Cos è uno spettrometro di massa

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Cos è uno spettrometro di massa"

Transcript

1 Cos è uno spettrometro di massa Lo spettrometro di massa è uno strumento che produce ioni e li separa in fase gassosa in base al loro rapporto massa/carica (m/z). Un analisi in spettrometria di massa può essere rappresentata dai seguenti passaggi: Introduzione del campione Ionizzazione Analisi della massa Rivelazione degli ioni/analisi dei dati.

2 Scopi della spettrometria di massa Identificazione di componenti di una miscela Indagini quantitative Determinazione del peso molecolare Delucidazione della struttura molecolare Studi meccanicistici Studio di interazioni intermolecolari

3 Proteomica Glicobiologia Genetica e medicina Biologia molecolare e cellulare Scienze ambientali Chimica dei polimeri Antiterrorismo Farmacologia Antidoping Archeologia Astronomia Analisi inorganica e ancora tante altre Aree di interesse

4 Alcune applicazioni - MS classica Misure di massa accurate possono essere usate per trovare la formula empirica che si appaia ad esse. Fingerprints di frammentazione (specifici per ciascun composto) possono essere usati per identificare campioni comparandoli a fingerprints presenti nei database. Frammentazioni controllate (ottenute con MS/MS e MS n ) possono essere usate per l elucidazione strutturale di composti ignoti. Picchi standard osservati in uno spettro possono dare informazioni utili relativamente a gruppi funzionali. Miscele complesse possono essere analizzate per mezzo di tecniche composte ('hyphenated ) quali GC-MS e HPLC-MS, evitando così il lungo tempo necessario per purificare il campione.

5 Alcune applicazioni - MS piu recente Peptidi Determinazione della massa molecolare identificazione. Analisi di sequenza. Analisi di miscele complesse, come quelle derivanti da digestioni proteasiche di proteine (LC/MS o CE/MS). Proteine Determinazione della massa molecolare - identificazione. Modificazioni post-traduzionali. Localizzazione di legami disolfuro. Interazioni noncovalenti.

6 Caratteristiche della spettrometria di massa Intervallo di PM fino a centinaia di kda Sensibilità dell ordine delle picomoli o inferiore Acquisizione veloce dei dati Interfacce con metodi separativi Alta e bassa risoluzione

7 Schema di uno spettrometro di massa generazione di ioni in fase gassosa separazione degli ioni in funzione del rapporto m/z rivelazione degli ioni cosi separati spettro di massa spettro di massa : mappa dell abbondanza relativa degli ioni prodotti in funzione del rapporto massa/carica (m/z)

8 Modalità di ionizzazione Hard Ionization: Ionizzazione elettronica Electron Ionization (EI) Soft Ionization: Ionizzazione chimica Chemical Ionization (CI) Bombardamento con atomi veloci Fast Atom Bombardment (FAB) Ionizzazione termospray Thermospray Ionization (TSP) Ionizzazione elettrospray Electrospray Ionization (ESI) Ionizzazione chimica a pressione atmosferica Atmospheric Pressure Chemical Ionization (APCI) Desorbimento laser assistito da matrice Matrix Assisted Laser Desorption (MALDI)

9 EI - Electron impact Ionisation

10

11

12

13 Ionizzazione elettronica (EI) Vantaggi Spettri ben interpretabili La frammentazione fornisce informazioni di tipo strutturale Gli spettri sono riproducibili Svantaggi Per alcuni composti lo ione molecolare puo essere poco rappresentato o addirittua assente Applicabile solo a composti volatili, termostabili, neutri e con peso molecolare non elevato

14

15 Ionizzazione chimica Generalmente in uno spettrometro di massa la pressione e' mantenuta la piu' bassa possibile con efficienti sistemi di pompaggio ( mmhg), e reazioni bimolecolari (es. ione-molecola) sono estremamente improbabili. La ionizzazione chimica avviene invece se introduciamo nella camera di ionizzazione un gas reagente, ad esempio metano, in concentrazioni relativamente elevate (1 mmhg). Lo ione molecolare del metano generato per impatto elettronico puo' reagire con l'eccesso di metano: Il catione CH 5+, è un acido forte, puo' quindi protonare con una reazione acido-base praticamente qualsiasi molecola organica. Questa tecnica di ionizzazione genera uno ione pseudomolecolare (M+H) + con un bassissimo eccesso di energia vibrazionale, e le reazioni di frammentazione sono quindi poco importanti.

16

17 M + [M+H] +

18 Schema di uno spettrometro di massa generazione di ioni in fase gassosa separazione degli ioni in funzione del rapporto m/z rivelazione degli ioni cosi separati spettro di massa

19 separazione degli ioni in funzione del rapporto m/z: - Strumenti a settore - Analizzatori di massa a quadrupolo - Time-of-Flight (TOF)

20 Quadrupole Mass Analyzers +U +Vcos( t) U Vcos( t) Per un dato valore dei potenziali solo gli ioni con un singolo valore del rapporto m/z raggiungono il rivelatore. La scansione di uno spettro si ottiene facendo variare simultaneamente Vcc e Vac, mantenendo costante il loro rapporto.

21

22 Spettrometro di massa a triplo quadrupolo

23

24 Interpretazione dello spettro di massa Nella comune pratica di laboratorio, si suggerisce prima di tutto di eseguire un confronto computerizzato dello spettro appena registrato con il vasto archivio di spettri ormai disponibile su tutti gli spettrometri commerciali. Anche se la molecola esaminata non e' compresa nell'archivio, l'elaboratore elenca una serie di composti che contengono il maggior numero possibile di ioni comuni con lo spettro incognito. L'identificazione di ioni caratteristici e' uno stadio importante anche nell'interpretazione "manuale" degli spettri di massa: l'aiuto di un computer quindi non guasta. Nell'interpretazione non assistita, normalmente si segue una procedura abbastanza semplice: 1.Identificazione dello ione molecolare. 2.Identificazione di ioni caratteristici. 3.Identificazione di processi di frammentazione caratteristici.

