Preparazione dei campioni da inviare per il sequenziamento

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Preparazione dei campioni da inviare per il sequenziamento"

Transcript

1 Preparazione dei campioni da inviare per il sequenziamento PCR preparativa Buffer 10x dntp 2mM Taq polimerasi Oligonucleotidi up e down 100 ng/ul Volume finale 2 ul/campione 2 ul/campione 0,5 U/campione 1 ul/campione 19 ul/campione -Aliquotare 19 ul in provette da PCR in ghiaccio. -Aggiungere il DNA (1 ul, 2-5 ng). Se il DNA è in agarosio: sciogliere a 90, trasferire a 60, pipettare 1 ul nella miscela di reazione. Chiudere le provette. -Accendere il termociclatore e far partire il programma. Quando raggiunge 80 C, mandare in pausa, inserire i campioni, chiudere e far ripartire (questo accorgimento migliora la specificità della reazione). Condizioni di PCR Condizioni consigliate: Denaturazione iniziale: 94 o C 45 sec. 30 cicli di: Denaturazione: Annealing: Elongazione 94 o C 45 sec. Tm-2 o C 45 sec. 72 o C 45 sec. (0.2-1Kb) o 60 sec. (1-2Kb). N.B.: Le temperature di denaturazione ed elongazione possono variare in base al tipo di DNA polimerasi che si utilizza. Verificare su gel che sia stata ottenuta una banda singola e netta. PCR aspecifiche, con più bande, o con bande poco definite, sono la causa di sequenze illeggibili. Purificazione dei frammenti di PCR Per la purificazione dei campioni è opportuno l utilizzo dei seguenti materiali: colonnine Micro-Bio-Spin (Biorad, product code: ) o piastre Multiscreen (Millipore cat. MAHVN4510) e resina Sepharose CL-6B (GE Healthcare product code: ) o resina SEPHADEX G-100 (GE Healthcare, product code: ). Quantificazione del DNA Una corretta quantificazione del DNA è molto importante per poter ottenere sequenze di buona qualità. Una scarsa quantità di DNA, infatti, genera delle sequenze con picchi bassi e determina un aumento del rumore di fondo, mentre un elevata quantità di DNA produce un segnale inizialmente forte che però decresce velocemente. Le preparazioni su colonnina danno DNA di elevata qualità. Se la preparazione e calibrata per produrre piu di 10 ug, si puo procedere alla misurazione spettrofotometrica in cuvette di tipo micro (2,5 ug in 500 ul generano una OD260 di 0,1). Il rapporto OD260/OD280 deve essere circa 1,8. Rapporti molto diversi indicano la presenza di impurezze. Per le minipreparazioni e le PCR, va invece usata una quantificazione fluorimetrica, molto piu sensibile alla presenza di DNA, ma meno sensibile alla presenza di impurezze. E assai importante calibrarli ogni

