ADESIONE CELLULARE SU MATERIALI BIOCOMPATIBILI

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "ADESIONE CELLULARE SU MATERIALI BIOCOMPATIBILI"

Transcript

1 Capitolo 11 - studi sperimentali e di ricerca ADESIONE CELLULARE SU MATERIALI BIOCOMPATIBILI a cura di Maristella Di Carmine Marco Marchisio Sebastiano Miscia 237

2 Implantologia Pratica Caratterizzazione morfologica dell adesione cellulare, su materiali biocompatibili ad uso odontoiatrico: valutazione dell organizzazione citoscheletrica con particolare attenzione alla componente proteica β-tubulina. L indagine è stata condotta utilizzando metodiche di immunofluorescenza in situ, che permettono la valutazione morfologica e i cambiamenti dell architettura tridimensionale data dalla polimerizzazione della β-tubulina, una delle proteine fondamentali del citoscheletro. I materiali utilizzati sono stati: dischi di titanio a superficie machined o rugosa (Oralplant, Cordenons, PN) mentre, come superficie di controllo è stato usato il vetro. Sono stati studiati tre modelli cellulari: cellule A-431, linea di carcinoma epiteliale umano, cellule RAW 264.7, linea tumorale monocito-macrofagica murina e infine fibroblasti di origine umana in coltura primaria (fig.1). Di questi tre modelli, è stata valutata la propensione all adesione sulle superfici prese in considerazione. Inoltre l utilizzo delle cellule RAW 264.7, che sono un modello utile per lo studio del differenziamento osteoclastico, ha reso possibile monitorare l influenza delle superfici sulla capacità di differenziamento cellulare. L assetto citoscheletrico è stato definito mediante l uso di anticorpi specifici per la β-tubulina, la cui presenza è stata evidenziata utilizzando anticorpi secondari coniugati con isotiocianato di fluoresceina (FITC), una molecola fluorocromica che se eccitata con luce blu ( nm) emette luce verde ( nm). Questa proprietà fisica, associata all utilizzo di un microscopio ad epifluorescenza, permette di ottenere delle immagini morfologiche di qualità, pur essendo il materiale biologico adeso a supporti opachi quali il titanio machined ed il titanio rugoso. Utilizzando un colorante specifico del DNA (DAPI) con caratteristiche anch esso di emissione, ma con lunghezza d onda diversa (blu), è stato possibile anche rilevare la morfologia nucleare, la localizzazione dei nucleoli e lo stato di condensazione e distribuzione del DNA. Dopo 24 ore dalla semina di un uguale numero di cellule, il primo parametro preso in considerazione è stato il numero di cellule aderenti ai diversi supporti. Tale valutazione è stata possibile grazie alla colorazione dei nuclei con DAPI e alla conta degli stessi in epifluorescenza, tenendo presente che, essendo tutte e tre i tipi cellulari mononucleati, il numero dei nuclei corrisponde al numero delle cellule adese. Come si può ben notare dai grafici riportati (fig. 2), l adesione dei tipi cellulari è diversa. Per quanto riguarda le A431, non sono state registrate variazioni significative del numero di cellule adese sui vari materiali e per questo motivo sono state omesse le conte. Per gli altri due tipi cellulari le variazioni sono significative e dimostrano come le RAW apparentemente aderiscano meglio al titanio machined mentre i fibroblasti primari preferiscano il titanio rugoso. Per tutte e due i tipi cellulari si evidenzia una maggior adesione sulle superfici Oralplant machined e rugosa rispetto al controllo utilizzato (superficie di vetro). L organizzazione citoscheletrica delle cellule A431 è sostanzialmente simile nelle cellule adese sulle varie superfici correlando pertanto con il dato dell adesione cellulare. Apparenti differenze rilevabili nelle cellule adese al titanio rugoso, dipendono in realtà dall impossibilità di osservare sullo stesso piano focale l intero citoscheletro, cosa che è possibile sulle superfici di vetro e di titanio liscio (fig. 3). Nelle cellule RAW è possibile rilevare come l organizzazione citoscheletrica sia complessa quando le cellule sono fatte aderire sulla superficie di titanio machined. L analisi morfologica delle cellule adese sul titanio rugo- Fig. 1 Esempio di morfologia del citoscheletro dei tre tipi cellulari presi in consederazione: A-431, linea di carcinoma epiteliale umano; RAW 264.7, monociti-macrofagi murini; fibroblasti in coltura primaria di origine umana. Il verde brillante rappresenta la localizzazione della β-tubulina e il blu la localizzazione del comparto nucleare. Le immagini sono state catturate mediante l utilizzo di una telecamera digitale. Queste immagini sono state ottenute utilizzando un obiettivo 100X. 238

3 Capitolo 11 - studi sperimentali e di ricerca Fig. 2 Conta delle cellule adese sui materiali presi in considerazione. Il dato proviene dalla conta di un campo rivelato dalla telecamera digitale utilizzando un obbiettivo 20X previa colorazione dei nuclei con dati e utilizzo di un microscopio ad epifluorescenza. Il dato della linea A431 non è stato riportato perché non sono state rivelate significative variazioni tra le varie superfici. 239