25 Ione molecolare E' lo ione (positivo) generato per ionizzazione della molecola da analizzare. Dopo ionizzazione per impatto elettronico e' una specie a numero dispari di elettroni: M + e- ----> M*+ + 2e- Non necessariamente e' osservabile nello spettro. Ad esempio negli alcoli alifatici a lunga catena e' di regola assente. Spesso e' possibile osservare ioni molecolari piu' intensi riducendo l'energia del fascio elettronico di ionizzazione. Metodi alternativi di ionizzazione producono ioni molecolari piu' intensi e relativamente meno ioni frammento. Lavorando ad alta risoluzione, la massa esatta dello ione molecolare fornisce direttamente la composizione elementare del composto incognito. - E' lo ione a massa più alta dello spettro. - E' legato ad altri ioni attraverso perdite logiche Esistono delle regole generali: - Se la molecola contiene solamente C, H, O, S, Alogeni o un numero pari di atomi di azoto, lo ione molecolare e' di massa nominale pari. - Se la molecola contiene un numero dispari di atomi di azoto, la massa nominale dello ione molecolare e' dispari.

26 Spettro di massa Picco Base CH 3 O C CH 2 CH 3-29 Ione Molecolare m/z 43 m/z 57-15

27

28

29

30

31

32

33

34 Esempio di spettro di massa (EI): acido benzoico 1. Identificazione dello ione molecolare. 2. Identificazione di ioni caratteristici. 3. Identificazione di processi di frammentazione caratteristici. 4. Ricostruzione della struttura della molecola sulla base della conoscenza di meccanismi di frammentazione standard.

35

36

Spettrometria di massa

Spettrometria di massa Tecniche di monitoraggio ambientale di tipo fisico Spettrometria di massa (J. B. Fenn, K. Tanaka, K. Wüthrich, premio nobel per la chimica nel 2002) Analisi chimica dell aerosol Riconoscimento di inquinanti

Dettagli

Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per

Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per identificare prodotti incogniti, per determinazioni quantitative

Dettagli

Determinazione della composizione elementare dello ione molecolare. Metodo dell abbondanza isotopica. Misure di massa esatta

Determinazione della composizione elementare dello ione molecolare. Metodo dell abbondanza isotopica. Misure di massa esatta Determinazione della composizione elementare dello ione molecolare Metodo dell abbondanza isotopica Misure di massa esatta PREMESSA: ISOTOPI PICCHI ISOTOPICI Il picco dello ione molecolare è spesso accompagnato

Dettagli

IMPORTANZA DELLA SPETTROMETRIA DI MASSA NEL CAMPO BIOTECNOLOGICO

IMPORTANZA DELLA SPETTROMETRIA DI MASSA NEL CAMPO BIOTECNOLOGICO UNIVERSITA DEGLI STUDI DI URBINO Carlo Bo FACOLTA DI SCIENZE e TECNOLOGIE Corso di laurea in Biotecnologie IMPORTANZA DELLA SPETTROMETRIA DI MASSA NEL CAMPO BIOTECNOLOGICO Docente: Anna Rita Mastrogiacomo

Dettagli

Metodi di ionizzazione

Metodi di ionizzazione Metodi di ionizzazione IL PROCESSO DI IONIZZAZIONE avviene solitamente all interno della sorgente dello spettrometro di massa e può essere realizzato mediante varie tecniche. Dal tipo di processo di ionizzazione

Dettagli

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE Servizio Risorse Umane e Relazioni Sindacali delegato dal Direttore Generale dell Azienda con

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

Spettrometria di Massa

Spettrometria di Massa Spettrometria di Massa Cosa è la spettrometria di massa? Metodo analitico per misurare il peso molecolare di un campione Sono richieste solo concentrazioni picomolari Accuratezza entro lo 0.01% del peso

Dettagli

GC GC/MS. Chiaravalle, 11-12 FEBBRAIO 2010

GC GC/MS. Chiaravalle, 11-12 FEBBRAIO 2010 GC GC/MS Chiaravalle, 11-12 FEBBRAIO 2010 GAS-CROMATOGRAFO GAS di TRASPORTO (carrier): Gas inerte (azoto,elio..): trasporta componenti della miscela lungo la colonna cromatografica INIETTORE: - Assicura

Dettagli

Che Cos è la SPETTROMETRIA DI MASSA

Che Cos è la SPETTROMETRIA DI MASSA Che Cos è la SPETTROMETRIA DI MASSA AMERICAN SOCIETY FOR MASS SPECTROMETRY SOCIETÀ CHIMICA ITALIANA DIVISIONE DI SPETTROMETRIA DI MASSA Traduzione da What is MASS SPECTROMETRY, ASMS (American Society for

Dettagli

CORSO DI SPETTROMETRIA DI MASSA 2016

CORSO DI SPETTROMETRIA DI MASSA 2016 Società Chimica Italiana Divisione di Spettrometria di Massa Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia CORSO DI SPETTROMETRIA DI MASSA 2016 Siena, Certosa di Pontignano

Dettagli

SPETTROMETRIA DI MASSA

SPETTROMETRIA DI MASSA SPETTROMETRIA DI MASSA INTRODUZIONE La spettrometria di massa e una tecnica analitica di delucidazione strutturale basata sulla ionizzazione di una molecola e sulla sua successiva frammentazione in ioni

Dettagli

2. Analisi dei segmenti a. Frammentare le subunità in peptidi

2. Analisi dei segmenti a. Frammentare le subunità in peptidi 1. Preliminari a. Biochimica delle proteine Prof. M. Bolognesi Denaturazione a.a. 2007/2008 delle proteine b. Riduzione e alchilazione dei ponti disolfuro c. Determinazione delle subunità 2. Analisi dei

