Si definisce PROTEOMA l insieme di tutte le componenti proteiche di una cellula, un tessuto, un organismo...!

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Si definisce PROTEOMA l insieme di tutte le componenti proteiche di una cellula, un tessuto, un organismo...!"

Transcript

1 Cos è il PROTEOMA?! Si definisce PROTEOMA l insieme di tutte le componenti proteiche di una cellula, un tessuto, un organismo...! Studiare il proteoma di una cellula quindi vuol dire:! elencare tutte le proteine nella cellula! confrontare le proteine presenti a diversi stadi di sviluppo! studiare tutte le modificazioni post-traduzionali,.. (es fosfoproteoma)! studiare tutte le possibili interazioni proteina-proteina (proteoma dei complessi)! confrontare le proteine in condizioni fisiologiche e patologiche (desease proteomics, clinical proteomics)! studiare l attività delle diverse proteine! studiare la struttura delle diverse proteine (structural proteomics)! PROBLEMI PRINCIPALI! complessità del quadro proteico! variabilità del quadro proteico! bassa quantità della componente proteica!

2 Componenti molecolari di una! cellula di Escherichia coli! Percento approssimato Numero approssimato! del peso totale di specie molecolari! della cellula diverse! Acqua 70 1! Proteine ! Acidi nucleici! DNA 1 1! RNA 6 >3000! Polisaccaridi 3 5! Lipidi 2 20! Subunità! monomeriche e! Intermedi 2 500! Ioni inorganici 1 20!

3 B. LEWIN, IL GENE - Edizione compatta, Zanichelli Editore S.p.A. Copyright 2007

4 - Il proteoma è molto + complesso del genoma. Ad esempio 1 gene può codificare fino a 50 differenti proteine.! ~ human genes alternative splicing of mrna 2-5 fold increase post-translational modifications of proteins (PTMs) 5-10 fold increase ~ 1'000'000 human proteins ~ 80 to human transcripts Protein complexity!

5 Why proteomics? La velocità di sintesi delle proteine è diversa in tessuti e cellule diverse e a seconda della sua attività.! one genome due proteomi Indovina la differenza!! La concentrazione delle proteine è diversa

6 Why proteomics? La concentrazione proteica varia in funzione di:

7 PROTEOMICS APPLICATIONS Proteogenomics Biomarkers discovery Phosphoproteomics Glycoproteomics Nitroproteomics Quantitative proteomics Application in nutritional science Toxicoproteomics Metabolomics Analysis of patterns, complexes and pathways Innovative biomaterials

8 Un solo approccio.. A Bruker MALDI TOF-TOF autoflex III * ThermoFisher LTQ Orbitrap Velos ETD and nano HPLC Ultimate 3000 Dionex Procise Applied Biosystems

9 pi= carica nulla!

10

11 Sensibilità dell ordine dei 5-10 ng

12

13

14 Metodo analitico per misurare esattamente il PM

15 Sample! +! _!

16

17 337 nm UV laser! Fluid (no salt)! +! _! cyano-hydroxy! cinnamic acid! MALDI! Gold tip needle! ESI!

18

19

20 aspirin!

21 53! 6! 54! 3! 4! 5! 1! 2! 10! 8! 9! 22! 11! 14! 15! 23! 17! 16! 20! 19! 18! 25! 24! 47! 52! 27! 29! 50! Quali proteine sono presenti nel mio campione?! 31! 34! 35!

22

23 Sequence! Mass (M+H)! Tryptic Fragments! >Protein 1! acedfhsakdfqea! sdfpkivtmeeewe! ndadnfekqwfe! acedfhsak! dfgeasdfpk! ivtmeeewendadnfek! gwfe! >Protein 2! acekdfhsadfqea! sdfpkivtmeeewe! nkdadnfeqwfe! >Protein 3! acedfhsadfqeka! sdfpkivtmeeewe! ndakdnfeqwfe! acek! dfhsadfgeasdfpk! ivtmeeewenk! dadnfeqwfe! acedfhsadfgek! asdfpk! ivtmeeewendak! dnfegwfe!

24 Sequence! Mass (M+H)! Mass Spectrum! >Protein 1! acedfhsakdfqea! sdfpkivtmeeewe! ndadnfekqwfe! ! >Protein 2! acekdfhsadfqea! sdfpkivtmeeewe! nkdadnfeqwfe! >Protein 3! acedfhsadfqeka! sdfpkivtmeeewe! ndakdnfeqwfe! ! !

25 Trypsin!!! XXX[KR]--[!P]XXX! Chymotrypsin!! XX[FYW]--[!P]XXX! Lys C!!! XXXXXK-- XXXXX! Asp N endo!! XXXXXD-- XXXXX! CNBr!!! XXXXXM--XXXXX! K-Lysine, R-Arginine, F-Phenylalanine, Y-Tyrosine,! W-Tryptophan,D-Aspartic Acid, M-Methionine, P-Proline!

