ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI"

Transcript

1

2 ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI

3 La Fecondazione Processo con cui due cellule sessuali (gameti) si uniscono per formare un nuovo individuo cha ha un genoma derivato da entrambi i genitori.

4 Non tutte le cellule uovo vengono fertilizzate allo stadio di MII

5 Eventi principali 0 Contatto e riconoscimento tra spermatozoo e oocita 0 Blocco della Polispermia 0 Singamia 0 Attivazione del metabolismo della cellula uovo

6 Tipi di Fecondazione Esterna Interna Es. Pesci, Anfibi Es. Mammiferi, Uccelli

7 Fecondazione esterna nel riccio di mare I gameti vengono rilasciati nell ambiente esterno L oocita maturo secerne sostanze chemiotattiche che «richiamano» gli spermatozoi Resact Piccolo peptide secreto da oociti di riccio di mare che agisce da peptide attivatore degli spermatozoi

8 Tardivi da 1 a 95 minuti Precoci entro 1 minuto Eventi della fecondazione nel riccio di mare 0 Legame spz-oocita 0 Blocco rapido della polispermia 0 Fusione membrane spz oocita 0 Aumento del Calcio 0 Esocitosi Granuli corticali 0 Attivazione dalla NAD chinasi 0 Aumento NADP+ e NADPH e del consumo di O2 0 Ingresso spz 0 Fuoriuscita H+ 0 Aumento del ph 0 Decondensazione della cromatina dello spz e migrazione del pronucleo maschile verso il centro dell uovo 0 Attivazione sintesi proteica e trasporto aminoacidi 0 Inizio sintesi di DNA 0 Mitosi e prima divisione cellulare

9 Eventi della fecondazione nel riccio di mare Il riconoscimento spz-oocita è mediato da una proteina-specie specifica presente nell acrosoma: la bindina Dopo la reazione acrosomiale e attraversamento del gelly si ha la fusione delle membrane cellulari oocita-spz con la formazione de cono di fecondazione Dopo l ingresso del primo spz si ha il bocco della polispermia (variazione potenziale di membrana e reazione granuli corticali)

10 Eventi della fecondazione nel riccio di mare Fusione Spz/oocita Attivazione del metabolismo dell oocita - Rappresentazione schematica

11 Eventi della fecondazione nel riccio di mare Fusione del materiale genetico Lo spermatozoo penetra nell oocita aploide, dopo la seconda divisione meiotica Il nucleo dello spz perde l involucro esponendo la cromatina compatta che viene decondensata e riorganizzata Migrazione pronucleo maschile verso il centro dell oocita Singamia formazione del nucleo diploide dello zigote

12 Fecondazione interna nei mammiferi

13 Fecondazione interna nei mammiferi La fecondazione avviene all interno dell apparato genitale femminile Il riconoscimento e l interazione oocita-spz è mediata da diverse proteine (ZP3, Izumo, Juno ) Quando lo spz interagisce con la zona pellucida si ha la reazione acrosomiale Lo spz attraversa la ZP e si va ha poi la fusione delle membrane cellulari L ingresso dello spz determina l attivazione dell oocita

14 Fecondazione interna nei mammiferi Fusione del materiale genetico Lo spermatozoo penetra nell oocita fermo in fase MII ed il suo nucleo viene decondensato e riorganizzato (sostituzione protammine con istoni) L attivazione dell oocita determina la ripresa del ciclo meiotico, così da avere un pronucleo femminile aploide Non si ha una vera e propria singamia, I due pronuclei vanno incontro a duplicazione del DNA separatamente, i due pronuclei si avvicinano, perdono l involucro nucleare e la cromatina di condensa in cromosomi che si orientano su un fuso mitotico. Si ha poi la prima divisione mitotica con formazione di due blastomeri con nucleo diploide biparentale

15 La Segmentazione Serie di divisioni mitotiche mediante le quali l enorme quantità del citoplasma della cellula uova viene suddiviso in cellule più piccole (blastomeri)