2 volta con un DNA a concentrazione nota (ad esempio DNA λ) assicurandosi che la quantità del DNA da misurare sia nel range di lettura lineare dello strumento. In assenza di un fluorimetro, il DNA può essere quantizzato su gel di agarosio. Utilizzando un minigel e possibile vedere bande anche di soli 10 ng. In tal caso, occorre utilizzare un DNA a concentrazione nota come standard, e caricarne varie diluizioni (ad es. 10, 30 e 100 ng). Nei templati preparati tramite PCR, si deve avere una resa minima di 5 ng/ul di reazione. Rese inferiori danno DNA più impuro e sequenze di cattiva qualità. Analisi di frammenti (SNPs, Microsatelliti) Genechron fornisce un servizio di analisi di frammenti mediante un sistema automatizzato ad elettroforesi capillare (ABI 3130XL o 3730, Life Technologies) ed effettua l analisi dei dati tramite software (Genemapper software, Life Technologies). L utente esegue una reazione di marcatura con oligonucleotidi fluorescenti (AFLP, microsatelliti, SNP, etc.) e la invia in un volume di 15 ul. Per marcare i primers si possono utilizzare, nella stessa reazione, fino a 4 fluorocromi differenti (set G5), destinando un fluorocromo al marcatore di peso molecolare. Genechron aggiunge il marcatore a metà del volume ed esegue l elettroforesi. Suggeriamo di effettuare una serie iniziale di prove su vostri campioni diluiti serialmente, in modo da calibrare la quantità inviata rispetto alle nostre condizioni di corsa. I files Genemapper vengono inviati all utente che li visualizza tramite un software apposito. Il set di filtri disponibile ed i relativi fluorocromi rilevati è il seguente: Set G5: 6FAM, VIC, NED, PET, LIZ (per SNP a 5 colori) I marcatori di peso molecolare disponibili sono i seguenti: Genescan 500-LIZ dye Size Standard: 16 frammenti compresi fra 35 e 500 basi (consigliato per la maggior parte delle applicazioni) Genescan 1200-LIZ dye Size Standard: 68 frammenti compresi fra 20 e Oligonucleotidi Primers standard (disponibili presso Genechron) Primer Sequenza Note M13 for TGTAAAACGACGGCCAGT Primers universali fiancheggianti il polylinker dei M13 rev CAGGAAACAGCTATGACC plasmidi puc, pbluescript, pgem e fagi M13 SP6 TAGGTGACACTATAGAATAC Primers universali fiancheggianti il polylinker dei T7 GTAATACGACTCACTATAG plasmidi pbluescript e pgem T3 CAATTAACCCTCACTAAAG Questi oligonucleotidi possono essere aggiunti da Genechron alla reazione di sequenza a costo zero su richiesta dell utente. La lista potrà essere aggiornata con nuovi primers di largo uso suggeriti dagli utenti. I primer non standard (disegnati e quantizzati dall utente) devono avere Tm compresa fra 50 C e 60 C e lunghezza fra 18 e 24 bp, anche se risultati non ottimali si possono ottenere anche con Tm e lunghezze maggiori. Lo step di annealing della reazione di sequenza viene effettuato a 48 C, per cui primers con Tm inferiori a 48 C non funzionano.

3 Calcolo della Tm e della quantità di oligonucleotide Tm= 2 C per ogni A o T + 4 C per ogni G o C 1 OD260=30 ug/ml oligo 1 pmole primer = 0,32 ng x n basi Disegno dei primers Scegliere un 19-20mero avente le seguenti caratteristiche: - niente stretch con più di 5 nucleotidi identici; - contenuto in GC: 40-60%; - nessuna zona complementare (per evitare strutture secondarie); - Calcolare la Tm (vd. sopra): deve essere preferibilmente compresa fra 50 C e 60 C; - Eventualmente allungare od accorciare il primer per ottimizzare la Tm (min 18 - max 24 basi); NB: Nella nostra esperienza, i primers PCR desalt forniti dalle maggiori ditte danno ottimi risultati senza bisogno di ulteriori purificazioni. Controllo del funzionamento dei primers Prima di inviare i primers insieme ai templati, è consigliabile controllare il loro funzionamento in una reazione di PCR, accertandosi che diano un amplificazione vigorosa e soprattutto una banda singola. Invio dei campioni: I campioni vanno inviati rigorosamente in un volume di 15 ul in provette o strip da PCR da 0.2 ml. Eventuali oligonucleotidi per la reazione di sequenziamento vanno aggiunti al campione e non inviati separatamente. Nel caso di invio in micropiastra, vanno utilizzate micropiastre da PCR di poliallomero (volume del pozzetto: 0.2 ml). La micropiastra va rigorosamente sigillata mediante tappini per strip al fine di evitare possibili evaporazioni contaminazioni incrociate dei campioni. Ogni invio fuori standard (provette di formato diverso, campioni liofilizzati) comportera un addebito di 1 /campione. Quantita raccomandate Frammento di PCR 9 ng /100 bp di lunghezza Plasmidi < 7 Kb 900 ng Plasmidi 7-15Kb 1500 ng Cosmidi e BAC 2100 ng Primer 9 pmoli (1) Volume finale: 15 ul (2) (1) 1 pmole primer = 0,32 ng x n basi. Aggiungere il primer alla reazione (non inviarlo in provetta separata). Nel caso si chieda l aggiunta di un primer universale Genechron, andrà indicato il nome nel modulo di richiesta sequenziamento. (2) La concentrazione finale di Tris o altri sali deve essere inferiore a 5 mm, quella di EDTA inferiore a 0,5 mm. Una concentrazione di sali eccessiva da sequenze corte (<400 basi). Corriere convenzionato Le spedizioni possono essere effettuate utilizzando il corriere SDA, con cui il laboratorio Genechron ha stipulato una convenzione. I costi molto vantaggiosi della convenzione con SDA verranno addebitati sul conto del cliente e sono validi per spedizioni in tutta Italia.

