Cos è uno spettrometro di massa

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Cos è uno spettrometro di massa"


1 Cos è uno spettrometro di massa Lo spettrometro di massa è uno strumento che produce ioni e li separa in fase gassosa in base al loro rapporto massa/carica (m/z). Un analisi in spettrometria di massa può essere rappresentata dai seguenti passaggi: Introduzione del campione Ionizzazione Analisi della massa Rivelazione degli ioni/analisi dei dati.

2 Scopi della spettrometria di massa Identificazione di componenti di una miscela Indagini quantitative Determinazione del peso molecolare Delucidazione della struttura molecolare Studi meccanicistici Studio di interazioni intermolecolari

3 Proteomica Glicobiologia Genetica e medicina Biologia molecolare e cellulare Scienze ambientali Chimica dei polimeri Antiterrorismo Farmacologia Antidoping Archeologia Astronomia Analisi inorganica e ancora tante altre Aree di interesse

4 Alcune applicazioni - MS classica Misure di massa accurate possono essere usate per trovare la formula empirica che si appaia ad esse. Fingerprints di frammentazione (specifici per ciascun composto) possono essere usati per identificare campioni comparandoli a fingerprints presenti nei database. Frammentazioni controllate (ottenute con MS/MS e MS n ) possono essere usate per l elucidazione strutturale di composti ignoti. Picchi standard osservati in uno spettro possono dare informazioni utili relativamente a gruppi funzionali. Miscele complesse possono essere analizzate per mezzo di tecniche composte ('hyphenated ) quali GC-MS e HPLC-MS, evitando così il lungo tempo necessario per purificare il campione.

5 Alcune applicazioni - MS piu recente Peptidi Determinazione della massa molecolare identificazione. Analisi di sequenza. Analisi di miscele complesse, come quelle derivanti da digestioni proteasiche di proteine (LC/MS o CE/MS). Proteine Determinazione della massa molecolare - identificazione. Modificazioni post-traduzionali. Localizzazione di legami disolfuro. Interazioni noncovalenti.

6 Caratteristiche della spettrometria di massa Intervallo di PM fino a centinaia di kda Sensibilità dell ordine delle picomoli o inferiore Acquisizione veloce dei dati Interfacce con metodi separativi Alta e bassa risoluzione

7 Schema di uno spettrometro di massa generazione di ioni in fase gassosa separazione degli ioni in funzione del rapporto m/z rivelazione degli ioni cosi separati spettro di massa spettro di massa : mappa dell abbondanza relativa degli ioni prodotti in funzione del rapporto massa/carica (m/z)

8 Modalità di ionizzazione Hard Ionization: Ionizzazione elettronica Electron Ionization (EI) Soft Ionization: Ionizzazione chimica Chemical Ionization (CI) Bombardamento con atomi veloci Fast Atom Bombardment (FAB) Ionizzazione termospray Thermospray Ionization (TSP) Ionizzazione elettrospray Electrospray Ionization (ESI) Ionizzazione chimica a pressione atmosferica Atmospheric Pressure Chemical Ionization (APCI) Desorbimento laser assistito da matrice Matrix Assisted Laser Desorption (MALDI)

9 EI - Electron impact Ionisation




13 Ionizzazione elettronica (EI) Vantaggi Spettri ben interpretabili La frammentazione fornisce informazioni di tipo strutturale Gli spettri sono riproducibili Svantaggi Per alcuni composti lo ione molecolare puo essere poco rappresentato o addirittua assente Applicabile solo a composti volatili, termostabili, neutri e con peso molecolare non elevato


15 Ionizzazione chimica Generalmente in uno spettrometro di massa la pressione e' mantenuta la piu' bassa possibile con efficienti sistemi di pompaggio ( mmhg), e reazioni bimolecolari (es. ione-molecola) sono estremamente improbabili. La ionizzazione chimica avviene invece se introduciamo nella camera di ionizzazione un gas reagente, ad esempio metano, in concentrazioni relativamente elevate (1 mmhg). Lo ione molecolare del metano generato per impatto elettronico puo' reagire con l'eccesso di metano: Il catione CH 5+, è un acido forte, puo' quindi protonare con una reazione acido-base praticamente qualsiasi molecola organica. Questa tecnica di ionizzazione genera uno ione pseudomolecolare (M+H) + con un bassissimo eccesso di energia vibrazionale, e le reazioni di frammentazione sono quindi poco importanti.


17 M + [M+H] +

18 Schema di uno spettrometro di massa generazione di ioni in fase gassosa separazione degli ioni in funzione del rapporto m/z rivelazione degli ioni cosi separati spettro di massa

19 separazione degli ioni in funzione del rapporto m/z: - Strumenti a settore - Analizzatori di massa a quadrupolo - Time-of-Flight (TOF)

20 Quadrupole Mass Analyzers +U +Vcos( t) U Vcos( t) Per un dato valore dei potenziali solo gli ioni con un singolo valore del rapporto m/z raggiungono il rivelatore. La scansione di uno spettro si ottiene facendo variare simultaneamente Vcc e Vac, mantenendo costante il loro rapporto.


