Target and Differentiation Terapy in oncologia

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Target and Differentiation Terapy in oncologia"

Transcript

1 Target and Differentiation Terapy in oncologia Prof. Maurizio Pianezza Dott. Stefano Cucumazzo

2 Cancro: malattia genetica acquisita dalle cellule somatiche Conferma della definizione: aberrazioni cromosomiche Biologia molecolare Citogenetica

3 Cellule tumorali: deviazione del normale valore diploide dei cromosomi Ploidia Combinazioni Morfologia Monosomie delezione Trisomie duplicazione Polisomie inversione traslocazione MSR: regioni cromosomiche amplificate all interno del braccio DM: regioni cromosomiche amplificate all esterno del braccio

4 BANDE CROMOSOMICHE 71 su 329 Riarrangiamenti tumore-associati

5 La citogenetica consente di individuare due classi di geni implicati nello sviluppo e progressione tumorale Proto oncogenes Tumor Suppressors Genes

6 Attivazione dei proto-oncogeni 1 meccanismo: Aumento proteine del gene per iperespressione del gene stesso Delezione del dominio regolatorio 2 meccanismo Trasposizione per traslocazione cromosomica 3 meccanismo Amplificazione genica

7 Proto-oncogene attivazione Oncogene bersaglio Differenti compartimenti cellulari recettore fattore di sistemi di sistemi di diretto crescita trasduzione trascrizione su proteine del segnale del ciclo cellulare

8 Inattivazione dei Tumor Suppressor Genes 1 evento Si inattiva uno dei due alleli 2 evento Linea germinale: tumori ereditari Mutazione somatica: tumori comuni Mutazione somatica che inattiva la restante parte allelica (allele selvaggio) La regione cromosomica che contiene l allele selvaggio viene eliminata attraverso: Non disgiunzione Mancata Ricombinazione mitotica Conversione genica

9 Eventi genetici nella genesi dei tumori solidi Eventi genetici distinti: Attivazione oncogeni Inattivazione tumor suppressors genes Lesioni genetiche multiple: PERDITA ALLELI CHE SI VALUTA CON MARKER D.N.A. CONTROPARTE MOLECOLARE ALLELOTIPO

10 Cambiamenti genetico molecolari: ploidia del tumore Tumori solidi aneuploidia instabilità genomica Aumento numerico dei cromosomi Ipometilazione Gene di Divisione cellulare Progressione di malattia Non-disgiunzione mitotica Cloni iperdiploidii Cloni ipodiploidi Modello Computerizzato Di Shackney Perdita di cromosomi Tetraploidizzazione Crescita cellulare Divisione cellulare Growning Promoting Aberrazione cromosomica

11 Aneuploidia Attivazione oncogenica Doppia e sequenziale non disgiunzione del cromosoma sovraesposizione

12 Cromosoma eucariote CROMATINA Complesso DNA Proteine Cromosomiche RNA Nucleare EUCROMATINA ETEROCROMATINA geneticamente attiva geneticamente inattiva

13 Struttura del DNA

14 Proteine cromosomiche Proteine Istoniche H1 H2a H2b H3 H4 Proteine non Istoniche Enzimi Proteine di trascrizione Proteine di replicazione Nucleosoma DNA avvolto sugli istoni H1 sigilla il DNA Tra 2 nucleosomi: DNA detto Linker Interazione proteine non istoniche che legano il DNA SUL: Centromero: regolano DNA in mitosi e meiosi evita non disgiunzione dei cromosomi Cinetocromo: consentono attacco fibre del fuso mitotico Telomero: evitano rimaneggiamenti cromosomi

15 Struttura degli Istoni

16 Struttura del nucleosoma

17

18

19 RECETTORE Molecola che lega in modo specifico, definito e con affinità precisa uno o più mediatori endogeni e che, in seguito al legame, subisce una modificazione conformazionale in grado di determinare un effetto biologico In base alla localizzazione subcellulare: 1)RECETTORI DI MEMBRANA 2)RECETTORI INTRACELLULARI

20 6 SUPERFAMIGLIE: Recettori di membrana RECETTORI CANALE O IONOTROPI RECETTORI ACCOPPIATI ALLE PROTEINE G O METABOTROPI RECETTORI CON ATTIVITA TIROSIN CHINASICA INTRINSECA RECETTORI CON ATTIVITA GUANILATO CICLASI INTRINSECA RECETTORI PER L ADESIONE CELLULARE RECETTORI PER LE CITOCHINE RECETTORE CANALE trasduzione del segnale molto rapida RECETTORE ACCOPPIATO ALLE PROTEINE G trasduzione del segnale più lunga e più lenta

21 STRUTTURA GENERALE DEI RECETTORI IONOTROPI Caratteristiche strutturali che variano apprezzabilmente tra i vari recettori: composizione e lunghezza del terzo loop citoplasmatico e dell estremità carbossiterminale.

