questionario senza farsi aiutare da altri. Cognome e Nome Data di Nascita / / Quanti anni scolastici ha frequentato? Maschio Femmina

Dettagli

Prodotto Isi Web Knowledge

Prodotto Isi Web Knowledge Guida pratica all uso di: Web of Science Prodotto Isi Web Knowledge acura di Liana Taverniti Biblioteca ISG INMP INMP I prodotti ISI Web of Knowledge sono basi di dati di alta qualità di ricerca alle quali

Dettagli

PRESENTAZIONE DI UN SMS AL GATEWAY

PRESENTAZIONE DI UN SMS AL GATEWAY Interfaccia Full Ascii Con questa interfaccia è possibile inviare i dati al Server utilizzando solo caratteri Ascii rappresentabili e solo i valori che cambiano tra un sms e l altro, mantenendo la connessione

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

Narrare i gruppi. Rivista semestrale pubblicata on-line dal 2006 Indirizzo web: www.narrareigruppi.it - Direttore responsabile: Giuseppe Licari

Narrare i gruppi. Rivista semestrale pubblicata on-line dal 2006 Indirizzo web: www.narrareigruppi.it - Direttore responsabile: Giuseppe Licari Narrare i gruppi Etnografia dell interazione quotidiana Prospettive cliniche e sociali ISSN: 2281-8960 Narrare i gruppi. Etnografia dell'interazione quotidiana. Prospettive cliniche e sociali è una Rivista

Dettagli

Windows Compatibilità

Windows Compatibilità Che novità? Windows Compatibilità CODESOFT 2014 é compatibile con Windows 8.1 e Windows Server 2012 R2 CODESOFT 2014 Compatibilità sistemi operativi: Windows 8 / Windows 8.1 Windows Server 2012 / Windows

Dettagli

Aggiornamenti CIO Rivista ufficiale del Club Italiano Osteosintesi

Aggiornamenti CIO Rivista ufficiale del Club Italiano Osteosintesi Aggiornamenti CIO Rivista ufficiale del Club Italiano Osteosintesi Istruzioni per gli Autori Informazioni generali Aggiornamenti CIO è la rivista ufficiale del Club Italiano Osteosintesi e pubblica articoli

Dettagli

Cos'è esattamente la gelatina

Cos'è esattamente la gelatina Cos'è esattamente la gelatina LA GELATINA È PURA E NATURALE La gelatina attualmente in commercio viene prodotta in moderni stabilimenti operanti in conformità ai più rigorosi standard di igiene e sicurezza.

Dettagli

ISTITUTO COMPRENSIVO N 1 LANCIANO - SCUOLA SECONDARIA DI PRIMO GRADO CURRICOLO VERTICALE - Classe Prima MATEMATICA a.s. 2014/2015

ISTITUTO COMPRENSIVO N 1 LANCIANO - SCUOLA SECONDARIA DI PRIMO GRADO CURRICOLO VERTICALE - Classe Prima MATEMATICA a.s. 2014/2015 NUMERI. SPAZIO E FIGURE. RELAZIONI, FUNZIONI, MISURE, DATI E PREVISIONI Le sociali e ISTITUTO COMPRENSIVO N 1 LANCIANO - SCUOLA SECONDARIA DI PRIMO GRADO CURRICOLO VERTICALE - Classe Prima MATEMATICA procedure

Dettagli

DynDevice ECM. La Suite di applicazioni web per velocizzare, standardizzare e ottimizzare il flusso delle informazioni aziendali

DynDevice ECM. La Suite di applicazioni web per velocizzare, standardizzare e ottimizzare il flusso delle informazioni aziendali DynDevice ECM La Suite di applicazioni web per velocizzare, standardizzare e ottimizzare il flusso delle informazioni aziendali Presentazione DynDevice ECM Cos è DynDevice ICMS Le soluzioni di DynDevice

Dettagli

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM ALLEGATO 2 FULL PROJECT FORM FORM 1 FORM 1 General information about the project PROJECT SCIENTIFIC COORDINATOR TITLE OF THE PROJECT (max 90 characters) TOTAL BUDGET OF THE PROJECT FUNDING REQUIRED TO

Dettagli

Metabolismo dell azoto

Metabolismo dell azoto rof. Giorgio Sartor Metabolismo dell azoto Copyright 2001-2012 by Giorgio Sartor. All rights reserved. Versione 1.4.2 may 2012 AD i RTEIE LISACCARIDI LIIDI AD i Aminoacidi Esosi; entosi Ac. Grassi; Glicerolo