22 Spettrometro di massa a triplo quadrupolo


24 Interpretazione dello spettro di massa Nella comune pratica di laboratorio, si suggerisce prima di tutto di eseguire un confronto computerizzato dello spettro appena registrato con il vasto archivio di spettri ormai disponibile su tutti gli spettrometri commerciali. Anche se la molecola esaminata non e' compresa nell'archivio, l'elaboratore elenca una serie di composti che contengono il maggior numero possibile di ioni comuni con lo spettro incognito. L'identificazione di ioni caratteristici e' uno stadio importante anche nell'interpretazione "manuale" degli spettri di massa: l'aiuto di un computer quindi non guasta. Nell'interpretazione non assistita, normalmente si segue una procedura abbastanza semplice: 1.Identificazione dello ione molecolare. 2.Identificazione di ioni caratteristici. 3.Identificazione di processi di frammentazione caratteristici.

25 Ione molecolare E' lo ione (positivo) generato per ionizzazione della molecola da analizzare. Dopo ionizzazione per impatto elettronico e' una specie a numero dispari di elettroni: M + e- ----> M*+ + 2e- Non necessariamente e' osservabile nello spettro. Ad esempio negli alcoli alifatici a lunga catena e' di regola assente. Spesso e' possibile osservare ioni molecolari piu' intensi riducendo l'energia del fascio elettronico di ionizzazione. Metodi alternativi di ionizzazione producono ioni molecolari piu' intensi e relativamente meno ioni frammento. Lavorando ad alta risoluzione, la massa esatta dello ione molecolare fornisce direttamente la composizione elementare del composto incognito. - E' lo ione a massa più alta dello spettro. - E' legato ad altri ioni attraverso perdite logiche Esistono delle regole generali: - Se la molecola contiene solamente C, H, O, S, Alogeni o un numero pari di atomi di azoto, lo ione molecolare e' di massa nominale pari. - Se la molecola contiene un numero dispari di atomi di azoto, la massa nominale dello ione molecolare e' dispari.

26 Spettro di massa Picco Base CH 3 O C CH 2 CH 3-29 Ione Molecolare m/z 43 m/z 57-15








34 Esempio di spettro di massa (EI): acido benzoico 1. Identificazione dello ione molecolare. 2. Identificazione di ioni caratteristici. 3. Identificazione di processi di frammentazione caratteristici. 4. Ricostruzione della struttura della molecola sulla base della conoscenza di meccanismi di frammentazione standard.



Spettrometria di massa

Spettrometria di massa Tecniche di monitoraggio ambientale di tipo fisico Spettrometria di massa (J. B. Fenn, K. Tanaka, K. Wüthrich, premio nobel per la chimica nel 2002) Analisi chimica dell aerosol Riconoscimento di inquinanti


Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per

Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per identificare prodotti incogniti, per determinazioni quantitative





Determinazione della composizione elementare dello ione molecolare. Metodo dell abbondanza isotopica. Misure di massa esatta

Determinazione della composizione elementare dello ione molecolare. Metodo dell abbondanza isotopica. Misure di massa esatta Determinazione della composizione elementare dello ione molecolare Metodo dell abbondanza isotopica Misure di massa esatta PREMESSA: ISOTOPI PICCHI ISOTOPICI Il picco dello ione molecolare è spesso accompagnato





Metodi di ionizzazione

Metodi di ionizzazione Metodi di ionizzazione IL PROCESSO DI IONIZZAZIONE avviene solitamente all interno della sorgente dello spettrometro di massa e può essere realizzato mediante varie tecniche. Dal tipo di processo di ionizzazione


La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac


Spettrometria di Massa

Spettrometria di Massa Spettrometria di Massa Cosa è la spettrometria di massa? Metodo analitico per misurare il peso molecolare di un campione Sono richieste solo concentrazioni picomolari Accuratezza entro lo 0.01% del peso


GC GC/MS. Chiaravalle, 11-12 FEBBRAIO 2010

GC GC/MS. Chiaravalle, 11-12 FEBBRAIO 2010 GC GC/MS Chiaravalle, 11-12 FEBBRAIO 2010 GAS-CROMATOGRAFO GAS di TRASPORTO (carrier): Gas inerte (azoto,elio..): trasporta componenti della miscela lungo la colonna cromatografica INIETTORE: - Assicura



SPETTROMETRIA DI MASSA SPETTROMETRIA DI MASSA INTRODUZIONE La spettrometria di massa e una tecnica analitica di delucidazione strutturale basata sulla ionizzazione di una molecola e sulla sua successiva frammentazione in ioni


Cromatografia liquida ad alta performance (HPLC)