22 RECETTORI METABOTROPI Proteine recettoriali formate da una singola catena polipeptidica che attraversa la membrana plasmaticain corrispondenza di altrettante regioni idrofobiche(regioni transmembranatm). La catena polipeptidica si organizza spazialmente nella membrana in modo da costituire una particella globulare. Sito di legame per il neurotrasmettitore: porzioni transmembranarie o extracellulari della sequenza amminoacidica.

23 Tratto di sequenza tra TM5 e TM6: rivolto verso il citoplasma; importante per il riconoscimento delle proteine G specifiche con cui ciascun recettore si accoppia QUINDI responsabile della specificità dell effetto dell attivazione recettoriale. RECETTORI METABOTROPI

24 Struttura del recettore del fattore di crescita epidermico EGF Attivazione del recettore di EGF RECETTORI TIROSINO CHINASICI

25 Proteine G Eterotrimeri costituiti da 3 subunità: α, ß, γ. α è in grado di legare il GTP e di idrolizzarlo grazie a una attività GTPasica intrinseca Le proteine G trasferiscono informazioni dai recettori alle molecole effettrici attraverso un ciclo di attivazionedeattivazione governato dal legame e dall idrolisi del GTP.

26 Recettori canale o ionotropi Recettori accoppiati alle proteine G o metabotropi

27 EFFETTORI DELLE PROTEINE G CON FUNZIONI DI CANALE IONICO I più studiati sono i canali al calcio operati da proteina G e un numero sempre più crescente di canali al potassio

28 ATTIVAZIONE ED INATTIVAZIONE DELLE PROTEINE G Le proteine G passano continuamente da una conformazione inattiva (GDP legato) ad una attiva (GTP legato). La transizione verso la forma attiva è indotta dal recettore; il ritorno alla forma inattiva è garantito dalla proprietà della subunità αche idrolizza il GTP

29 SISTEMI EFFETTORI Il segnale generato dall interazione recettore proteina G viene tradotto in un messaggio cellulare attraverso l attivazione di EFFETTORI specifici:

30 Meccanismo di azione tirosino chinasico

31 Recettori a tirosin-chinasi

32 ATTIVAZIONE DELLA CASCATA DELLE MAP CHINAS Le MAP chinasi (proteinchinasi attivate da mitogeni) rivestono un ruolo centrale in processi cellulari importanti quali la proliferazione e il differenziamento. Possono essere attivate tramite vie diverse che coinvolgono o l attivazione di recettori per i fattori di crescita ad attività tirosin chinasica o l attivazione di recettori associati a proteine G. Le MAP chinasi sono fosfoproteine fosforilate da una chinasi chiamata MEK. L attivazione delle MAP chinasi determinano traslocazione al nucleo, con conseguente fosforilazione di proteine nucleari, soprattutto fattori di trascrizione che regolano l espressione di geni essenziali per la stimolazione di crescita e differenziamento cellulari.

33 MECCANISMI DI TRASDUZIONE DEL SEGNALE La TRASDUZIONE DEL SEGNALE viene definita come la capacità della cellula di modificare il proprio funzionamento in risposta a una interazione recettoreligando Il ligando rappresenta il PRIMO MESSAGGERO.

34 I secondi messaggeri sono l anello di congiunzione tra l attivazione recettoriale e la generazione della risposta cellulare. Il primo messaggero è invece il neurotrasmettitore responsabile dall attivazione del recettore. Dato che il secondo messaggero è in grado di diffondere nel citoplasma, esso è anche in grado di regolare l attività di processi cellulari che hanno luogo in sedi distanti. I più studiati sono l ADENILATO CICLASI e la FOSFOLIPASI C che generano rispettivamente i SECONDI MESSAGGERI camp e IP3/DAG. EFFETTORI DELLE PROTEINE G CON FUNZIONE ENZIMATICA

35 RECETTORI ACCOPPIATI ALL ADENILATO CICLASI L adenilatociclasi è un enzima ubiquitario che converte ATP in camp; l attività può essere inibita o stimolata da vari recettori associati alle proteineg. Il camp svolge la sua azione di secondo messaggero regolando l attività di diverse proteine cellulari, in particolare le proteinchinasi A (PKA). Attraverso questo meccanismo il Camp controlla una serie di processi cellulari: reazioni metaboliche, secrezione, rilasciamento delle cellule muscolari lisce, attività di canali ionici, trascrizione di geni specifici.