Dettagli

Cromatografia liquida ad alta performance (HPLC)

Cromatografia liquida ad alta performance (HPLC) Cromatografia liquida ad alta performance (HPLC) La cromatografia in fase liquida viene utilizzata per la separazione di miscele complesse di molecole e/o biomolecole. Riducendo il diametro delle particelle

Dettagli

LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da

LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da 1 All.to 1 LOTTO 1 - CAPITOLATO TECNICO Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da Analizzatore Tubo di volo lineare di almeno 1,5m

Dettagli

1. Teoria ITIS FACCIO VERCELLI DIPARTIMENTO DI CHIMICA - 2014 2

1. Teoria ITIS FACCIO VERCELLI DIPARTIMENTO DI CHIMICA - 2014 2 1. Teoria La spettrometria di massa (Mass Spettroscopy - MS) è una tecnica analitica piuttosto vecchia (risale agli anni venti del novecento) ma, dopo l'interfacciamento con i moderni PC, ha conosciuto

Dettagli

Accoppiamento fra tecniche cromatografiche e spettrometria di massa

Accoppiamento fra tecniche cromatografiche e spettrometria di massa Accoppiamento fra tecniche cromatografiche e spettrometria di massa I due principali accoppiamenti fra cromatografia e spettrometria di massa sono GC-MS e HPLC-MS: Tecnica GC-MS Tipi di accoppiamento con

Dettagli

1.3.8.3 Termogravimetro (TG)

1.3.8.3 Termogravimetro (TG) 1.3.8.3 Termogravimetro (TG) Il termogravimetro è un particolare strumento che tramite un'analisi termogravimetrica misura la variazione percentuale di peso di un materiale, quando esso viene riscaldato,

Dettagli

UNIVERSITÀ DELLA CALABRIA

UNIVERSITÀ DELLA CALABRIA UNIVERSITÀ DELLA CALABRIA FACOLTÀ DI SCIENZE MATEMATICHE, FISICHE E NATURALI CORSO DI LAUREA IN CHIMICA TESI DI LAUREA DETERMINAZIONE QUANTITATIVA DI ROTENONE IN OLIVICOLTURA BIOLOGICA MEDIANTE SPETTROMETRIA

Dettagli

Sistema LC/MS Agilent Serie 6210 Time-of-Flight Dai campioni alle risposte

Sistema LC/MS Agilent Serie 6210 Time-of-Flight Dai campioni alle risposte Sistema LC/MS Agilent Serie 6210 Time-of-Flight Dai campioni alle risposte Dai campioni alle risposte Se analizzi sostanze farmaceutiche o campioni ambientali, proteine o peptidi sintetici, il sistema

Dettagli

Campionamento ed analisi di composti volatili in matrici alimentari

Campionamento ed analisi di composti volatili in matrici alimentari Campionamento ed analisi di composti volatili in matrici alimentari Lo studio dei composti volatili di un alimento ha l obiettivo di fornirne la caratterizzazione del profilo aromatico, permettendo in

Dettagli

METODI FISICI IN CHIMICA ORGANICA

METODI FISICI IN CHIMICA ORGANICA METODI FISICI IN CHIMICA ORGANICA Spettrometria di massa Testi consigliati: -B. Gioia, R. Stradi,, E. Rossi, Guida al corso di metodi fisici in chimica organica, Vol II, (Massa), Ed. CUSL, Milano 1989

Dettagli

RIVELAZIONE DELLE RADIAZIONI IONIZZANTI. Nelle tecniche di rivelazione delle radiazioni ionizzanti le grandezze da rivelare possono essere diverse:

RIVELAZIONE DELLE RADIAZIONI IONIZZANTI. Nelle tecniche di rivelazione delle radiazioni ionizzanti le grandezze da rivelare possono essere diverse: RIVELAZIONE DELLE RADIAZIONI IONIZZANTI Nelle tecniche di rivelazione delle radiazioni ionizzanti le grandezze da rivelare possono essere diverse: -Fluenza di particelle -Fluenza di energia -Informazioni

Dettagli

Spettroscopia atomica

Spettroscopia atomica Spettroscopia atomica La spettroscopia atomica è una tecnica di indagine qualitativa e quantitativa, in cui una sostanza viene decomposta negli atomi che la costituiscono tramite una fiamma, un fornetto

Dettagli

SPETTROSCOPIA MOLECOLARE

SPETTROSCOPIA MOLECOLARE SPETTROSCOPIA MOLECOLARE La spettroscopia molecolare studia l assorbimento o l emissione delle radiazioni elettromagnetiche da parte delle molecole. Il dato sperimentale che si ottiene, chiamato rispettivamente

Dettagli

Metodi spettroscopici in Chimica Organica

Metodi spettroscopici in Chimica Organica Metodi spettroscopici in Chimica Organica II Edizione Manfred Hesse Università di Zurigo Herbert Meier Università di Mainz Bernd Zeeh BASF Limburgerhof Edizione italiana a cura di Giorgio Abbiati Facoltà

Dettagli

v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina 3500 V catod o

v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina 3500 V catod o La prima e : Isoelectric focusing (IEF) v=e z f 1 step1 v = velocità di migrazione della proteina in un campo elettrico E = forza del campo elettrico z = carica netta della proteina Tot 76 kvh f = coefficiente

Dettagli

CORSO DI SPETTROMETRIA DI MASSA 2015

CORSO DI SPETTROMETRIA DI MASSA 2015 Società Chimica Italiana Divisione di Spettrometria di Massa Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia CORSO DI SPETTROMETRIA DI MASSA 2015 Certosa di Pontignano

Dettagli

determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D

determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Metodi di studio delle proteine : determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Determinazione della sequenza aminoacilica di una

Dettagli

1. Un elemento Ä formato da particelle indivisibili chiamate atomi. 2. Gli atomi di uno specifico elemento hanno proprietå identiche. 3.