26 Enzima molto stabile Lavora in un ampio range di ph e T. E abbastanza specifico nel taglio Produce peptidi di PM ideale per analisi di massa E poco costoso Produce picchi di autolisi che si usano come std interni , , , , , , ,

27 546 aa! 60 kda; Da pi = 4.75! >RBME00320 Contig0311_ _ EC-mopA 60 KDa chaperonin GroEL! MAAKDVKFGR TAREKMLRGV DILADAVKVT LGPKGRNVVI EKSFGAPRIT KDGVSVAKEV! ELEDKFENMG AQMLREVASK TNDTAGDGTT TATVLGQAIV QEGAKAVAAG MNPMDLKRGI! DLAVNEVVAE LLKKAKKINT SEEVAQVGTI SANGEAEIGK MIAEAMQKVG NEGVITVEEA! KTAETELEVV EGMQFDRGYL SPYFVTNPEK MVADLEDAYI LLHEKKLSNL QALLPVLEAV! VQTSKPLLII AEDVEGEALA TLVVNKLRGG LKIAAVKAPG FGDCRKAMLE DIAILTGGQV! ISEDLGIKLE SVTLDMLGRA KKVSISKENT TIVDGAGQKA EIDARVGQIK QQIEETTSDY! DREKLQERLA KLAGGVAVIR VGGATEVEVK EKKDRVDDAL NATRAAVEEG IVAGGGTALL! RASTKITAKG VNADQEAGIN IVRRAIQAPA RQITTNAGEE ASVIVGKILE NTSETFGYNT! ANGEYGDLIS LGIVDPVKVV RTALQNAASV AGLLITTEAM IAELPKKDAA PAGMPGGMGG! MGGMDF!

28 Trypsin yields 47 peptides (theoretically)! Peptide masses in Da:! 501.3! 533.3! 544.3! 545.3! 614.4! 634.3!!! 674.3! 675.4! 701.4! 726.4! 822.4! 855.5!!! 861.4! 879.4! 921.5! 953.4! 974.5! 988.5!!! ! ! ! ! ! !!! ! ! ! ! ! !!! ! ! ! ! ! !!! ! ! ! ! ! !!! ! ! ! ! !!!

29 1007! 1199! 2211 (trp)! 609! 450! 698! 1940 (trp)! 2098! !

30 Query Masses Database Mass List Results! ! ! ! ! ! ! (P21234)! (P12345)! (P89212)! (P12345)! (P89212)! (P12345)! (P21234)! (P21234)! (P89212)! (P89212)! (P21234)! (P12345)! 2 Unknown masses! 1 hit on P21234! 3 hits on P12345! Conclude the query! protein is P12345!

31 PeptIdent (ExPasy)! Mascot (Matrix Science)! MS-Fit (Prospector; UCSF)! ProFound (Proteometrics)! MOWSE (HGMP)! Human Genome Mapping Project! Mascot! theoretical! Protein ID! experimental!

32 2DE gel Intact protein Experimental proteolytic peptides Experimental MS COMPUTER SEARCH DNA sequence database Protein sequence database Theoretical proteolytic peptides Theorectical MS Susana Cristobal Bioinformatik, 4p. KTH

33 E necessario che la proteina sia presente in banca dati Picchi spuri possono dare problemi nel riconoscimento La precisione e l accuratezza del dato di massa è un fattore critico Generalmente si riescono ad identificare circa il 40% degli spots di un gel

34 P.M. 43 KDa Componente del ribosoma coinvolta nella biosintesi proteica Abbondante in S. aureus Simile alla Ribosomal protein S2 in Neurospora caninum, proteina immunodominante

35 Innovative biomaterials! BIAS BioInspired Adhesives for Surgery Università degli Studi di Milano Bicocca Department of Biotecnology and Biosciences Department of Material Science Department of Surgical Sciences Università di Milano Deparment of Animal Pathology Hygiene and Public Health Max-Planck Institute for Metal research University of Idaho Department of Biological Science Monogenoid ean parasite! Protein S1!? form the glue! Protein S2! Protein S3 detaching enzyme!

36 Quali sono le proprietà della mia proteina?!

37

38 MODIFICAZIONI DI PEPTIDI E PROTEINE -redox Cys! -fosforilazioni (-OH di Ser Thr Tyr)! -amidazioni (c-terminale)! -deamidazioni ( Asn Asp Gln Glu)! -adenilazioni (AMP) e uridilazioni (-OH di Ser e Tyr)! -ADP-ribosilazione (Arg, Cys, Glu)! -idrossilazioni (aa aromatici)! -metilazioni -O-CH 3! -CO-O- CH 3!! -NH-CH 3! -ossidazioni (Met)!