4 Implantologia Pratica so denota una diminuita organizzazione rispetto a quelle adese sul titanio machined, indicando una difficoltà all adesione che viene suggerita dalla forma più rotondeggiante che queste cellule acquisiscono (fig. 4). Nei fibroblasti primari umani, è possibile osservare un comportamento diverso sia rispetto alle cellule A431 che alle cellule RAW Queste cellule, infatti, modificano la loro organizzazione citoscheletrica in funzione della superficie su cui aderiscono (fig. 5). Quando vengono fatte aderire sul titanio rugoso, il citoscheletro tende ad organizzarsi in modo da ancorare le cellule a questa superficie complessa dando origine a zone di intensa concentrazione di β-tubulina localizzate nel fondo delle depressioni della superficie. Inoltre si può notare come i fibroblasti vengano orientati dalla presenza di solchi riscontrabili sulla superficie del titanio machined (fig. 6). Nelle altre due superfici si può notare come l orientamento delle cellule sia, invece, assente. È interessante notare meglio come le cellule adese al titanio rugoso abbiano delle zone di intensa marcatura per la β-tubulina nella parte più profonda della rugosità della superficie. La capacità delle cellule RAW di differenziare in osteoclasti dopo stimolazione con citochine, ha reso possibile la valutazione dell effetto delle diverse superfici sul differenziamento osteoclastico. Le differenze registrate sono statisticamente significative e dimostrano come il titanio rugoso tenda a stimolare maggiormente il differenziamento osteoclastico (fig. 7). Fig. 3 Morfologia del citoscheletro delle cellule A431 fatte aderire sulle diverse superfici prese in considerazione. Osservazione eseguita con microscopio ad epifluorescenza con obbiettivo 100X immagini catturate mediante telecamera digitale. La marcatura verde rappresenta la proteina β-tubulina, la marcatura blu rappresenta il DNA che costituisce il nucleo cellulare. Fig. 4 Morfologia del citoscheletro delle cellule Raw fatte aderire sulle diverse superfici prese in considerazione. Osservazione eseguita con microscopio ad epifluorescenza con obbiettivo 100X immagini catturate mediante telecamera digitale. La marcatura verde rappresenta la proteina β-tubulina, la marcatura blu rappresenta il DNA che costituisce il nucleo cellulare. 240

5 Capitolo 11 - studi sperimentali e di ricerca Fig. 5 Morfologia del citoscheletro dei Fibroblasti primari umani fatti aderire sulle diverse superfici prese in considerazione. Osservazione eseguita con microscopio ad epifluorescenza con obbiettivo 100X immagini catturate mediante telecamera digitale. La marcatura verde rappresenta la proteina β-tubulina, la marcatura blu rappresenta il DNA che costituisce il nucleo cellulare. Fig. 6 Morfologia del citoscheletro ed orientamento cellulare dei Fibroblasti primari umani fatti aderire sulle diverse superfici prese in considerazione. Osservazione eseguita con microscopio ad epifluorescenza con obbiettivo 40X immagini catturate mediante telecamera digitale. La marcatura verde rappresenta la proteina β-tubulina, la marcatura blu rappresenta il DNA che costituisce il nucleo cellulare. Fig. 7 Morfologia del citoscheletro nelle cellule RAW differenziate in osteoclasti e conte della loro presenza sulle varie superfici prese in considerazione Osservazione eseguita con microscopio ad epifluorescenza con obbiettivo 40X immagini catturate mediante telecamera digitale. La marcatura verde rappresenta la proteina β-tubulina, la marcatura blu rappresenta il DNA che costituisce il nucleo cellulare. 241

6 Implantologia Pratica 242

Effetti di correnti ad alta frequenza e bassa intensità: biostimolazione e rigenerazione cellulare

Effetti di correnti ad alta frequenza e bassa intensità: biostimolazione e rigenerazione cellulare UNIVERSITA DEGLI STUDI DI PADOVA Dipartimento di Anatomia e Fisiologia Umana Department of Human Anatomy and Physiology Effetti di correnti ad alta frequenza e bassa intensità: biostimolazione e rigenerazione

Dettagli

LA CELLULA VEGETALE. Il MICROSCOPIO OTTICO

LA CELLULA VEGETALE. Il MICROSCOPIO OTTICO LA CELLULA VEGETALE Il MICROSCOPIO OTTICO L origine del microscopio ottico è ancora materia di discussione. La maggior parte degli studiosi, tuttavia, fanno risalire i primi microscopi ottici alla fine

Dettagli

Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16

Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16 Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16 L'immunoistochimica e' una tecnica ampiamente utilizzata per l'identificazione e la localizzazione di costituenti cellulari

Dettagli

Report di Adesione Cellulare su Impianti dentali Tecom

Report di Adesione Cellulare su Impianti dentali Tecom Report di Adesione Cellulare su Impianti dentali Tecom Committente: Titanmed s.r.l. Scopo del lavoro: Lo scopo del lavoro consiste nello studio morfologico dell adesione cellulare all interfaccia con impianti