4 Nella maggior parte delle città, telefonando entro le 11 del mattino, il corriere ritira il campione entro il pomeriggio e consegna generalmente al nostro laboratorio entro le 15 del giorno successivo (2 giorni per isole e Calabria). Le provette, chiuse in un contenitore a tenuta (es. provetta tipo Falcon da 50 ml), e le piastre vanno inviate in busta imbottita. Per il ritiro è sufficiente: -Telefonare al numero SDA Richiedere il ritiro a domicilio, specificando che si tratta di spedizione in porto assegnato. -Specificare al corriere il codice cliente della convenzione SDA - Ylichron Srl (che gestisce il laboratorio Genechron) che è o la P. IVA della Società Ylichron Srl: Ylichron Srl C.R. ENEA Casaccia Via Anguillarese, 301 P. IVA: Mettere sulla busta l indirizzo completo riportato qui sotto: Genechron C.R. ENEA Casaccia (Ed. T4 Piano Terra) - Sacco Postale 026 Via Anguillarese 301 Al momento del ricevimento, Genechron avvertirà l utente tramite . Vi preghiamo di segnalarci via eventuali disservizi. Tempi di lavorazione I campioni arrivati entro le 11 dei giorni di lavorazione vengono processati immediatamente, con invio dei risultati entro la mattinata del giorno successivo.

5 Ordini ed amministrazione Parallelamente all invio dei campioni da sequenziare va curata l emissione, da parte della propria amministrazione, di un regolare ordine. Per ordini inferiori a 100 euro verrà applicata una sovrattassa di 10 euro. Nell ordine vanno riportati i seguenti dati: Nome del Richiedente Codice Utente Tipo dei servizi richiesti (o tipo abbonamento) Importo IVA esclusa L ordine va inviato a: Ylichron Srl C.R. ENEA Casaccia Via Anguillarese, P.IVA: IBAN: IT 38 S L ordine va anticipato via mail all indirizzo : I prezzi in abbonamento vengono attivati al momento di arrivo dell ordine. Gli utenti riceveranno una conferma via dell avvenuta ricezione dell ordine, con relativo estratto conto. Gli utenti riceveranno il conto aggiornato del proprio ordine ad ogni esaurimento del credito e ad ogni ricevimento di un ordine nuovo. L invio dell estratto conto può essere richiesto via Istruzioni per il saldo delle fatture: Il pagamento deve essere effettuato mediante bonifico bancario. Le spese bancarie sono a carico del cliente e non possono essere dedotte dall'importo totale. Si prega di citare il numero della fattura nella causale del bonifico.

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Immagine di una sequenza ben riuscita. Sequences troubleshooting

Immagine di una sequenza ben riuscita. Sequences troubleshooting Immagine di una sequenza ben riuscita. Sequences troubleshooting Sequenza fallita Reazione fallita: non presenta picchi definiti e ha un alto rumore di fondo. il primer non trova sito di annealing il DNA

Dettagli

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction)

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail: orgabiohuman@fastwebnet.it

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test U.O.C. di Epatologia Clinica e Biomolecolare Lotto N. DESCRIZIONE PRODOTTO Quantità annua richiesta Unità di misura Repertorio CND Codice Prodotto, Confezione Offerta e nome commerciale Prezzo unitario

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Real Time PCR. La PCR Real Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico.

