Si definisce PROTEOMA l insieme di tutte le componenti proteiche di una cellula, un tessuto, un organismo...!

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Si definisce PROTEOMA l insieme di tutte le componenti proteiche di una cellula, un tessuto, un organismo...!"

Transcript

1 Cos è il PROTEOMA?! Si definisce PROTEOMA l insieme di tutte le componenti proteiche di una cellula, un tessuto, un organismo...! Studiare il proteoma di una cellula quindi vuol dire:! elencare tutte le proteine nella cellula! confrontare le proteine presenti a diversi stadi di sviluppo! studiare tutte le modificazioni post-traduzionali,.. (es fosfoproteoma)! studiare tutte le possibili interazioni proteina-proteina (proteoma dei complessi)! confrontare le proteine in condizioni fisiologiche e patologiche (desease proteomics, clinical proteomics)! studiare l attività delle diverse proteine! studiare la struttura delle diverse proteine (structural proteomics)! PROBLEMI PRINCIPALI! complessità del quadro proteico! variabilità del quadro proteico! bassa quantità della componente proteica!

2 Componenti molecolari di una! cellula di Escherichia coli! Percento approssimato Numero approssimato! del peso totale di specie molecolari! della cellula diverse! Acqua 70 1! Proteine ! Acidi nucleici! DNA 1 1! RNA 6 >3000! Polisaccaridi 3 5! Lipidi 2 20! Subunità! monomeriche e! Intermedi 2 500! Ioni inorganici 1 20!

3 B. LEWIN, IL GENE - Edizione compatta, Zanichelli Editore S.p.A. Copyright 2007

4 - Il proteoma è molto + complesso del genoma. Ad esempio 1 gene può codificare fino a 50 differenti proteine.! ~ human genes alternative splicing of mrna 2-5 fold increase post-translational modifications of proteins (PTMs) 5-10 fold increase ~ 1'000'000 human proteins ~ 80 to human transcripts Protein complexity!

5 Why proteomics? La velocità di sintesi delle proteine è diversa in tessuti e cellule diverse e a seconda della sua attività.! one genome due proteomi Indovina la differenza!! La concentrazione delle proteine è diversa

6 Why proteomics? La concentrazione proteica varia in funzione di:

7 PROTEOMICS APPLICATIONS Proteogenomics Biomarkers discovery Phosphoproteomics Glycoproteomics Nitroproteomics Quantitative proteomics Application in nutritional science Toxicoproteomics Metabolomics Analysis of patterns, complexes and pathways Innovative biomaterials

8 Un solo approccio.. A Bruker MALDI TOF-TOF autoflex III * ThermoFisher LTQ Orbitrap Velos ETD and nano HPLC Ultimate 3000 Dionex Procise Applied Biosystems

9 pi= carica nulla!

10

11 Sensibilità dell ordine dei 5-10 ng

12

13

14 Metodo analitico per misurare esattamente il PM

15 Sample! +! _!

16

17 337 nm UV laser! Fluid (no salt)! +! _! cyano-hydroxy! cinnamic acid! MALDI! Gold tip needle! ESI!

18

19

20 aspirin!

21 53! 6! 54! 3! 4! 5! 1! 2! 10! 8! 9! 22! 11! 14! 15! 23! 17! 16! 20! 19! 18! 25! 24! 47! 52! 27! 29! 50! Quali proteine sono presenti nel mio campione?! 31! 34! 35!

22

23 Sequence! Mass (M+H)! Tryptic Fragments! >Protein 1! acedfhsakdfqea! sdfpkivtmeeewe! ndadnfekqwfe! acedfhsak! dfgeasdfpk! ivtmeeewendadnfek! gwfe! >Protein 2! acekdfhsadfqea! sdfpkivtmeeewe! nkdadnfeqwfe! >Protein 3! acedfhsadfqeka! sdfpkivtmeeewe! ndakdnfeqwfe! acek! dfhsadfgeasdfpk! ivtmeeewenk! dadnfeqwfe! acedfhsadfgek! asdfpk! ivtmeeewendak! dnfegwfe!

24 Sequence! Mass (M+H)! Mass Spectrum! >Protein 1! acedfhsakdfqea! sdfpkivtmeeewe! ndadnfekqwfe! ! >Protein 2! acekdfhsadfqea! sdfpkivtmeeewe! nkdadnfeqwfe! >Protein 3! acedfhsadfqeka! sdfpkivtmeeewe! ndakdnfeqwfe! ! !

