Dimensione: px
Iniziare la visualizzazioe della pagina:




2 Programma Banche dati proteiche. Interrogazione delle banche dati. Allineamento di sequenze proteiche. Matrici di sostituzione. Allineamento con gap. Allineamento globale e locale. BLAST e FASTA. Allineamento multiplo. Visualizzazione degli allineamenti. Applicazioni dei profili di multiallinemento. Ricerca di pattern e motivi funzionali nelle proteine. Banche dati dei profili proteici. Filogenesi molecolare. L orologio molecolare. Analisi della struttura primaria delle proteine. Struttura secondaria delle proteine. Strumenti per la predizione della struttura secondaria. Visualizzazione tridimensionale delle proteine. Strumenti per la proteomica. RasMol. Swiss PDB Viewer. Strumenti per la predizione della struttura tridimensionale. Homology modelling. Interazione tra proteine. Docking. Testi consigliati: G.Valle et al. Introduzione alla bioinformatica Zanichelli A.Tramontano Bioinformatica - Zanichelli

3 Cos è la bioinformatica E una scienza multidisciplinare che integra conoscenze informatiche, chimiche, matematiche, biologiche allo scopo di collezionare ed elaborare sistematicamente ogni informazione per ottenere la massima resa dalle ricerche sperimentali ma anche per sviluppare queste ultime in modo più mirato. Grazie alla bioinformatica è possibile avere uno sguardo d insieme su tutte le conoscenze scientifiche e da questo partire per ulteriori osservazioni sia mediante metodi informatici, sia mediante metodi sperimentali.

4 Chi si occupa di bioinformatica può appartenere a due categorie principali: SVILUPPATORI: coloro che si occupano di creare nuovi strumenti informatici per l analisi scientifica UTENTI: coloro che utilizzano gli strumenti bioinformatici per ottenere dati e da questi partire per l analisi sperimentale vera e propria. il programma che si utilizza può definirsi il metodo sperimantale della bioinformatica le banche dati posso definirsi il materiale sperimentale utilizzato dalla bioinformatica

5 Banche dati Si possono raggruppare in quattro categorie principali: - di biosequenze (dette anche primarie) - genomiche - di espressione genica - proteiche Nel corso verranno trattate le banche dati proteiche anche se non bisogna dimenticare che molti dati sulle proteine derivano dalle banche dati primarie, cioè quelle nucleotidiche.

6 Data una sequenza nucleotidica è possibile tradurla utilizzando tutti e tre i frame di lettura (+1, +2, +3) di entrambi i filamenti (senso e antisenso), allo scopo di individuare una Open Reading Frame (ORF) +1 cioè una sequenza proteica di lungheza adatta ad essere una proteina (non meno di residui). In questo modo, e con programmi appositi che scansionano tutto un genoma, è possibile trovare tantissime proteine PUTATIVE, cioè possibili ma non verificate Traduzione in silico T R M P L S L S M G M P I V H I H S N A N A S L S F D G Y A N C P H S L E R E C L S L F R W V C Q L S T F T R 1 gaacgcgaatgcctctctctctttcgatgggtatgccaattgtccacattcactcgt F A F A E R E K S P Y A L Q G C E S T R S H R E R K R H T H W N D V N V R V R I G R E R E I P I G I T W M * E

7 Il codice genetico Si definisce DEGENERATO e RIDONDANTE. E composto da 64 diversi codoni che codificano i 20 amino acidi. La tebella accanto mostra le varie degenerazioni dei codoni per ogni amino acido. Alanine Ala A GC[CATG] Cysteine Cys C TG[CT] Aspartic AciD Asp D GA[CT] Glutamic Acid Glu E GA[AG] Phenylalanine Phe F TT[CT] Glycine Gly G GG[CATG] Histidine His H CA[CT] Isoleucine Ile I AT[CAT] Lysine Lys K AA[AG] Leucine Leu L CT[CATG], TT[AG] Methionine Met M ATG AsparagiNe Asn N AA[CT] Proline Pro P CC[CATG] Glutamine Gln Q CA[AG] ARginine Arg R CG[CATG], AG[AG] Serine Ser S TC[CTAG], AG[CT] Threonine Thr T AC[CATG] Valine Val V GT[CATG] Tryptophan Trp W TGG TYrosine Tyr Y TA[CT] STOP - - TA[AG], TGA

8 Trascrizione Aminoacil-tRNA trna rrna mrna RBS----ATG AAA TAC TAA Struttura primaria Sintesi proteica Struttura secondaria Folding Struttura terziaria

9 Gli amino acidi Sono composti organici che presentano almeno un gruppo carbossilico (-COOH) a funzione acida e un gruppo aminico (-NH 2 ) a funzione basica Le proteine sono composte soltanto da alfa-amino acidi, legati tra loro mediante legami detti PEPTIDICI che si instaurano tra il COOH e l NH 2. Ciò che diversifica i vari amino acidi è la catena laterale legata al carbonio alfa, che può conferire all amino acido caratteristiche chimico-fisiche diverse.