Cromatografia liquida ad alta performance (HPLC) Cromatografia liquida ad alta performance (HPLC) La cromatografia in fase liquida viene utilizzata per la separazione di miscele complesse di molecole e/o biomolecole. Riducendo il diametro delle particelle

Dettagli Termogravimetro (TG) Termogravimetro (TG) Termogravimetro (TG) Il termogravimetro è un particolare strumento che tramite un'analisi termogravimetrica misura la variazione percentuale di peso di un materiale, quando esso viene riscaldato,






CORSO DI SPETTROMETRIA DI MASSA 2016 Società Chimica Italiana Divisione di Spettrometria di Massa Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia CORSO DI SPETTROMETRIA DI MASSA 2016 Siena, Certosa di Pontignano


2. Analisi dei segmenti a. Frammentare le subunità in peptidi

2. Analisi dei segmenti a. Frammentare le subunità in peptidi 1. Preliminari a. Biochimica delle proteine Prof. M. Bolognesi Denaturazione a.a. 2007/2008 delle proteine b. Riduzione e alchilazione dei ponti disolfuro c. Determinazione delle subunità 2. Analisi dei


Accoppiamento fra tecniche cromatografiche e spettrometria di massa

Accoppiamento fra tecniche cromatografiche e spettrometria di massa Accoppiamento fra tecniche cromatografiche e spettrometria di massa I due principali accoppiamenti fra cromatografia e spettrometria di massa sono GC-MS e HPLC-MS: Tecnica GC-MS Tipi di accoppiamento con


Campionamento ed analisi di composti volatili in matrici alimentari

Campionamento ed analisi di composti volatili in matrici alimentari Campionamento ed analisi di composti volatili in matrici alimentari Lo studio dei composti volatili di un alimento ha l obiettivo di fornirne la caratterizzazione del profilo aromatico, permettendo in



1. Teoria ITIS FACCIO VERCELLI DIPARTIMENTO DI CHIMICA - 2014 2 1. Teoria La spettrometria di massa (Mass Spettroscopy - MS) è una tecnica analitica piuttosto vecchia (risale agli anni venti del novecento) ma, dopo l'interfacciamento con i moderni PC, ha conosciuto


LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da

LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da 1 1 LOTTO 1 - CAPITOLATO TECNICO Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da Analizzatore Tubo di volo lineare di almeno 1,5m





v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina 3500 V catod o

v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina 3500 V catod o La prima e : Isoelectric focusing (IEF) v=e z f 1 step1 v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina Tot 76 kvh f = coefficiente



METODI FISICI IN CHIMICA ORGANICA METODI FISICI IN CHIMICA ORGANICA Spettrometria di massa Testi consigliati: -B. Gioia, R. Stradi,, E. Rossi, Guida al corso di metodi fisici in chimica organica, Vol II, (Massa), Ed. CUSL, Milano 1989


Spettroscopia atomica

Spettroscopia atomica Spettroscopia atomica La spettroscopia atomica è una tecnica di indagine qualitativa e quantitativa, in cui una sostanza viene decomposta negli atomi che la costituiscono tramite una fiamma, un fornetto


Corso di Laboratorio di Chimica Generale Esperienza 6: ph, sua misura e applicazioni

Corso di Laboratorio di Chimica Generale Esperienza 6: ph, sua misura e applicazioni Corso di Laboratorio di Chimica Generale Esperienza 6: ph, sua misura e applicazioni Una delle più importanti proprietà di una soluzione acquosa è la sua concentrazione di ioni idrogeno. Lo ione H + o


Spettrometria di massa (principi fondamentali)

Spettrometria di massa (principi fondamentali) Spettrometria di massa (principi fondamentali) Rilevamento con spettrometria di massa (MS) Una tecnica più raffinata del PID è la spettrometria di massa che prevede l analisi in massa di ioni formati (con


Sistema LC/MS Agilent Serie 6210 Time-of-Flight Dai campioni alle risposte

Sistema LC/MS Agilent Serie 6210 Time-of-Flight Dai campioni alle risposte Sistema LC/MS Agilent Serie 6210 Time-of-Flight Dai campioni alle risposte Dai campioni alle risposte Se analizzi sostanze farmaceutiche o campioni ambientali, proteine o peptidi sintetici, il sistema


RIVELAZIONE DELLE RADIAZIONI IONIZZANTI. Nelle tecniche di rivelazione delle radiazioni ionizzanti le grandezze da rivelare possono essere diverse:

RIVELAZIONE DELLE RADIAZIONI IONIZZANTI. Nelle tecniche di rivelazione delle radiazioni ionizzanti le grandezze da rivelare possono essere diverse: RIVELAZIONE DELLE RADIAZIONI IONIZZANTI Nelle tecniche di rivelazione delle radiazioni ionizzanti le grandezze da rivelare possono essere diverse: -Fluenza di particelle -Fluenza di energia -Informazioni