Dettagli

04_12_08. Microscopia confocale. Esempio di analisi con focale: vedi il filmato corrispondente. Vedi filmato

04_12_08. Microscopia confocale. Esempio di analisi con focale: vedi il filmato corrispondente. Vedi filmato Citologia Animale e Vegetale (corso A - I. Perroteau) - microscopia confocale Microscopia confocale 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - microscopia confocale Esempio di analisi con

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

Tecniche di microscopia

Tecniche di microscopia Tecniche di microscopia I microscopi permettono di vedere l estremamente piccolo I microscopi ottici utilizzano lenti di vetro in grado di deflettere e focalizzare i raggi luminosi per riprodurre le immagini

Dettagli

Misura della concentrazione intracellulare di ioni calcio con tecniche di video-imaging

Misura della concentrazione intracellulare di ioni calcio con tecniche di video-imaging Misura della concentrazione intracellulare di ioni calcio con tecniche di video-imaging Lo ione Calcio è il catione più abbondante nel corpo umano La concentrazione intracellulare di Calcio è bassa (100

Dettagli

SUMMER SCHOOL 2013 EFFETTO DELL ACIDO RETINOICO SU CELLULE PROMIELOCITICHE UMANE

SUMMER SCHOOL 2013 EFFETTO DELL ACIDO RETINOICO SU CELLULE PROMIELOCITICHE UMANE SUMMER SCHOOL 2013 EFFETTO DELL ACIDO RETINOICO SU CELLULE PROMIELOCITICHE UMANE HANNO PARTECIPATO ALL ESPERIMENTO: M. Ascari¹; N. Bucalossi²; F. Drocco³; L. Lombardino 4 ; V. Macarelli 5 ; M. Maddii 6

Dettagli

La colla intelligente

La colla intelligente La colla intelligente IFOM per la Scuola Lo Studente Ricercatore 2010 Massa Giacomo Istituto di Istruzione Superiore A. Maserati- Voghera Gruppo di lavoro: Angiogenesi Nome del tutor:mariagrazia Lampugnani

Dettagli

Proprietà ottiche ed oceanografiche di un sito abissale rilevanti per un telescopio a neutrini

Proprietà ottiche ed oceanografiche di un sito abissale rilevanti per un telescopio a neutrini Capitolo 2 Proprietà ottiche ed oceanografiche di un sito abissale rilevanti per un telescopio a neutrini Come si è già detto, la collaborazione NEMO sta realizzando un telescopio sottomarino per la rivelazione

Dettagli

03/11/15. Metodi vigorosi

03/11/15. Metodi vigorosi Metodi blandi Lisi cellulare con detergenti Metodi vigorosi 1 1. Centrifugazione preparativa Centrifugazione preparativa permette di separare i vari elementi di un omogenato cellulare 2. Ultracentrifugazione

Dettagli

Microscopio convenzionale

Microscopio convenzionale Microscopio convenzionale 160 mm 195 mm 45 mm Midollo osseo normale Anti-kappa vs. Anti-lambda DEFINIZIONI Citometria a flusso Metodologia per misurare le proprietà di cellule in flusso Cell Sorting Separazione

Dettagli

Tecniche Immunologiche

Tecniche Immunologiche Tecniche Immunologiche Reazioni Antigene (Ag)/Anticorpo (Ab) Modello Chiave-Serratura Legami non covalenti: Ag Interazione Lisozima/Anti-Lisozima Legami Idrogeno Legami Elettrostatici Legami Idrofobici

Dettagli

INFORMAZIONI PER GLI APPELLI DI ESAME:

INFORMAZIONI PER GLI APPELLI DI ESAME: Biologia della Cellula e dei Tessuti (Corso A) 12 ECTS Docenti: I. Perroteau (Biologia della Cellula) B. Dore (Biologia dei Tessuti) S. De Marchis (laboratorio di colture cellulari) 1 INFORMAZIONI PER

Dettagli

Tecniche Immunologiche

Tecniche Immunologiche Tecniche Immunologiche Reazioni Antigene (Ag)/Anticorpo (Ab) Modello Chiave-Serratura Legami non covalenti: Ag Interazione Lisozima/Anti-Lisozima Legami Idrogeno Legami Elettrostatici Legami Idrofobici

Dettagli

Genova 15 01 14 TIPOLOGIE DI LAMPADE

Genova 15 01 14 TIPOLOGIE DI LAMPADE Genova 15 01 14 TIPOLOGIE DI LAMPADE Le lampade a vapori di mercurio sono sicuramente le sorgenti di radiazione UV più utilizzate nella disinfezione delle acque destinate al consumo umano in quanto offrono

Dettagli

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente.