25 Trypsin!!! XXX[KR]--[!P]XXX! Chymotrypsin!! XX[FYW]--[!P]XXX! Lys C!!! XXXXXK-- XXXXX! Asp N endo!! XXXXXD-- XXXXX! CNBr!!! XXXXXM--XXXXX! K-Lysine, R-Arginine, F-Phenylalanine, Y-Tyrosine,! W-Tryptophan,D-Aspartic Acid, M-Methionine, P-Proline!

26 Enzima molto stabile Lavora in un ampio range di ph e T. E abbastanza specifico nel taglio Produce peptidi di PM ideale per analisi di massa E poco costoso Produce picchi di autolisi che si usano come std interni , , , , , , ,

27 546 aa! 60 kda; Da pi = 4.75! >RBME00320 Contig0311_ _ EC-mopA 60 KDa chaperonin GroEL! MAAKDVKFGR TAREKMLRGV DILADAVKVT LGPKGRNVVI EKSFGAPRIT KDGVSVAKEV! ELEDKFENMG AQMLREVASK TNDTAGDGTT TATVLGQAIV QEGAKAVAAG MNPMDLKRGI! DLAVNEVVAE LLKKAKKINT SEEVAQVGTI SANGEAEIGK MIAEAMQKVG NEGVITVEEA! KTAETELEVV EGMQFDRGYL SPYFVTNPEK MVADLEDAYI LLHEKKLSNL QALLPVLEAV! VQTSKPLLII AEDVEGEALA TLVVNKLRGG LKIAAVKAPG FGDCRKAMLE DIAILTGGQV! ISEDLGIKLE SVTLDMLGRA KKVSISKENT TIVDGAGQKA EIDARVGQIK QQIEETTSDY! DREKLQERLA KLAGGVAVIR VGGATEVEVK EKKDRVDDAL NATRAAVEEG IVAGGGTALL! RASTKITAKG VNADQEAGIN IVRRAIQAPA RQITTNAGEE ASVIVGKILE NTSETFGYNT! ANGEYGDLIS LGIVDPVKVV RTALQNAASV AGLLITTEAM IAELPKKDAA PAGMPGGMGG! MGGMDF!

28 Trypsin yields 47 peptides (theoretically)! Peptide masses in Da:! 501.3! 533.3! 544.3! 545.3! 614.4! 634.3!!! 674.3! 675.4! 701.4! 726.4! 822.4! 855.5!!! 861.4! 879.4! 921.5! 953.4! 974.5! 988.5!!! ! ! ! ! ! !!! ! ! ! ! ! !!! ! ! ! ! ! !!! ! ! ! ! ! !!! ! ! ! ! !!!

29 1007! 1199! 2211 (trp)! 609! 450! 698! 1940 (trp)! 2098! !

30 Query Masses Database Mass List Results! ! ! ! ! ! ! (P21234)! (P12345)! (P89212)! (P12345)! (P89212)! (P12345)! (P21234)! (P21234)! (P89212)! (P89212)! (P21234)! (P12345)! 2 Unknown masses! 1 hit on P21234! 3 hits on P12345! Conclude the query! protein is P12345!

31 PeptIdent (ExPasy)! Mascot (Matrix Science)! MS-Fit (Prospector; UCSF)! ProFound (Proteometrics)! MOWSE (HGMP)! Human Genome Mapping Project! Mascot! theoretical! Protein ID! experimental!

32 2DE gel Intact protein Experimental proteolytic peptides Experimental MS COMPUTER SEARCH DNA sequence database Protein sequence database Theoretical proteolytic peptides Theorectical MS Susana Cristobal Bioinformatik, 4p. KTH

33 E necessario che la proteina sia presente in banca dati Picchi spuri possono dare problemi nel riconoscimento La precisione e l accuratezza del dato di massa è un fattore critico Generalmente si riescono ad identificare circa il 40% degli spots di un gel

34 P.M. 43 KDa Componente del ribosoma coinvolta nella biosintesi proteica Abbondante in S. aureus Simile alla Ribosomal protein S2 in Neurospora caninum, proteina immunodominante

35 Innovative biomaterials! BIAS BioInspired Adhesives for Surgery Università degli Studi di Milano Bicocca Department of Biotecnology and Biosciences Department of Material Science Department of Surgical Sciences Università di Milano Deparment of Animal Pathology Hygiene and Public Health Max-Planck Institute for Metal research University of Idaho Department of Biological Science Monogenoid ean parasite! Protein S1!? form the glue! Protein S2! Protein S3 detaching enzyme!