SPETTROSCOPIA MOLECOLARE SPETTROSCOPIA MOLECOLARE La spettroscopia molecolare studia l assorbimento o l emissione delle radiazioni elettromagnetiche da parte delle molecole. Il dato sperimentale che si ottiene, chiamato rispettivamente


INTERVENTO DI CLAUDIA RICCARDI PLASMAPROMETEO - Dipartimento di Fisica Università degli Studi di Milano - Bicocca

INTERVENTO DI CLAUDIA RICCARDI PLASMAPROMETEO - Dipartimento di Fisica Università degli Studi di Milano - Bicocca INTERVENTO DI CLAUDIA RICCARDI PLASMAPROMETEO - Dipartimento di Fisica Università degli Studi di Milano - Bicocca La ricerca come strumento per lo sviluppo aziendale: sinergia tra università e industria


È importante quindi conoscere le proprietà chimiche dell acqua. Le reazioni acido base sono particolari esempi di equilibrio chimico in fase acquosa

È importante quindi conoscere le proprietà chimiche dell acqua. Le reazioni acido base sono particolari esempi di equilibrio chimico in fase acquosa Premessa Le nozioni di acido e di base non sono concetti assoluti ma sono relativi al mezzo in cui tale sostanze sono sciolte. L acqua è il solvente per eccellenza, scelto per studiare le caratteristiche



I TEST DI CHIMICA - INGEGNERIA DELL INFORMAZIONE AA 04/05 I TEST DI CHIMICA - INGEGNERIA DELL INFORMAZIONE AA 04/05 COGNOME E NOME: 1. Br 1 si è trasformato in Br +3 in una reazione in cui lo ione bromuro: A) ha acquistato 3 elettroni B) ha ceduto 4 elettroni



MISURE DI POTERE CALORIFICO E COMPOSIZIONE MISURE DI POTERE CALORIFICO E COMPOSIZIONE Potere calorifico dei combustibili: bomba calorimetrica e calorimetro di Junkers Composizione: gascromatografia Composizione dei gas combusti: o Sonda λ o Strumenti


determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D

determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Metodi di studio delle proteine : determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Determinazione della sequenza aminoacilica di una



CORSO DI SPETTROMETRIA DI MASSA 2015 Società Chimica Italiana Divisione di Spettrometria di Massa Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia CORSO DI SPETTROMETRIA DI MASSA 2015 Certosa di Pontignano


Metodi spettroscopici in Chimica Organica

Metodi spettroscopici in Chimica Organica Metodi spettroscopici in Chimica Organica II Edizione Manfred Hesse Università di Zurigo Herbert Meier Università di Mainz Bernd Zeeh BASF Limburgerhof Edizione italiana a cura di Giorgio Abbiati Facoltà


LEZIONE 1. Materia: Proprietà e Misura

LEZIONE 1. Materia: Proprietà e Misura LEZIONE 1 Materia: Proprietà e Misura MISCELE, COMPOSTI, ELEMENTI SOSTANZE PURE E MISCUGLI La materia può essere suddivisa in sostanze pure e miscugli. Un sistema è puro solo se è formato da una singola


SDD - Seconde Equilibrio e ph. Equilibrio e ph. Obiettivo

SDD - Seconde Equilibrio e ph. Equilibrio e ph. Obiettivo 1 Obiettivo Capire che cosa è il ph, apprendere le leggi fondamentali che lo controllano e capire qualitativamente le applicazioni delle soluzioni tampone. Prerequisiti Il concetto di equilibrio (che comunque


accoppiato con la Spettrometria di Massa. Sviluppo ed Applicazioni in Biochimica Clinica per la Diagnosi e lo

accoppiato con la Spettrometria di Massa. Sviluppo ed Applicazioni in Biochimica Clinica per la Diagnosi e lo Dispositivo per il Desorbimento e la Ionizzazione a Pressione Atmosferica accoppiato con la Spettrometria di Massa. Sviluppo ed Applicazioni in Biochimica Clinica per la Diagnosi e lo Screening degli Errori



GIOCHI DELLA CHIMICA GIOCHI DELLA CHIMICA FASE D ISTITUTO (TRIENNIO) 21 marzo 2016 La prova è costituita da 50 quesiti. ALUNNO CLASSE Scrivi la risposta a ciascuna domanda nel foglio risposte allegato. 1. Quale dei seguenti


Spettrometria di massa tandem

Spettrometria di massa tandem Spettrometria di massa tandem Sorgenti come electrospray e MALDI hanno il vantaggio di provocare poche o nessuna frammentazione, e quindi: garantiscono la misura del peso molecolare possono essere usate


Le proprietà periodiche degli elementi LA LEZIONE

Le proprietà periodiche degli elementi LA LEZIONE Le proprietà periodiche degli elementi LA LEZIONE Le proprietà degli elementi mostrano delle tendenze che possono essere predette usando il sistema periodico ed essere spiegate e comprese analizzando la


1. Un elemento Ä formato da particelle indivisibili chiamate atomi. 2. Gli atomi di uno specifico elemento hanno proprietå identiche. 3.