36 RECETTORI ACCOPPIATI ALLA FOSFOLIPASI C Il calcio si lega alla proteina calmodulina e il complesso CA++-calmodulina determina l attivazione di una serie di risposte cellulari

37 STIMOLAZIONE E INIBIZIONE DELL ADENILATO CICLASI AD OPERA DI DIFFERENTI PROTEINE G (a)il legame della noradrenalina al recettore ß attiva Gs che attiva l adenilatociclasi. Questo genera camp che attiva l enzima a valle protein-chinasi A (b)il legame della noradrenalinaal recettore α2 attiva Gi che inibisce l adenilatociclasi

38 RECETTORI ACCOPPIATI ALLA FOSFOLIPASI C Le due vie di attivazione, calcio e proteinchinasi C (PKC), regolano svariati processi cellulari (metabolismo, secrezione, contrazione, attività neuronale, proliferazione)

39 AMPLIFICAZIONE DEL SEGNALE CAUSATA DALLE CASCATE DEL SECONDO MESSAGGERO ASSOCIATO ALLE PROTEINE G

40 SCHEMA RIASSUNTIVO

41

42 I Recettori

43 Feed-back Terapeutico:differenziazione blocco proliferativo Effettori extracellulari Sintesi Proteica Recettori di Membrana Citoplasmatica Trasduttori del Segnale Effettori Intracellulari e secondi messaggeri RNA M.T.R. Piccoli effettori Modulazione espressione genica diretta Recettori nucleari Modulazione Espressione genica indiretta

44 Farmacodinamica La farmacodinamica studia gli effetti biochimici e il meccanismo d azione dei farmaci proponendosi di: identificare i siti di azione dei farmaci delineare le interazioni fisiche o chimiche tra farmaco e cellula caratterizzare la sequenza completa farmaco-effetto definire le basi per l uso razionale dei farmaci e per il disegno di nuovi farmaci

45 Farmacomodulazione Presuppone la conoscenza di: meccanismi biomolecolari normali e nel cancro conoscenza dei dosaggi terapeutici ottimali e i sinergismi tra di essi

46 Farmaci target molecolari Trastuzumab (herceptin) Legame con ER2-NEU codificato da gene C-ERB2 Tirosino chinasico Famiglia EGFR Mammella Stomaco

47 Farmaci target molecolari Imatinib (Glivec) Legame con CD117 Tirosino Chinasico Leucemia mieloide cronica GIST

48 Farmaci target molecolari Rituximab (Mabthera) Legame CD20 Citotossicità complemento-mediata Citotossicità cellulo-mediata Linfoma Non-Hodgkin

49 Farmaci target molecolari Gentuzumab Ozogamicin (Milotarg) Legame CD33+ Citotossicità come rituximab Leucemia mieloide acuta

50 Farmaci target molecolari Bortezomid (Velcade) Blocco del proteosoma Mieloma multiplo

51 Farmaci target molecolari Gefitinib (Iressa) Legame EGFR Tirosino-Chinasico Polmone Apparato digerente

52 Farmaci target molecolari Cetuximab (Erbitux) Legame EGFR Tirosino Chinasico Maggiore efficacia se su pezzo operatorio riscontro immunoistochimico di R1

53 Farmaci target molecolari Bevacizumab (Avastin) Legame VEGF Tutti i tumori solidi con prevalenza di quelli ipervascolarizzati

54 Farmaci target molecolari SU11248 (sperimentale) Legame VEGF Legame PDGF-R

55 Farmaci target molecolari BAY (sperimentale) Inibizione del RAFchinasi Promotore G proteins per effetto antiproliferativo ed antiangiogenetico Tutti i tumori

56 Farmaci target molecolari Batimastat, Barimastat, Ag3340, BAY (sperimentali) Inibitori delle metalloproteinasi intercellulari Inibizione angiogenetica Tutti i tumori

57 Farmaci target molecolari Farnesil difosfato analoghi, CAAXtetrapeptide analogo Inibitore della farnesil transferasi con interruzione dell attività della proteina RAS- H, RAS-K, RAS-N Blocco del messaggio recettoriale da EGF, PDGF, GM-CSF, IL2, IL3

58 Farmaci Molecolari Ormonali Estrogeni (Antagonisti ormonali) Dietil-Stilbestrolo Dietilen-estradiolo Fosfestrolo-tetrasodico Progestinici Medrossi-progesterone acetato (Provera, Farlutal) Megestrolo-Acetato (Megace) Noretisterone (non registrato in Italia)

59 Farmaci Molecolari Ormonali Inibitori delle aromatasi (impediscono conversione androgeni--> estrogeni) Aminoglutetimide NS (Orimeten) Anastrozolo NS (Arimidex) Letrozolo NS (Femara) Formestan S (Entaron) Esemestan S (Aromasin) Trilostato S (non registrato in Italia)

60 Farmaci Molecolari Ormonali Inibizione recettoriale, antagonista ormonale Tamoxifene (Nolvadex) Toremifene (Fareston) Fulvestrant (Fasiodex)

61 Farmaci Molecolari Ormonali Antiandrogeni, antagonisti ormonali Ciproterone (Androcur) Flutamide (Eulexin) Bicalutamide (Casudex)