10 In base alla catena laterale si riconoscono 5 gruppi principali di amino acidi Acidi Basici Strutturali Polari non carichi Idrofobici Aromatici

11 I polimeri di alfa amino acidi (le proteine) sono influenzati dalle caratteristiche chimico-fisiche delle catane laterali e in base a principi di interazioni deboli di tipo idrofobico o elettrostatico si osservano dei ripiegamenti, fino al raggiungimento della minor energia termodinamica. Questo processo, denominato FOLDING, è alla base del funzionamento delle proteine, visto che solo se sono correttamente strutturate esse assumeranno la loro forma e soprattutto FUNZIONE definitiva. La strutturazione delle proteine dipende quindi principalmente dalla sequenza dei residui che la compongono, oltre che dall ambiente in cui si strutturano

12 Struttura delle proteine Il legame peptidico ha delle caratteristiche di doppio legame e costringe i due atomo adiacenti a giacere sullo stesso piano. La rotazione della molecola avviene intorno al carbonio alfa, ma non tutti gli angoli di rotazione sono permessi a causa degli ingombri sterici delle diverse catene laterali e dello scheletro stesso.

13 Il legame peptidico genera una polarità negli scheletri proteici per cui si vengono a formare PONTI IDROGENO tra gli idrogeni dei gruppi amidici e ossigeni dei carbonili. Queste interazioni deboli portano la struttura primaria della proteina (la sequenza dei suoi residui) a ripiegarsi in una STRUTTURA SECONDARIA in cui sono riconoscibili due formazioni 1- Alfa elica: struttura compatta avvolta in cui i legami idrogeno sono disposti parallelamente allo scheletro. 2 - Beta-strand: struttura rilassata in cui i ponti idrogeno si stabiliscono tra catene adiacenti che possono essere parallele o antiparallele, a formare dei foglietti beta.

14 Le varie strutture secondarie si collegano tra loro mediante anse (loop) in cui non ci sono ponti idrogeno intramolecolari e che quindi non hanno un organizzazione definita. In realtà alcune connessioni tra strutture secondarie sono conservate: es. per congiungere due beta-strands antiparalleli serve un connettore che permetta una curva molto stretta. La connessione HAIRPIN LOOP è un esempio. Strutture secondarie che si uniscono formano molto spesso delle strutture super-secondarie denominate MOTIVI

15 Beta-turn-beta up-down greca jelly-roll Alpha-turn-alpha super-barrel coiled-coil four helix bundle beta-alpha-beta fold di Rossmann

16 Alcune strutture terziarie Dominio singolo Dominio doppio Dominio triplo Dominio quadruplo

17 Strutture quaternarie simmetriche

18 Alcune osservazioni importanti 1) nello scrivere le proteine o i nucleotidi, usate sempre il carattere COURIER, non altri caratteri con spaziatura ineguale come il times, altrimenti succede questo: VILMA anzichè: VILMA e si perdono gli allineamenti VLLMA VLLMA 2) utilizzate sempre il blocco note o simili per editare le sequenze, in modo da non avere formattazioni impreviste. Il formato SOLO TESTO è il più adatto. 3) non copiate MAI a mano le sequenze, anche se brevi. Usate sempre il copia e incolla. Quindi: tenete i dati in formato elettronico, non cartaceo. 4) per modificare l aspetto delle sequenze, utilizzate programmi appositi, non fate nulla a mano. Un ottimo programma è il Sequence Manipulation Suite (SMS)


20 Banche dati

21 Nascita delle banche dati Inizio anni 70: nasce la tecnologia del DNA ricombinante, che permette di manipolare le sequenze nucleotidiche e di capire la struttura, la funzione e l organizzazione del DNA. Fine anni 70: pubblicazione dei primi dati genomici, con le prime sequenze nucleotidiche codificanti liberamente accessibili attraverso i rudimenti della rete disponibili a quel tempo tra le varie università. 2001: il Consorzio Pubblico Internazionale e la Celera Genomics forniscono dati del genoma umano completo, aprendo la strada ai progetti di sequenziamento a tappeto. Successivamente, l approccio biotecnologico ha fornito una serie imponente di dati di natura proteomica grazie all analisi spettrometrica e all elettroforesi 2-D, ed una serie altrettanto vasta di dati di trascrittomica grazie alla tecnologia dei microarrays.