1. Un elemento Ä formato da particelle indivisibili chiamate atomi. 2. Gli atomi di uno specifico elemento hanno proprietå identiche. 3. Atomi e molecole Ipotesi di Dalton (primi dell 800) 1. Un elemento Ä formato da particelle indivisibili chiamate atomi. 2. Gli atomi di uno specifico elemento hanno proprietå identiche. 3. Gli atomi dei





2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma L elettroforesi bidimensionale separa le proteine in base alla loro carica (come nella IEF) e dimensioni


I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici La seta della tela di ragno è un insieme di macromolecole, dette proteine. Sono le caratteristiche fisico-chimiche di queste


Istituto di Istruzione Superiore L. da Vinci Civitanova Marche. Anno scolastico 2014-2015. Programma svolto. Docente: Silvana Venditti

Istituto di Istruzione Superiore L. da Vinci Civitanova Marche. Anno scolastico 2014-2015. Programma svolto. Docente: Silvana Venditti Anno scolastico 2014-2015 Programma svolto Docente: Silvana Venditti Disciplina: Scienze Naturali Classe : IV sez. E - Indirizzo Linguistico ARTICOLAZIONE DEI CONTENUTI E DEGLI OBIETTIVI SECONDO UNITA


Corso di Formazione: La spettrometria di massa delle biomolecole: applicazioni in ambito clinico, proteomico, alimentare.

Corso di Formazione: La spettrometria di massa delle biomolecole: applicazioni in ambito clinico, proteomico, alimentare. Corso di Formazione: La spettrometria di massa delle biomolecole: applicazioni in ambito clinico, proteomico, alimentare 1-2 luglio 2014 Politecnico di Milano Aula Rogers, via Ampere 2, Milano Direzione


Visita agli spettrometri di massa Dott. Fabio Hollan

Visita agli spettrometri di massa Dott. Fabio Hollan Visita agli spettrometri di massa Dott. Fabio Hollan Strumento a ionizzazione ESI: Electrospray Ionization (formazione di particelle liquide cariche dalle quali gli ioni vengono emessi per desorbimento





1)Quale tra i seguenti elementi è un gas nobile? a. Si b. Mo c. Ge d. He. 2) L'acqua è:

1)Quale tra i seguenti elementi è un gas nobile? a. Si b. Mo c. Ge d. He. 2) L'acqua è: 1)Quale tra i seguenti elementi è un gas nobile? a. Si b. Mo c. Ge d. He 2) L'acqua è: a. una sostanza elementare b. un composto chimico c. una miscela omogenea d. una soluzione 3) Quale dei seguenti elementi


Progress Report Piano Progetti 2010

Progress Report Piano Progetti 2010 Progress Report Piano Progetti 2010 IWorkshop di presentazione e valutazione dei risultati SMARTSEARCH: Ricerca di composti farmacologicamente attivi e potenzialmente pericolosi di libero commercio impiegando


materia atomi miscugli omogenei e eterogenei sostanze elementari composti

materia atomi miscugli omogenei e eterogenei sostanze elementari composti Elementi e Composti materia miscugli omogenei e eterogenei sostanze elementari composti atomi Gli atomi sono, per convenzione, le unità costituenti le sostanze Le sostanze possono essere costituite da


Metalli in medicina. L utilizzo dei metalli in medicina ha radici ben antiche. Il ferro ed il

Metalli in medicina. L utilizzo dei metalli in medicina ha radici ben antiche. Il ferro ed il Metalli in medicina L utilizzo dei metalli in medicina ha radici ben antiche. Il ferro ed il rame, per esempio, erano utilizzati nella Grecia antica. Già da secoli il Hg 2+ era utilizzato nel trattamento


Si dividono in: N-glicosilate (su Asparagina) O-glicosilate (su Serina o Treonina. Raramente su Tirosina, idrossiprolina, idrossilisina)

Si dividono in: N-glicosilate (su Asparagina) O-glicosilate (su Serina o Treonina. Raramente su Tirosina, idrossiprolina, idrossilisina) GLICOSILAZIONE La glicosilazione è la modificazione PTM più diffusa. Circa il 50% delle proteine umane sono glicosilate Caratteristica di molte proteine della superficie cellulare e delle d proteine di





Fare clic sull'icona per inserire un'immagine. Unità Operativa: CNR-ISPA Bioindustry Park S. Fumero Colleretto Giacosa (TO)

Fare clic sull'icona per inserire un'immagine. Unità Operativa: CNR-ISPA Bioindustry Park S. Fumero Colleretto Giacosa (TO) are clic sull'icona per inserire Unità Operativa: -SP Bioindustry Park S. umero olleretto Giacosa (TO) Metodi di analisi di secondo livello mediante spettrometria di massa per la conferma di campioni contenenti