Real Time PCR. La PCR Real Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico. eal Time PC La PC eal Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico. Gli strumenti per PC eal Time, oltre a fungere da termociclatori,

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA

Dettagli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli ANALISI OGM SOYA Il progetto si proponeva di verificare le caratteristiche qualitative di diversi lotti di soya rispetto alla contaminazione accidentale da OGM per avere una valutazione indicativa della

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica

Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica Biologia molecolare clinica Organizzazione del laboratorio di biologia molecolare clinica Le tecniche di biologia molecolare negli ultimi anni si sono diffuse nei laboratori di diagnostica clinica dove

Dettagli

Analisi qualitativa con Agilent BioAnalyzer. cdna, RNA Totale e Messaggero e small RNA

Analisi qualitativa con Agilent BioAnalyzer. cdna, RNA Totale e Messaggero e small RNA Il Servizio di Biologia Molecolare si è di recente dotato di uno strumento per l analisi qualitativa e quantitativa degli acidi nucleici Agilent Bioanalyzer 2100 e ha implementato tale tecnologia nell

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

Protocollo di laboratorio per la purificazione manuale del DNA a partire da 0,5 ml di campione

Protocollo di laboratorio per la purificazione manuale del DNA a partire da 0,5 ml di campione Protocollo di laboratorio per la purificazione manuale del DNA a partire da 0,5 ml di campione Per la purificazione del DNA genomico proveniente dai kit di prelievo Oragene e ORAcollect. Per le istruzioni

Dettagli

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno).

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Programma: Giorno 1Preparazione di DNA genomico da foglie 2 - Controllo qualità DNA

Dettagli

Tecniche di sequenziamento del DNA

Tecniche di sequenziamento del DNA Tecniche di sequenziamento del DNA -Metodo di Maxam e Gilbert (della degradazione chimica del DNA) -Metodo di Sanger (a terminazione di catena) Metodo di Maxam-Gilbert Questo metodo, basato sulla degradazione

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici

Dettagli

Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

Istruzioni per l uso GenDx SBTexcellerator

Istruzioni per l uso GenDx SBTexcellerator Ottavo edizione Luglio 2011 Istruzioni per l uso GenDx SBTexcellerator Sequence-based typing (SBT) per HLA ad alta risoluzione Genome Diagnostics B.V. Telefono: +31 302 523 799 e-mail: info@gendx.com Web:

Dettagli

ELETTROFORESI SU GEL

ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Termini e condizioni contrattuali! Termini, Condizioni di vendita e Contrattuali!

Termini e condizioni contrattuali! Termini, Condizioni di vendita e Contrattuali! Termini e condizioni contrattuali Termini, Condizioni di vendita e Contrattuali Definizioni Oggetto Modalità di acquisto Conclusione del contratto Pagamento Spedizioni Garanzia per merce difettosa Diritto

Dettagli

Kit per la determinazione di contaminazioni in biologia molecolare REF 7091. 40 Reazioni

Kit per la determinazione di contaminazioni in biologia molecolare REF 7091. 40 Reazioni IT Istruzioni d uso Wipe test Controllo di contaminazione Kit per la determinazione di contaminazioni in biologia molecolare REF 7091 40 Reazioni 1. Descrizione del prodotto Per impedire le contaminazioni

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

AREA GESTIONE PATRIMONIO DETERMINAZIONE

AREA GESTIONE PATRIMONIO DETERMINAZIONE ISTITUTO TUMORI GIOVANNI PAOLO II ISTITUTO DI RICOVERO E CURA A CARATTERE SCIENTIFICO BARI AREA GESTIONE PATRIMONIO DETERMINAZIONE Raccolta Particolare Raccolta Generale delle Determinazioni dell Area

Dettagli

IVD. IVD Diagnostici in Vitro. ThromboFil

IVD. IVD Diagnostici in Vitro. ThromboFil IVD IVD Diagnostici in Vitro ThromboFil Genotipizzazione molecolare del Fattore V di Leiden, Fattore II, MTHFR C677T, MTHFR A1298C attraverso Multiplex PCR / elettroforesi capillare Codice MDS-PTF-001

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

CAPITOLATO TECNICO PER DIAGNOSTICI PER TIPIZZAZIONE MOLECOLARE DA DESTINARSI AL LABORATORIO DI GENETICA MOLECOLARE-MEDICINA LEGALE P.O.