16 Durante le prime divisioni cellulari manca la fase G Fase S Fase M Il ciclo cellulare è regolato dal fattore promotore della mitosi (MPF) MPF : ingresso in mitosi MPF : ingresso in fase S Fase M

17 Caratteristiche delle Segmentazione 0 Ciclo cellulare rapido costituito solo a fase S e fase M, manca la fase G. 0 Il tipo di segmentazione è influenzato dalla composizione dell uovo (quantità di tuorlo) 0 Il destino delle cellule è influenzata dall interazione con le altre cellule e/o dalla distribuzione non uniforme di fattori di trascrizione (polarità embrionale)

18 Tipi di segmentazione Tuorlo assente o poco Tuorlo grandi quantità

19 Segmentazione Oloblastica

20 Segmentazione Meroblastica

21 Tipi di Blastula Celoblastula con blastocele centrale Anfiosso Blastocisti - Mammiferi Celoblastula con blastocele eccentrico Anfibi Discoblastula Rettili, Uccelli

22 La Gastrulazione Fase dello sviluppo, successiva alla segmentazione, costituita da una serie di MOVIMENTI MORFOGENETICI che porta alla formazione dei tre foglietti embrionali (ectoderma, mesoderma, endoderma)

23 Meccanismi primari della Gastrulazione 0 Epibolia 0 Delaminazione 0 Movimenti di cellule dalla superficie all interno Invaginazione Involuzione Ingressione o immigrazione

24 Meccanismi primari della Gastrulazione Epibolia Espansione di cellule di superficie in modo da ricoprire quelle più interne Delaminazione Divisione di uno strato di cellule in due strati/lamine parallele

25 Meccanismi primari della Gastrulazione Movimenti di cellule dalla superficie all interno Invaginazione Involuzione Ingressione Ripiegamento di una porzione di blastoderma verso l interno Ripiegamento o scorrimento di cellule in modo da accollarsi alla superficie interna Migrazione di cellule da foglietti esterni verso l interno dell embrione

26

27 Specificazione delle cellule e determinazione degli assi Assi fondamentali dell organizzazione del corpo 1. Asse anteroposteriore (cefalocaudale) 2. Asse dorsoventrale 3. Asse destra-sinistra

28 Specificazione cellulare Autonoma (invertebrati) Condizionata (vertebrati, alcuni invertebrati) Sinciziale (insetti)

29 Specificazione Autonoma Un blastomero isolato produce gli stessi tipi cellulari che avrebbe prodotto se lasciato nella sua posizione originaria nell embrione. Sviluppo a Mosaico, in quanto l embrione è costituito da parti indipendenti.

30 Specificazione Condizionata Un blastomero ha la capacità di svilupparsi in svariati tipi cellulari. Le possibilità del blastomero vengono limitate dalle cellule circostanti, quindi sono dipendenti dall ambiente in cui il blastomero viene a trovarsi. Sviluppo regolativo La rimozione di alcune cellule a stadi precoci di sviluppo viene compensata (regolazione) dalle cellule circostanti che alterano il proprio destino allo scopo di sostituire le cellule rimosse.

31 L embrione di armadillo dalla nove fasce si divide in 4 gruppi di cellule, ognuno dei quali darà origine ad un individuo

32 Specificazione Sinciziale Tipica degli insetti Presenza di gradienti morfogenetici nel citoplasma della cellula uovo Il destino di ogni cellula è influenzato dalla concentrazione di specifici fattori (Bicoid e Nanos) Drosophila Melanogaster

33

34

Modelli embrionali PESCI UCCELLI

Modelli embrionali PESCI UCCELLI Modelli embrionali PESCI UCCELLI Pesci Sviluppo di Zebrafish Primi Stadi di Sviluppo di Zebrafish Segmentazione in Zebrafish Uovo Telolecitico Segmentazione Meroblastica Discoidale Fertilizzazione Aumento

Dettagli

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi Vie genitali maschili e ghiandole accessorie FECONDAZIONE

Dettagli

Gastrulazione. Movimento di cellule che passano dalla superficie verso l interno. Strato esterno. ectoderma. Struttura bistratificata