Dettagli

VIRTUALIZE IT. www.digibyte.it - digibyte@digibyte.it

VIRTUALIZE IT. www.digibyte.it - digibyte@digibyte.it il server? virtualizzalo!! Se ti stai domandando: ma cosa stanno dicendo? ancora non sai che la virtualizzazione è una tecnologia software, oggi ormai consolidata, che sta progressivamente modificando

Dettagli

E-MAIL INTEGRATA OTTIMIZZAZIONE DEI PROCESSI AZIENDALI

E-MAIL INTEGRATA OTTIMIZZAZIONE DEI PROCESSI AZIENDALI E-MAIL INTEGRATA OTTIMIZZAZIONE DEI PROCESSI AZIENDALI E-MAIL INTEGRATA Ottimizzazione dei processi aziendali Con il modulo E-mail Integrata, NTS Informatica ha realizzato uno strumento di posta elettronica

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

Analisi dei requisiti e casi d uso

Analisi dei requisiti e casi d uso Analisi dei requisiti e casi d uso Indice 1 Introduzione 2 1.1 Terminologia........................... 2 2 Modello del sistema 4 2.1 Requisiti hardware........................ 4 2.2 Requisiti software.........................

Dettagli

Micro.Stat Workshop laboratori

Micro.Stat Workshop laboratori Promozione e diffusione della cultura statistica Micro.Stat Workshop laboratori I numeri raccontano storie a chi li sa leggere. Le statistiche parlano di ciò che siamo e della società in cui viviamo. Chi

Dettagli

Il World Wide Web: nozioni introduttive

Il World Wide Web: nozioni introduttive Il World Wide Web: nozioni introduttive Dott. Nicole NOVIELLI novielli@di.uniba.it http://www.di.uniba.it/intint/people/nicole.html Cos è Internet! Acronimo di "interconnected networks" ("reti interconnesse")!

Dettagli

Competizione tra reazioni di sostituzione e di eliminazione

Competizione tra reazioni di sostituzione e di eliminazione Competizione tra reazioni di sostituzione e di eliminazione C δ + δ - CH 2 G Centro elettrofilo δ + H Centro elettrofilo Potenziale buon gruppo uscente Si distinguono due principali meccanismi di eliminazione:

Dettagli

Gli orbitali: modello atomico probabilistico

Gli orbitali: modello atomico probabilistico 1 Approfondimento 2.1 Gli orbitali: modello atomico probabilistico Modello atomico planetario (o a gusci): gli elettroni ruotano intorno al nucleo percorrendo orbite prefissate. Il modello atomico planetario

Dettagli

Le formule possono essere scritte utilizzando un insieme di funzioni predefinite che Excel mette a disposizione, raggruppate per argomento.

Le formule possono essere scritte utilizzando un insieme di funzioni predefinite che Excel mette a disposizione, raggruppate per argomento. Excel: le funzioni Le formule possono essere scritte utilizzando un insieme di funzioni predefinite che Excel mette a disposizione, raggruppate per argomento. DEFINIZIONE: Le funzioni sono dei procedimenti

Dettagli

Nota Informativa Relativa alla Circolare 2009/1

Nota Informativa Relativa alla Circolare 2009/1 Nota Informativa Relativa alla Circolare 2009/1 In merito alla nuova circolare del Sottosegretariato per il Commercio Estero del Primo Ministero della Repubblica di Turchia, la 2009/21, (pubblicata nella

Dettagli

Text mining ed analisi di dati codificati in linguaggio naturale. Analisi esplorative di dati testualilezione

Text mining ed analisi di dati codificati in linguaggio naturale. Analisi esplorative di dati testualilezione Text mining ed analisi di dati codificati in linguaggio naturale Analisi esplorative di dati testualilezione 2 Le principali tecniche di analisi testuale Facendo riferimento alle tecniche di data mining,

Dettagli

Internet Internet è universalmente nota come la Rete delle reti: un insieme smisurato di computer collegati tra loro per scambiarsi dati e servizi.