62 Farmaci Molecolari Ormonali Inibitori LHRH, analoghi ormone di rilascio Buserelina (Suprefat) Goserelin (Zoladex) Leuprorelina (Enantone) Triptorelina (Decapeptil)

63 Blocco Proliferativo Blocco Angiogenetico Blocco Proliferativo Blocco Angiogenetico Somatostatina, Octreotide, Lanreotide, Vapreotide* Azione antiproliferativa: Diretta SST Indiretta IGFR Antiproliferativa Antiangiogenetica Antiproliferativa Antiangiogenetica Differenziante Differenziante FosforilazionePTP Inibizione Inattivazione ERK Inibizione (fosfotirosin fosfatasi) bfgf IGFR Inibizione:RAS (certa) Inibizione ENOS Inattivazione SRC (certo) Attivazione PI3K-AKT SRC (incerto) Ceramide UpRegolation P27 (incerto) espressione Ki67 (incerto) Defosforilazione ERK Inibizione di NO Inibizione enos-no G-Protein inibizione SHP-2 C-SRC

64 Grazie per la cortese attenzione

65 Il cancro è una malattia in cui le cellule sfuggono al meccanismo di controllo della crescita indispensabile per mantenere normale la struttura e le funzioni dei tessuti

66 Il concetto che il cancro sia una malattia genetica delle cellule somatiche ha trovato concretezza grazie agli studi di biologia molecolare e citogenetica molecolare. La prova della teoria della mutazione somatica è il frequente riscontro di aberrazioni cromosomiche nelle neoplasie solide, presentando peraltro un cariotipo molto più complesso rispetto alle neoplasie ematologiche e quindi i cambiamenti cromosomici tumore specifici si rendono più difficoltosi.

67 La tumorogenesi è infatti considerata come il risultato finale di eventi genetici multipli che portano le cellule alla perdita del controllo della crescita ed alla metastatizzazione.

68 Nelle cellule tumorali si riscontrano spesso deviazioni dal normale valore diploide dei cromosomi. Questi cambiamenti citogenetici interessano l aploidia o la morfologia dei cromosomi oppure combinazioni di entrambe le alterazioni. Le monosomie o le trisomie e polisomie appartengono al primo gruppo mentre delezioni, duplicazioni, inversioni e traslocazioni appartengono al secondo gruppo. In più certe regioni cromosomiche possono risultare amplificate e mostrarsi come regioni colorate omogeneamente all interno del braccio cromosomico o all esterno di esso.

69 La specificità dei cambiamenti cromosomici è dimostrata dal fatto che solo 71 delle 329 bande cromosomiche del genoma umano sono interessate da riarrangiamenti tumore associati. Inoltre molti oncogeni cellulari che sono stati localizzati su specifici cromosomi localizzano anche break-point neoplasia associati.

70 L analisi dei cromosomi di cellule tumorali ha evidenziato che solo il 15% presenta alterazioni del cariotipo. Questo dato però, apparentemente discrepante, trova una spiegazione nella tecnica di studio: infatti è difficile ottenere preparati di buona qualità a causa di problemi come l indice mitotico basso e crescita sproporzionata, oppure perché il cariotipo mostra alti numeri modali con molti markers cromosomici bizzarri che probabilmente riflettono l evoluzione del cariotipo ma parallelamente mascherano gli eventi specifici principali.

71 Al momento attuale due classi di geni sono coinvolte nello sviluppo e progressione del cancro: proto-oncogeni e tumor suppressors genes

72 I proto-oncogeni sono normali geni cellulari implicati nel controllo della crescita cellulare. Le mutazioni possono convertirli in oncogeni attivati sovrintendendo in moto patologico alla crescita delle cellule tumorali. Ad oggi sono stati individuati 70 protooncogeni, ed il loro bersaglio è localizzato in differenti compartimenti e funzioni della cellula quale il recettore per la crescita cellulare, i fattori di crescita cellulare, i sistemi di trasduzione intracellulari, i fattori di trascrizione e direttamente sulla proteine che sovrintendono il ciclo cellulare.

73 La mutazione che attiva il proto-oncogene è dovuta ad un aumento delle proteine del gene per imprevedibile espressione del gene e delezione del dominio regolatorio del gene oltre, come secondo meccanismo di trasformazione, vi è la transposizione per translocazione cromosomica. Vi è poi l amplificazione genica che porta ad una sovraespressione degli oncogeni.

74 I tumor suppressor genes formano una categoria di geni di recente scoperta. La loro inattivazione per mutazione libera i meccanismi di crescita negativi da loro esercitati. Il primo risultato che si ottiene è una linea germinale (tumore ereditario) o una mutazione somatica (tumore sporadico) che inattiva uno dei due alleli del gene. Il secondo evento è una mutazione somatica che inattiva la restante parte allelica: il cosiddetto allele selvaggio.