22 Insieme ai dati nasce l esigenza di sistemi di archiviazione e di ritrovamento facili e esaustivi, in modo da averli a disposizione in ogni istante, dato che sebbene ci siano tantissime informazioni, ognuna deve essere validata e confermata, essendo per la maggior parte dati grezzi non rielaborati. Conoscere il dato non significa capire il dato, serve sempre un approccio sperimentale classico perchè questo sia veramente verificato. => una banca dati è il posto dove cercare i dati da cui partire per una ricerca, non il suo punto di arrivo.

23 I pionieri 1965: Margareth Dayhoff compila un atlante di proteine omologhe studiando le relazioni tra le sequenze primarie 1970: l atlante viene reso pubblico in versione elettronica nella banca dati NBRF nascita della prima banca dati proteica. Ancora non ci sono dati di sequenziamento nucleotidico nella banca, sono tutti dati di natura biochimica classica, ma l idea di rendere disponibili in modo libero dei dati accumulati e organizzati è alla base del concetto che muove gli organizzatori e i curatori delle banche dati, e che muove anche i fondi per la loro gestione

24 Banche dati primarie 1981: nasce nel Laboratorio Europeo di Biologia Molecolare ad Heidelberg (Germania) l EMBL-datalibrary, 519 entries con sequenze di DNA e RNA, autore Kurt Stueber 1982: nasce una banca dati simile negli USA, darà vità alla GenBank, autore Walter Goad 1986: nel National Institute of Genetics in Mishima (Giappone) nasce un mirror della GenBank, la DDBJ EMBL GenBank DDBJ => circa le stesse informazioni, organizzate in modo diverso

25 Infrastrutture principali EMBNet, nata nel 1988 come rete europea a supporto della ricerca bio-molecolare, oggi conta 41 nodi nazionali in paesi europei ed extraeuropei (In Italia il nodo è a Bari) APBioNet (Asian-Pacific Biologic Network), recentemente gemelleta con EMBNet, organizzazione analoga Oggi i due database primari più importanti sono nei centri EBI (Cambridge, UK) : EMBL data-library NCBI (USA) : GenBank

26 Organizzazione di un database biologico L oggetto principale è la ENTRY, una unità riconoscibile grazie ad un identificatore univoco, che possiede una descrizione organizzata in campi standardizzati riconoscibili grazie ad HEADERS univoci nella banca dati. es. Identificatore Autore Data ecc. Ogni banca dati presenta 2 versioni delle entries: Flat-file: un file di testo semplice, formattato, non interattivo HTML (o XML): interattivo, di facile consultazione

27 L interattività ha un ruolo centrale per una banca dati, perchè permette di navigare tra le sue entries e quelle di altri databases sia i flat-file sia le pagine XML sono ricchi di cross-references, riferimenti che mandano ad altre banche dati generiche o specializzate. Si ottiene così per ogni entry una serie di informazioni spesso ridondanti, tra cui è bene sapresi orientare, anche perchè alcune sembrano in contraddizione, es. - una proteina può avere dei riferimenti a sequenze codificanti diverse - una entry può avere più nomi per descriverla o può corrispondere a più autori

28 Un esempio di entry proteica EMBL (flat-file) 1: AAC orf, hypothetical...[gi: ] LOCUS AAC aa linear BCT 01-DEC-2000 DEFINITION orf, hypothetical protein [Escherichia coli K12]. ACCESSION AAC74054 VERSION AAC GI: DBSOURCE locus AE accession AE KEYWORDS. SOURCE Escherichia coli K12. ORGANISM Escherichia coli K12 Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae; Escherichia. REFERENCE 1 (residues 1 to 92) AUTHORS Blattner,F.R., Plunkett,G. III, Bloch,C.A., Perna,N.T., Burland,V., Riley,M., Collado-Vides,J., Glasner,J.D., Rode,C.K., Mayhew,G.F., Gregor,J., Davis,N.W., Kirkpatrick,H.A., Goeden,M.A., Rose,D.J., Mau,B. and Shao,Y. TITLE The complete genome sequence of Escherichia coli K-12 JOURNAL Science 277 (5331), (1997) MEDLINE PUBMED