Cromatografia Dal greco chroma : colore, graphein : scrivere 1903 Mikhail Twsett (pigmenti vegetali su carta)

Cromatografia Dal greco chroma : colore, graphein : scrivere 1903 Mikhail Twsett (pigmenti vegetali su carta) Cromatografia Dal greco chroma : colore, graphein : scrivere 1903 Mikhail Twsett (pigmenti vegetali su carta) E il termine generico che indica una serie di tecniche di separazione di molecole simili in


Dissociazione elettrolitica

Dissociazione elettrolitica Dissociazione elettrolitica Le sostanze ioniche si solubilizzano liberando ioni in soluzione. La dissociazione elettrolitica è il processo con cui un solvente separa ioni di carica opposta e si lega ad





Tecniche di spettrometria di massa applicabili all analisi del proteoma

Tecniche di spettrometria di massa applicabili all analisi del proteoma Tecniche di spettrometria di massa applicabili all analisi del proteoma In proteomica, la spettrometria di massa non rappresenta soltanto la procedura di elezione per ottenere misure precise della massa


rifiuti plastici RICICLO CHIMICO riciclo terziario

rifiuti plastici RICICLO CHIMICO riciclo terziario RICICL TERZIARI: recupero come materie prime secondarie rifiuti plastici combustione viene preservato il massimo valore sfruttabile contenuto nel rifiuto plastico, ma spesso ha numerosi fattori limitanti





miscela di reazione miscela di reazione

miscela di reazione miscela di reazione Alla fine della reazione: miscela di reazione 1.Si tratta con acqua o acqua e ghiaccio 2.Si aggiunge un solvente organico immiscibile e si agita Si lava (estrae) con una base Si lava (estrae) con un acido


Istruzioni per l uso IVD Matrix HCCA-portioned

Istruzioni per l uso IVD Matrix HCCA-portioned Istruzioni per l uso IVD Matrix HCCA-portioned Matrice purificata per spettrometria di massa a tempo di volo con desorbimento e ionizzazione laser assistita da matrice (MALDI-TOF-MS). I prodotti CARE sono



IDROCARBURI AROMATICI. Scaricato da IDROCARBURI AROMATICI BENZENE E il capostipite degli idrocarburi aromatici. Osservazioni sperimentali: Formula bruta C 6 6 elevato grado di insaturazione (4) I 6 atomi di C sono legati a formare un anello


Spettrometria di massa

Spettrometria di massa Spettrometria di massa Serve a misurare la massa delle molecole. Fornisce la massa molecolare, e anche la formula molecolare La molecola deve essere ionizzata, così da misurare il rapporto massa/carica


Tecniche di Analisi Termica e Diffrazione di Raggi X

Tecniche di Analisi Termica e Diffrazione di Raggi X ESERCITAZIONI DI CHIMICA FISICA A.A 2010/2011 I MODULO 6 crediti (Anna Corrias) Tecniche di Analisi Termica e Diffrazione di Raggi X Analisi Termica Cenni teorici Descrizione esperienze di laboratorio


Programmazione individuale per competenze CLASSE 3^B LSA. Materia: CHIMICA

Programmazione individuale per competenze CLASSE 3^B LSA. Materia: CHIMICA Programmazione individuale per competenze CLASSE 3^B LSA Materia: CHIMICA Situazione della classe Accordi con la classe Accordi con le altre discipline Correlazione con i progetti proposti alla classe


Laura Beata Classe 4 B Concorso Sperimento Anch io Silvia Valesano Classe 4 B

Laura Beata Classe 4 B Concorso Sperimento Anch io Silvia Valesano Classe 4 B Laura Beata Classe 4 B Concorso Sperimento Anch io Silvia Valesano Classe 4 B RELAZINI DI LABRATRI (Italiano) Titolo: : Cosa mangiamo veramente? Scopo: 1. Scoprire in quali alimenti ci sono o non ci sono



ENERGIA NELLE REAZIONI CHIMICHE ENERGIA NELLE REAZIONI CHIMICHE Nelle trasformazioni chimiche e fisiche della materia avvengono modifiche nelle interazioni tra le particelle che comportano sempre variazioni di energia "C è un fatto,



SISTEMI ELETTROCHIMICI Università degli studi di Palermo SISTEMI ELETTROCHIMICI Dott. Ing. Serena Randazzo Dipartimento di Ingegneria Chimica, Gestionale, Informatica e Meccanica OUTLINE 1) Introduzione sui sistemi elettrochimici



PROTEOMA E PROTEOMICA PROTEOMA E PROTEOMICA "The analysis of the entire PROTEin content expressed by a genome, or by a cell or tissue type. Wasinger VC et al, Electrophoresis 16 (1995) PROTEOMICS is the systematic analysis