75 Questo è dovuto al fatto che la presenza dell allele selvaggio nella regione cromosomica sede di mutazione provoca la sua eliminazione. Ciò avviene per non disgiunzione, mancata ricombinazione mititoca o conversione genica.

76 Gli studi di genetica molecolare dimostrano come la sequenza adenoma-carcinoma nelle neoplasie colo-rettali sia caratterizzata da un sovrapporsi di eventi genetici distinti tra cui l attivazione di oncogeni e la inattivazione di Tumor Suppressors Genes. Occorrono quindi come avviene in altri tumori, il verificarsi di lesioni genetiche multiple.

77 Per valutare correttamente e quantizzare la perdita di alleli, bisogna testare tutti i cromosomi con almeno un marker DNA, ottenendo una controparte molecolare chiamata allelotipo.

78 Quale parametro quantitativo della perdita multipla di alleli, è stato introdotto il termine di perdita allelica frazionala (F.A.L.) che rappresenta la parte evidenziabile di cromosoma con perdita allelica per singolo tumore.

79 La aneuploidia rappresenta il segnale tipico dei tumori solidi e nello stesso tempo la sua associazione clinico patologica della malattia. Questo sembra si a generato od accompagnato da instabilità del genoma.

80 L evoluzione genetica dei tumori solidi sottostà a delle forze che sono state recentemente messe a fuoco da un lavoro di Shackney che ha sviluppato un modello computerizzato di simulazione temporale delle mutazioni che accompagnano la spontanea mutazione neoplastica. Il modello include la crescita cellulare, la divisione cellulare, la tetraploidizzazione, la perdita di cromosomi, lo sviluppo di aberrazioni strutturali cromosomiche.

81 Mentre la tetraploidizzazione non è il solo meccanismo messo in moto, la non disgiunzione mitotica può portare ad aneuploidia, rappresentando la via preferita di sviluppo di cloni ipodiploidi o iperdiploidi.

82 L instabilità genomica certamente gioca un ruolo centrale nell evoluzione clonale. Oltre all aumento numerico dei cromosomi, la ipometilazione e le mutazioni di uno specifico gene coinvolto nella divisione cellulare sono le teorie a sostegno.

83 I proto-oncogeni attivati sarebbero i candidati migliori per la crescita dose-dipendente con anormalità cromosomiche per l evoluzione di linee aneuploidi come avviene nel modello di Shackney.

84 L aumento di dosaggio del gene mutante, associato ad aneuploidia, è stato identificato in una doppia e sequenziale non disgiunzione del cromosoma dell oncogene attivato.

85 La destabilizzazione di normali cellule diploidi da parte di fattori genetici può sfociare in cloni near-diploidi o tetraploidi.

86 Entrambe queste vie possono sfociare in attivazione di oncogeni o inattivazione di Tumor Suppressors Genes. Le cellule così configurate possono crescere e moltiplicarsi come linea dominante.

87 Analogamente si è dimostrata una forte correlazione tra aneuploidia ed inattivazione di Tumor Suppressors Genes.

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula Mediatore chimico Recettore Trasduzione del segnale Risposta della cellula I mediatori chimici sono prodotti da cellule specializzate e sono diffusi nell organismo da apparati di distribuzione Sistemi

Dettagli

TRASDUZIONE DEL SEGNALE LE PRINCIPALI MOLECOLE CHE PROVVEDONO ALLO SCAMBIO DI INFORMAZIONI TRA LE CELLULE SONO FATTORI SOLUBILI QUALI NEUROTRASMETTITORI, ORMONI, FATTORI DI CRESCITA, CITOCHINE. UN CASO

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz www.fisiokinesiterapia.biz FARMACODINAMICA La farmacodinamica può essere definita come lo studio degli effetti biochimici e fisiologici dei farmaci e dei loro meccanismi d azione. Gli obiettivi dell analisi

Dettagli

scaricato da www.sunhope.it

scaricato da www.sunhope.it Recettori a tirosina chinasi I recettori a tirosina chinasi presentano vari domini Una regione di legame (extracellulare) Una regione transmembrana Una coda intracellulare con numerose tirosine scaricato

Dettagli

04/04/14. Fondamenti di biochimica Terza edizione. Le ghiandole principali del sistema endocrino. Capitolo 13 La segnalazione biochimica

04/04/14. Fondamenti di biochimica Terza edizione. Le ghiandole principali del sistema endocrino. Capitolo 13 La segnalazione biochimica Fondamenti di biochimica Terza edizione Donald Voet Judith G. Voet Charlotte W. Pratt La segnalazione biochimica Copyright 2013 Zanichelli editore S.p.A. Gli ormoni Conce& chiave 13.1 Gli ormoni endocrini