Gastrulazione. Movimento di cellule che passano dalla superficie verso l interno. Strato esterno. ectoderma. Struttura bistratificata Gastrulazione Movimento di cellule che passano dalla superficie verso l interno Struttura bistratificata Strato esterno ectoderma Strato interno entoderma mesoderma I territori presuntivi raggiungono la

Dettagli

La fecondazione. www.fisiokinesiterapia.biz

La fecondazione. www.fisiokinesiterapia.biz La fecondazione www.fisiokinesiterapia.biz Siti utili http://arbl.cvmbs.colostate.edu/hbooks/pathphys/reprod/fert/index.html http://worms.zoology.wisc.edu/frogs/fert/fert_intro.html http://www.centrogenesis.it/attlante_index.htm

Dettagli

La riproduzione e lo sviluppo

La riproduzione e lo sviluppo La riproduzione e lo sviluppo La riproduzione umana In biologia si definisce riproduzione il processo attraverso il quale vengono generati nuovi individui della stessa specie. La riproduzione umana è caratterizzata

Dettagli

Lo sviluppo embrionale.

Lo sviluppo embrionale. Lo sviluppo embrionale. La riproduzione umana In biologia si definisce riproduzione il processo attraverso il quale vengono generati nuovi individui della stessa specie. La riproduzione umana è caratterizzata

Dettagli

Visione della superficie dorsale

Visione della superficie dorsale mappe gastrulazione presuntive Tracciare linee di discendenza cellulare. Mappare la struttura larvale o adulta sulla regione dell embrione dalla quale tale struttura deriverà. Visione della superficie

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

SVILUPPO DEGLI ANFIBI

SVILUPPO DEGLI ANFIBI SVILUPPO DEGLI ANFIBI SVILUPPO DEGLI ANFIBI UTILITA DEL MODELLO Vertebrati tetrapodi Facile allevamento Sviluppo esterno e pianificabile Uova relativamente grandi (circa 1 mm) Sviluppo rapido (circa 18h

Dettagli

RIPRODUZIONE SESSUATA E FECONDAZIONE

RIPRODUZIONE SESSUATA E FECONDAZIONE RIPRODUZIONE SESSUATA E FECONDAZIONE RIPRODUZIONE SESSUATA Gametogenesi Spermatogenesi Oogenesi Fecondazione Fusione delle membrane dei gameti Fusione dei nuclei FUNZIONI DELLA FECONDAZIONE Sessualità

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi Unicità chimica Possesso di un programma genetico Riproduzione Sviluppo Complessità ed organizzazione gerarchica Metabolismo Interazione ambientale Lo sviluppo

Dettagli

L ORIGINE DEI TESSUTI

L ORIGINE DEI TESSUTI L ORIGINE DEI TESSUTI Tutte le cellule dell organismo derivano dallo zigote Embrioni di topo a diversi stadi di sviluppo: A, stadio a 2 pronuclei; E, stadio a circa 16 cellule B, stadio a 2 blastomeri;

Dettagli

SVILUPPO EMBRIONALE (PARTE PRIMA)

SVILUPPO EMBRIONALE (PARTE PRIMA) SVILUPPO EMBRIONALE (PARTE PRIMA) Lo sviluppo embrionale è il processo che, per successive mitosi porta dallo zigote all'individuo completo. Lo sviluppo embrionale comprende in realtà vari aspetti, che

Dettagli

RIPRODUZIONE. Sessuata. Asessuata

RIPRODUZIONE. Sessuata. Asessuata RIPRODUZIONE Asessuata Può avvenire per: Gemmazione Scissione Frammentazione Comporta un periodo di accrescimento che si realizza per divisioni mitotiche successive Offre il vantaggio di un rapido aumento

Dettagli

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula

Dettagli

Lo sviluppo embrionale

Lo sviluppo embrionale Lo sviluppo embrionale Se diverse sono le modalità con cui gli animali possono venire al mondo, tutti hanno in comune il fatto di essersi sviluppati da un unica cellula, lo zigote. Perché questo processo

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

Embryology. Early development from a phenomenological point of view. Bolk s Companions for the study of medicine www.louisbolk.org