Internet Internet è universalmente nota come la Rete delle reti: un insieme smisurato di computer collegati tra loro per scambiarsi dati e servizi. Internet Internet è universalmente nota come la Rete delle reti: un insieme smisurato di computer collegati tra loro per scambiarsi dati e servizi. Internet: la rete delle reti Alberto Ferrari Connessioni

Dettagli

Traduzione di TeamLab in altre lingue

Traduzione di TeamLab in altre lingue Lingue disponibili TeamLab è disponibile nelle seguenti lingue nel mese di gennaio 2012: Traduzioni complete Lingue tradotte parzialmente Inglese Tedesco Francese Spagnolo Russo Lettone Italiano Cinese

Dettagli

Proposition for a case-study identification process. 6/7 May 2008 Helsinki

Proposition for a case-study identification process. 6/7 May 2008 Helsinki Conférence des Régions Périphériques Maritimes d Europe Conference of Peripheral Maritime Regions of Europe ANALYSIS PARTICIPATION TO THE FP THROUGH A TERRITORIAL AND REGIONAL PERSPECTIVE MEETING WITH

Dettagli

group HIGH CURRENT MULTIPLEX NODE

group HIGH CURRENT MULTIPLEX NODE HIGH CURRENT MULTIPLEX NODE edizione/edition 04-2010 HIGH CURRENT MULTIPLEX NODE DESCRIZIONE GENERALE GENERAL DESCRIPTION L'unità di controllo COBO è una centralina elettronica Multiplex Slave ; la sua

Dettagli

IBM Cognos 8 BI Midmarket Reporting Packages Per soddisfare tutte le vostre esigenze di reporting restando nel budget

IBM Cognos 8 BI Midmarket Reporting Packages Per soddisfare tutte le vostre esigenze di reporting restando nel budget Data Sheet IBM Cognos 8 BI Midmarket Reporting Packages Per soddisfare tutte le vostre esigenze di reporting restando nel budget Panoramica Le medie aziende devono migliorare nettamente le loro capacità

Dettagli

Unità 12. La corrente elettrica

Unità 12. La corrente elettrica Unità 12 La corrente elettrica L elettricità risiede nell atomo Modello dell atomo: al centro c è il nucleo formato da protoni e neutroni ben legati tra di loro; in orbita intorno al nucleo si trovano

Dettagli

WAN 80.80.80.80 / 24. L obiettivo è quello di mappare due server web interni (porta 80) associandoli agli indirizzi IP Pubblici forniti dall ISP.

WAN 80.80.80.80 / 24. L obiettivo è quello di mappare due server web interni (porta 80) associandoli agli indirizzi IP Pubblici forniti dall ISP. Configurazione di indirizzi IP statici multipli Per mappare gli indirizzi IP pubblici, associandoli a Server interni, è possibile sfruttare due differenti metodi: 1. uso della funzione di Address Translation

Dettagli

GEOMETRIA MOLECOLARE

GEOMETRIA MOLECOLARE GEOMETRIA MOLECOLARE Le molecole hanno geometrie spaziali ben definite caratterizzate da distanze di legame ed angoli di legame. Questi possono essere determinati sperimentalmente (es. raggi X). Si vede

Dettagli

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica).

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica). 3.4. I LIVELLI I livelli sono strumenti a cannocchiale orizzontale, con i quali si realizza una linea di mira orizzontale. Vengono utilizzati per misurare dislivelli con la tecnica di livellazione geometrica

Dettagli

Web conferencing software. Massimiliano Greco - Ivan Cerato - Mario Salvetti

Web conferencing software. Massimiliano Greco - Ivan Cerato - Mario Salvetti 1 Web conferencing software Massimiliano Greco - Ivan Cerato - Mario Salvetti Arpa Piemonte 2 Che cosa è Big Blue Button? Free, open source, web conferencing software Semplice ed immediato ( Just push

Dettagli

MODULO DI ISCRIZIONE - ENROLMENT FORM

MODULO DI ISCRIZIONE - ENROLMENT FORM Under the Patronage of Comune di Portofino Regione Liguria 1ST INTERNATIONAL OPERA SINGING COMPETITION OF PORTOFINO from 27th to 31st July 2015 MODULO DI ISCRIZIONE - ENROLMENT FORM Direzione artistica

Dettagli

1 - Cos è l accessibilità e a chi è destinata

1 - Cos è l accessibilità e a chi è destinata 1 - Cos è l accessibilità e a chi è destinata di Michele Diodati michele@diodati.org http://www.diodati.org Cosa significa accessibile 2 di 19 Content is accessible when it may be used by someone with