29 REFERENCE 2 (residues 1 to 92) AUTHORS Blattner,F.R. TITLE Direct Submission JOURNAL Submitted (16-JAN-1997) Guy Plunkett III, Laboratory of Genetics, University of Wisconsin, 445 Henry Mall, Madison, WI 53706, USA. Phone: Fax: REFERENCE 3 (residues 1 to 92) AUTHORS Blattner,F.R. TITLE Direct Submission JOURNAL Submitted (02-SEP-1997) Guy Plunkett III, Laboratory of Genetics, University of Wisconsin, 445 Henry Mall, Madison, WI 53706, USA. Phone: Fax: REFERENCE 4 (residues 1 to 92) AUTHORS Plunkett,G. III. TITLE Direct Submission JOURNAL Submitted (13-OCT-1998) Laboratory of Genetics, University of Wisconsin, 445 Henry Mall, Madison, WI 53706, USA COMMENT This sequence was determined by the E. coli Genome Project at the University of Wisconsin-Madison (Frederick R. Blattner, director). Supported by NIH grants HG00301 and HG01428 (from the Human Genome

30 Project and NCHGR). The entire sequence was independently determined from E. coli K12 strain MG1655. Predicted open reading frames were determined using GeneMark software, kindly supplied by Mark Borodovsky, Georgia Institute of Technology, Atlanta, GA, [ Open reading frames that have been correlated with genetic loci are being annotated with CG Site Nos., unique ID nos. for the genes in the E. coli Genetic Stock Center (CGSC) database at Yale University, kindly supplied by Mary Berlyn. A public version of the database is accessible ( Annotation of the genome is an ongoing task whose goal is to make the genome sequence more useful by correlating it with other data. Comments to the authors are appreciated. Updated information will be available at the E. coli Genome Project's World Wide Web site ( *** The E. coli K12 sequence and its annotations are periodically updated; this is version M54. No sequence changes. Annotation updates: updated gene identifications and products; all new functional assignments courtesy of Monica Riley; added promoters, protein binding sites, and repeated sequences described in reference 1. The unique numeric identifiers beginning with a lowercase 'b' assigned to each gene (protein- or RNA-encoding) are now designated as gene synonyms instead of labels. This should allow them to be searched for in Entrez as gene names.

31 Method: conceptual translation. FEATURES Location/Qualifiers source /organism="escherichia coli K12" /strain="k12" /sub_strain="mg1655" /db_xref="taxon:83333" Protein /function="orf; Unknown" CDS /gene="b0968" /coded_by="ae : " /note="o93; 44 pct identical (2 gaps) to 85 residues from acylphosphatase, organ-common type isozyme, ACYO_CHICK SW:P07032 (98 aa)" /transl_table=11 ORIGIN 1 mskvciiawv ygrvqgvgfr yttqyeakrl gltgyaknld dgsvevvacg eegqveklmq 61 wlksggprsa rvervlseph hpsgeltdfr ir // Revised: July 5, 2002.

32 Ogni banca dati ha dei suoi codici di identificazione e definisce le sue entries secondo un rigido standard, imponendo a priori un certo numero di possibili campi contrassegnati da tag specifici. Nell esempio visto prima: ACCESSION AAC74054 indica il numero di accesso, ORGANISM Escherichia coli K12 Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae; Escherichia. indica l organismo a cui appartiene e la sua tassonomia. Qualsiasi cosa è standardizzata, dai tags agli spazi ed ai segni di punteggiatura. Questo permette ai programmi di RETRIEVAL, cioè di ricerca, di trovare rapidamente ciò che si cerca.

33 Banche dati dell EMBL

34 Banche dati dell NCBI

35 Banche dati proteiche più utilizzate UniProt raccoglie le informazioni dei database Swiss-prot, TrEMBL e PIR. Offre la possibilità di effettuare Text Search o Blast Search. Viene curato anche un database NON RIDONDANTE (UniRef). Molto curato e dattagliato, con annotazioni circa funzione, struttura, modificazioni e altre informazioni utili E la traduzione in silico di ogni entry codificante del database primario dell EMBL, non è accurato, ma è ricchissimo E il discendente diretto del database della Dayhoff, è curato a mano e le annotazioni sono molto ricche e precise

36 Banche dati proteiche più utilizzate E un database di famiglie e domini proteici comprensiva di pattern e motivi (signatures) che identificano e rendono riconoscibili e classificabili le proteine. La ricerca in prosite comprende anche altri database strutturali e di classificazione. una signature formattata, definita anche pattern.