La Vita è una Reazione Chimica

La Vita è una Reazione Chimica La Vita è una Reazione Chimica Acqua Oro Zucchero Il numero atomico, il numero di massa e gli isotopi numero atomico (Z) = numero di protoni nel nucleo numero di massa (A) = numero di protoni + numero


MPT Capitolo 12 Redox. Le ossidoriduzioni. Obiettivo. Definizioni di ossidazione e di riduzione

MPT Capitolo 12 Redox. Le ossidoriduzioni. Obiettivo. Definizioni di ossidazione e di riduzione 1 Le ossidoriduzioni Obiettivo In questo capitolo svilupperemo i concetti fondamentali delle reazioni di ossido-riduzione. Si tratta di conoscenze fondamentali sia per la vita comune, sia, per molti di


Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare


Sostituzioni sull anello aromatico

Sostituzioni sull anello aromatico Sostituzioni sull anello aromatico Criteri per stabilire l esistenza di carattere aromatico 1. Il composto deve essere ciclico, planare e deve avere una nuvola ininterrotta di elettroni π sopra e sotto


Cosa misura il ph: la concentrazione di ioni H +, che si scrive [H + ]. La definizione di ph è: ph = -log 10 [H + ]

Cosa misura il ph: la concentrazione di ioni H +, che si scrive [H + ]. La definizione di ph è: ph = -log 10 [H + ] La molecola d acqua è un dipolo perché l atomo di ossigeno è molto elettronegativo ed attira più vicini a sé gli elettroni di legame. Questo, unito alla forma della molecola, produce un accumulo di carica



IL MARCATORE TUMORALE IL MARCATORE TUMORALE Un marcatore tumorale è una sostanza rilevabile nei fluidi biologici la cui positività indica la presenza di un tumore. Il marcatore tumorale ideale dovrebbe presentare una completa


Sinergie tra nutrienti e fattori limitanti l utilizzo della fibra

Sinergie tra nutrienti e fattori limitanti l utilizzo della fibra Sinergie tra nutrienti e fattori limitanti l utilizzo della fibra A. Formigoni e A. Palmonari Impianti di Biogas 8 InfoBiogas- Montichiari (Bs) 19-1- 2012 Obiettivi dei gestori


Esame di Chimica Generale (M-Z) A.A. 2011-2012 (25 gennaio 2012)

Esame di Chimica Generale (M-Z) A.A. 2011-2012 (25 gennaio 2012) CORSO DI LAUREA IN SCIENZE BIOLOGICHE Esame di Chimica Generale (M-Z) A.A. 2011-2012 (25 gennaio 2012) 1) Bilanciare la seguente ossidoriduzione: KMnO 4 + H 2 O 2 + H 2 SO 4 MnSO 4 + K 2 SO 4 + O 2 + H


LO STATO GASSOSO. Proprietà fisiche dei gas Leggi dei gas Legge dei gas ideali Teoria cinetico-molecolare dei gas Solubilità dei gas nei liquidi

LO STATO GASSOSO. Proprietà fisiche dei gas Leggi dei gas Legge dei gas ideali Teoria cinetico-molecolare dei gas Solubilità dei gas nei liquidi LO STATO GASSOSO Proprietà fisiche dei gas Leggi dei gas Legge dei gas ideali Teoria cinetico-molecolare dei gas Solubilità dei gas nei liquidi STATO GASSOSO Un sistema gassoso è costituito da molecole


DENSITA La densità è una grandezza fisica che indica la massa, di una sostanza o di un corpo, contenuta nell unità di volume; è data dal rapporto:

DENSITA La densità è una grandezza fisica che indica la massa, di una sostanza o di un corpo, contenuta nell unità di volume; è data dal rapporto: Richiami di Chimica DENSITA La densità è una grandezza fisica che indica la massa, di una sostanza o di un corpo, contenuta nell unità di volume; è data dal rapporto: d = massa / volume unità di misura



METODI IN PROTEOMICA DIFFERENZIALE METODI IN PROTEOMICA DIFFERENZIALE PRINCIPIO COMUNE: ANALISI SIMULTANEA DEI CAMPIONI DA CONFRONTARE Proteine di diversa provenienza sono modificate in maniera differenziale. Le alterazioni prodotte differenzialmente


Corso di Biochimica Applicata 2012

Corso di Biochimica Applicata 2012 Corso di Biochimica Applicata 2012 Laboratorio di Proteomica La proteomica è una tecnica biochimica molto complessa (tanto che in alcuni Paesi è considerata una disciplina scientifica) che studia il proteoma


BIOLOGIA GENERALE 22-24 ottobre 2007

BIOLOGIA GENERALE 22-24 ottobre 2007 Biologia generale Massolo Alessandro; Tel. 347-9403330 BIOLOGIA GENERALE 22-24 ottobre 2007 Facoltà di Psicologia Tecniche di Psicologia Generale e Sperimentale Alessandro Massolo Dip.