1. Un elemento Ä formato da particelle indivisibili chiamate atomi. 2. Gli atomi di uno specifico elemento hanno proprietå identiche. 3. Atomi e molecole Ipotesi di Dalton (primi dell 800) 1. Un elemento Ä formato da particelle indivisibili chiamate atomi. 2. Gli atomi di uno specifico elemento hanno proprietå identiche. 3. Gli atomi dei

Dettagli

I TEST DI CHIMICA - INGEGNERIA DELL INFORMAZIONE AA 04/05

I TEST DI CHIMICA - INGEGNERIA DELL INFORMAZIONE AA 04/05 I TEST DI CHIMICA - INGEGNERIA DELL INFORMAZIONE AA 04/05 COGNOME E NOME: 1. Br 1 si è trasformato in Br +3 in una reazione in cui lo ione bromuro: A) ha acquistato 3 elettroni B) ha ceduto 4 elettroni

Dettagli

Spettrometria di massa tandem

Spettrometria di massa tandem Spettrometria di massa tandem Sorgenti come electrospray e MALDI hanno il vantaggio di provocare poche o nessuna frammentazione, e quindi: garantiscono la misura del peso molecolare possono essere usate

Dettagli

Corso di Formazione: La spettrometria di massa delle biomolecole: applicazioni in ambito clinico, proteomico, alimentare.

Corso di Formazione: La spettrometria di massa delle biomolecole: applicazioni in ambito clinico, proteomico, alimentare. Corso di Formazione: La spettrometria di massa delle biomolecole: applicazioni in ambito clinico, proteomico, alimentare 1-2 luglio 2014 Politecnico di Milano Aula Rogers, via Ampere 2, Milano Direzione

Dettagli

accoppiato con la Spettrometria di Massa. Sviluppo ed Applicazioni in Biochimica Clinica per la Diagnosi e lo

accoppiato con la Spettrometria di Massa. Sviluppo ed Applicazioni in Biochimica Clinica per la Diagnosi e lo Dispositivo per il Desorbimento e la Ionizzazione a Pressione Atmosferica accoppiato con la Spettrometria di Massa. Sviluppo ed Applicazioni in Biochimica Clinica per la Diagnosi e lo Screening degli Errori

Dettagli

Corso di Laboratorio di Chimica Generale Esperienza 6: ph, sua misura e applicazioni

Corso di Laboratorio di Chimica Generale Esperienza 6: ph, sua misura e applicazioni Corso di Laboratorio di Chimica Generale Esperienza 6: ph, sua misura e applicazioni Una delle più importanti proprietà di una soluzione acquosa è la sua concentrazione di ioni idrogeno. Lo ione H + o

Dettagli

LEZIONE 1. Materia: Proprietà e Misura

LEZIONE 1. Materia: Proprietà e Misura LEZIONE 1 Materia: Proprietà e Misura MISCELE, COMPOSTI, ELEMENTI SOSTANZE PURE E MISCUGLI La materia può essere suddivisa in sostanze pure e miscugli. Un sistema è puro solo se è formato da una singola

Dettagli

Progress Report Piano Progetti 2010

Progress Report Piano Progetti 2010 Progress Report Piano Progetti 2010 IWorkshop di presentazione e valutazione dei risultati SMARTSEARCH: Ricerca di composti farmacologicamente attivi e potenzialmente pericolosi di libero commercio impiegando

Dettagli

ISTITUTO TECNICO INDUSTRIALE STATALE GALILEO FERRARIS RELAZIONE

ISTITUTO TECNICO INDUSTRIALE STATALE GALILEO FERRARIS RELAZIONE ISTITUTO TECNICO INDUSTRIALE STATALE GALILEO FERRARIS RELAZIONE VISITA D ISTRUZIONE PRESSO IL CONSIGLIO NAZIONALE DELLE RICERCHE (CNR), ISTITUTO PER I POLIMERI, COMPOSITI E BIOMATERIALI (IPCB) Catania

Dettagli

Tecniche di spettrometria di massa applicabili all analisi del proteoma

Tecniche di spettrometria di massa applicabili all analisi del proteoma Tecniche di spettrometria di massa applicabili all analisi del proteoma In proteomica, la spettrometria di massa non rappresenta soltanto la procedura di elezione per ottenere misure precise della massa

Dettagli

GIOCHI DELLA CHIMICA

GIOCHI DELLA CHIMICA GIOCHI DELLA CHIMICA FASE D ISTITUTO (TRIENNIO) 21 marzo 2016 La prova è costituita da 50 quesiti. ALUNNO CLASSE Scrivi la risposta a ciascuna domanda nel foglio risposte allegato. 1. Quale dei seguenti

Dettagli

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma L elettroforesi bidimensionale separa le proteine in base alla loro carica (come nella IEF) e dimensioni

Dettagli

Fare clic sull'icona per inserire un'immagine. Unità Operativa: CNR-ISPA Bioindustry Park S. Fumero Colleretto Giacosa (TO)

Fare clic sull'icona per inserire un'immagine. Unità Operativa: CNR-ISPA Bioindustry Park S. Fumero Colleretto Giacosa (TO) are clic sull'icona per inserire Unità Operativa: -SP Bioindustry Park S. umero olleretto Giacosa (TO) Metodi di analisi di secondo livello mediante spettrometria di massa per la conferma di campioni contenenti

Dettagli

Metalli in medicina. L utilizzo dei metalli in medicina ha radici ben antiche. Il ferro ed il

Metalli in medicina. L utilizzo dei metalli in medicina ha radici ben antiche. Il ferro ed il Metalli in medicina L utilizzo dei metalli in medicina ha radici ben antiche. Il ferro ed il rame, per esempio, erano utilizzati nella Grecia antica. Già da secoli il Hg 2+ era utilizzato nel trattamento