CAPITOLATO TECNICO PER DIAGNOSTICI PER TIPIZZAZIONE MOLECOLARE DA DESTINARSI AL LABORATORIO DI GENETICA MOLECOLARE-MEDICINA LEGALE P.O. ALLEGATO A CAPITOLATO TECNICO PER DIAGNOSTICI PER TIPIZZAZIONE MOLECOLARE DA DESTINARSI AL LABORATORIO DI GENETICA MOLECOLARE-MEDICINA LEGALE P.O. MONSERRATO Durata della fornitura: 1 anno + 1 rinnovabile

Dettagli

Esperienza 2: gli enzimi di restrizione

Esperienza 2: gli enzimi di restrizione Esperienza 2: gli enzimi di restrizione Gli enzimi di restrizione sono delle proteine sintetizzate dai batteri per proteggersi dalle infezioni virali (batteriofagi). Questi enzimi tagliano il DNA virale

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

PCR Polymerase Chain Reaction = Reazione a catena della polimerasi

PCR Polymerase Chain Reaction = Reazione a catena della polimerasi PR Polymerase hain Reaction = Reazione a catena della polimerasi mplifica un frammento di D di cui si conosce almeno in parte la sequenza Utilizza un enzima, la D Polimerasi, per copiare una molecola di

Dettagli

Indice. Informazioni sulla sicurezza 2. Pulizia e smaltimento 4. Specifiche 4. Informazioni per gli ordinativi del sistema FlashGel 33

Indice. Informazioni sulla sicurezza 2. Pulizia e smaltimento 4. Specifiche 4. Informazioni per gli ordinativi del sistema FlashGel 33 Sistema FlashGel Lonza Rockland, Inc. www.lonza.com scientific.support@lonza.com Supporto scientifico: 00 32 87 321 611 Servizio clienti: 0039 0363 45710 Rockland, ME 04841 Indice Informazioni sulla sicurezza

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (www.cusmibio.unimi.it).

Dettagli

QUESITI E RISPOSTE. Aggiornato al 19/09/2013

QUESITI E RISPOSTE. Aggiornato al 19/09/2013 ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA E DELL'EMILIA ROMAGNA (ENTE SANITARIO DI DIRITTO PUBBLICO) ------------------------------------- BRESCIA Via Bianchi,/9 25124 BRESCIA Tel. 030-22901

Dettagli

METODI ALTERNATIVI. PCR digitale per la rilevazione e quantificazione. assoluta del DNA

METODI ALTERNATIVI. PCR digitale per la rilevazione e quantificazione. assoluta del DNA METODI ALTERNATIVI PCR digitale per la rilevazione e quantificazione assoluta del DNA Roma, 25 settembre 2013 Giuseppina Buonincontro IZS PLV- S.S. Controllo Alimenti La prima generazione di PCR consente

Dettagli

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA

Dettagli

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA.

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA. ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE Margherita Vinciguerra U.O. Ematologia II Laboratorio per lo Studio e la Diagnosi Molecolare Prenatale di Talassemia A.O. V. Cervello, Palermo. Analisi di sequenza

Dettagli

Istruzioni d uso HISTO TYPE SSP Kits Bassa risoluzione

Istruzioni d uso HISTO TYPE SSP Kits Bassa risoluzione Istruzioni d uso HISTO TYPE SSP Kits Bassa risoluzione 0123 Kits per la tipizzazione tissutale degli alleli HLA (Classe I: HLA-A, B, C e Classe II: HLA-DR, DQ) in biologia molecolare IVD 20 tipizzazioni

Dettagli

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING DALL ESTRAZIONE DEL DNA AL FINGERPRINTING SCOPO DELL'ATTIVITÀ Ciascuno studente estrae il proprio DNA da cellule della mucosa boccale. Quindi, mediante PCR, vengono amplificati frammenti corrispondenti

Dettagli

Purificazione degli acidi nucleici

Purificazione degli acidi nucleici A cosa serve? Purificazione degli acidi nucleici DNA genomico: per costruire librerie genomiche e/o usato nell analisi d ibridazione Southern. mrna: sintesi del cdna; analisi d ibridazione Northern, o

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica

SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica Prof. Francesco Michelotti SAPIENZA Università di Roma Facoltà di Ingegneria

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano

La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano SOC di Farmacologia Sperimentale e Clinica VI CONGRESSO NAZIONALE FITeLab Slow Medicine Laboratory: IT s the Future 1-2-3 Ottobre 2015 Ospedale Borgo Roma (Verona) La farmacogeneticanella gestione del

Dettagli

100bp DNA Ladder H3 RTU

100bp DNA Ladder H3 RTU 100bp DNA Ladder H3 RTU Elettroforesi Una combinazione unica di prodotti di PCR e una serie di plasmidi proprietarie digerito con enzimi di restrizione appropriati per produrre frammenti 12, adatto per

Dettagli

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine Università degli Studi del Piemonte Orientale A. Avogadro CORSO DI ALTA FORMAZIONE IN LEGISLAZIONE ALIMENTARE Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

Sfrutta subito i Vantaggi! Validità 1 Aprile 30 Giugno 2005. Scopri la qualità e il risparmio!