Embryology. Early development from a phenomenological point of view. Bolk s Companions for the study of medicine www.louisbolk.org Tratto da: Guus van der Bie, M.D. Embryology. Early development from a phenomenological point of view Bolk s Companions for the study of medicine www.louisbolk.org Traduzione a cura di: Stefano Cecchi

Dettagli

RIPRODUZIONE. Può avvenire per: Gemmazione Scissione Frammentazione

RIPRODUZIONE. Può avvenire per: Gemmazione Scissione Frammentazione RIPRODUZIONE Può avvenire per: Gemmazione Scissione Frammentazione Asessuata Comporta un periodo di accrescimento che si realizza per divisioni mitotiche successive Offre il vantaggio di un rapido aumento

Dettagli

RIPRODUZIONE. Sessuata. Asessuata

RIPRODUZIONE. Sessuata. Asessuata RIPRODUZIONE Asessuata Può avvenire per: Gemmazione Scissione Frammentazione Comporta un periodo di accrescimento che si realizza per divisioni mitotiche successive Offre il vantaggio di un rapido aumento

Dettagli

IL CICLO CELLULARE. Il ciclo cellulare è formato da due fasi: interfase e divisione cellulare

IL CICLO CELLULARE. Il ciclo cellulare è formato da due fasi: interfase e divisione cellulare IL CICLO CELLULARE Nella vita della cellula si assiste a un aumento di volume del citoplasma, nella maggior parte dei casi seguito dalla replicazione del DNA e dalla divisione cellulare. Quest ultima permette

Dettagli

RIPRODUZIONE E SVILUPPO EMBRIONALE

RIPRODUZIONE E SVILUPPO EMBRIONALE RIPRODUZIONE E SVILUPPO EMBRIONALE Il ponte di collegamento tra i genitori ed i figli, loro diretti discendenti, è molto stretto e consiste in una cellula uovo fecondata (lo zigote) che porta i materiali

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

SVILUPPO FASI GENERALI DI SVILUPPO

SVILUPPO FASI GENERALI DI SVILUPPO SVILUPPO FASI GENERALI DI SVILUPPO Sviluppo di Xenopus laevis Gametogenesi Formazione di spermatozoi e uova Fecondazione Unione dei gameti Segmentazione Serie di divisioni mitotiche rapide Gastrulazione

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

LE TAPPE DELLO SVILUPPO

LE TAPPE DELLO SVILUPPO LE TAPPE DELLO SVILUPPO ONTOGENESI: insieme dei fenomeni attraverso i quali dall uovo fecondato si origina un adulto capace di riprodursi. EMBRIOGENESI: 3 FASI (segmentazione, gastrulazione, organogenesi)

Dettagli

1 Parte: Identità e Statuto dell embrione Umano - A.Giuli - Seminario Russia - 10/2014 1 PARTE: IDENTITÀ E STATUTO DELL EMBRIONE UMANO

1 Parte: Identità e Statuto dell embrione Umano - A.Giuli - Seminario Russia - 10/2014 1 PARTE: IDENTITÀ E STATUTO DELL EMBRIONE UMANO Introduzione 1 PARTE: IDENTITÀ E STATUTO DELL EMBRIONE UMANO Il progresso biotecnologico e la terza cultura In ambito scientifico gli ultimi decenni hanno visto lo straordinario progresso nel campo della

Dettagli

FECONDAZIONE E IMPIANTO

FECONDAZIONE E IMPIANTO FECONDAZIONE E IMPIANTO La fecondazione rappresenta l insieme dei La fecondazione rappresenta l insieme dei fenomeni attinenti al riconoscimento e all unione dei due gameti e all ottenimento dell embrione

Dettagli

fasi che precedono la fecondazione: nelle vie genitali maschili

fasi che precedono la fecondazione: nelle vie genitali maschili fecondazione ØÈ il processo biologico mediante il quale lo spermatozoo e l oocito interagiscono per dare luogo alla riproduzione sessuale ØInizia quando gli spermatozoi vengono deposti nelle vie genitali