Dettagli

materia atomi miscugli omogenei e eterogenei sostanze elementari composti

materia atomi miscugli omogenei e eterogenei sostanze elementari composti Elementi e Composti materia miscugli omogenei e eterogenei sostanze elementari composti atomi Gli atomi sono, per convenzione, le unità costituenti le sostanze Le sostanze possono essere costituite da

Dettagli

INTERVENTO DI CLAUDIA RICCARDI PLASMAPROMETEO - Dipartimento di Fisica Università degli Studi di Milano - Bicocca

INTERVENTO DI CLAUDIA RICCARDI PLASMAPROMETEO - Dipartimento di Fisica Università degli Studi di Milano - Bicocca INTERVENTO DI CLAUDIA RICCARDI PLASMAPROMETEO - Dipartimento di Fisica Università degli Studi di Milano - Bicocca La ricerca come strumento per lo sviluppo aziendale: sinergia tra università e industria

Dettagli

METODI IN PROTEOMICA DIFFERENZIALE

METODI IN PROTEOMICA DIFFERENZIALE METODI IN PROTEOMICA DIFFERENZIALE PRINCIPIO COMUNE: ANALISI SIMULTANEA DEI CAMPIONI DA CONFRONTARE Proteine di diversa provenienza sono modificate in maniera differenziale. Le alterazioni prodotte differenzialmente

Dettagli

Esame di Chimica Generale (M-Z) A.A. 2011-2012 (25 gennaio 2012)

Esame di Chimica Generale (M-Z) A.A. 2011-2012 (25 gennaio 2012) CORSO DI LAUREA IN SCIENZE BIOLOGICHE Esame di Chimica Generale (M-Z) A.A. 2011-2012 (25 gennaio 2012) 1) Bilanciare la seguente ossidoriduzione: KMnO 4 + H 2 O 2 + H 2 SO 4 MnSO 4 + K 2 SO 4 + O 2 + H

Dettagli

Istituto di Istruzione Superiore L. da Vinci Civitanova Marche. Anno scolastico 2014-2015. Programma svolto. Docente: Silvana Venditti

Istituto di Istruzione Superiore L. da Vinci Civitanova Marche. Anno scolastico 2014-2015. Programma svolto. Docente: Silvana Venditti Anno scolastico 2014-2015 Programma svolto Docente: Silvana Venditti Disciplina: Scienze Naturali Classe : IV sez. E - Indirizzo Linguistico ARTICOLAZIONE DEI CONTENUTI E DEGLI OBIETTIVI SECONDO UNITA

Dettagli

SDD - Seconde Equilibrio e ph. Equilibrio e ph. Obiettivo

SDD - Seconde Equilibrio e ph. Equilibrio e ph. Obiettivo 1 Obiettivo Capire che cosa è il ph, apprendere le leggi fondamentali che lo controllano e capire qualitativamente le applicazioni delle soluzioni tampone. Prerequisiti Il concetto di equilibrio (che comunque

Dettagli

MISURE DI POTERE CALORIFICO E COMPOSIZIONE

MISURE DI POTERE CALORIFICO E COMPOSIZIONE MISURE DI POTERE CALORIFICO E COMPOSIZIONE Potere calorifico dei combustibili: bomba calorimetrica e calorimetro di Junkers Composizione: gascromatografia Composizione dei gas combusti: o Sonda λ o Strumenti

Dettagli

PIANO DI STUDIO DELLA DISCIPLINA

PIANO DI STUDIO DELLA DISCIPLINA Modulo Gestione Qualità UNI EN ISO 9001 : 2008 Tel. 0331635718 fax 0331679586 info@isisfacchinetti.it www.isisfacchinetti.it PIANO STUDIO DELLA DISCIPLINA PIANO DI STUDIO DELLA DISCIPLINA Chimica Analitica

Dettagli

1)Quale tra i seguenti elementi è un gas nobile? a. Si b. Mo c. Ge d. He. 2) L'acqua è:

1)Quale tra i seguenti elementi è un gas nobile? a. Si b. Mo c. Ge d. He. 2) L'acqua è: 1)Quale tra i seguenti elementi è un gas nobile? a. Si b. Mo c. Ge d. He 2) L'acqua è: a. una sostanza elementare b. un composto chimico c. una miscela omogenea d. una soluzione 3) Quale dei seguenti elementi

Dettagli

Si dividono in: N-glicosilate (su Asparagina) O-glicosilate (su Serina o Treonina. Raramente su Tirosina, idrossiprolina, idrossilisina)

Si dividono in: N-glicosilate (su Asparagina) O-glicosilate (su Serina o Treonina. Raramente su Tirosina, idrossiprolina, idrossilisina) GLICOSILAZIONE La glicosilazione è la modificazione PTM più diffusa. Circa il 50% delle proteine umane sono glicosilate Caratteristica di molte proteine della superficie cellulare e delle d proteine di

Dettagli

È importante quindi conoscere le proprietà chimiche dell acqua. Le reazioni acido base sono particolari esempi di equilibrio chimico in fase acquosa

È importante quindi conoscere le proprietà chimiche dell acqua. Le reazioni acido base sono particolari esempi di equilibrio chimico in fase acquosa Premessa Le nozioni di acido e di base non sono concetti assoluti ma sono relativi al mezzo in cui tale sostanze sono sciolte. L acqua è il solvente per eccellenza, scelto per studiare le caratteristiche