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. CHE COS E LA CELLULA? La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. DA COSA SONO COSTITUITE LE CELLULE? Tutte le

Dettagli

Laboratorio di Tecniche Microscopiche AA 2007-2008. 2008 Lezione 28 Marzo 2008 Ore 11-13

Laboratorio di Tecniche Microscopiche AA 2007-2008. 2008 Lezione 28 Marzo 2008 Ore 11-13 Laboratorio di Tecniche Microscopiche AA 2007-2008 2008 Lezione 28 Marzo 2008 Ore 11-13 13 Continuiamo il discorso sulla fluorescenza ricordando alcuni fra i più comuni utilizzi dei fluorocromi Istochimica

Dettagli

EPITHELIAL TO MESENCHYMAL TRANSITION (EMT) IN DEVELOPMENT AND DISEASES. Cristina Valacca 18 Maggio 2012

EPITHELIAL TO MESENCHYMAL TRANSITION (EMT) IN DEVELOPMENT AND DISEASES. Cristina Valacca 18 Maggio 2012 EPITHELIAL TO MESENCHYMAL TRANSITION (EMT) IN DEVELOPMENT AND DISEASES Cristina Valacca 18 Maggio 2012 DEFINIZIONE L'EMT è un processo biologico che consente a una cellula epiteliale di iniziare numerosi

Dettagli

L endocitosi dell EGFR

L endocitosi dell EGFR L endocitosi dell EGFR IFOM per la scuola Lo Studente Ricercatore 2011 Muzio Giulia Istituto d Istruzione Superiore Maserati Voghera Gruppo di lavoro: Determinanti della trasformazione neoplastica e della

Dettagli

MISURE DI VELOCITA OTTICHE

MISURE DI VELOCITA OTTICHE MISURE DI VELOCITA OTTICHE SOMMARIO VISUALIZZAZIONI ANALISI DI IMMAGINI 1) METODO DELLA SOGLIA 2) PARTICLE TRACKING VELOCIMETRY (PTV) 3) PARTICLE IMAGE VELOCIMETRY (PIV) 2 VISUALIZZAZIONI 1. INIEZIONE

Dettagli

FONDAMENTI DI ILLUMINOTECNICA

FONDAMENTI DI ILLUMINOTECNICA Prof. Ceccarelli Antonio ITIS G. Marconi Forlì Articolazione: Elettrotecnica Disciplina: Tecnologie e progettazione di sistemi elettrici ed elettronici A.S. 2012/13 FONDAMENTI DI ILLUMINOTECNICA CHE COSA

Dettagli

1. Microscopio in campo chiaro 2. Microscopio in campo oscuro 3. Microscopio in contrasto di fase 4. Microscopio ad interferenza 5.

1. Microscopio in campo chiaro 2. Microscopio in campo oscuro 3. Microscopio in contrasto di fase 4. Microscopio ad interferenza 5. Principali tipi di microscopi 1. Microscopio in campo chiaro 2. Microscopio in campo oscuro 3. Microscopio in contrasto di fase 4. Microscopio ad interferenza 5. Microscopio a contrasto di fase interferenziale

Dettagli

ZytoLight SPEC HER2/CEN 17 Dual Color Probe

ZytoLight SPEC HER2/CEN 17 Dual Color Probe ZytoLight SPEC HER2/CEN 17 Dual Color Probe Z-2015-200 Z-2015-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del gene umano HER2 e degli alfa-satelliti del cromosoma 17 mediante ibridazione in situ fluorescente

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

Metodi per l analisi morfo-funzionale delle cellule Prof. Marisa Levi Parte 5

Metodi per l analisi morfo-funzionale delle cellule Prof. Marisa Levi Parte 5 Metodi per l analisi morfo-funzionale delle cellule Prof. Marisa Levi Parte 5 Colture cellulari Un organismo è un sistema molto complesso, costituito da organi, che a loro volta sono costituiti da diversi

Dettagli

STAGE DIPARTIMENTO DI FISICA Biofisica: microscopia confocale e costruzione di nanocapsule

STAGE DIPARTIMENTO DI FISICA Biofisica: microscopia confocale e costruzione di nanocapsule STAGE DIPARTIMENTO DI FISICA Biofisica: microscopia confocale e costruzione di nanocapsule Bocchio Marco (Leonardo da Vinci, Genova) Gadoglia Edoardo (Galileo Ferrarsi, Savona) Zilioli Andrea (Nicoloso,

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

Il Microscopio. Il microscopio, dal greco micron (piccolo) e. skopein (guardare), è uno strumento che. permette di ottenere un immagine ingrandita

Il Microscopio. Il microscopio, dal greco micron (piccolo) e. skopein (guardare), è uno strumento che. permette di ottenere un immagine ingrandita Il Microscopio Il Microscopio Il microscopio, dal greco micron (piccolo) e skopein (guardare), è uno strumento che permette di ottenere un immagine ingrandita degli oggetti osservati. Unità di misura Unità

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

IL TEST DI CITOTOSSICITÀ

IL TEST DI CITOTOSSICITÀ IL TEST DI CITOTOSSICITÀ Questo test permette di valutare in vitro la capacità di un agente di inibire la crescita cellulare. La riduzione nel numero delle colonie può derivare sia dal blocco della proliferazione

Dettagli

VARIABILI METEROROLOGICHE E CONCENTRAZIONI DI PM10. 5.1 Introduzione

VARIABILI METEROROLOGICHE E CONCENTRAZIONI DI PM10. 5.1 Introduzione VARIABILI METEROROLOGICHE E CONCENTRAZIONI DI PM10 5.1 Introduzione Tra gli interventi finanziati dalla Regione Emilia Romagna per il 2004, ai fini della messa a punto di strumenti conoscitivi utili per