Dettagli

Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse

Dettagli

Farmacodinamica. Mariapia Vairetti. Dipartimento di Medicina Interna e Terapia Sezione di Farmacologia e Tossicologia Cellulare e Molecolare

Farmacodinamica. Mariapia Vairetti. Dipartimento di Medicina Interna e Terapia Sezione di Farmacologia e Tossicologia Cellulare e Molecolare Farmacodinamica Mariapia Vairetti Dipartimento di Medicina Interna e Terapia Sezione di Farmacologia e Tossicologia Cellulare e Molecolare Perchè una sostanza ha una determinata azione o tossicità? Farmacodinamica

Dettagli

Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione

Dettagli

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi Ciclo Cellulare M --> G1--> S --> G2 --> M S, G2 e M hanno durata sempre uguale mentre la fase G1 (in media 10 ore) può subire enormi variazioni da tessuto a tessuto (fino a migliaia di ore per i neuroni).

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la

Dettagli

Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili.

Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. La sensibilita delle vie di trasduzione dipende da 3 fattori: -l affinita

Dettagli

Prof.ssa Adriana Albini Angiogenesi come target di terapia LA TERAPIA BIOLOGICA MIRATA: LE PREMESSE

Prof.ssa Adriana Albini Angiogenesi come target di terapia LA TERAPIA BIOLOGICA MIRATA: LE PREMESSE Prof.ssa Adriana Albini Angiogenesi come target di terapia LA TERAPIA BIOLOGICA MIRATA: LE PREMESSE Anche se la base comune delle neoplasie è rappresentata dalla crescita incontrollata di cellule trasformate,

Dettagli

Prof. Maria Alessandra Santucci

Prof. Maria Alessandra Santucci La famiglia Abl consiste di due isoforme Abl (1a e 1b ) e due isoforme Arg (1a e 1b). Le isoforme di tipo b contengono un sito di miristoilazione all N-teminale che manca nelle isoforme a. c-abl è una

Dettagli

Her-2 nel carcinoma mammario

Her-2 nel carcinoma mammario Her-2 nel carcinoma mammario Piera Balzarini U.O. Anatomia Patologica Università degli Studi di Brescia Spedali Civili di Brescia Il gene ERBB2 dà origine ad un recettore tirosin-chinasico appartenente

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Corso di recupero Fisiologia cellulare/ Laboratorio di colture cellulari

Corso di recupero Fisiologia cellulare/ Laboratorio di colture cellulari Corso di laurea magistrale in BIOTECNOLOGIE DELLA RIPRODUZIONE UNIVERSITA DEGLI STUDI DI TERAMO Corso di recupero Fisiologia cellulare/ Laboratorio di colture cellulari Prof.ssa Luisa Gioia COMUNICAZIONE

Dettagli

Recettori di superficie

Recettori di superficie Recettori di superficie Esistono 3 classi principali di recettori di superficie 1. Recettori annessi a canali ionici 2. Recettori accoppiati alle proteine G 3. Recettori associati ad enzimi Recettori

Dettagli

Si verificano in tutte le classi di vertebrati ed invertebrati

Si verificano in tutte le classi di vertebrati ed invertebrati Genetica dei tumori Si verificano in tutte le classi di vertebrati ed invertebrati Sarcomi e carcinomi sono stati riscontrati in alcune mummie egiziane e vengono descritti nei papiri. I Greci erano a conoscenza

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici www.fisiokinesiterapia.biz Fattori estrinseci Ambiente Danno genotossico

Dettagli

Meccanismi di controllo della proliferazione cellulare

Meccanismi di controllo della proliferazione cellulare Meccanismi di controllo della proliferazione cellulare Il ciclo cellulare è regolato dall azione di PROTOONCOGENI e (attivatori della proliferazione cellulare) GENI ONCOSOPPRESSORI (inibitori del ciclo

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

BYE BYE CHEMIOTERAPIA!!.ARRIVANO LE BOMBE INTELLIGENTI!!! A A CURA DI ORIANA SURDO

BYE BYE CHEMIOTERAPIA!!.ARRIVANO LE BOMBE INTELLIGENTI!!! A A CURA DI ORIANA SURDO BYE BYE CHEMIOTERAPIA!!.ARRIVANO LE BOMBE INTELLIGENTI!!! A A CURA DI ORIANA SURDO Cancro «Massa abnormale di tessuto che cresce in eccesso e in modo scoordinato rispetto ai tessuti normali, e persiste

Dettagli

COMPARAZIONE DELLA METODICA AUTOMATICA SISH

COMPARAZIONE DELLA METODICA AUTOMATICA SISH COMPARAZIONE DELLA METODICA AUTOMATICA SISH (Silver Enhanced In Situ Hybridization) CON LA METODICA MANUALE FISH (Fluorescence In Situ Hybridization) PER LA VALUTAZIONE DELLO STATO DEL GENE HER2 (neu)