Dettagli

STRATEGIE SINTETICHE PER LA REALIZZAZIONE DI DERIVATI PIRROLICI TIPICI DEGLI AROMI DEL FUNGO PORCINO

STRATEGIE SINTETICHE PER LA REALIZZAZIONE DI DERIVATI PIRROLICI TIPICI DEGLI AROMI DEL FUNGO PORCINO ALBERTO MASSIMI CorsoChimici a.s.2008/09 DEBORAH BATTECCA FEDERICA CARUSO NICCOLO SCHIAVI STEFANIA SPIGAROLI STRATEGIESINTETICHEPERLA REALIZZAZIONEDIDERIVATIPIRROLICI TIPICIDEGLIAROMIDELFUNGOPORCINO 2

Dettagli

Istruzioni per l uso IVD Matrix HCCA-portioned

Istruzioni per l uso IVD Matrix HCCA-portioned Istruzioni per l uso IVD Matrix HCCA-portioned Matrice purificata per spettrometria di massa a tempo di volo con desorbimento e ionizzazione laser assistita da matrice (MALDI-TOF-MS). I prodotti CARE sono

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Le proprietà periodiche degli elementi LA LEZIONE

Le proprietà periodiche degli elementi LA LEZIONE Le proprietà periodiche degli elementi LA LEZIONE Le proprietà degli elementi mostrano delle tendenze che possono essere predette usando il sistema periodico ed essere spiegate e comprese analizzando la

Dettagli

IL MARCATORE TUMORALE

IL MARCATORE TUMORALE IL MARCATORE TUMORALE Un marcatore tumorale è una sostanza rilevabile nei fluidi biologici la cui positività indica la presenza di un tumore. Il marcatore tumorale ideale dovrebbe presentare una completa

Dettagli

Cromatografia Dal greco chroma : colore, graphein : scrivere 1903 Mikhail Twsett (pigmenti vegetali su carta)

Cromatografia Dal greco chroma : colore, graphein : scrivere 1903 Mikhail Twsett (pigmenti vegetali su carta) Cromatografia Dal greco chroma : colore, graphein : scrivere 1903 Mikhail Twsett (pigmenti vegetali su carta) E il termine generico che indica una serie di tecniche di separazione di molecole simili in

Dettagli

Capitolo 7 Le particelle dell atomo

Capitolo 7 Le particelle dell atomo Capitolo 7 Le particelle dell atomo 1. La natura elettrica della materia 2. La scoperta delle proprietà elettriche 3. Le particelle fondamentali dell atomo 4. La scoperta dell elettrone 5. L esperimento

Dettagli

Sostituzioni sull anello aromatico

Sostituzioni sull anello aromatico Sostituzioni sull anello aromatico Criteri per stabilire l esistenza di carattere aromatico 1. Il composto deve essere ciclico, planare e deve avere una nuvola ininterrotta di elettroni π sopra e sotto

Dettagli

Programmazione individuale per competenze CLASSE 3^B LSA. Materia: CHIMICA

Programmazione individuale per competenze CLASSE 3^B LSA. Materia: CHIMICA Programmazione individuale per competenze CLASSE 3^B LSA Materia: CHIMICA Situazione della classe Accordi con la classe Accordi con le altre discipline Correlazione con i progetti proposti alla classe

Dettagli

Corso di Biochimica Applicata 2012

Corso di Biochimica Applicata 2012 Corso di Biochimica Applicata 2012 Laboratorio di Proteomica La proteomica è una tecnica biochimica molto complessa (tanto che in alcuni Paesi è considerata una disciplina scientifica) che studia il proteoma

Dettagli

TAVOLA DI PROGRAMMAZIONE PER GRUPPI DIDATTICI

TAVOLA DI PROGRAMMAZIONE PER GRUPPI DIDATTICI TAVOLA DI PROGRAMMAZIONE PER GRUPPI DIDATTICI MATERIA: CHIMICA CLASSI: PRIME I II QUADRIMESTRE Competenze Abilità/Capacità Conoscenze* Attività didattica Strumenti Tipologia verifiche Osservare, descrivere

Dettagli

Programmazione individuale di Laboratorio Materia : Chimica e Laboratorio. Docenti : Giancarlo Cardone Classe : 2 CAT a.s.

Programmazione individuale di Laboratorio Materia : Chimica e Laboratorio. Docenti : Giancarlo Cardone Classe : 2 CAT a.s. Programmazione individuale di Laboratorio Materia : Chimica e Laboratorio. Docenti : Giancarlo Cardone Classe : 2 CAT a.s. 2015-2016 Mondovi 05/11/2015 Prof. Giancarlo Cardone PROGRAMMAZIONE DELL ATTIVITA

Dettagli

ENERGIA NELLE REAZIONI CHIMICHE

ENERGIA NELLE REAZIONI CHIMICHE ENERGIA NELLE REAZIONI CHIMICHE Nelle trasformazioni chimiche e fisiche della materia avvengono modifiche nelle interazioni tra le particelle che comportano sempre variazioni di energia "C è un fatto,

Dettagli

Visita agli spettrometri di massa Dott. Fabio Hollan

Visita agli spettrometri di massa Dott. Fabio Hollan Visita agli spettrometri di massa Dott. Fabio Hollan Strumento a ionizzazione ESI: Electrospray Ionization (formazione di particelle liquide cariche dalle quali gli ioni vengono emessi per desorbimento

Dettagli

PROTEOMA E PROTEOMICA

PROTEOMA E PROTEOMICA PROTEOMA E PROTEOMICA "The analysis of the entire PROTEin content expressed by a genome, or by a cell or tissue type. Wasinger VC et al, Electrophoresis 16 (1995) PROTEOMICS is the systematic analysis

Dettagli

Tecniche analitiche più usate per le sostanze organiche

Tecniche analitiche più usate per le sostanze organiche Tecniche analitiche più usate per le sostanze organiche Le tecniche analitiche strumentali sono un utilissimo strumento per identificare sostanze incognite (analisi qualitativa), ad esempio per riconoscere

Dettagli

CROMATOGRAFIA E GASCROMATOGRAFIA (lezione 3 e lezione 4)