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

Esperienza con il sistema Aklides

Esperienza con il sistema Aklides Evoluzione tecnologica del metodo di immunofluorescenza indiretta: i sistemi esperti per la lettura del test ANA Esperienza con il sistema Aklides Elio Tonutti Immunopatologia e Allergologia - Udine Il

Dettagli

EMISSIONE E ASSORBIMENTO DI LUCE DA PARTE DELLA MATERIA

EMISSIONE E ASSORBIMENTO DI LUCE DA PARTE DELLA MATERIA EMISSIONE E ASSORBIMENTO DI LUCE DA PARTE DELLA MATERIA Poiché la luce è energia trasportata da oscillazioni del campo elettrico (fotoni) e la materia è fatta di particelle elettricamente cariche (atomi

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

Tipi di microscopio ottico

Tipi di microscopio ottico Tipi di microscopio ottico MIcroscopio brightfield: quello piu usato: il campione e retroilluminato Microscopio darkfield: il campione e illuminato lateralmente e viene osservato con uno sfondo nero Microscopio

Dettagli

Lo schema a blocchi di uno spettrofotometro

Lo schema a blocchi di uno spettrofotometro Prof.ssa Grazia Maria La Torre è il seguente: Lo schema a blocchi di uno spettrofotometro SORGENTE SISTEMA DISPERSIVO CELLA PORTACAMPIONI RIVELATORE REGISTRATORE LA SORGENTE delle radiazioni elettromagnetiche

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI

DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI Testi di riferimento: Alberts B. et al. Biologia molecolare della cellula - Ed. Zanichelli Gilbert S.F. Biologia dello sviluppo - Ed. Zanichelli COS E UNA CELLULA

Dettagli

ZytoLight SPEC ALK/EML4 TriCheck Probe

ZytoLight SPEC ALK/EML4 TriCheck Probe ZytoLight SPEC ALK/EML4 TriCheck Probe Z-2117-200 Z-2117-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del riarrangiamento dei geni ALK- EML4 mediante ibridazione in situ fluorescente (FISH).... Dispositivo

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

Tecniche di studio in Biologia Cellulare. - Colture cellulari. - Gi an-corpi: policlonali e monoclonali

Tecniche di studio in Biologia Cellulare. - Colture cellulari. - Gi an-corpi: policlonali e monoclonali - Colture cellulari - Gi an-corpi: policlonali e monoclonali - Tecniche morfologiche: la microscopia - Colorazioni e immunocitochimica - Microscopia o?ca: a campo chiaro, a fluorescenza (confocale) - Microscopia

Dettagli

Capitolo 2 Caratteristiche delle sorgenti luminose In questo capitolo sono descritte alcune grandezze utili per caratterizzare le sorgenti luminose.

Capitolo 2 Caratteristiche delle sorgenti luminose In questo capitolo sono descritte alcune grandezze utili per caratterizzare le sorgenti luminose. Capitolo 2 Caratteristiche delle sorgenti luminose In questo capitolo sono descritte alcune grandezze utili per caratterizzare le sorgenti luminose. 2.1 Spettro di emissione Lo spettro di emissione di

Dettagli

Bioingegneria Elettronica I

Bioingegneria Elettronica I Bioingegneria Elettronica I Cenni alla fisiologia delle cellule e dei sistemi biologici A. Bonfiglio La cellula struttura generale La cellula Struttura generale della cellula Composizione dei liquidi intracellulare

Dettagli

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza

Dettagli

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici

Dettagli

Diffrazione da reticolo: un CD come Spettroscopio

Diffrazione da reticolo: un CD come Spettroscopio Diffrazione da reticolo: un CD come Spettroscopio 1 -Argomento Esperimenti con uno spettroscopio realizzato con materiali a costo nullo o basso o di riciclo. Cosa serve - un vecchio CD, - una scatola di

Dettagli

LA TERMOGRAFIA SPETTRO ONDE ELETTROMAGNETICHE

LA TERMOGRAFIA SPETTRO ONDE ELETTROMAGNETICHE SPETTRO ONDE ELETTROMAGNETICHE La radiazione elettromagnetica è un mezzo di trasmissione dell energia sotto forma di onde aventi entrambe le componenti elettriche e magnetiche. La sequenza ordinata delle

Dettagli

Servizi di Ricerca a Terzi. Luglio 2015

Servizi di Ricerca a Terzi. Luglio 2015 Servizi di Ricerca a Terzi Luglio 2015 Chi siamo Vera Salus Ricerca S.r.l. (VSR) è una target discovery biotech company che mette a disposizione le proprie competenze e la propria strumentazione in qualità

Dettagli

Elettroforesi. Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita.