Sfrutta subito i Vantaggi! Validità 1 Aprile 30 Giugno 2005. Scopri la qualità e il risparmio! www.eppendorf.com/advantage/32 Get Eppendorf quality today! Validità 1 Aprile 30 Giugno 2005 Sfrutta subito i Vantaggi! Scopri la qualità e il risparmio! www.eppendorf.com/advantage/32 Get Eppendorf quality

Dettagli

Istruzioni per prelievo nei cani

Istruzioni per prelievo nei cani Pag. 1 di 5 IST RUZIONI AN ALIS I CAN I Istruzioni per prelievo nei cani PER LE ANALISI O IL DEPOSITO DEL DNA NEL CANE E' OBBLIGATORIO EFFETTUARE L'INSERIMENTO DEI DATI TRAMITE IL MODULO ON LINE E STAMPARNE

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

COME ORDINARE UN PRODOTTO: Inviare un FAX al numero (+39) 091 8991350. Nell' ORDINE dovranno essere riportati i seguenti dati:

COME ORDINARE UN PRODOTTO: Inviare un FAX al numero (+39) 091 8991350. Nell' ORDINE dovranno essere riportati i seguenti dati: COME ORDINARE UN PRODOTTO: Inviare un FAX al numero (+39) 091 8991350 Nell' ORDINE dovranno essere riportati i seguenti dati: Oggetto: ORDINE Codice o descrizione del prodotto che si intende acquistare

Dettagli

ESTRAZIONE ACIDI NUCLEICI CON PARTICOLARE RIFERIMENTO A DNA ESTRATTO DA TESSUTI FISSATI IN FORMALINA E INCLUSI IN PARAFFINA (FFPE)

ESTRAZIONE ACIDI NUCLEICI CON PARTICOLARE RIFERIMENTO A DNA ESTRATTO DA TESSUTI FISSATI IN FORMALINA E INCLUSI IN PARAFFINA (FFPE) ESTRAZIONE ACIDI NUCLEICI CON PARTICOLARE RIFERIMENTO A DNA ESTRATTO DA TESSUTI FISSATI IN FORMALINA E INCLUSI IN PARAFFINA (FFPE) SALVATORE GIRLANDO LABORATORIO PATOLOGIA MOLECOLARE ANATOMIA PATOLOGICA

Dettagli

HISTO SPOT On-Call Typing Kit

HISTO SPOT On-Call Typing Kit Istruzioni per l uso HISTO SPOT On-Call Typing Kit REF 726070 Kit per test di tipizzazione tissutale HLA in biologia molecolare 10 test per HLA-A, B, C, DRB1, DRB3/4/5, DQ, DPB1 IVD 0123 Versione: 03/2014

Dettagli

1.3 Con l espressione Press Up S.r.l. si intendono il soggetto indicato in epigrafe ovvero il soggetto prestatore dei servizi di informazione.

1.3 Con l espressione Press Up S.r.l. si intendono il soggetto indicato in epigrafe ovvero il soggetto prestatore dei servizi di informazione. CONDIZIONI GENERALI DI CONTRATTO 1. Identificazione della Press Up S.r.l. I servizi oggetto delle presenti condizioni generali sono offerti dalla Press Up s.r.l. con sede in Roma, Via Catone, 6 iscritta

Dettagli

AGM di Luca Taormina Ditta Individuale. Carta di qualità

AGM di Luca Taormina Ditta Individuale. Carta di qualità AGM di Luca Taormina Ditta Individuale Carta di qualità Servizi a valore aggiunto offerti al pubblico: Posta prioritaria tracciata con ora e data di consegna certa Pick-up (prelievo presso la sede del

Dettagli

DETERMINAZIONE N 246 DEL 19/05/2015

DETERMINAZIONE N 246 DEL 19/05/2015 AZIENDA OSPEDALIERO-UNIVERSITARIA DI SASSARI Via Michele Coppino, 26-07100 SASSARI C.F. - P. IVA 02268260904 DETERMINAZIONE N 246 DEL 19/05/2015 Oggetto: Fornitura annuale di materiale diagnostico vario