CROMATOGRAFIA E GASCROMATOGRAFIA (lezione 3 e lezione 4) CROMATOGRAFIA E GASCROMATOGRAFIA (lezione 3 e lezione 4) Il nome cromatografia significa segno colorato e tale nome venne usato poiché le prime analisi venivano eseguite con sostanze pigmentate. Tale tecnica

Dettagli

IDROCARBURI AROMATICI. Scaricato da Sunhope.it

IDROCARBURI AROMATICI. Scaricato da Sunhope.it IDROCARBURI AROMATICI BENZENE E il capostipite degli idrocarburi aromatici. Osservazioni sperimentali: Formula bruta C 6 6 elevato grado di insaturazione (4) I 6 atomi di C sono legati a formare un anello

Dettagli

Allegato 1. COD_TD2 ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO

Allegato 1. COD_TD2 ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO Profilo 1 Esperto in tecnologie di pastificazione e spettrometria RAMAN L esperto dovrà operare presso la Piattaforma di Tecnologie Alimentari, laboratorio di

Dettagli

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici La seta della tela di ragno è un insieme di macromolecole, dette proteine. Sono le caratteristiche fisico-chimiche di queste

Dettagli

Tecniche di Analisi Termica e Diffrazione di Raggi X

Tecniche di Analisi Termica e Diffrazione di Raggi X ESERCITAZIONI DI CHIMICA FISICA A.A 2010/2011 I MODULO 6 crediti (Anna Corrias) Tecniche di Analisi Termica e Diffrazione di Raggi X Analisi Termica Cenni teorici Descrizione esperienze di laboratorio

Dettagli

A cosa serve il computer in Chimica?

A cosa serve il computer in Chimica? Il computer è uno strumento prezioso e viene ormai usato quotidianamente da milioni di persone. Per un chimico il computer è utile per eseguire operazioni ormai considerate normali come scrivere relazioni,

Dettagli

RIDUZIONE DELLE CLOROAMMINE IN PISCINA TRAMITE RAGGI ULTRAVIOLETTI

RIDUZIONE DELLE CLOROAMMINE IN PISCINA TRAMITE RAGGI ULTRAVIOLETTI RIDUZIONE DELLE CLOROAMMINE IN PISCINA TRAMITE RAGGI ULTRAVIOLETTI Autore: Andrea Peluso INTRODUZIONE: La riduzione delle cloroammine in piscina tramite l utilizzo di raggi ultravioletti è una pratica

Dettagli

Dissociazione elettrolitica

Dissociazione elettrolitica Dissociazione elettrolitica Le sostanze ioniche si solubilizzano liberando ioni in soluzione. La dissociazione elettrolitica è il processo con cui un solvente separa ioni di carica opposta e si lega ad

Dettagli

SISTEMA INTEGRATO A LETTURA AUTOMATICA DI RIVELATORI A TRACCIA PADC CON ANALISI DEI DATI COMPUTERIZZATA

SISTEMA INTEGRATO A LETTURA AUTOMATICA DI RIVELATORI A TRACCIA PADC CON ANALISI DEI DATI COMPUTERIZZATA SISTEMA INTEGRATO A LETTURA AUTOMATICA DI RIVELATORI A TRACCIA PADC CON ANALISI DEI DATI COMPUTERIZZATA 1. INTRODUZIONE Il Radon ( 222 Rn) è un gas radioattivo monoatomico presente nell atmosfera e generato

Dettagli

LO STATO GASSOSO. Proprietà fisiche dei gas Leggi dei gas Legge dei gas ideali Teoria cinetico-molecolare dei gas Solubilità dei gas nei liquidi

LO STATO GASSOSO. Proprietà fisiche dei gas Leggi dei gas Legge dei gas ideali Teoria cinetico-molecolare dei gas Solubilità dei gas nei liquidi LO STATO GASSOSO Proprietà fisiche dei gas Leggi dei gas Legge dei gas ideali Teoria cinetico-molecolare dei gas Solubilità dei gas nei liquidi STATO GASSOSO Un sistema gassoso è costituito da molecole

Dettagli

Allegato 3. COD_TD2 MATERIE E PROVE DI ESAME

Allegato 3. COD_TD2 MATERIE E PROVE DI ESAME MATERIE E PROVE DI ESAME 1 Profilo 1 Esperto in tecnologie di pastificazione e spettrometria RAMAN Produzione di pasta Utilizzo del RAMAN Pasta di grano duro L amido La spettroscopia Raman 2 Profilo 2

Dettagli

rifiuti plastici RICICLO CHIMICO riciclo terziario

rifiuti plastici RICICLO CHIMICO riciclo terziario RICICL TERZIARI: recupero come materie prime secondarie rifiuti plastici combustione viene preservato il massimo valore sfruttabile contenuto nel rifiuto plastico, ma spesso ha numerosi fattori limitanti

Dettagli

Metodo di conferma in GC-MS

Metodo di conferma in GC-MS 9 - TETRAIDROCANNABINOLO-COOH urinario Cod. GC47010 Metodo di conferma in GC-MS INTRODUZIONE Il 9 -THC-COOH è il metabolita urinario principale della Cannabis. La sua determinazione di screening nei liquidi

Dettagli

ISTITUTO ISTRUZIONE SUPERIORE "L. EINAUDI" ALBA ANNO SCOLASTICO 2015/2016

ISTITUTO ISTRUZIONE SUPERIORE L. EINAUDI ALBA ANNO SCOLASTICO 2015/2016 ISTITUTO ISTRUZIONE SUPERIORE "L. EINAUDI" ALBA ANNO SCOLASTICO 2015/2016 Classe II^ D COSTRUZIONI AMBIENTE E TERRITORIO Disciplina : SCIENZE INTEGRATE CHIMICA E LABORATORIO PROGETTAZIONE DIDATTICA ANNUALE