Elettroforesi. Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita. Elettroforesi Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita. A qualunque ph diverso dal pi le proteine hanno una carica netta quindi,

Dettagli

Misura delle proprietà di trasmissione e assorbimento della luce da parte dei materiali mediante spettrofotometro

Misura delle proprietà di trasmissione e assorbimento della luce da parte dei materiali mediante spettrofotometro Misura delle proprietà di trasmissione e assorbimento della luce da parte dei materiali mediante spettrofotometro Apparato sperimentale: Spettrofotometro digitale SPID HR (U21830) con software di acquisizione,

Dettagli

La pompa Na + /Glucosio: simporto

La pompa Na + /Glucosio: simporto MFN0366-A1 (I. Perroteau) - trasportatori e canali La pompa Na + /Glucosio: simporto Il trasportatore oscilla fra due stati alternativi (A e B); nello stato A la proteina è aperta nello spazio extracellulare,

Dettagli

ZytoLight SPEC ALK Dual Color Break Apart Probe

ZytoLight SPEC ALK Dual Color Break Apart Probe ZytoLight SPEC ALK Dual Color Break Apart Probe Z-2124-200 20 (0.2 ml) Z-2124-50 5 (0.05 ml) Per la rilevazione della traslocazione che coinvolge il gene ALK a 2p23 mediante ibridazione in situ fluorescente

Dettagli

Introduzione alla CITOLOGIA.

Introduzione alla CITOLOGIA. Introduzione alla CITOLOGIA www.fisiokinesiterapia.biz La cellula La più piccola porzione di materia vivente dotata di tutte le caratteristiche della materia vivente medesima I tessuti Porzioni di materia

Dettagli

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE Tutti i tipi cellulari presenti sul nostro pianeta appartengono ad uno di due gruppi fondamentali: procarioti ed eucarioti. I termini procariota (dal greco pro

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

APPLICAZIONI DELLA CITOFLUORIMETRIA QUALCHE ESEMPIO

APPLICAZIONI DELLA CITOFLUORIMETRIA QUALCHE ESEMPIO APPLICAZIONI DELLA CITOFLUORIMETRIA QUALCHE ESEMPIO STUDIO DEL SISTEMA IMMUNITARIO Una delle maggiori applicazioni della citofluorimetria e rappresentata dall analisi (e sorting) delle diverse popolazioni

Dettagli

PROGETTO SCIENZE CLASSI PRIME SECONDARIA I GRADO A.S. 2013/2014

PROGETTO SCIENZE CLASSI PRIME SECONDARIA I GRADO A.S. 2013/2014 Ministero dell Istruzione, dell Università e della Ricerca ISTITUTO COMPRENSIVO Via San Francesco 5 20061 CARUGATE (MI) tel. 02.92151388 02.9253970 02.9252433 FAX 02.9253741 e-mail segreteria: miic8bj003@istruzione.it

Dettagli

la storia di HER2 Citogenetica e biologia molecolare dei tumori mammari: implicazioni cliniche HER2: Human Epidermal Receptor

la storia di HER2 Citogenetica e biologia molecolare dei tumori mammari: implicazioni cliniche HER2: Human Epidermal Receptor Citogenetica e biologia molecolare dei tumori mammari: implicazioni cliniche la storia di HER2 V. Martin 28 giugno 2011 HER2: Human Epidermal Receptor HER2 e carcinoma mammario alias c-erb, ERBB2, HER-

Dettagli

Progetto di Ricerca. 1) la capacità dei cheratinociti umani di internalizzare il nanoparticolato

Progetto di Ricerca. 1) la capacità dei cheratinociti umani di internalizzare il nanoparticolato Progetto di Ricerca Studio del potenziale pro-infiammatorio e pro-fibrotico del particolato ambientale (nanoparticelle da gas di scarico di motori diesel) nella Sclerosi Sistemica *Silvana Fiorito, *Felice

Dettagli

LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI PROTEINE. sono ACIDI NUCLEICI. molecole complesse = POLIMERI. formate dall'unione di

LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI PROTEINE. sono ACIDI NUCLEICI. molecole complesse = POLIMERI. formate dall'unione di LE BIOMOLECOLE LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI LE BIOMOLECOLE sono LIPIDI PROTEINE ACIDI NUCLEICI molecole complesse = POLIMERI formate dall'unione di molecole semplici = MONOMERI

Dettagli

D.LGS.81/08 TITOLO VIII CAPO V RADIAZIONI OTTICHE ARTIFICIALI (ROA)

D.LGS.81/08 TITOLO VIII CAPO V RADIAZIONI OTTICHE ARTIFICIALI (ROA) D.LGS.81/08 TITOLO VIII CAPO V RADIAZIONI OTTICHE ARTIFICIALI (ROA) 1.1 Descrizione della fonte di rischio Le radiazioni ROA sono radiazioni elettromagnetiche che hanno la caratteristica di avere una lunghezza

Dettagli

Gruppo di Ricerca Didattica Unità Didattica Dalla Luce al Telescopio Resoconto attività svolta al Liceo Sperimentale Siani di Napoli

Gruppo di Ricerca Didattica Unità Didattica Dalla Luce al Telescopio Resoconto attività svolta al Liceo Sperimentale Siani di Napoli Gruppo di Ricerca Didattica Unità Didattica Dalla Luce al Telescopio Resoconto attività svolta al Liceo Sperimentale Siani di Napoli di Gennaro Cretella e Gianfranco Spirito Nel mese di maggio 0, il Liceo

Dettagli

Esercitazione di Microbiologia generale. Microscopia

Esercitazione di Microbiologia generale. Microscopia Esercitazione di Microbiologia generale Microscopia I microrganismi Le cellule più primitive viventi attualmente sono i batteri questi appartengono a un gruppo di organismi chiamati procarioti (letteralmente

Dettagli

Interferenza di luce visibile (esperimento di Young a basso costo)

Interferenza di luce visibile (esperimento di Young a basso costo) Interferenza di luce visibile (esperimento di Young a basso costo) 1 -Argomento Esperimenti su interferenza di luce visibile da doppia fenditura realizzata con materiali a costo nullo o basso o di riciclo.