Trasformazioni materia

Trasformazioni materia REAZIONI CHIMICHE Trasformazioni materia Trasformazioni fisiche (reversibili) Trasformazioni chimiche (irreversibili) È una trasformazione che non produce nuove sostanze È una trasformazione che produce


Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana


Tipi di reazioni. Reazioni chimiche. Di dissociazione. Di sintesi. Di semplice scambio. Di doppio scambio. Reazioni complesse

Tipi di reazioni. Reazioni chimiche. Di dissociazione. Di sintesi. Di semplice scambio. Di doppio scambio. Reazioni complesse Tipi di reazioni Le reazioni chimiche vengono tradizionalmente classificate a seconda del tipo di trasformazione subita dai reagenti: Reazioni chimiche possono essere Di dissociazione Una sostanza subisce





Programmazione individuale di Laboratorio Materia : Chimica e Laboratorio. Docenti : Giancarlo Cardone Classe : 2 CAT a.s.

Programmazione individuale di Laboratorio Materia : Chimica e Laboratorio. Docenti : Giancarlo Cardone Classe : 2 CAT a.s. Programmazione individuale di Laboratorio Materia : Chimica e Laboratorio. Docenti : Giancarlo Cardone Classe : 2 CAT a.s. 2015-2016 Mondovi 05/11/2015 Prof. Giancarlo Cardone PROGRAMMAZIONE DELL ATTIVITA



DEFINIZIONE ACIDO/BASE SECONDO BRONSTED-LOWRY DEFINIZIONE ACIDO/BASE SECONDO BRONSTED-LOWRY Una reazione acido/base coinvolge un trasferimento di protone: l'acido è il donatore di protone e la base è l'accettore del protone. Questa definizione spiega


Tratto dal libro Come vivere 150 anni Dr. Dimitris Tsoukalas

Tratto dal libro Come vivere 150 anni Dr. Dimitris Tsoukalas 1 Tratto dal libro Come vivere 150 anni Dr. Dimitris Tsoukalas Capitolo 7 Enzimi, le macchine della vita Piccole macchine regolano la funzione del corpo umano in un orchestrazione perfetta e a velocità


Capitolo 7 Le particelle dell atomo

Capitolo 7 Le particelle dell atomo Capitolo 7 Le particelle dell atomo 1. La natura elettrica della materia 2. La scoperta delle proprietà elettriche 3. Le particelle fondamentali dell atomo 4. La scoperta dell elettrone 5. L esperimento


Valitutti, Taddei, Kreuzer, Massey, Sadava, Hills, Heller, Berenbaum

Valitutti, Taddei, Kreuzer, Massey, Sadava, Hills, Heller, Berenbaum Dal carbonio agli OGM VERSO L UNIVERSITÀ Le domande sono tratte dalle prove di ammissione emesse annualmente dal Ministero dell Istruzione, dell Università e della Ricerca (MIUR) e le soluzioni sono evidenziate


Tecniche analitiche più usate per le sostanze organiche

Tecniche analitiche più usate per le sostanze organiche Tecniche analitiche più usate per le sostanze organiche Le tecniche analitiche strumentali sono un utilissimo strumento per identificare sostanze incognite (analisi qualitativa), ad esempio per riconoscere


REAZIONI ORGANICHE Variazioni di energia e velocità di reazione

REAZIONI ORGANICHE Variazioni di energia e velocità di reazione REAZIONI ORGANICHE Variazioni di energia e velocità di reazione Abbiamo visto che i composti organici e le loro reazioni possono essere suddivisi in categorie omogenee. Per ottenere la massima razionalizzazione



LA MOLE : UN UNITA DI MISURA FONDAMENTALE PER LA CHIMICA LA MOLE : UN UNITA DI MISURA FONDAMENTALE PER LA CHIMICA Poiché è impossibile contare o pesare gli atomi o le molecole che formano una qualsiasi sostanza chimica, si ricorre alla grandezza detta quantità


Attivitá e cinetica enzimatica

Attivitá e cinetica enzimatica Attivitá e cinetica enzimatica PAS : Classe di insegnamento A60 Biologia e scienze A.A. 2013/2014 09/05/2014 Cinetica Enzimatica La cinetica enzimatica è misurata come velocità di conversione del substrato


Biosintesi non ribosomiale di metaboliti peptidici bioattivi

Biosintesi non ribosomiale di metaboliti peptidici bioattivi Biosintesi non ribosomiale di metaboliti peptidici bioattivi Principali bersagli degli antibiotici Gli antibiotici derivano per la maggior parte da composti naturali Strutture di alcuni peptidi bioattivi



Allegato 1. COD_TD2 ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO Profilo 1 Esperto in tecnologie di pastificazione e spettrometria RAMAN L esperto dovrà operare presso la Piattaforma di Tecnologie Alimentari, laboratorio di