36 Quali sono le proprietà della mia proteina?!

37

38 MODIFICAZIONI DI PEPTIDI E PROTEINE -redox Cys! -fosforilazioni (-OH di Ser Thr Tyr)! -amidazioni (c-terminale)! -deamidazioni ( Asn Asp Gln Glu)! -adenilazioni (AMP) e uridilazioni (-OH di Ser e Tyr)! -ADP-ribosilazione (Arg, Cys, Glu)! -idrossilazioni (aa aromatici)! -metilazioni -O-CH 3! -CO-O- CH 3!! -NH-CH 3! -ossidazioni (Met)!

39 Phosphorylation of Sic1 by CK2 in budding yeast cells (A) 2-D silver-stained gel of Sic1 immunopurified from elutriated cells with 0.90 of budding index (yeast strain 4245 Sic1-HA). Spots 1 and 2 are indicated (upper panel). After treatment with alkaline phosphatase only the spot 1 was detected (lower panel). (B) MALDI-TOF spectra of the spot 2 of Sic1 pooled from five individual gels. A peak at m/z corresponding to peptide was indicated. Inset shows that after phosphatase treatment the non-phosphorylated peak at m/z was identified. BBRC 346 (2006) !

40 Lysine specific histone demethylase 1 (LSD1): tissue specificity and phosphorylation pattern of the LSD1-8a isoform! LSD1 contributes to chromatin remodeling by specifically removing methyl groups from Lys4 of histone H3. The E8a containing isoforms are detected only in brain tissues and contributes to neurite morphogenesis! LSD1-2a/8a! LSD1-2a! LSD1-8a! LSD1! 8a 2a! 8a! Asp Thr Val Lys! 1-876aa! 1-872aa! 1-856aa! 1-852aa!

41

42

43 E importante identificare il sito della modifica?! NO 2! P! Tyr 17! Tyr 376! NO 2! N- terminal! C- terminal!

44 !!! TAU PROTEIN! Pathological conditions! Nitration of TAU protein is linked to neurodegeneration in tauopathies (Alzheimer s disease, lateral sclerosis, Huntington s disease,.)! Physiological conditions! TAU is nitrated in PC12 cells after NGF-induced differentiation! TAU is nitrated in rat and mouse brain! Nitration is a novel modification involved in modulation of cytoskeleton stability! TAU_MOUSE Tyr17 Tyr488 Tyr601 Tyr685 // TAU_RAT Tyr17 Tyr507 Tyr620 Tyr704 Tyr432 hτ40_human Tyr29 Tyr197 Tyr310 Tyr394 // Neurochem Res. 33 (2008), ! TAU green / anti NOTYR red / DAPI blue!

45

46

47

48

49

50

51 -solubilità diversa delle proteine! -la 2D NON separa tutte le proteine! -molte proteine sono poco espresse (es. chinasi)! -proteine non presenti in banca dati NON possono essere identificate! -ci possono essere più isoforme! -non esiste una tecnica analoga all PCR x campioni poco abbondanti!

52 Fractionation &! Isolation! 2-DE! Liquid! Chromatography! Peptides! Characterization! Mass Spectrometry! Identification! Post Translational modifications! Quantification! Database Search! MALDI-TOF MS! µ-(lc)-esi-ms/ms!

53

54 Protein Mixture! Tandem Mass Spectrometer! Digestion! 2D Chromatography! Peptide Mixture! RP! SCX! > 1,000 Proteins Identified! MS/MS Spectrum! SEQUEST! DTASelect & Contrast!

55 337 nm UV laser! cyano-hydroxy! cinnaminic acid! MALDI!

56 Normal! Tumor!

57 BIBLIOGRAFIA! Methods in Molecular Biology Basic protein and peptide protocols - Vol. 32! John M, Walker ed.! Methods in Molecular Biology 2-D proteome analysis protocols Vol 112! Andrew J. Link ed.! K. Wilson, J. Walker Metodologia Biochimica, Raffaello Cortina Editore, Milano! NATURE INSIGHT PROTEOMICS - 422, (2003)! Riviste:! Electrophoresis! Methods in Enzymology! Analytical Biochemistry! Proteomics! Journal of mass spectrometry! Journal of proteome research! Links utili:!

58

59 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Cella di collisione! m/z! Gas di collisione! Lo ione entra nella cella di collisione!

60 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Collisione! Cella di collisione! m/z! Gas di collisione! Lo ione collide con una molecola di gas presente nella cella di collisione!

61 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Cella di collisione! Molecola attivata! m/z! Gas di collisione! Lo ione passa ad uno stato attivato (energia dell urto)!

62 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Cella di collisione! Frammenti! (m/z) 1! (m/z) 2! (m/z) 3! N! Gas di collisione! Lo ione Dissipa l energia frammentandosi!