39 Phosphorylation of Sic1 by CK2 in budding yeast cells (A) 2-D silver-stained gel of Sic1 immunopurified from elutriated cells with 0.90 of budding index (yeast strain 4245 Sic1-HA). Spots 1 and 2 are indicated (upper panel). After treatment with alkaline phosphatase only the spot 1 was detected (lower panel). (B) MALDI-TOF spectra of the spot 2 of Sic1 pooled from five individual gels. A peak at m/z corresponding to peptide was indicated. Inset shows that after phosphatase treatment the non-phosphorylated peak at m/z was identified. BBRC 346 (2006) !

40 Lysine specific histone demethylase 1 (LSD1): tissue specificity and phosphorylation pattern of the LSD1-8a isoform! LSD1 contributes to chromatin remodeling by specifically removing methyl groups from Lys4 of histone H3. The E8a containing isoforms are detected only in brain tissues and contributes to neurite morphogenesis! LSD1-2a/8a! LSD1-2a! LSD1-8a! LSD1! 8a 2a! 8a! Asp Thr Val Lys! 1-876aa! 1-872aa! 1-856aa! 1-852aa!

41

42

43 E importante identificare il sito della modifica?! NO 2! P! Tyr 17! Tyr 376! NO 2! N- terminal! C- terminal!

44 !!! TAU PROTEIN! Pathological conditions! Nitration of TAU protein is linked to neurodegeneration in tauopathies (Alzheimer s disease, lateral sclerosis, Huntington s disease,.)! Physiological conditions! TAU is nitrated in PC12 cells after NGF-induced differentiation! TAU is nitrated in rat and mouse brain! Nitration is a novel modification involved in modulation of cytoskeleton stability! TAU_MOUSE Tyr17 Tyr488 Tyr601 Tyr685 // TAU_RAT Tyr17 Tyr507 Tyr620 Tyr704 Tyr432 hτ40_human Tyr29 Tyr197 Tyr310 Tyr394 // Neurochem Res. 33 (2008), ! TAU green / anti NOTYR red / DAPI blue!

45

46

47

48

49

50

51 -solubilità diversa delle proteine! -la 2D NON separa tutte le proteine! -molte proteine sono poco espresse (es. chinasi)! -proteine non presenti in banca dati NON possono essere identificate! -ci possono essere più isoforme! -non esiste una tecnica analoga all PCR x campioni poco abbondanti!

52 Fractionation &! Isolation! 2-DE! Liquid! Chromatography! Peptides! Characterization! Mass Spectrometry! Identification! Post Translational modifications! Quantification! Database Search! MALDI-TOF MS! µ-(lc)-esi-ms/ms!

53

54 Protein Mixture! Tandem Mass Spectrometer! Digestion! 2D Chromatography! Peptide Mixture! RP! SCX! > 1,000 Proteins Identified! MS/MS Spectrum! SEQUEST! DTASelect & Contrast!

55 337 nm UV laser! cyano-hydroxy! cinnaminic acid! MALDI!

56 Normal! Tumor!

57 BIBLIOGRAFIA! Methods in Molecular Biology Basic protein and peptide protocols - Vol. 32! John M, Walker ed.! Methods in Molecular Biology 2-D proteome analysis protocols Vol 112! Andrew J. Link ed.! K. Wilson, J. Walker Metodologia Biochimica, Raffaello Cortina Editore, Milano! NATURE INSIGHT PROTEOMICS - 422, (2003)! Riviste:! Electrophoresis! Methods in Enzymology! Analytical Biochemistry! Proteomics! Journal of mass spectrometry! Journal of proteome research! Links utili:!

58

59 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Cella di collisione! m/z! Gas di collisione! Lo ione entra nella cella di collisione!

60 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Collisione! Cella di collisione! m/z! Gas di collisione! Lo ione collide con una molecola di gas presente nella cella di collisione!

61 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Cella di collisione! Molecola attivata! m/z! Gas di collisione! Lo ione passa ad uno stato attivato (energia dell urto)!

62 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Cella di collisione! Frammenti! (m/z) 1! (m/z) 2! (m/z) 3! N! Gas di collisione! Lo ione Dissipa l energia frammentandosi!

63 CID: Collision-Induced Dissociation! CAD: Collision Activated Dissociation! Cella di collisione! Frammenti! N! (m/z) 3! (m/z) 2! (m/z) 1! MS! Gas di collisione! Gli ioni generatisi per frammentazione possono! essere analizzati dal secondo analizzatore!

64

65 His 6 - Cdc34 S130A 123 SVLISIVA 130 LLE 133 Cell Cycle 7 (2008), 1-12!

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma.