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

SVILUPPO FASI GENERALI DI SVILUPPO

SVILUPPO FASI GENERALI DI SVILUPPO SVILUPPO FASI GENERALI DI SVILUPPO Sviluppo di Xenopus laevis Gametogenesi Formazione di spermatozoi e uova Fecondazione Unione dei gameti Segmentazione Serie di divisioni mitotiche rapide Gastrulazione

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Le cellule del corpo non vivono isolate ma si organizzano a formare tessuti

Le cellule del corpo non vivono isolate ma si organizzano a formare tessuti Le cellule del corpo non vivono isolate ma si organizzano a formare tessuti I tessuti studio dei tessuti: è compito dell I STOLOGIA (dal greco istos, tela e logos, discorso). I tessuti UN TESSUTO: è formato

Dettagli

1. Capacità di autorinnovamento illimitato

1. Capacità di autorinnovamento illimitato 1. Capacità di autorinnovamento illimitato 2. Capacità di dare origine in risposta a stimoli adeguati e specifici a cellule progenitrici di transito dalle quali discendono popolazioni di cellule altamente

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

La riproduzione èl unicomezzochehaunorganismoperassicurarela sopravvivenza della sua specie sullaterra.

La riproduzione èl unicomezzochehaunorganismoperassicurarela sopravvivenza della sua specie sullaterra. La riproduzione èl unicomezzochehaunorganismoperassicurarela sopravvivenza della sua specie sullaterra. Se l organismo per qualche causa non può più riprodursi o diminuisce la messa al mondo di nuovi esseri

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi LA Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi Trasporto nelle vie spermatiche Le vie spermatiche sono i canali

Dettagli

WWW.FISIOKINESITERAPIA.BIZ

WWW.FISIOKINESITERAPIA.BIZ La biologia dello sviluppo La maggior parte della Biologia studia la struttura e il funzionamento dell organismo adulto. La Biologia dello sviluppo studia gli stadi transitori che conducono all organismo

Dettagli

APPARATO GENITALE INSIEME DI ORGANI DEPUTATI ALLA : FORMAZIONE DEI GAMETI FECONDAZIONE SVILUPPO DELL EMBRIONE E DEL FETO

APPARATO GENITALE INSIEME DI ORGANI DEPUTATI ALLA : FORMAZIONE DEI GAMETI FECONDAZIONE SVILUPPO DELL EMBRIONE E DEL FETO APPARATO GENITALE INSIEME DI ORGANI DEPUTATI ALLA : FORMAZIONE DEI GAMETI FECONDAZIONE SVILUPPO DELL EMBRIONE E DEL FETO APPARATO RIPRODUTTORE MASCHILE GONADI VIE SPERMATICHE convogliano i gameti all uretra

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

BIOLOGIA DELLO SVILUPPO

BIOLOGIA DELLO SVILUPPO BIOLOGIA DELLO SVILUPPO La biologia dello sviluppo un giorno rappresenterà la base comune di tutte le discipline e, in continua simbiosi con queste, giocherà un ruolo di primo piano nella soluzione dei

Dettagli

unità C11. La riproduzione

unità C11. La riproduzione Gli animali a fecondazione interna si suddividono in base al tipo di sviluppo dell embrione ovipari ovovivipari vivipari lo sviluppo avviene all esterno del corpo della madre lo sviluppo avviene all interno

Dettagli

Riproduzione asessuale. Non prevede ricombinazione genica Da un individuo progenitore derivano individui geneticamente identici

Riproduzione asessuale. Non prevede ricombinazione genica Da un individuo progenitore derivano individui geneticamente identici Riproduzione Riproduzione asessuale Non prevede ricombinazione genica Da un individuo progenitore derivano individui geneticamente identici La riproduzione asessuale è fortemente correlata alla capacità

Dettagli

Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro

Dettagli

Indice. Parte prima PRINCIPI DI BIOLOGIA DELLO SVILUPPO. Prefazione alla settima edizione americana