Dettagli

Relazione sul data warehouse e sul data mining

Relazione sul data warehouse e sul data mining Relazione sul data warehouse e sul data mining INTRODUZIONE Inquadrando il sistema informativo aziendale automatizzato come costituito dall insieme delle risorse messe a disposizione della tecnologia,

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

Informatica per la comunicazione" - lezione 9 -

Informatica per la comunicazione - lezione 9 - Informatica per la comunicazione" - lezione 9 - Protocolli di livello intermedio:" TCP/IP" IP: Internet Protocol" E il protocollo che viene seguito per trasmettere un pacchetto da un host a un altro, in

Dettagli

2. Cos è una buona pratica

2. Cos è una buona pratica 2. Cos è una buona pratica Molteplici e differenti sono le accezioni di buona pratica che è possibile ritrovare in letteratura o ricavare da esperienze di osservatori nazionali e internazionali. L eterogeneità

Dettagli

BRM. Tutte le soluzioni. per la gestione delle informazioni aziendali. BusinessRelationshipManagement

BRM. Tutte le soluzioni. per la gestione delle informazioni aziendali. BusinessRelationshipManagement BRM BusinessRelationshipManagement Tutte le soluzioni per la gestione delle informazioni aziendali - Business Intelligence - Office Automation - Sistemi C.R.M. I benefici di BRM Garantisce la sicurezza

Dettagli

MARKETING INTELLIGENCE SUL WEB:

MARKETING INTELLIGENCE SUL WEB: Via Durini, 23-20122 Milano (MI) Tel.+39.02.77.88.931 Fax +39.02.76.31.33.84 Piazza Marconi,15-00144 Roma Tel.+39.06.32.80.37.33 Fax +39.06.32.80.36.00 www.valuelab.it valuelab@valuelab.it MARKETING INTELLIGENCE

Dettagli

voce dei cittadini in tempo reale OpinionMeter Chieda la sua prova personalizzata senza impegno entro il 15 ottobre 2010

voce dei cittadini in tempo reale OpinionMeter Chieda la sua prova personalizzata senza impegno entro il 15 ottobre 2010 Grazie per il suo interesse alla nuova tecnologia voce dei cittadini in tempo reale OpinionMeter Chieda la sua prova personalizzata senza impegno entro il 15 ottobre 2010 Cristina Brambilla Telefono 348.9897.337,

Dettagli

Materia: INGLESE Data: 24/10/2004

Materia: INGLESE Data: 24/10/2004 ! VERBI CHE TERMINANO IN... COME COSTRUIRE IL SIMPLE PAST ESEMPIO e aggiungere -d live - lived date - dated consonante + y 1 vocale + 1 consonante (ma non w o y) cambiare y in i, poi aggiungere -ed raddoppiare

Dettagli

Manuale installazione KNOS

Manuale installazione KNOS Manuale installazione KNOS 1. PREREQUISITI... 3 1.1 PIATTAFORME CLIENT... 3 1.2 PIATTAFORME SERVER... 3 1.3 PIATTAFORME DATABASE... 3 1.4 ALTRE APPLICAZIONI LATO SERVER... 3 1.5 ALTRE APPLICAZIONI LATO

Dettagli

Sistemi di gestione dei dati e dei processi aziendali. Information Technology General Controls

Sistemi di gestione dei dati e dei processi aziendali. Information Technology General Controls Information Technology General Controls Indice degli argomenti Introduzione agli ITGC ITGC e altre componenti del COSO Framework Sviluppo e manutenzione degli applicativi Gestione operativa delle infrastrutture

Dettagli

Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009

Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009 Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009 Introduzione generale Autenticazione dell operatore https://sebina1.unife.it/sebinatest Al primo accesso ai servizi di Back Office, utilizzando

Dettagli

Introduzione a MySQL

Introduzione a MySQL Introduzione a MySQL Cinzia Cappiello Alessandro Raffio Politecnico di Milano Prima di iniziare qualche dettaglio su MySQL MySQL è un sistema di gestione di basi di dati relazionali (RDBMS) composto da

Dettagli

Castello di San Donato in Perano Matrimoni nel Chianti Weddings in Chianti

Castello di San Donato in Perano Matrimoni nel Chianti Weddings in Chianti Castello di San Donato in Perano Matrimoni nel Chianti Weddings in Chianti Sede di Rappresentanza: Castello di San Donato in Perano 53013 Gaiole in Chianti (Si) Tel. 0577-744121 Fax 0577-745024 www.castellosandonato.it

Dettagli