63 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Cella di collisione! Frammenti! N! (m/z) 3! (m/z) 2! (m/z) 1! MS! Gas di collisione! Gli ioni generatisi per frammentazione possono! essere analizzati dal secondo analizzatore!

64

65 His 6 - Cdc34 S130A 123 SVLISIVA 130 LLE 133 Cell Cycle 7 (2008), 1-12!

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma.

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma. PROTEOMA Si definisce proteoma il complemento tempo- e cellulo- specifico del genoma. Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse nello stesso momento in

Dettagli

Recent gene discoveries and applications in cancer FUNCTIONAL GENOMICS:

Recent gene discoveries and applications in cancer FUNCTIONAL GENOMICS: Recent gene discoveries and applications in cancer FUNCTIONAL GENOMICS: Bioinformatics ( ad Hoc Database searches) Micro-array expression analysis Tissue Multiple Array Gain and Loss chromosomal analyses

Dettagli

2. Analisi dei segmenti a. Frammentare le subunità in peptidi

2. Analisi dei segmenti a. Frammentare le subunità in peptidi 1. Preliminari a. Biochimica delle proteine Prof. M. Bolognesi Denaturazione a.a. 2007/2008 delle proteine b. Riduzione e alchilazione dei ponti disolfuro c. Determinazione delle subunità 2. Analisi dei

Dettagli

METODI IN PROTEOMICA DIFFERENZIALE

METODI IN PROTEOMICA DIFFERENZIALE METODI IN PROTEOMICA DIFFERENZIALE PRINCIPIO COMUNE: ANALISI SIMULTANEA DEI CAMPIONI DA CONFRONTARE Proteine di diversa provenienza sono modificate in maniera differenziale. Le alterazioni prodotte differenzialmente

Dettagli

Cos è uno spettrometro di massa

Cos è uno spettrometro di massa Cos è uno spettrometro di massa Lo spettrometro di massa è uno strumento che produce ioni e li separa in fase gassosa in base al loro rapporto massa/carica (m/z). Un analisi in spettrometria di massa può

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

La Spettrometria di Massa nello Studio di Proteine e Peptidi

La Spettrometria di Massa nello Studio di Proteine e Peptidi La Spettrometria di Massa nello Studio di Proteine e Peptidi Gianluca Giorgi Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia via Aldo Moro 531 Siena e-mail: gianluca.giorgi@unisi.it

Dettagli

Functional Genomics in Cancer Genetics 03-04-09

Functional Genomics in Cancer Genetics 03-04-09 Functional Genomics in Cancer Genetics 03-04-09 La Genomica Funzionale è una branca della biologia molecolare il cui l obiettivo è di raccogliere il maggior numero di dati che consentono di studiare il

Dettagli

v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina 3500 V catod o

v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina 3500 V catod o La prima e : Isoelectric focusing (IEF) v=e z f 1 step1 v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina Tot 76 kvh f = coefficiente

Dettagli

Spettrometria di Massa applicata alla PROTEOMICA

Spettrometria di Massa applicata alla PROTEOMICA Spettrometria di Massa applicata alla PROTEOMICA 1. MALDI-TOF: Determinazione di mappe peptidiche mediante digestione in gel di spot separati su E-2D E da estratti proteici totali Identificazione rapida

Dettagli

Proteomica: Gel bidimensionale e Sistemi di Spettrometria di Massa

Proteomica: Gel bidimensionale e Sistemi di Spettrometria di Massa Proteomica: Gel bidimensionale e Sistemi di Spettrometria di Massa DNA RNA Mantenimento e trasmissione informazione L informazione di base di un organismo è uguale per tutte le sue cellule GENOMICA Trasferimento

Dettagli

Ø Gel Elettroforesi (GE) Ø Spettrometria di Massa (MS)

Ø Gel Elettroforesi (GE) Ø Spettrometria di Massa (MS) Tecniche di indagine nello studio delle PTMs Ø Gel Elettroforesi (GE) Ø Tecniche cromatografiche (LC, HPLC) Ø Spettrometria di Massa (MS) Possono essere utilizzate da sole o in combinazione, direttamente

Dettagli

Le proteine. Polimeri composto da 20 diversi aminoacidi

Le proteine. Polimeri composto da 20 diversi aminoacidi Le proteine Polimeri composto da 20 diversi aminoacidi (D. Voet, J.G. Voet, Biochemistry, 3 ed., John Wiley & Sons, 2004) PROTEINE come ATTUATORI nella cellula Trasporto elettronico Trasporto di ioni e