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma. PROTEOMA Si definisce proteoma il complemento tempo- e cellulo- specifico del genoma. Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse nello stesso momento in

Dettagli

Recent gene discoveries and applications in cancer FUNCTIONAL GENOMICS:

Recent gene discoveries and applications in cancer FUNCTIONAL GENOMICS: Recent gene discoveries and applications in cancer FUNCTIONAL GENOMICS: Bioinformatics ( ad Hoc Database searches) Micro-array expression analysis Tissue Multiple Array Gain and Loss chromosomal analyses

Dettagli

2. Analisi dei segmenti a. Frammentare le subunità in peptidi

2. Analisi dei segmenti a. Frammentare le subunità in peptidi 1. Preliminari a. Biochimica delle proteine Prof. M. Bolognesi Denaturazione a.a. 2007/2008 delle proteine b. Riduzione e alchilazione dei ponti disolfuro c. Determinazione delle subunità 2. Analisi dei

Dettagli

METODI IN PROTEOMICA DIFFERENZIALE

METODI IN PROTEOMICA DIFFERENZIALE METODI IN PROTEOMICA DIFFERENZIALE PRINCIPIO COMUNE: ANALISI SIMULTANEA DEI CAMPIONI DA CONFRONTARE Proteine di diversa provenienza sono modificate in maniera differenziale. Le alterazioni prodotte differenzialmente

Dettagli

La Spettrometria di Massa nello Studio di Proteine e Peptidi

La Spettrometria di Massa nello Studio di Proteine e Peptidi La Spettrometria di Massa nello Studio di Proteine e Peptidi Gianluca Giorgi Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia via Aldo Moro 531 Siena e-mail: gianluca.giorgi@unisi.it

Dettagli

Proteomica: Gel bidimensionale e Sistemi di Spettrometria di Massa

Proteomica: Gel bidimensionale e Sistemi di Spettrometria di Massa Proteomica: Gel bidimensionale e Sistemi di Spettrometria di Massa DNA RNA Mantenimento e trasmissione informazione L informazione di base di un organismo è uguale per tutte le sue cellule GENOMICA Trasferimento

Dettagli

Functional Genomics in Cancer Genetics 03-04-09

Functional Genomics in Cancer Genetics 03-04-09 Functional Genomics in Cancer Genetics 03-04-09 La Genomica Funzionale è una branca della biologia molecolare il cui l obiettivo è di raccogliere il maggior numero di dati che consentono di studiare il

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Le proteine. Polimeri composto da 20 diversi aminoacidi

Le proteine. Polimeri composto da 20 diversi aminoacidi Le proteine Polimeri composto da 20 diversi aminoacidi (D. Voet, J.G. Voet, Biochemistry, 3 ed., John Wiley & Sons, 2004) PROTEINE come ATTUATORI nella cellula Trasporto elettronico Trasporto di ioni e

Dettagli

Cos è uno spettrometro di massa

Cos è uno spettrometro di massa Cos è uno spettrometro di massa Lo spettrometro di massa è uno strumento che produce ioni e li separa in fase gassosa in base al loro rapporto massa/carica (m/z). Un analisi in spettrometria di massa può

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina 3500 V catod o

v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina 3500 V catod o La prima e : Isoelectric focusing (IEF) v=e z f 1 step1 v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina Tot 76 kvh f = coefficiente

Dettagli

Continua. Peptidasi H 2 O

Continua. Peptidasi H 2 O Continua Peptidasi H 2 O Classificazione delle peptidasi 1. Meccanismo catalitico 2. Tipo di reazione catalizzata 3. Struttura molecolare e omologia 1. Meccanismo catalitico (mostrato per la chimotripsina)

Dettagli

COS E LA PROTEOMICA? The total PROTEIN complement of a GENOME Proteoma proteine codificate modificazioni post-traduzionali

COS E LA PROTEOMICA? The total PROTEIN complement of a GENOME Proteoma proteine codificate modificazioni post-traduzionali COS E LA PROTEOMICA? The total PROTEIN complement of a GENOME (M. Wilkins et al. Electrophoresis 1995,16 1090-95) La Proteomica è lo studio del PROTEOMA Ud'A [Biochimica Applicata 1] dia n. 1 Proteoma

Dettagli

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica Gli aminoacidi NOMENCLATURA Aminoacido Abbr. tre lettere Abbr. una lettera Aminoacido Abbr. tre lettere Abbr. una lettera Alanina ALA A Lisina LYS K Arginina ARG R Metionina MET M Asparagina ASN N Fenilalanina

Dettagli

Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi

Dettagli

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Allegato 1. COD_TD2 ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO

Allegato 1. COD_TD2 ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO Profilo 1 Esperto in tecnologie di pastificazione e spettrometria RAMAN L esperto dovrà operare presso la Piattaforma di Tecnologie Alimentari, laboratorio di

Dettagli

mediante proteasi industriali

mediante proteasi industriali Valorizzazione delle farine disoleate mediante proteasi industriali Alessandra Stefan Unità operativa: CSGI (Consorzio per lo Sviluppo dei Sistemi a Grande Interfase, Firenze) Dipartimento di Farmacia

Dettagli

L essenziale di biologia molecolare della cellula

L essenziale di biologia molecolare della cellula Bruce ALBERTS et al. L essenziale di biologia molecolare della cellula Seconda edizione Capitolo 7: Dal DNA alle proteine: come la cellula legge il genoma Alberts et al., L ESSENZIALE DI BIOLOGIA MOLECOLARE