Dettagli

Progetto di Odontoiatria Sociale. Prof. Luigi Baggi

Progetto di Odontoiatria Sociale. Prof. Luigi Baggi Progetto di Odontoiatria Sociale Prof. Luigi Baggi L AMBULATORIO DI ODONTOIATRIA SOCIALE E RIABILITAZIONE GNATOLOGICA DELL INMP Dal 2010 è attivo, presso l INMP, il servizio di Odontoiatria sociale e di

Dettagli

Stato dell arte nell uso dei sensori per la diagnostica colturale

Stato dell arte nell uso dei sensori per la diagnostica colturale Stato dell arte nell uso dei sensori per la diagnostica colturale Martina Corti martina.corti@unimi.it Sensore Impiegato Tecnica di acquisizione Elaborazione Dato Camera Digitale Camera Termica Satellite

Dettagli

Nuclear size control in C. elegans

Nuclear size control in C. elegans Nuclear size control in C. elegans Chiara Knecht (Liceo Lugano 2) e Justin-Aurel Ulbrich (Liceo Lugano 1) Sotto la supervisione di Christian Gentili, Swiss Institute for Experimental Cancer Research (ISREC),

Dettagli

TOSSICOLOGIA. TOSSICO Ogni sostanza capace di provocare in un organismo modificazioni funzionali DANNOSE mediante una azione fisica o chimica.

TOSSICOLOGIA. TOSSICO Ogni sostanza capace di provocare in un organismo modificazioni funzionali DANNOSE mediante una azione fisica o chimica. TOSSICOLOGIA COS E UN FARMACO? - ogni sostanza capace di provocare in un organismo modificazioni funzionali mediante un azione fisica o chimica. - Per l OMS è farmaco una sostanza o un prodotto utilizzato

Dettagli

Studio mediante Microscopia a Forza Atomica (Atomic Force Microscopy AFM) dell interazione tra DNA e molecole organiche di sintesi

Studio mediante Microscopia a Forza Atomica (Atomic Force Microscopy AFM) dell interazione tra DNA e molecole organiche di sintesi Studio mediante Microscopia a Forza Atomica (Atomic Force Microscopy AFM) dell interazione tra DNA e molecole organiche di sintesi La possibilità di osservare direttamente singole molecole dà grandi vantaggi

Dettagli

CORSO DI FISICA TECNICA 2 AA 2013/14 ILLUMINOTECNICA. Lezione n 3:

CORSO DI FISICA TECNICA 2 AA 2013/14 ILLUMINOTECNICA. Lezione n 3: CORSO DI FISICA TECNICA 2 AA 2013/14 ILLUMINOTECNICA Lezione n 3: Elementi caratterizzanti il colore Grandezze fotometriche qualitative Le Sorgenti Luminose artificiali Ing. Oreste Boccia 1 Elementi caratterizzanti

Dettagli

Riccardo Di Liberto Struttura Complessa di Fisica Sanitaria Fondazione IRCCS Policlinico San Matteo -Pavia

Riccardo Di Liberto Struttura Complessa di Fisica Sanitaria Fondazione IRCCS Policlinico San Matteo -Pavia Effetti biologici derivanti da dall interazione tra fasci laser utilizzati nelle applicazioni industriali ed il corpo umano Riccardo Di Liberto Struttura Complessa di Fisica Sanitaria Fondazione IRCCS

Dettagli

CITOSCHELETRO. Caratteristica degli epiteli: mutua adesività fra le singole cellule.

CITOSCHELETRO. Caratteristica degli epiteli: mutua adesività fra le singole cellule. CITOSCHELETRO Caratteristica degli epiteli: mutua adesività fra le singole cellule. Ematossilina eosina Ematossilina ferrica, fissazione in bicromato Nell epidermide l istologia rivela strutture di coesione

Dettagli

ANALISI CITOFLUORIMETRICA E SUE APPLICAZIONI IN AMBITO BIOMEDICO

ANALISI CITOFLUORIMETRICA E SUE APPLICAZIONI IN AMBITO BIOMEDICO ANALISI CITOFLUORIMETRICA E SUE APPLICAZIONI IN AMBITO BIOMEDICO Cos è la CITOMETRIA A FLUSSO? Citometria si riferisce alla misura di caratteristiche chimico-fisiche di cellule o di altre particelle biologiche.