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

BLIGHIOSTALI E' E SENZA OBBLIGHI

BLIGHIOSTALI E' E SENZA OBBLIGHI BLIGHIOSTALI E' E SENZA OBBLIGHI Nel 2015 4.121 Studi di amministrazione condominiale hanno usato il nostro servizio postale. Nel 2015 67 aziende e 3 associazioni di categoria hanno spedito la loro corrispondenza

Dettagli

Regolamento Del Negozio Internet Di Up Logistic Srl Prezzi

Regolamento Del Negozio Internet Di Up Logistic Srl Prezzi Termini e Condizioni La vendita relativa ad un negozio internet, si definisce in base al Regolamento del negozio internet stesso. Il cliente è tenuto ad informarsi riguardo al Regolamento, prima di effettuare

Dettagli

Istruzioni per prelievo nei gatti

Istruzioni per prelievo nei gatti Pag. 1 di 5 IST RUZIONI AN ALIS I GATTI Istruzioni per prelievo nei gatti Prelievo di sangue: 0,3-0,5 ml di sangue in provette contenenti EDTA. Oppure prelievo buccale, da effettuarsi con: Spazzolino Cytobrush

Dettagli

ALLEGATO 1 SERVIZIO DI MOVIMENTAZIONE MERCI RITIRO - MAGAZZINO - SPEDIZIONE. Investment and Trading Forum, 23-24 maggio 2013 Palacongressi di Rimini

ALLEGATO 1 SERVIZIO DI MOVIMENTAZIONE MERCI RITIRO - MAGAZZINO - SPEDIZIONE. Investment and Trading Forum, 23-24 maggio 2013 Palacongressi di Rimini ALLEGATO 1 SERVIZIO DI MOVIMENTAZIONE MERCI RITIRO - MAGAZZINO - SPEDIZIONE Investment and Trading Forum, 23-24 maggio 2013 Palacongressi di Rimini INFORMAZIONI GENERALI Palaservip/Mail-Boxes é il fornitore

Dettagli

Analisi mutazionale di K-RAS metodiche a confronto

Analisi mutazionale di K-RAS metodiche a confronto Analisi mutazionale di K-RAS metodiche a confronto Aula Magna Villa Sironi Gallarate 16 ottobre Dott. Carmelo Lupo Coordinatore Tecnico Anatomia Patologica e Patologia Molecolare Oncologica PERCHÉ K-RAS

Dettagli

13. Life Sciences Sommario

13. Life Sciences Sommario GENERAL CATALOGUE EDITION 8. Life Sciences Sommario Genomica 6 PCR 6 DNA-Elettroforesi 9 Gel-Documentation Filtrazione, Concentrazione 8 Proteomica ELISA Proteine-Elettroforesi 60 Blotting 6 Purificazione

Dettagli

Test per il rilevamento o la quantificazione tramite PCR in real-time di Legionella spp. e Legionella pneumophila nei campioni di acqua

Test per il rilevamento o la quantificazione tramite PCR in real-time di Legionella spp. e Legionella pneumophila nei campioni di acqua iq-check Screen Legionella spp. Kit Codice #: 357-8104 iq-check Quanti Legionella spp. Kit Codice #: 357-8102 iq-check Screen L. pneumophila Kit Codice #: 357-8105 iq-check Quanti L. pneumophila Kit Codice

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

GenoType MTBC VER 1.X. Deutsch: S. 2-14 English: p. 15-26 Français : p. 27-39 Italiano: p. 40-52 Español: p. 53-65 Português: p. 66-78 Česky: s.

GenoType MTBC VER 1.X. Deutsch: S. 2-14 English: p. 15-26 Français : p. 27-39 Italiano: p. 40-52 Español: p. 53-65 Português: p. 66-78 Česky: s. GenoType MTBC VER 1.X Deutsch: S. 2-14 English: p. 15-26 Français : p. 27-39 Italiano: p. 40-52 Español: p. 53-65 Português: p. 66-78 Česky: s. 79-91 04/2006 GenoType MTBC Test genetico molecolare per

Dettagli