Indice. Parte prima PRINCIPI DI BIOLOGIA DELLO SVILUPPO. Prefazione alla settima edizione americana Indice XI Prefazione alla settima edizione americana I diblastici, 42 Protostomi e deuterostomi, 42 PRINCIPI DELLO SVILUPPO: CICLI VITALI E MODELLI DI SVILUPPO, 45 Parte prima PRINCIPI DI BIOLOGIA DELLO

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

Fecondazione. Fecondazione. Fecondazione 13/11/16%

Fecondazione. Fecondazione. Fecondazione 13/11/16% Fecondazione Fecondazione E il processo attraverso il quale uno spermatozoo ed un ovocita si fondono per formare una singola cellula, lo zigote Fecondazione Esterna: rilascio di uova e spermatozoi nell

Dettagli

aumento intracellulare del calcio esocitosi dei granuli corticali modificazione della ZP e blocco alla polispermia

aumento intracellulare del calcio esocitosi dei granuli corticali modificazione della ZP e blocco alla polispermia Il controllo della fertilizzazione e la qualità embrionaria FECONDAZIONE processo che porta alla fusione del patrimonio genetico materno e di quello paterno con la formazione di un nuovo individuo La normale

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Biologia dello Sviluppo

Biologia dello Sviluppo Biologia dello Sviluppo Anatomia Genetica Fisiologia Biochimica Biologia molecolare Ecologia Biologia evoluzionistica Medicina La biologia dello sviluppo un giorno rappresenterà la base comune di tutte

Dettagli

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni Perché ci troviamo oggi a parlare delle cellule staminali? Driesch (fine 800) dimostra la totipotenza dei blastomeri dell embrione embrione

Dettagli

ERRI DE LUCA - VALORE

ERRI DE LUCA - VALORE ERRI DE LUCA - VALORE Considero valore ogni forma di vita, la neve, la fragola, la mosca. Considero valore il regno minerale, l'assemblea delle stelle. Considero valore il vino finché dura il pasto, un

Dettagli

Introduzione alla Biologia dello Sviluppo. Principi generali dello sviluppo embrionale (I. Albanese, G. Augusti-Tocco, C. Campanella) 1 1.

Introduzione alla Biologia dello Sviluppo. Principi generali dello sviluppo embrionale (I. Albanese, G. Augusti-Tocco, C. Campanella) 1 1. Introduzione alla Biologia dello Sviluppo. Principi generali dello sviluppo embrionale (I. Albanese, G. Augusti-Tocco, C. Campanella) 1 1. Sviluppo embrionale 2 Tipi di uova e sviluppo embrionale in rapporto

Dettagli

Cellule, tessuti, organi ed apparati

Cellule, tessuti, organi ed apparati LE CELLULE UMANE Il corpo umano contiene circa 100 000 miliardi di cellule che si uniscono a formare i tessuti e più tessuti formano organi come i muscoli, il cervello, il fegato, ecc. EMBRIOLOGIA-UNIPG

Dettagli

UCCELLI IL POLLO COME MODELLO

UCCELLI IL POLLO COME MODELLO IL POLLO COME MODELLO Vertebrati amnioti Facile allevamento e deposizione regolare delle uova Grandi dimensioni degli embrioni Sviluppo diretto e relativamente rapido Possibilità di manipolazione chirurgica

Dettagli

UCCELLI IL IL POLLO COME MODELLO

UCCELLI IL IL POLLO COME MODELLO IL IL POLLO COME MODELLO Vertebrati amnioti Facile allevamento e deposizione regolare delle uova Grandi dimensioni degli embrioni Sviluppo diretto e relativamente rapido Possibilità di manipolazione chirurgica

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

BIOLOGIA DELLO SVILUPPO

BIOLOGIA DELLO SVILUPPO BIOLOGIA DELLO SVILUPPO INTRODUZIONE: SVILUPPO - processi da un uovo fecondato embrione organismo - si studia per la comprensione dei meccanismi cellulari e molecolari e manipolazione - unica via per andare

Dettagli

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015 1) I batteri sono organismi: a- bicellulari b- monocellulari c- pluricellulari 2) I virus: a- possono riprodursi solo nell acqua b- possono riprodursi solo sulla superficie di una cellula c- possono riprodursi