Dettagli

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice

Dettagli

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015 1) I batteri sono organismi: a- bicellulari b- monocellulari c- pluricellulari 2) I virus: a- possono riprodursi solo nell acqua b- possono riprodursi solo sulla superficie di una cellula c- possono riprodursi

Dettagli

Serie DMS-850 Microscopi digitali LCD a fluorescenza

Serie DMS-850 Microscopi digitali LCD a fluorescenza Serie DMS-850 Microscopi digitali LCD a fluorescenza Introduzione I microscopi digitali LCD a fluorescenza serie DMS-850 hanno esteso il concetto tradizionale di osservazione microscopica grazie ad un

Dettagli

IL CONTRIBUTO DELLA RICERCA DI BASE

IL CONTRIBUTO DELLA RICERCA DI BASE IL CONTRIBUTO DELLA RICERCA DI BASE Barbara Begni Centro di Referenza Nazionale per il Benessere Animale - IZSLER - BRESCIA CONVEGNO PROBLEMATICHE ATTUALI DI RICERCA E STUDIO SUL BENESSERE ANIMALE MILANO

Dettagli

Analisi avanzata del materiale seminale

Analisi avanzata del materiale seminale Analisi avanzata del materiale seminale ASMA system (Automated sperm morphometry analysis system) Microscopio a contrasto di fase con obiettivo 100X Videocamere Computer per digitalizzare le immagini Valori

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Definizione di motore molecolare e di sistemi su nanoscala

Definizione di motore molecolare e di sistemi su nanoscala 1 Definizione di motore molecolare e di sistemi su nanoscala 2 Macchine molecolari semplici devono prevedere almeno tre elementi (molecolari) funzionali e garantire tre requisiti fondamentali. Il campo

Dettagli

GENETICA GENERALE GENETICA UMANA E MOLECOLARE

GENETICA GENERALE GENETICA UMANA E MOLECOLARE GENETICA GENERALE GENETICA UMANA E MOLECOLARE Come si studiano i geni 1. Trasmissione genetica, studia i fenomeni del passaggio dei caratteri da generazione a generazione (sperimentale: in modelli animali

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli

Dettagli

Citoscheletro Microtubuli

Citoscheletro Microtubuli PROPRIETA DEI MICROTUBULI, FILAMENTI INTERMEDI E FILAMENTI DI ACTINA Citoscheletro Microtubuli Biotec _ 2011 Da G. Karp, BIOLOGIA CELLULARE E MOLECOLARE, 3a ed, CORRETTA Microtubuli Microfilamenti Filamenti

Dettagli

Introduzione al Pattern Recognition Statistico

Introduzione al Pattern Recognition Statistico Introduzione al Pattern Recognition Statistico Roberto Tagliaferri Dipartimento di Informatica Università di Salerno ( Sa ) 84084 Fisciano e-mail robtag@unisa.it Statistical Pattern Recognition Introduzione

Dettagli

Applicazioni della citometria a flusso nel laboratorio di ricerca: Corso teorico-metodologico. 17-18 Ottobre 2007

Applicazioni della citometria a flusso nel laboratorio di ricerca: Corso teorico-metodologico. 17-18 Ottobre 2007 Applicazioni della citometria a flusso nel laboratorio di ricerca: Corso teorico-metodologico 17-18 Ottobre 2007 Ciclo cellulare - Contenuto di DNA - Apoptosi Delia Mezzanzanica Il ciclo cellulare Analisi

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Caratterizzazione biologica del tessuto cutaneo in seguito ad omogeneizzazione

Caratterizzazione biologica del tessuto cutaneo in seguito ad omogeneizzazione Caratterizzazione biologica del tessuto cutaneo in seguito ad omogeneizzazione V. Purpura 1, M. Ghetti 1, E. Bondioli 1, P. Minghetti 1, D. Melandri 1, M. Riccio 2 Accademia del Lipofilling Centro Studi

Dettagli

Ibridizzazione in situ

Ibridizzazione in situ ANALISI DELL RNA Northen blot E un metodo simile a quello di traferimento e di ibridizzazione del DNA (Southern blot) e si usa per sondare molecole di RNA. Gli mrna sono molecole brevi, in genere meno

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Microscopia confocale

Microscopia confocale MFN0366-A1 (I. Perroteau) - microscopia confocale Microscopia confocale 1 MFN0366-A1 (I. Perroteau) - microscopia confocale Esempio di analisi con focale: vedi il filmato corrispondente Vedi filmato 2

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Her-2 nel carcinoma mammario

Her-2 nel carcinoma mammario Her-2 nel carcinoma mammario Piera Balzarini U.O. Anatomia Patologica Università degli Studi di Brescia Spedali Civili di Brescia Il gene ERBB2 dà origine ad un recettore tirosin-chinasico appartenente

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Strategie di purificazione di proteine

Strategie di purificazione di proteine Laurea Magistrale in Scienze e Biotecnologie degli Alimenti Strategie di purificazione di proteine Lezione n.xx-2-23 PRINCIPIO - ALIMENTI DA MATRICI SOLIDE E LIQUIDE MATRICI SOLIDE - ROMPERE LA STRUTTURA

Dettagli