37 Banche dati proteiche più utilizzate Pfam è una raccolta di proteine allineate e di profili generati con gli HMM che descrivono quasi tutte le famiglie e i domini proteici conosciuti. Da qui è possibile una analisi dettagliata sfruttando le risorse disponibili nel server del Sanger Institute per l analisi familiare delle proteine. Il Proteome Analysis Database è una immensa raccolta di proteine catalogate per organismo di appartenenza e permette analisi interproteomiche mediante opportuni programmi di confronto.

38 Banche dati proteiche più utilizzate Database di Protein Fingerprints, cioè pattern caratteristici di certe famiglie proteihce Database di domini proteici generato in modo automatico da Swiss-Prot e TrEMBL Database di architetture proteiche annotate per organismo e per famiglia Database di strutture tridimensionali di proteiene altre componenti proteiche

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l


amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente Gli amminoacidi naturali sono α-amminoacidi : il gruppo amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente formula generale: gruppo funzionale carbossilico


Rappresentazione dei Dati Biologici

Rappresentazione dei Dati Biologici Rappresentazione dei Dati Biologici CORSO DI BIOINFORMATICA C.d.L. Ingegneria Informatica e Biomedica Outline Proteine ed Amminoacidi Rappresentazione di Amminoacidi Rappresentazione delle strutture Proteiche


I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica Gli aminoacidi NOMENCLATURA Aminoacido Abbr. tre lettere Abbr. una lettera Aminoacido Abbr. tre lettere Abbr. una lettera Alanina ALA A Lisina LYS K Arginina ARG R Metionina MET M Asparagina ASN N Fenilalanina


Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.



AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE Vengono chiamate amminoacidi quelle molecole organiche in cui sono contemporaneamente presenti sia un gruppo acido carbossilico -COO che un gruppo amminico -N2. Una molecola appartenente


Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo


Le proteine. Polimeri composto da 20 diversi aminoacidi

Le proteine. Polimeri composto da 20 diversi aminoacidi Le proteine Polimeri composto da 20 diversi aminoacidi (D. Voet, J.G. Voet, Biochemistry, 3 ed., John Wiley & Sons, 2004) PROTEINE come ATTUATORI nella cellula Trasporto elettronico Trasporto di ioni e



REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma


Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,





Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine


SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche.

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche. I due centri maggiori, EBI e NCBI hanno sviluppato sistemi dedicati di RETRIEVAL allo scopo di ottenere il massimo delle informazioni con il minimo sforzo da parte dell utente SRS (Sequence Retrieval System)


Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti Le Biomolecole I parte Lezioni d'autore di Giorgio Benedetti LE BIOMOLECOLE Le biomolecole, presenti in tutti gli esseri viventi, sono molecole composte principalmente da carbonio, idrogeno, azoto e ossigeno.


2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata Ammino acidi Composto che contiene una funziome acida e amminica. Usualmente però con amminoacidi si intendono gli alfa- amminoacidi. Tra questi composti ve ne sono 20 che vengono definiti geneticamente


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,


Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli


E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale.

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale. Homology modelling L omology modeling delle proteine è il tipo di predizione di struttura terziaria più semplice ed affidabile. Viene richiesta soltanto una (o più) sequenze di riferimento su cui modellare


ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor


Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica



INTRODUZIONE ALLA PROTEINE BCP 1-2 INTRODUZIONE ALLA BIOCHIMICA DELLE PROTEINE BCP 1-2 Pietre miliari Lehninger 1973 Biochemistry Proteine ricombinanti Protein engineering Cristallografia, NMR, EM, MS, spettroscopie... Computing Bioinformaticai


Predizione della struttura terziaria

Predizione della struttura terziaria Predizione della struttura terziaria Metodi di predizione La predizione della struttura tridimensionale è di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi


Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale:

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: N 2 Il nome ordinario degli amminoacidi prevale su quello della nomenclatura IUPA. Si possono avere α-amminoacidi,



BIOINFORMATICA: Cosa è? BIOINFORMATICA: Cosa è? THE DEFINITIONS OF BIOINFORMATICS Bioinformatics is an integration of mathematical, statistical and computer methods to analyse biological, biochemical and biophysical data (Georgia


Dipartimento Di Scienze Della Vita STRUTTURA DELLE PROTEINE



Bioinformatica: Allineamento di Sequenze di Aminoacidi di Bandiera Roberto

Bioinformatica: Allineamento di Sequenze di Aminoacidi di Bandiera Roberto Bioinformatica: Allineamento di Sequenze di Aminoacidi di Bandiera Roberto La Bioinformatica è una disciplina che si occupa dell applicazione dell informatica nell ambito biologico per consentire lo studio


Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli Fonti e testi di riferimento Dan Graur: >courses > bioinformatics


Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione


Aminoacidi e proteine

Aminoacidi e proteine Prof. Giorgio Sartor Aminoacidi e proteine Copyright 2001-2012 by Giorgio Sartor. Versione 1.7.1 mar 2012 All rights reserved. Le cellule V.1.7.1 gsartor 2001-2012 Aminoacidi e proteine -2- Aminoacidi


Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,


Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


delegate a conservare e trasmettere l'informazione genetica. Oggi é noto che sono gli acidi

delegate a conservare e trasmettere l'informazione genetica. Oggi é noto che sono gli acidi 8. Le proteine Il termine "proteina" (dal greco προτειος: di primaria importanza) fu coniato nel 1838 dal chimico svedese J. Berzelius 1 quando ancora si riteneva che le proteine fossero le molecole delegate


Macromolecole Biologiche. I domini (I)

Macromolecole Biologiche. I domini (I) I domini (I) I domini I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I domini sono definiti come una


Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)


Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine


Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa

Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa Gli amminoacidi Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa classe di molecole: p. es. la catalisi delle


Struttura delle proteine

Struttura delle proteine Struttura delle proteine Nelle proteine vi sono quattro livelli di organizzazione strutturale Struttura Primaria: sequenza di aminoacidi legati tra loro da legami peptidici Tutte le proteine esistenti


Amminoacidi e Proteine

Amminoacidi e Proteine Amminoacidi e Proteine Struttura generale di un α-amminoacido R = catena laterale AMMINOACIDI (AA) CELLULARI Gli amminoacidi presenti nella cellula possono essere il prodotto di idrolisi delle proteine


Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle


Relazione struttura-funzione

Relazione struttura-funzione Biotecnologie applicate alla progettazione e sviluppo di molecole biologicamente attive A.A. 2010-2011 Modulo di Biologia Strutturale Relazione struttura-funzione Marco Nardini Dipartimento di Scienze


Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE


Continua. Peptidasi H 2 O

Continua. Peptidasi H 2 O Continua Peptidasi H 2 O Classificazione delle peptidasi 1. Meccanismo catalitico 2. Tipo di reazione catalizzata 3. Struttura molecolare e omologia 1. Meccanismo catalitico (mostrato per la chimotripsina)


Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 7 La struttura delle proteine Concetti chiave: La struttura terziaria di una proteina descrive il ripiegamentodei suoi elementi


1. Le banche dati biologiche

1. Le banche dati biologiche 1. Le banche dati biologiche NCBI, ENTREZ, MEDLINE, PUBMED Il National Center for Biotechnology Information (NCBI), un ente governativo americano, gestisce un sito web ( attraverso


Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4 Indice Prefazione XIII Protein Data Bank: una nota degli autori XIV Nota all edizione italiana XV Ringraziamenti XVI CAPITOLO 1 Dalla sequenza alla struttura 1.0 Visione d insieme: funzione e architettura


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze



AMINOACIDI - 1 AMINOACIDI - 2 AMINOAIDI - 1 Proteine (gr. pròtos = primo) 50-80% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida o alcalina α-aminoacidi proteasi Struttura generale degli α-aminoacidi primari



SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza



BIOMOLECOLE STRUTTURA E FUNZIONE BIOMOLECOLE STRUTTURA E FUNZIONE Lo studio delle relazioni tra struttura e funzione nelle biomolecole è uno degli aspetti più importanti per la comprensione del funzionamento dei processi biologici La


4x4x4=4 3 =64 codoni. 20 aminoacidi

4x4x4=4 3 =64 codoni. 20 aminoacidi 4x4x4=4 3 =64 codoni 20 aminoacidi 1 Le 20 diverse catene laterali (gruppo R) che costituiscono gli aminoacidi si differenziano considerevolmente per dimensioni, volume e per le loro caratteristiche fisico-chimiche,


Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Docente: Dr. Nicola Vitulo Dipartimento di Biologia, CRIBI Viale G.Colombo3, 35131 Padova


Macromolecole Biologiche. I domini (II)

Macromolecole Biologiche. I domini (II) I domini (II) Domini β Nonostante l elevato numero di possibili disposizioni di filamenti β (a costituire foglietti β antiparalleli) connessi da tratti di loop, i domini β più frequentemente osservati





La biochimica è anche definita la chimica del C :

La biochimica è anche definita la chimica del C : Tutte le cellule viventi sono composte da macromolecole simili, costituite dalle stesse piccole molecole di base. La grande diversità è data dalle diverse combinazioni di 4 principali elementi C H O N


La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un


Basi di dati biologiche

Basi di dati biologiche Basi di dati biologiche Seminario per il corso di Basi di Dati II Luana Rinaldi AGENDA: Introduzione alla bioinformatica; Concetti Biologici; Banche dati biologiche; Collaborazioni


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%


I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini.