Dettagli

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE Nell ultima fase della sintesi proteica la catena polipeptidica neosintetizzata assume spontaneamente la sua conformazione nativa (massimo numero di legami

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

Epithelial-Mesenchymal Transition in Cancer. Relevance of Periostin Splice Variants

Epithelial-Mesenchymal Transition in Cancer. Relevance of Periostin Splice Variants DISS. ETH NO. 19590 Epithelial-Mesenchymal Transition in Cancer Relevance of Periostin Splice Variants A dissertation submitted to the ETH Zurich For the degree of Doctor of Sciences Presented by Laura

Dettagli

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV ADULTS AND CHILDREN ESTIMATED TO BE LIVING WITH HIV/AIDS,

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente Gli amminoacidi naturali sono α-amminoacidi : il gruppo amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente formula generale: gruppo funzionale carbossilico

Dettagli

LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da

LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da 1 All.to 1 LOTTO 1 - CAPITOLATO TECNICO Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da Analizzatore Tubo di volo lineare di almeno 1,5m

Dettagli

Relazione struttura-funzione

Relazione struttura-funzione Biotecnologie applicate alla progettazione e sviluppo di molecole biologicamente attive A.A. 2010-2011 Modulo di Biologia Strutturale Relazione struttura-funzione Marco Nardini Dipartimento di Scienze

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

AMMINOACIDI E PROTEINE

AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE Vengono chiamate amminoacidi quelle molecole organiche in cui sono contemporaneamente presenti sia un gruppo acido carbossilico -COO che un gruppo amminico -N2. Una molecola appartenente

Dettagli

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata Ammino acidi Composto che contiene una funziome acida e amminica. Usualmente però con amminoacidi si intendono gli alfa- amminoacidi. Tra questi composti ve ne sono 20 che vengono definiti geneticamente

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Spettrometria di massa

Spettrometria di massa Tecniche di monitoraggio ambientale di tipo fisico Spettrometria di massa (J. B. Fenn, K. Tanaka, K. Wüthrich, premio nobel per la chimica nel 2002) Analisi chimica dell aerosol Riconoscimento di inquinanti

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Amminoacidi e Proteine

Amminoacidi e Proteine Amminoacidi e Proteine Struttura generale di un α-amminoacido R = catena laterale AMMINOACIDI (AA) CELLULARI Gli amminoacidi presenti nella cellula possono essere il prodotto di idrolisi delle proteine

Dettagli

INTRODUZIONE ALLA PROTEINE BCP 1-2

INTRODUZIONE ALLA PROTEINE BCP 1-2 INTRODUZIONE ALLA BIOCHIMICA DELLE PROTEINE BCP 1-2 Pietre miliari Lehninger 1973 Biochemistry Proteine ricombinanti Protein engineering Cristallografia, NMR, EM, MS, spettroscopie... Computing Bioinformaticai

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma L elettroforesi bidimensionale separa le proteine in base alla loro carica (come nella IEF) e dimensioni

Dettagli

PROTEOMA E PROTEOMICA

PROTEOMA E PROTEOMICA PROTEOMA E PROTEOMICA "The analysis of the entire PROTEin content expressed by a genome, or by a cell or tissue type. Wasinger VC et al, Electrophoresis 16 (1995) PROTEOMICS is the systematic analysis

Dettagli

IL MARCATORE TUMORALE

IL MARCATORE TUMORALE IL MARCATORE TUMORALE Un marcatore tumorale è una sostanza rilevabile nei fluidi biologici la cui positività indica la presenza di un tumore. Il marcatore tumorale ideale dovrebbe presentare una completa

Dettagli

4x4x4=4 3 =64 codoni. 20 aminoacidi

4x4x4=4 3 =64 codoni. 20 aminoacidi 4x4x4=4 3 =64 codoni 20 aminoacidi 1 Le 20 diverse catene laterali (gruppo R) che costituiscono gli aminoacidi si differenziano considerevolmente per dimensioni, volume e per le loro caratteristiche fisico-chimiche,

Dettagli

AVVISO SELEZIONE DI 15 RICERCATORI PER ATTIVITÀ DI RICERCA, SVILUPPO E TRASFERIMENTO TECNOLOGICO

AVVISO SELEZIONE DI 15 RICERCATORI PER ATTIVITÀ DI RICERCA, SVILUPPO E TRASFERIMENTO TECNOLOGICO AVVISO SELEZIONE DI 15 RICERCATORI PER ATTIVITÀ DI RICERCA, SVILUPPO E TRASFERIMENTO TECNOLOGICO Porto Conte Ricerche Srl indice una selezione, per titoli, eventuale colloquio e prova pratica, per il conferimento

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per

Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per identificare prodotti incogniti, per determinazioni quantitative

Dettagli

12-05-2010 ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI

12-05-2010 ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI Il primo passaggio per la maggior parte delle procedure che verranno trattate in questo corso consiste nell estrazione del DNA (e dell RNA) da materiale biologico, e nella sua purificazione mediante separazione