Dettagli

LA PRIMA SETTIMANA. La segmentazione

LA PRIMA SETTIMANA. La segmentazione LA PRIMA SETTIMANA La segmentazione Embrioni di topo a diversi stadi di sviluppo. LA PRIMA globulo polare SETTIMANA A, uovo fecondato; B, C e D, stadi a 2, 4 e 8 blastomeri. LA PRIMA SETTIMANA 24-30 ore

Dettagli

Trasmissione della informazione: livello cellulare

Trasmissione della informazione: livello cellulare Trasmissione della informazione: livello cellulare Prof.ssa Flavia Frabetti aa.2010-11 ACCRESCIMENTO E DIVISIONE DIVISIONE CELLULARE CRESCITA CELLULARE E DUPLICAZIONE DEI CROMOSOMI SEGREGAZIONE DEI CROMOSOMI

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

Malattie genetiche umane

Malattie genetiche umane Malattie genetiche umane Provocate da geni localizzati su cromosomi sessuali Emofilia e Daltonismo Provocate da geni localizzati su autosomi Acondroplasia, Fenilchetonuria, Albinismo, Galattosemia Provocate

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

LA PRIMA SETTIMANA. La segmentazione

LA PRIMA SETTIMANA. La segmentazione LA PRIMA SETTIMANA La segmentazione LA PRIMA SETTIMANA 24-30 ore 2 giorni 3 giorni I primi stadi di sviluppo embrionali globulo polare Embrioni di topo a diversi stadi di sviluppo. LA PRIMA SETTIMANA A,

Dettagli

Glossario essenziale a cura di Salvino Leone

Glossario essenziale a cura di Salvino Leone Glossario essenziale a cura di Salvino Leone I molti termini tecnici usati dagli addetti ai lavori in materia di procreazione assistita non sono usuali. Ne proponiamo un elenco che pur non essendo completo

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

DAL PICK UP TRANSFER. Lab. Biologia della Riproduzione - Potenza

DAL PICK UP TRANSFER. Lab. Biologia della Riproduzione - Potenza DAL PICK UP ALL EMBRYO TRANSFER Lab. Biologia della Riproduzione - Potenza Fisiologia del gamete maschile Lo spermatozoo è costituito da tre parti principali: a) La testa: sede del patrimonio genetico;

Dettagli

Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

I MAMMIFERI Sottoclasse dei Prototeri o Monotremi Sottoclasse dei Metateri o Marsupiali Sottoclasse degli Euteri o Placentati

I MAMMIFERI Sottoclasse dei Prototeri o Monotremi Sottoclasse dei Metateri o Marsupiali Sottoclasse degli Euteri o Placentati I MAMMIFERI Sottoclasse dei Prototeri o Monotremi: le uova si sviluppano al di fuori del corpo materno o all interno ma senza nutrimento fornito dalla madre; Sottoclasse dei Metateri o Marsupiali: embrioni

Dettagli

FONDAMENTI DI BIOLOGIA DELLO SVILUPPO

FONDAMENTI DI BIOLOGIA DELLO SVILUPPO FONDAMENTI DI BIOLOGIA DELLO SVILUPPO Grazyna Ptak, PhD, DSc Dipartimento di Scienze Biomediche Comparate Università degli Studi di Teramo Il ciclo della vita: gli stadi dello sviluppo animale 1. specificazione

Dettagli

Che cos è una cellula staminale?

Che cos è una cellula staminale? Che cos è una cellula staminale? Una cellula che ha la capacita di rigenerarsi - self renewal (dare origine ad altre cellule staminali) dare origine a cellule specializzate Una cellula staminale è una

Dettagli

Le varie modalita di segmentazione. BioSvi FC

Le varie modalita di segmentazione. BioSvi FC Le varie modalita di segmentazione FC16.2 La riorganizzazione del citoplasma nell oocita fecondato FC9.17 Estensione dei microtubuli lungo l asse dorso-ventrale FC9.18 Riarrangiamenti citoplasmatici negli

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

ISTITUTO D ISTRUZIONE SUPERIORE ISTITUTO TECNICO ECONOMICO STATALE. Roberto Valturio RELAZIONE FINALE E PROGRAMMA SVOLTO. a.s.