I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I domini sono definiti come una catena polipeptidica


Le proteine. Le proteine sono macromolecole che presentano differenze funzionali e strutturali

Le proteine. Le proteine sono macromolecole che presentano differenze funzionali e strutturali Le proteine Le proteine sono macromolecole che presentano differenze funzionali e strutturali LE PROTEINE HANNO FUNZIONI BIOLOGICHE DIVERSE enzimi proteine di trasporto proteine strutturali proteine di


La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA


I Composti Organici. Le Biomolecole

I Composti Organici. Le Biomolecole I Composti Organici I composti organici sono molecole tutte contenenti carbonio. Essi comprendono. 1. composti di interesse energetico che sono gli Idrocarburi ( i derivati del petrolio), 2. composti a


LE PROTEINE. Le proteine sono i biopolimeri piu' abbondanti negli organismi viventi e svolgono funzioni biologiche di fondamentale importanza:

LE PROTEINE. Le proteine sono i biopolimeri piu' abbondanti negli organismi viventi e svolgono funzioni biologiche di fondamentale importanza: LE PRTEINE Le proteine sono i biopolimeri piu' abbondanti negli organismi viventi e svolgono funzioni biologiche di fondamentale importanza: PRTEINE CATALITICHE PRTEINE REGLATRICI PRTEINE DIFESA PRTEINE



3.3. UMAMI NEGLI ALIMENTI 3.3. UMAMI NEGLI ALIMENTI In questo capitolo saranno esaminati i vari cibi, ad esclusione di quelli ittici che verranno presi in considerazione successivamente, allo scopo di scoprire se in essi è presente,


Prof. Maria Nicola GADALETA

Prof. Maria Nicola GADALETA Prof. Maria Nicola GADALETA E-mail: Facoltà di Scienze Biotecnologiche Corso di Laurea in Biotecnologie Sanitarie e Farmaceutiche Biochimica e Biotecnologie Biochimiche DISPENSA

Dettagli Emanuele Pascariello Emanuele Pascariello Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email Emanuele Pascariello


Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette


DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,



V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una


e-science Bioinformatics

e-science Bioinformatics Luciano Milanesi Luciano Milanesi Institute of Biomedical Technology CNR ABSTRACT. The Bioinformatics community was an early adopter of the Internet and contributed to the e-science development by publishing



Codoni di STOP: UAA UAG UGA PARTECIPANO ALLA TRADUZIONE: trna e aminoacidi Aminoacil-tRNA sintetasi Ribosomi mrna, che contiene una Open Reading Frame (ORF) CODONE DI INIZIO CODONE DI STOP 5 Cap NNNNNN AUG AAA GCA AUU----(n codoni)----uga


Domini nelle Proteine

Domini nelle Proteine Struttura secondaria, Motivi e Domini nelle Proteine Proprietà generali Le forme ioniche degli aminoacidi, senza considerare alcuna ionizzazione delle catene laterali. Proprietà generali Tutti gli aminoacidi


Costituzione dei viventi

Costituzione dei viventi Costituzione dei viventi La materia e costituita da elementi chimici in forma pura o in combinazioni dette composti 25 dei 92 elementi naturali sono costituenti essenziali dei viventi 4 (C, O,, N) costituiscono


aa 2013-14 Proteine Struttura delle Proteine α Amminoacidi

aa 2013-14 Proteine Struttura delle Proteine α Amminoacidi Proteine Biopolimeri degli α-amino acidi. Amino acidi sono uniti attraverso il legame peptidico. Alcune funzioni: Struttura (collagene, cheratina ecc.) Enzimi (maltasi, deidrogenasi ecc) Trasporto (albumine,


Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of



REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)


Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:



TUTTI UGUALI, TUTTI DIVERSI Caccia al gene Centro Università di Milano-Scuola per la diffusione delle bioscienze e delle biotecnologie TUTTI UGUALI, TUTTI DIVERSI Caccia al gene 1 Tutti uguali, tutti diversi Caccia al gene


formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita i da unoo più domini.

formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita i da unoo più domini. Idomini(I) I domini I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita i da unoo più domini. I domini sono definiti come parte


La sintesi delle proteine

La sintesi delle proteine La sintesi delle proteine Struttura del trna In che modo l informazione contenuta sotto forma di sequenze nucleotidiche nel DNA e nell RNA si traduce nella sequenza amminoacidica delle proteine? Esperimenti


Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e


la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui

la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui Durante la traduzione l informazione di ripiegamento codificata nella sequenza aminoacidica diventa disponibile in maniera vettoriale la struttura tridimensionale può essere ottenuta solo per Un intero


La diagnosi genetica della talassemia. Dott.ssa L.Pagano. Unità Operativa Microcitemia Dipartimento di Onco-Ematologia A.O.R.N. A.