Dettagli

Spettrometria di massa

Spettrometria di massa Tecniche di monitoraggio ambientale di tipo fisico Spettrometria di massa (J. B. Fenn, K. Tanaka, K. Wüthrich, premio nobel per la chimica nel 2002) Analisi chimica dell aerosol Riconoscimento di inquinanti

Dettagli

mediante proteasi industriali

mediante proteasi industriali Valorizzazione delle farine disoleate mediante proteasi industriali Alessandra Stefan Unità operativa: CSGI (Consorzio per lo Sviluppo dei Sistemi a Grande Interfase, Firenze) Dipartimento di Farmacia

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi

Dettagli

Continua. Peptidasi H 2 O

Continua. Peptidasi H 2 O Continua Peptidasi H 2 O Classificazione delle peptidasi 1. Meccanismo catalitico 2. Tipo di reazione catalizzata 3. Struttura molecolare e omologia 1. Meccanismo catalitico (mostrato per la chimotripsina)

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata Ammino acidi Composto che contiene una funziome acida e amminica. Usualmente però con amminoacidi si intendono gli alfa- amminoacidi. Tra questi composti ve ne sono 20 che vengono definiti geneticamente

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

COS E LA PROTEOMICA? The total PROTEIN complement of a GENOME Proteoma proteine codificate modificazioni post-traduzionali

COS E LA PROTEOMICA? The total PROTEIN complement of a GENOME Proteoma proteine codificate modificazioni post-traduzionali COS E LA PROTEOMICA? The total PROTEIN complement of a GENOME (M. Wilkins et al. Electrophoresis 1995,16 1090-95) La Proteomica è lo studio del PROTEOMA Ud'A [Biochimica Applicata 1] dia n. 1 Proteoma

Dettagli

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica Gli aminoacidi NOMENCLATURA Aminoacido Abbr. tre lettere Abbr. una lettera Aminoacido Abbr. tre lettere Abbr. una lettera Alanina ALA A Lisina LYS K Arginina ARG R Metionina MET M Asparagina ASN N Fenilalanina

Dettagli

Allegato 1. COD_TD2 ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO

Allegato 1. COD_TD2 ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO Profilo 1 Esperto in tecnologie di pastificazione e spettrometria RAMAN L esperto dovrà operare presso la Piattaforma di Tecnologie Alimentari, laboratorio di

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE Servizio Risorse Umane e Relazioni Sindacali delegato dal Direttore Generale dell Azienda con

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente Gli amminoacidi naturali sono α-amminoacidi : il gruppo amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente formula generale: gruppo funzionale carbossilico

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da

LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da 1 All.to 1 LOTTO 1 - CAPITOLATO TECNICO Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da Analizzatore Tubo di volo lineare di almeno 1,5m

Dettagli

3.3. UMAMI NEGLI ALIMENTI

3.3. UMAMI NEGLI ALIMENTI 3.3. UMAMI NEGLI ALIMENTI In questo capitolo saranno esaminati i vari cibi, ad esclusione di quelli ittici che verranno presi in considerazione successivamente, allo scopo di scoprire se in essi è presente,

Dettagli

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Struttura secondaria

Struttura secondaria Struttura secondaria Struttura localmente ordinata Polimeri lineari ad unità monomeriche asimmetriche elica j = 0,1,2,..., N N = numero di residui z j = h z j + z 0 x j = r cos (j2p h z /P + d 0 ) y j

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Tecniche biofisiche basate su nanopori

Tecniche biofisiche basate su nanopori Tecniche biofisiche basate su nanopori -Pori di dimensione nanometrica -Attraverso membrane lipidiche o inorganiche -Di natura proteica o scavati con tecnologie top-down Possono essere impiegati per -Studiare

Dettagli

Corso di Formazione Genopom-Pro. Dr.ssa Angela Flagiello

Corso di Formazione Genopom-Pro. Dr.ssa Angela Flagiello Corso di Formazione Genopom-Pro Studio del Proteoma Dr.ssa Angela Flagiello Lab. Proteomica (Prof. P. Pucci) CEINGE Biotecnologie Avanzate s.c.a r.l. Via Comunale Margherita, 486 80145 Napoli flagiello@ceinge.unina.it

Dettagli

Epithelial-Mesenchymal Transition in Cancer. Relevance of Periostin Splice Variants

Epithelial-Mesenchymal Transition in Cancer. Relevance of Periostin Splice Variants DISS. ETH NO. 19590 Epithelial-Mesenchymal Transition in Cancer Relevance of Periostin Splice Variants A dissertation submitted to the ETH Zurich For the degree of Doctor of Sciences Presented by Laura