ISTITUTO D ISTRUZIONE SUPERIORE ISTITUTO TECNICO ECONOMICO STATALE. Roberto Valturio RELAZIONE FINALE E PROGRAMMA SVOLTO. a.s. ISTITUTO D ISTRUZIONE SUPERIORE ISTITUTO TECNICO ECONOMICO STATALE Roberto Valturio RELAZIONE FINALE E PROGRAMMA SVOLTO a.s. 2O13-2014 Materia : Chimica e Biologia Classe : II sez. B Rimini,05/06/2014

Dettagli

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice

Dettagli

Sistematica e filogenesi dei Vertebrati

Sistematica e filogenesi dei Vertebrati Sistematica e filogenesi dei Vertebrati Lezione 8: Sviluppo dei vertebrati dott. Andrea Brusaferro Scuola di Scienze Ambientali Unità di Ricerca in Ecologia Animale Università di Camerino - UNICAM 0737/403226

Dettagli

Differenziamento Cellule Staminali

Differenziamento Cellule Staminali Differenziamento Cellule Staminali Differenziamento Tutte le cellule hanno funzioni di base Respirazione, crescita, divisione, sintesi La maggior parte ha inoltre delle capacità particolari 200 differenti

Dettagli

Cellule staminali: evoluzione e rivoluzione della medicina moderna

Cellule staminali: evoluzione e rivoluzione della medicina moderna Cellule staminali: evoluzione e rivoluzione della medicina moderna Le cellule staminali (SC), embrionali (ES) e somatiche o adulte (SSC) sono cellule dotate della singolare proprietà di rinnovarsi mantenendo

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Ciclo Cellulare 18/01/2015

Ciclo Cellulare 18/01/2015 Ciclo Cellulare Biotecnologie http://upload.wikimedia.org/wikipedia/commons/e/e3/mitosis_%28261_13%29_pressed%3b_root_meristem_of_onion_%28cells_in_ prophase,_metaphase,_anaphase,_telophase%29.jpg http://270c81.medialib.glogster.com/media/3b/3b966af047cca0605f106aa1a34dd3451287c5e41a0c7ce8ce537f74bbb795eb/main

Dettagli

SVILUPPO DI UN CEFALOCORDATO L ANFIOSSO

SVILUPPO DI UN CEFALOCORDATO L ANFIOSSO SVILUPPO DI UN CEFALOCORDATO L ANFIOSSO Comunicazioni: Martedì 25 novembre la lezione di Biologia dello Sviluppo delle ore 16-18 sarà sostituita da una lezione di Zoologia del Prof. Bologna. La settimana

Dettagli

EMBRIOLOGIA UMANA ESSENZIALE

EMBRIOLOGIA UMANA ESSENZIALE MASSIMO DE FELICI EMBRIOLOGIA UMANA ESSENZIALE Per corsi di laurea in Professioni sanitarie e per il corso di laurea in Odontoiatria e protesi dentaria II edizione DVD in abbinamento editoriale Copyright

Dettagli

1 a LEGGE DI MENDEL Legge della Segregazione

1 a LEGGE DI MENDEL Legge della Segregazione IMPRINTING 1 a LEGGE DI MENDEL Legge della Segregazione I due membri di una coppia di alleli, durante la formazione dei gameti segregano in maniera indipendente, cioè in modo che metà dei gameti porti

Dettagli

Tessuto epiteliale Tessuto connettivo Tessuto muscolare Tessuto nervoso TESSUTO

Tessuto epiteliale Tessuto connettivo Tessuto muscolare Tessuto nervoso TESSUTO Tessuto epiteliale TESSUTO Ogni cellula del nostro organismo ha lo stesso patrimonio genetico ma, allora, perché ogni cellula è diversa da un altra? Del messaggio genetico ricevuto ogni cellula legge un

Dettagli