Dettagli

miscela di reazione miscela di reazione

miscela di reazione miscela di reazione Alla fine della reazione: miscela di reazione 1.Si tratta con acqua o acqua e ghiaccio 2.Si aggiunge un solvente organico immiscibile e si agita Si lava (estrae) con una base Si lava (estrae) con un acido

Dettagli

Le tecniche combinate TG/IR e TG/IR/GCMS: principi ed applicazioni

Le tecniche combinate TG/IR e TG/IR/GCMS: principi ed applicazioni Le tecniche combinate TG/IR e TG/IR/GCMS: principi ed applicazioni November 7, Maria 2014 Grazia Garavaglia Materials Characterization Product Specialist San Vito di Altivole, 05 Novembre 2014 2009 PerkinElmer

Dettagli

Biosintesi non ribosomiale di metaboliti peptidici bioattivi

Biosintesi non ribosomiale di metaboliti peptidici bioattivi Biosintesi non ribosomiale di metaboliti peptidici bioattivi Principali bersagli degli antibiotici Gli antibiotici derivano per la maggior parte da composti naturali Strutture di alcuni peptidi bioattivi

Dettagli

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

La Vita è una Reazione Chimica

La Vita è una Reazione Chimica La Vita è una Reazione Chimica Acqua Oro Zucchero Il numero atomico, il numero di massa e gli isotopi numero atomico (Z) = numero di protoni nel nucleo numero di massa (A) = numero di protoni + numero

Dettagli

Metabolismo: Introduzione

Metabolismo: Introduzione Metabolismo: Introduzione METABOLISMO Insieme delle reazioni chimiche coordinate e integrate che hanno luogo in tutte le cellule C A T A B O L I S M O Ossidazioni esoergoniche Alimenti: Carboidrati Lipidi

Dettagli

Bioingegneria Elettronica I

Bioingegneria Elettronica I Bioingegneria Elettronica I Cenni alla fisiologia delle cellule e dei sistemi biologici A. Bonfiglio La cellula struttura generale La cellula Struttura generale della cellula Composizione dei liquidi intracellulare

Dettagli

DIPARTIMENTO DI SCIENZE INTEGRATE CHIMICA FISICA SCIENZE DELLA TERRA - BIOLOGIA

DIPARTIMENTO DI SCIENZE INTEGRATE CHIMICA FISICA SCIENZE DELLA TERRA - BIOLOGIA IISS A. De Pace Lecce A.S. 2012-2013 DIPARTIMENTO DI SCIENZE INTEGRATE FISICA SCIENZE DELLA TERRA - BIOLOGIA PIANI DI STUDIO DELLE DISCIPLINE SECONDO ANNO Piano di studi della disciplina DESCRIZIONE Lo

Dettagli

La sostanza organica

La sostanza organica La sostanza organica La frazione solida di un suolo comprende anche la componente organica. Il contenuto di sostanza organica in un suolo è molto variabile, in genere nell intervallo 0.5-10 %, (5% in media).

Dettagli

Valitutti, Taddei, Kreuzer, Massey, Sadava, Hills, Heller, Berenbaum

Valitutti, Taddei, Kreuzer, Massey, Sadava, Hills, Heller, Berenbaum Dal carbonio agli OGM VERSO L UNIVERSITÀ Le domande sono tratte dalle prove di ammissione emesse annualmente dal Ministero dell Istruzione, dell Università e della Ricerca (MIUR) e le soluzioni sono evidenziate

Dettagli

DENSITA La densità è una grandezza fisica che indica la massa, di una sostanza o di un corpo, contenuta nell unità di volume; è data dal rapporto:

DENSITA La densità è una grandezza fisica che indica la massa, di una sostanza o di un corpo, contenuta nell unità di volume; è data dal rapporto: Richiami di Chimica DENSITA La densità è una grandezza fisica che indica la massa, di una sostanza o di un corpo, contenuta nell unità di volume; è data dal rapporto: d = massa / volume unità di misura

Dettagli

SISTEMI ELETTROCHIMICI

SISTEMI ELETTROCHIMICI Università degli studi di Palermo SISTEMI ELETTROCHIMICI Dott. Ing. Serena Randazzo Dipartimento di Ingegneria Chimica, Gestionale, Informatica e Meccanica OUTLINE 1) Introduzione sui sistemi elettrochimici

Dettagli

Unità di misura. Perché servono le unità di misura nella pratica di laboratorio e in corsia? Le unità di misura sono molto importanti

Unità di misura. Perché servono le unità di misura nella pratica di laboratorio e in corsia? Le unità di misura sono molto importanti Unità di misura Le unità di misura sono molto importanti 1000 è solo un numero 1000 lire unità di misura monetaria 1000 unità di misura monetaria ma il valore di acquisto è molto diverso 1000/mese unità

Dettagli

Lezione 15 metodi di analisi termici legati alla separazione di fase. Separazione di fase. Fasi della materia: solido, liquido, gas

Lezione 15 metodi di analisi termici legati alla separazione di fase. Separazione di fase. Fasi della materia: solido, liquido, gas Lezione 15 metodi di analisi termici legati alla separazione di fase Separazione di fase Fasi della materia: solido, liquido, gas SOLIDO Scioglimento solidificazione LIQUIDO evaporazione condensazione

Dettagli

Laura Beata Classe 4 B Concorso Sperimento Anch io Silvia Valesano Classe 4 B

Laura Beata Classe 4 B Concorso Sperimento Anch io Silvia Valesano Classe 4 B Laura Beata Classe 4 B Concorso Sperimento Anch io Silvia Valesano Classe 4 B RELAZINI DI LABRATRI (Italiano) Titolo: : Cosa mangiamo veramente? Scopo: 1. Scoprire in quali alimenti ci sono o non ci sono

Dettagli