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

Modello del collasso idrofobico. Il folding è facilitato dalla presenza di chaperons molecolari quali le Heat Shock Proteins, Hsp70 e Hsp60

Modello del collasso idrofobico. Il folding è facilitato dalla presenza di chaperons molecolari quali le Heat Shock Proteins, Hsp70 e Hsp60 Modello gerarchico Modello del collasso idrofobico Il folding è facilitato dalla presenza di chaperons molecolari quali le Heat Shock Proteins, Hsp70 e Hsp60 Le Hsp70 si legano ai segmenti idrofobici di

Dettagli

3.3. UMAMI NEGLI ALIMENTI

3.3. UMAMI NEGLI ALIMENTI 3.3. UMAMI NEGLI ALIMENTI In questo capitolo saranno esaminati i vari cibi, ad esclusione di quelli ittici che verranno presi in considerazione successivamente, allo scopo di scoprire se in essi è presente,

Dettagli

La spettrometria di massa è una metodica che consente l identificazione e l analisi quantitativa di una molecola dalla sua massa.

La spettrometria di massa è una metodica che consente l identificazione e l analisi quantitativa di una molecola dalla sua massa. La spettrometria di massa è una metodica che consente l identificazione e l analisi quantitativa di una molecola dalla sua massa. Si sfruttano due fenomeni correlati alla massa ed alla carica. 1) la traiettoria

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

Tecniche biofisiche basate su nanopori

Tecniche biofisiche basate su nanopori Tecniche biofisiche basate su nanopori -Pori di dimensione nanometrica -Attraverso membrane lipidiche o inorganiche -Di natura proteica o scavati con tecnologie top-down Possono essere impiegati per -Studiare

Dettagli

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino Strutture molecolari della cellula: Bio-macromolecole Prof. C. Guarino INTRO Ogni cellula vivente racchiude una pluralità di molecole diverse L acqua è l elemento dominante, nelle cellule vegetali e nei

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali):

AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali): AMINOAIDI. Proteine (gr. pròtos = primo) > 50% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida (o alcalina) α-aminoacidi Struttura generale degli α-aminoacidi primari (standard,

Dettagli

Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer

Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer Beatrice Arosio Dipartimento di Medicina Interna, Università degli Studi di Milano U.O. di Geriatria, Fondazione IRCCS

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Tecniche di spettrometria di massa applicabili all analisi del proteoma

Tecniche di spettrometria di massa applicabili all analisi del proteoma Tecniche di spettrometria di massa applicabili all analisi del proteoma In proteomica, la spettrometria di massa non rappresenta soltanto la procedura di elezione per ottenere misure precise della massa

Dettagli

Prof. Maria Nicola GADALETA

Prof. Maria Nicola GADALETA Prof. Maria Nicola GADALETA E-mail: m.n.gadaleta@biologia.uniba.it Facoltà di Scienze Biotecnologiche Corso di Laurea in Biotecnologie Sanitarie e Farmaceutiche Biochimica e Biotecnologie Biochimiche DISPENSA

Dettagli

Le idee della chimica

Le idee della chimica G. Valitutti A.Tifi A.Gentile Seconda edizione Copyright 2009 Zanichelli editore Capitolo 25 Le basi della biochimica 1. I carboidrati 2. I lipidi 3. Gli amminoacidi, i peptidi e le proteine 4. La struttura

Dettagli

Ibridizzazione in situ

Ibridizzazione in situ ANALISI DELL RNA Northen blot E un metodo simile a quello di traferimento e di ibridizzazione del DNA (Southern blot) e si usa per sondare molecole di RNA. Gli mrna sono molecole brevi, in genere meno

Dettagli

Si dividono in: N-glicosilate (su Asparagina) O-glicosilate (su Serina o Treonina. Raramente su Tirosina, idrossiprolina, idrossilisina)

Si dividono in: N-glicosilate (su Asparagina) O-glicosilate (su Serina o Treonina. Raramente su Tirosina, idrossiprolina, idrossilisina) GLICOSILAZIONE La glicosilazione è la modificazione PTM più diffusa. Circa il 50% delle proteine umane sono glicosilate Caratteristica di molte proteine della superficie cellulare e delle d proteine di

Dettagli

AMINOACIDI - 1 AMINOACIDI - 2

AMINOACIDI - 1 AMINOACIDI - 2 AMINOAIDI - 1 Proteine (gr. pròtos = primo) 50-80% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida o alcalina α-aminoacidi proteasi Struttura generale degli α-aminoacidi primari

Dettagli

La produzione di ROS è catalizzata da metalli legati a proteine

La produzione di ROS è catalizzata da metalli legati a proteine Stress Ossidativo La produzione di ROS è catalizzata da metalli legati a proteine Reazioni di Fenton e di Haber-Weiss SOD H 2 O 2 + O 2 O 2 - + Fe 3+ Fe 2+ + O 2 Fe 2+ + H 2 O 2 OH - + Fe 3+ + OH Catalasi