Dettagli

Si dividono in: N-glicosilate (su Asparagina) O-glicosilate (su Serina o Treonina. Raramente su Tirosina, idrossiprolina, idrossilisina)

Si dividono in: N-glicosilate (su Asparagina) O-glicosilate (su Serina o Treonina. Raramente su Tirosina, idrossiprolina, idrossilisina) GLICOSILAZIONE La glicosilazione è la modificazione PTM più diffusa. Circa il 50% delle proteine umane sono glicosilate Caratteristica di molte proteine della superficie cellulare e delle d proteine di

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE Nell ultima fase della sintesi proteica la catena polipeptidica neosintetizzata assume spontaneamente la sua conformazione nativa (massimo numero di legami

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

La Spettrometria di Massa nello Studio di Proteine e Peptidi

La Spettrometria di Massa nello Studio di Proteine e Peptidi La Spettrometria di Massa nello Studio di Proteine e Peptidi Gianluca Giorgi Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia via Aldo Moro 53100 Siena e-mail: gianluca.giorgi@unisi.it

Dettagli

MFN0366-A1 (I. Perroteau) -traduzione e indirizzamento delle proteine. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) -traduzione e indirizzamento delle proteine. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) -traduzione e indirizzamento delle proteine MFN0366-A1 (I. Perroteau) -traduzione delle proteine trna Traduzione: mrna -------> proteine mrna MFN0366-A1 (I. Perroteau) -traduzione

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV ADULTS AND CHILDREN ESTIMATED TO BE LIVING WITH HIV/AIDS,

Dettagli

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento www.unitn.it/cibio

Dettagli

12-05-2010 ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI

12-05-2010 ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI Il primo passaggio per la maggior parte delle procedure che verranno trattate in questo corso consiste nell estrazione del DNA (e dell RNA) da materiale biologico, e nella sua purificazione mediante separazione

Dettagli

IL MARCATORE TUMORALE

IL MARCATORE TUMORALE IL MARCATORE TUMORALE Un marcatore tumorale è una sostanza rilevabile nei fluidi biologici la cui positività indica la presenza di un tumore. Il marcatore tumorale ideale dovrebbe presentare una completa

Dettagli

FOODFLAVR:industria 2015

FOODFLAVR:industria 2015 FOODFLAVR:industria 2015 Pacco di Lavoro (PL) 28.2 Analisi dei profili molecolari globali (PMG) in alimen7 di quarta gamma mediante tecniche di proteomica Mariasole Di Carli, Linda Bianco, CrisDna Capodicasa,

Dettagli

Relazione struttura-funzione

Relazione struttura-funzione Biotecnologie applicate alla progettazione e sviluppo di molecole biologicamente attive A.A. 2010-2011 Modulo di Biologia Strutturale Relazione struttura-funzione Marco Nardini Dipartimento di Scienze

Dettagli

Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer

Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer Beatrice Arosio Dipartimento di Medicina Interna, Università degli Studi di Milano U.O. di Geriatria, Fondazione IRCCS

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

AMMINOACIDI E PROTEINE

AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE Vengono chiamate amminoacidi quelle molecole organiche in cui sono contemporaneamente presenti sia un gruppo acido carbossilico -COO che un gruppo amminico -N2. Una molecola appartenente

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Regolazione redox nel cloroplasto

Regolazione redox nel cloroplasto Regolazione redox nel cloroplasto Mirko Zaffagnini Laboratorio di Fisiologia Molecolare delle piante, Università di Bologna Accademia dei Georgofili, 24 maggio 2012 Alghe verdi (Cr) Piante superiori (At)

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

4x4x4=4 3 =64 codoni. 20 aminoacidi

4x4x4=4 3 =64 codoni. 20 aminoacidi 4x4x4=4 3 =64 codoni 20 aminoacidi 1 Le 20 diverse catene laterali (gruppo R) che costituiscono gli aminoacidi si differenziano considerevolmente per dimensioni, volume e per le loro caratteristiche fisico-chimiche,

Dettagli

06_citologia_SER_golgi 1

06_citologia_SER_golgi 1 1 La sintesi proteica inizia sempre nello stesso modo: aggancio della piccola subunità ribosomale al estremità 5 dell mrna. si aggancio la grande subunità ribosomale In corrispondenza del codone di inizio

Dettagli

La spettrometria di massa è una metodica che consente l identificazione e l analisi quantitativa di una molecola dalla sua massa.