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

SEBASTIANO FILETTI. Dipartimento di Medicina Interna e Specialità Mediche. Università di Roma Sapienza, Roma

SEBASTIANO FILETTI. Dipartimento di Medicina Interna e Specialità Mediche. Università di Roma Sapienza, Roma SEBASTIANO FILETTI Dipartimento di Medicina Interna e Specialità Mediche Università di Roma Sapienza, Roma La malattia tiroidea è in aumento negli ultimi anni. Quali le ragioni? Dati epidemiologici provenienti

Dettagli

Neoplasie della mammella - 2

Neoplasie della mammella - 2 Neoplasie della mammella - 2 Fattori prognostici Numero di N+ : >3 Età e stato menopausale Diametro di T Invasione linfatica e vascolare Tipo istologico Grading Recettore per Estrogeni/Progesterone Amplificazione

Dettagli

Ricerca di bersagli per la terapia sistemica del mesotelioma

Ricerca di bersagli per la terapia sistemica del mesotelioma Ricerca di bersagli per la terapia sistemica del mesotelioma Searching for targets for the systemic therapy of mesothelioma Stahel RA, Weder W, Felley- Bosco E, Petrausch U, Curioni-Fontecedro A, Schmitt-Opitz

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Biochimica Strutturale con Elementi di Enzimologia corso integrato di Struttura e Funzione delle Macromolecole Biologiche

Biochimica Strutturale con Elementi di Enzimologia corso integrato di Struttura e Funzione delle Macromolecole Biologiche Biochimica Strutturale con Elementi di Enzimologia corso integrato di Struttura e Funzione delle Macromolecole Biologiche Codice Disciplina : BT019 Settore : BIO/10 N CFU: 6 Codice Corso integrato : BT067

Dettagli

Modellazione dinamica e strumenti per la valutazione sperimentale del comportamento della via EGFR-IGF1R per la linea cellulare H1650

Modellazione dinamica e strumenti per la valutazione sperimentale del comportamento della via EGFR-IGF1R per la linea cellulare H1650 Università deglistudidiperugia FacoltàdiIngegneria Tesi di Laurea Magistrale in Ingegneria Informatica e dell Automazione Anno Accademico 2011/2012 Modellazione dinamica e strumenti per la valutazione

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

Trasduzione del Segnale da Recettori di Superfice

Trasduzione del Segnale da Recettori di Superfice Trasduzione del Segnale da Recettori di Superfice MEMBRANA 1. Legame recettore-ligando 2. oligomerizzazione 3. Attivazione TYR-K -Dominio citosolico dei RTK -Reclutamento TYR-K (src, jak, fak, abl) 4.

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

La comunicazione intercellulare: gli ormoni ed i recettori. Copyright (c) by W. H. Freeman and Company

La comunicazione intercellulare: gli ormoni ed i recettori. Copyright (c) by W. H. Freeman and Company La comunicazione intercellulare: gli ormoni ed i recettori La trasduzione del segnale: processo che converte i segnali extracellulari in risposte cellulari. La comunicazione mediante segnali extracellulari

Dettagli

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

TRATTAMENTO ED ASSISTENZA ALLA DONNA CON NEOPLASIA MAMMARIA NELLA SUA GLOBALITA

TRATTAMENTO ED ASSISTENZA ALLA DONNA CON NEOPLASIA MAMMARIA NELLA SUA GLOBALITA TRATTAMENTO ED ASSISTENZA ALLA DONNA CON NEOPLASIA MAMMARIA NELLA SUA GLOBALITA Luigi Salvagno U.O. di Oncologia ANATOMIA DELLA GHIANDOLA MAMMARIA PROGRESSIONE TUMORALE La progressione neoplastica richiede

Dettagli

I geni del cancro. Il tumore è causato da squilibrio fra divisione e morte cellulare. Numero di divisioni cellulari. Numero di morti cellulari

I geni del cancro. Il tumore è causato da squilibrio fra divisione e morte cellulare. Numero di divisioni cellulari. Numero di morti cellulari I geni del cancro Il tumore è causato da squilibrio fra divisione e morte cellulare Numero di divisioni cellulari Numero di morti cellulari Aumento della popolazione cellulare Eccesso di mitosi e/o difetto

Dettagli

Citochine dell immunità specifica

Citochine dell immunità specifica Citochine dell immunità specifica Proprietà biologiche delle citochine Sono proteine prodotte e secrete dalle cellule in risposta agli antigeni Attivano le risposte difensive: - infiammazione (immunità

Dettagli

Evasione apoptosi. Angiogenesi

Evasione apoptosi. Angiogenesi Il cancro rappresenta un gruppo d malaae che comprende almeno 100 Bpi differenb di tumori. A secondo del tessuto di origne si classificano tre Bpi principali di tumori: in tessub epiteliali: Carcinoma