Dettagli

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance

Dettagli

Regolazione redox nel cloroplasto

Regolazione redox nel cloroplasto Regolazione redox nel cloroplasto Mirko Zaffagnini Laboratorio di Fisiologia Molecolare delle piante, Università di Bologna Accademia dei Georgofili, 24 maggio 2012 Alghe verdi (Cr) Piante superiori (At)

Dettagli

FOODFLAVR:industria 2015

FOODFLAVR:industria 2015 FOODFLAVR:industria 2015 Pacco di Lavoro (PL) 28.2 Analisi dei profili molecolari globali (PMG) in alimen7 di quarta gamma mediante tecniche di proteomica Mariasole Di Carli, Linda Bianco, CrisDna Capodicasa,

Dettagli

delegate a conservare e trasmettere l'informazione genetica. Oggi é noto che sono gli acidi

delegate a conservare e trasmettere l'informazione genetica. Oggi é noto che sono gli acidi 8. Le proteine Il termine "proteina" (dal greco προτειος: di primaria importanza) fu coniato nel 1838 dal chimico svedese J. Berzelius 1 quando ancora si riteneva che le proteine fossero le molecole delegate

Dettagli

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento www.unitn.it/cibio

Dettagli

Clonaggio e mutagenesi sito-specifica di geni codificanti proteine respiratorie per la loro caratterizzazione strutturale e funzionale

Clonaggio e mutagenesi sito-specifica di geni codificanti proteine respiratorie per la loro caratterizzazione strutturale e funzionale Rendiconti Seminario Facoltà Scienze Università Cagliari Vol. 76, Fasc. 1-2 (2006) Clonaggio e mutagenesi sito-specifica di geni codificanti proteine respiratorie per la loro caratterizzazione strutturale

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE Servizio Risorse Umane e Relazioni Sindacali delegato dal Direttore Generale dell Azienda con

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Scheda tecnica TRI118

Scheda tecnica TRI118 TRI REAGENT - RNA / DNA / PROTEIN ISOLATION REAGENT Cat. No. TR 118/50 Cat. No. TR 118/100 Cat. No. TR 118/200 Produttore: Molecular Research Center Distributore: Bio-Optica Conservare a 4-25 C DESCRIZIONE

Dettagli

Titolo TESI STUDIO DI FATTIBILITÀ DI UNO STRUMENTO PER ANALISI CONTEMPORANEE DI PATOGENI E TOSSINE. Candidato. Dr. Alessandro Sassolini

Titolo TESI STUDIO DI FATTIBILITÀ DI UNO STRUMENTO PER ANALISI CONTEMPORANEE DI PATOGENI E TOSSINE. Candidato. Dr. Alessandro Sassolini Titolo TESI STUDIO DI FATTIBILITÀ DI UNO STRUMENTO PER ANALISI CONTEMPORANEE DI PATOGENI E TOSSINE Candidato Dr. Alessandro Sassolini Master In Protezione da eventi CBRN A.A 2010 2011 BREVE RIASSUNTO DELLA

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

1. Punto isoelettrico (pi) 2. Peso molecolare (Mw)

1. Punto isoelettrico (pi) 2. Peso molecolare (Mw) PROTEOMA E PROTEOMICA Le proteine hanno due valori intrinseci che ne determinano le caratteristiche specifiche: 1. Punto isoelettrico (pi) 2. Peso molecolare (Mw) PRINCIPIO DELL ELETTROFORESI BIDIMENSIONALE

Dettagli

PROF. MASSIMO TABATON - CURRICULUM VITAE

PROF. MASSIMO TABATON - CURRICULUM VITAE PROF. MASSIMO TABATON - CURRICULUM VITAE Stato Professionale 1980-1981: Assistente di ruolo in Neurologia, Osp. Di Alessandria 1987-1990 : Assistente Neurologo, Clinica Neurologica, Università di Genova

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

LEGAMI CON L`ITALIA. ATTESTATI: breve cronologia

LEGAMI CON L`ITALIA. ATTESTATI: breve cronologia Curriculum Vitae Antonio Giordano, M.D., Ph.D. Il Professor Antonio Giordano si e laureato con il massimo dei voti in Medicina a Napoli nel 1986. Ha conseguito la specializzazione in Anatomia Patologica

Dettagli

Segnali post-inserzionali

Segnali post-inserzionali Segnali post-inserzionali Ritenzione nel R.E. KDEL C-term RDEL KEEL Individuazione di recettori per KDEL tramite anticorpi di Seconda generazione Recupero di proteine localizzate nel reticolo endoplasmatico

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Nuovi marcatori proteici di mastite nei piccoli ruminanti: prospettive per la diagnosi sul campo e nel laboratorio

Nuovi marcatori proteici di mastite nei piccoli ruminanti: prospettive per la diagnosi sul campo e nel laboratorio Nuovi marcatori proteici di mastite nei piccoli ruminanti: prospettive per la diagnosi sul campo e nel laboratorio Maria Filippa Addis, Porto Conte Ricerche, Alghero addis@portocontericerche.it Giornata

Dettagli

dieta vengono convertiti in composti dei corpi chetonici.

dieta vengono convertiti in composti dei corpi chetonici. Metabolismo degli aminoacidi Metabolismo degli aminoacidi Gli aminoacidi introdotti in eccesso con la dieta vengono convertiti in composti precursori del glucosio, degli acidi grassi e dei corpi chetonici.