La spettrometria di massa è una metodica che consente l identificazione e l analisi quantitativa di una molecola dalla sua massa. La spettrometria di massa è una metodica che consente l identificazione e l analisi quantitativa di una molecola dalla sua massa. Si sfruttano due fenomeni correlati alla massa ed alla carica. 1) la traiettoria

Dettagli

Modello del collasso idrofobico. Il folding è facilitato dalla presenza di chaperons molecolari quali le Heat Shock Proteins, Hsp70 e Hsp60

Modello del collasso idrofobico. Il folding è facilitato dalla presenza di chaperons molecolari quali le Heat Shock Proteins, Hsp70 e Hsp60 Modello gerarchico Modello del collasso idrofobico Il folding è facilitato dalla presenza di chaperons molecolari quali le Heat Shock Proteins, Hsp70 e Hsp60 Le Hsp70 si legano ai segmenti idrofobici di

Dettagli

IL-2R & IL-15R Alice Praduroux

IL-2R & IL-15R Alice Praduroux Università degli Studi di Torino Facoltà di Biotecnologie Molecolari Anno Accademico 2006/2007 Corso di Immunologia Molecolare IL-2R & IL-15R Alice Praduroux Classificazione Recettori appartenenti alla

Dettagli

SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

Sintesi Genomica Sintesi di DNA e Modificazioni Listino prezzi 1 maggio 2005

Sintesi Genomica Sintesi di DNA e Modificazioni Listino prezzi 1 maggio 2005 Sintesi Genomica Sintesi di DNA e Modificazioni Listino prezzi 1 maggio 2005 Gli Oligonucleotidi HPSF - (High Purity Salt Free, desalificati ad alta purezza) Scala di Sintesi 1 0,01 µmol5 0,05 µmol 0,2

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Prof. Fulvio Ursini Dipartimento di Chimica Biologica (Vallisneri IV piano Nord) Viale G. Colombo, Padova. Tel.

Prof. Fulvio Ursini Dipartimento di Chimica Biologica (Vallisneri IV piano Nord) Viale G. Colombo, Padova. Tel. Prof. Fulvio Ursini Dipartimento di Chimica Biologica (Vallisneri IV piano Nord) Viale G. Colombo, 3-35121 Padova. Tel.:+39-049-8276104 Fax.:+39-049-8073310 E-mail: fulvio.ursini@unipd.it Funzioni delle

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

Relatrice: dott.ssa Ilaria Pegoretti

Relatrice: dott.ssa Ilaria Pegoretti Relatrice: dott.ssa Ilaria Pegoretti IL LABORATORIO DI BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni 26 Novembre 2011 Auditorium Presidio Ospedaliero S.Chiara, Trento Scoperta

Dettagli

Nuovi marcatori proteici di mastite nei piccoli ruminanti: prospettive per la diagnosi sul campo e nel laboratorio

Nuovi marcatori proteici di mastite nei piccoli ruminanti: prospettive per la diagnosi sul campo e nel laboratorio Nuovi marcatori proteici di mastite nei piccoli ruminanti: prospettive per la diagnosi sul campo e nel laboratorio Maria Filippa Addis, Porto Conte Ricerche, Alghero addis@portocontericerche.it Giornata

Dettagli

INTRODUZIONE ALLA PROTEINE BCP 1-2

INTRODUZIONE ALLA PROTEINE BCP 1-2 INTRODUZIONE ALLA BIOCHIMICA DELLE PROTEINE BCP 1-2 Pietre miliari Lehninger 1973 Biochemistry Proteine ricombinanti Protein engineering Cristallografia, NMR, EM, MS, spettroscopie... Computing Bioinformaticai

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

C). Quindi, con la spettroscopia NMR, le informazioni sulla struttura molecolare vengono dedotte osservando il comportamento dei nuclei atomici.

C). Quindi, con la spettroscopia NMR, le informazioni sulla struttura molecolare vengono dedotte osservando il comportamento dei nuclei atomici. La spettroscopia di Risonanza Magnetica Nucleare (NMR) è una tecnica analitica strumentale che permette di ottenere dettagliate informazioni sulla struttura molecolare dei composti in esame. La spettroscopia

Dettagli

L enigma del XXI secolo: decifrare il codice della vita

L enigma del XXI secolo: decifrare il codice della vita L enigma del XXI secolo: decifrare il codice della vita David Horner Dipar9mento di Bioscienze Università degli Studi di Milano Via Celoria 26 Milano 20133 david.horner@unimi.it Regola di Chargaff %A =