La diagnosi genetica della talassemia. Dott.ssa L.Pagano. Unità Operativa Microcitemia Dipartimento di Onco-Ematologia A.O.R.N. A. Diapositiva 1 La diagnosi genetica della talassemia Dott.ssa L.Pagano Unità Operativa Microcitemia Dipartimento di Onco-Ematologia A.O.R.N. A. Cardarelli Napoli 2 Dicembre 2005 Castel dell Ovo Sala Virgilio


La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac


Capitolo 17. Risposte alle domande interne al capitolo. 17.1 (p. 501) a. glicina. b. prolina. c. treonina. d. aspartato

Capitolo 17. Risposte alle domande interne al capitolo. 17.1 (p. 501) a. glicina. b. prolina. c. treonina. d. aspartato apitolo 17 Risposte alle domande interne al capitolo 17.1 (p. 501) a. glicina b. prolina c. treonina d. aspartato e. 17.2 (p. 501) a. La glicina è un aminoacido idrofobico. b. La prolina è un aminoacido


Siti Web utili per la conoscenza della Biologia

Siti Web utili per la conoscenza della Biologia Siti Web utili per la conoscenza della Biologia Aggiornamento: marzo 2010: Per avere una animazione della sintesi proteica visitare il sito: prodotta


10. Previsione della struttura tridimensionale di una proteina

10. Previsione della struttura tridimensionale di una proteina 10. Previsione della struttura tridimensionale di una proteina Lo scopo di questa esercitazione è di comprendere la logica alla base della modellizzazione per omologia attraverso la previsione della struttura


SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico


Lezione 2. Sommario. Bioinformatica. Lezione 2: AMMINOACIDI E POLIPEPTIDI Aminoacidi e proteine. Mauro Ceccanti e Alberto Paoluzzi

Lezione 2. Sommario. Bioinformatica. Lezione 2: AMMINOACIDI E POLIPEPTIDI Aminoacidi e proteine. Mauro Ceccanti e Alberto Paoluzzi Lezione 2 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 2: AMMINOACIDI E POLIPEPTIDI Aminoacidi e proteine Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università


Corso di Laurea in Farmacia Insegnamento di CHIMICA BIOLOGICA. Angela Chambery Lezione 4

Corso di Laurea in Farmacia Insegnamento di CHIMICA BIOLOGICA. Angela Chambery Lezione 4 Corso di Laurea in Farmacia Insegnamento di CHIMICA BIOLOGICA Angela Chambery Lezione 4 Scoperta degli amminoacidi: gli amminoacidi essenziali Gli amminoacidi essenziali sono quegli amminoacidi che un


Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule


Sperimenta il BioLab

Sperimenta il BioLab Sperimenta il BioLab Attività di Bioinformatica Le proteine in 3D Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 LE PROTEINE IN 3D Obiettivo dell'attività è


Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting


Ogni globina ha una tasca in cui lega un gruppo EME, quindi l Hb può legare e trasportare 4 molecole di O 2

Ogni globina ha una tasca in cui lega un gruppo EME, quindi l Hb può legare e trasportare 4 molecole di O 2 Emoglobina (Hb): tetramero (le globine si associano formando due copie di dimeri αβ (α 1 β 1 e α 2 β 2 ) che si associano a formare un tetramero attraverso interazioni idrofobiche, legami H e ponti salini


LA BIOINFORMATICA LEZIONI. Le principali banche dati biologiche sono: EMBL datalibrary (Europa); GenBank (USA); DDBJ (Giappone).

LA BIOINFORMATICA LEZIONI. Le principali banche dati biologiche sono: EMBL datalibrary (Europa); GenBank (USA); DDBJ (Giappone). NME... CLASSE... DATA................................... LA BIINFRMATICA Tutto cominciò attorno al 1990 quando si è assistito a una crescita parallela della ricerca genetica e delle potenzialità dei computer.


mediante proteasi industriali

mediante proteasi industriali Valorizzazione delle farine disoleate mediante proteasi industriali Alessandra Stefan Unità operativa: CSGI (Consorzio per lo Sviluppo dei Sistemi a Grande Interfase, Firenze) Dipartimento di Farmacia