Dettagli

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione in campo medico e biotecnologico Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione delle sequenze di acido nucleico Elena Comoglio Jacobacci & Partners S.p.A. Brevetti

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Open Access RESEARCH ARTICLE The Worker Honeybee Fat Body Proteome Is Extensively Remodeled

Open Access RESEARCH ARTICLE The Worker Honeybee Fat Body Proteome Is Extensively Remodeled PLoS ONE Open Access RESEARCH ARTICLE The Worker Honeybee Fat Body Proteome Is Extensively Remodeled Preceding a Major Life-History Transition Queenie W. T. Chan1, Navdeep S. Mutti2, Leonard J. Foster1,

Dettagli

IL-2R & IL-15R Alice Praduroux

IL-2R & IL-15R Alice Praduroux Università degli Studi di Torino Facoltà di Biotecnologie Molecolari Anno Accademico 2006/2007 Corso di Immunologia Molecolare IL-2R & IL-15R Alice Praduroux Classificazione Recettori appartenenti alla

Dettagli

Gli equini non sono tradizionalmente considerati produttori CHIMICA & PROTEOMICA DEL LATTE EQUINO SPETTROMETRIA DI MASSA

Gli equini non sono tradizionalmente considerati produttori CHIMICA & PROTEOMICA DEL LATTE EQUINO SPETTROMETRIA DI MASSA Vincenzo Cunsolo, Salvatore Foti, Vera Muccilli, Rosaria Saletti Dipartimento di Scienze Chimiche Università di Catania sfoti@unict.it PROTEOMICA DEL LATTE EQUINO Un indagine sistematica del latte di asina,

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

UNIVERSITA DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE CHIMICHE TESI DI LAUREA MAGISTRALE

UNIVERSITA DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE CHIMICHE TESI DI LAUREA MAGISTRALE UNIVERSITA DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE CHIMICHE CORSO DI LAUREA MAGISTRALE IN CHIMICA INDUSTRIALE TESI DI LAUREA MAGISTRALE SVILUPPO DI UN METODO ANALITICO PER LA VALUTAZIONE DEI CAMBIAMENTI

Dettagli

Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa

Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa Gli amminoacidi Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa classe di molecole: p. es. la catalisi delle

Dettagli

CORSO DI SPETTROMETRIA DI MASSA 2016

CORSO DI SPETTROMETRIA DI MASSA 2016 Società Chimica Italiana Divisione di Spettrometria di Massa Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia CORSO DI SPETTROMETRIA DI MASSA 2016 Siena, Certosa di Pontignano

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

Scuola Universitaria Interfacoltà per le Biotecnologie Primo anno della Laurea specialistica in Biotecnologie molecolari Anno Accademico 2004-2005

Scuola Universitaria Interfacoltà per le Biotecnologie Primo anno della Laurea specialistica in Biotecnologie molecolari Anno Accademico 2004-2005 Scuola Universitaria Interfacoltà per le Biotecnologie Primo anno della Laurea specialistica in Biotecnologie molecolari Anno Accademico 2004-2005 ALESSIA PERINO La leptina è una piccola proteina non glicosilata

Dettagli

Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione

Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione Informatica Lezione VIII Visualizzazione 3D di proteine Visualizzazioni 3D Rappresentazione di strutture/oggetti tridimensionali Risultato di un esperimento modello teorico dati fisici astrazione 1 Lezione

Dettagli

C). Quindi, con la spettroscopia NMR, le informazioni sulla struttura molecolare vengono dedotte osservando il comportamento dei nuclei atomici.

C). Quindi, con la spettroscopia NMR, le informazioni sulla struttura molecolare vengono dedotte osservando il comportamento dei nuclei atomici. La spettroscopia di Risonanza Magnetica Nucleare (NMR) è una tecnica analitica strumentale che permette di ottenere dettagliate informazioni sulla struttura molecolare dei composti in esame. La spettroscopia

Dettagli

pdfmachine trial version

pdfmachine trial version Corso di Dottorato di Ricerca in : INGEGNERIA CHIMICA,DEI MATERIALI E DI PROCESSO Ciclo XXI Scuola: SCIENZE E TECNOLOGIE INNOVATIVE PER L INGEGNERIA INDUSTRIALE Processo di produzione dei sottoprodotti

Dettagli