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

TAVOLA DI PROGRAMMAZIONE PER GRUPPI DIDATTICI

TAVOLA DI PROGRAMMAZIONE PER GRUPPI DIDATTICI TAVOLA DI PROGRAMMAZIONE PER GRUPPI DIDATTICI MATERIA: CHIMICA CLASSI: PRIME I II QUADRIMESTRE Competenze Abilità/Capacità Conoscenze* Attività didattica Strumenti Tipologia verifiche Osservare, descrivere

Dettagli

Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per

Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per identificare prodotti incogniti, per determinazioni quantitative

Dettagli

Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione

Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione Informatica Lezione VIII Visualizzazione 3D di proteine Visualizzazioni 3D Rappresentazione di strutture/oggetti tridimensionali Risultato di un esperimento modello teorico dati fisici astrazione 1 Lezione

Dettagli

CORSO DI SPETTROMETRIA DI MASSA 2016

CORSO DI SPETTROMETRIA DI MASSA 2016 Società Chimica Italiana Divisione di Spettrometria di Massa Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia CORSO DI SPETTROMETRIA DI MASSA 2016 Siena, Certosa di Pontignano

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Analisi e purificazione di proteine

Analisi e purificazione di proteine Analisi e purificazione di proteine elettroforesi ultracentrifugazione cromatografia frammenti specifici sequenziamento struttura primaria livelli superiori contesto fisiologico funzione Condizioni denaturanti

Dettagli

Corso di Formazione: La spettrometria di massa delle biomolecole: applicazioni in ambito clinico, proteomico, alimentare.

Corso di Formazione: La spettrometria di massa delle biomolecole: applicazioni in ambito clinico, proteomico, alimentare. Corso di Formazione: La spettrometria di massa delle biomolecole: applicazioni in ambito clinico, proteomico, alimentare 1-2 luglio 2014 Politecnico di Milano Aula Rogers, via Ampere 2, Milano Direzione

Dettagli

Metabolismo: Introduzione

Metabolismo: Introduzione Metabolismo: Introduzione METABOLISMO Insieme delle reazioni chimiche coordinate e integrate che hanno luogo in tutte le cellule C A T A B O L I S M O Ossidazioni esoergoniche Alimenti: Carboidrati Lipidi

Dettagli

dieta vengono convertiti in composti dei corpi chetonici.

dieta vengono convertiti in composti dei corpi chetonici. Metabolismo degli aminoacidi Metabolismo degli aminoacidi Gli aminoacidi introdotti in eccesso con la dieta vengono convertiti in composti precursori del glucosio, degli acidi grassi e dei corpi chetonici.

Dettagli

AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali):

AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali): AMINOAIDI. Proteine (gr. pròtos = primo) > 50% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida (o alcalina) α-aminoacidi Struttura generale degli α-aminoacidi primari (standard,

Dettagli

Determinazione della composizione elementare dello ione molecolare. Metodo dell abbondanza isotopica. Misure di massa esatta

Determinazione della composizione elementare dello ione molecolare. Metodo dell abbondanza isotopica. Misure di massa esatta Determinazione della composizione elementare dello ione molecolare Metodo dell abbondanza isotopica Misure di massa esatta PREMESSA: ISOTOPI PICCHI ISOTOPICI Il picco dello ione molecolare è spesso accompagnato

Dettagli

Allegato 3. COD_TD2 MATERIE E PROVE DI ESAME

Allegato 3. COD_TD2 MATERIE E PROVE DI ESAME MATERIE E PROVE DI ESAME 1 Profilo 1 Esperto in tecnologie di pastificazione e spettrometria RAMAN Produzione di pasta Utilizzo del RAMAN Pasta di grano duro L amido La spettroscopia Raman 2 Profilo 2

Dettagli

La produzione di ROS è catalizzata da metalli legati a proteine

La produzione di ROS è catalizzata da metalli legati a proteine Stress Ossidativo La produzione di ROS è catalizzata da metalli legati a proteine Reazioni di Fenton e di Haber-Weiss SOD H 2 O 2 + O 2 O 2 - + Fe 3+ Fe 2+ + O 2 Fe 2+ + H 2 O 2 OH - + Fe 3+ + OH Catalasi

Dettagli

determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D

determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Metodi di studio delle proteine : determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Spettrofotometro cuvetta monocromatore rivelatore

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

Amminoacidi e Proteine

Amminoacidi e Proteine Amminoacidi e Proteine Struttura generale di un α-amminoacido R = catena laterale AMMINOACIDI (AA) CELLULARI Gli amminoacidi presenti nella cellula possono essere il prodotto di idrolisi delle proteine

Dettagli