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

1. Capacità di autorinnovamento illimitato

1. Capacità di autorinnovamento illimitato 1. Capacità di autorinnovamento illimitato 2. Capacità di dare origine in risposta a stimoli adeguati e specifici a cellule progenitrici di transito dalle quali discendono popolazioni di cellule altamente

Dettagli

La trasduzione del segnale

La trasduzione del segnale Latrasduzionedelsegnale AlesandraPontillo,LaboratorioImmunologiaPediatrica,IRCCSBurloGarofolo pontillo@burlo.trieste.it Lez.1:4/12/2006www.pediatria.univ.trieste.it/didattica/biol/ppt/genfunz_06_09.ppt

Dettagli

The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione

Dettagli

PATOLOGIA MOLECOLARE

PATOLOGIA MOLECOLARE Diagnosi rischio individuale diagnosi precoce PATOLOGIA MOLECOLARE prognosi therapia singolo paziente Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail.

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

CICLO CELLULARE EUCARIOTICO

CICLO CELLULARE EUCARIOTICO CICLO CELLULARE EUCARIOTICO COMPESSO SISTEMA DI CONTROLLO OMEOSTASI ORGANISMO NORMALE G 0 CANCRO DNA marcato con molecole intercalanti fluorescenti Fluorescence Activated Cell Sorting (FACS) Rilevazione

Dettagli

Tipi di neurotrasmettitori

Tipi di neurotrasmettitori Tipi di neurotrasmettitori Neurotrasmettitori classici: molecole a basso peso molecolare, di varia natura: acetilcolina amine biogene (dopamina, adrenalina, noradrenalina) istamina aminoacidi (GABA, glicina,

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Riparazione del DNA ed insorgenza di tumori Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Danni al DNA e cancro Le cellule tumorali L importanza della stabilità

Dettagli

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4 Indice Prefazione XIII Protein Data Bank: una nota degli autori XIV Nota all edizione italiana XV Ringraziamenti XVI CAPITOLO 1 Dalla sequenza alla struttura 1.0 Visione d insieme: funzione e architettura

Dettagli

FARMACOLOGIA Oncologica. www.baveno.net by G.B.

FARMACOLOGIA Oncologica. www.baveno.net by G.B. Oncologica www.baveno.net by G.B. Agg: settembre 2015 AVVERTENZE 2 I contenuti della presentazione sono estrapolati da materiale esistente, redatti e verificati da personale sanitario Le informazioni fornite

Dettagli

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE Servizio Risorse Umane e Relazioni Sindacali delegato dal Direttore Generale dell Azienda con

Dettagli

LEGA ITALIANA PER LA LOTTA CONTRO I TUMORI

LEGA ITALIANA PER LA LOTTA CONTRO I TUMORI LEGA ITALIANA PER LA LOTTA CONTRO I TUMORI Il Consiglio Direttivo Nazionale LILT, nella seduta del 19 marzo 2015, ha formalmente approvato la documentazione relativa ai lavori della Commissione tecnico-scientifica

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

Proteine di interesse terapeutico

Proteine di interesse terapeutico Proteine di interesse terapeutico Proteine come farmaci (es. insulina, anticorpi, ormoni, anticoagulanti, fattori della coagulazione) Proteine come antigeni per la produzione di vaccini (es. HBsAg) La

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Messaggeri proteici e Recettori di membrana: Meccanismi di trasduzione del segnale

Messaggeri proteici e Recettori di membrana: Meccanismi di trasduzione del segnale Messaggeri proteici e Recettori di membrana: Meccanismi di trasduzione del segnale Figure e tabelle: Becker et al. ; Il mondo della cellula EdiSES Wolfe, Biologia molecolare e cellulare - EdiSES Le cellule

Dettagli

Cosa sono i Macatori Tumorali?

Cosa sono i Macatori Tumorali? Marcatori tumorali Cosa sono i Macatori Tumorali? Sostanze biologiche sintetizzate e rilasciate dalle cellule tumorali o prodotte dall ospite in risposta alla presenza del tumore Assenti o presenti in

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti

Dettagli

Progetto Tesi di Master Dr. Zamir KADIJA

Progetto Tesi di Master Dr. Zamir KADIJA Progetto Tesi di Master Dr. Zamir KADIJA Profilo mutazionale di oncogeni candidati nel carcinoma broncogeno non-a-piccole cellule condotto su campioni ottenuti mediante biopsia endobronchiale ed agoaspirato

Dettagli

Gallarate 11 giugno 2011 ASSOCIAZIONE ITALIANA TECNICI di ISTOLOGIA e CITOLOGIA

Gallarate 11 giugno 2011 ASSOCIAZIONE ITALIANA TECNICI di ISTOLOGIA e CITOLOGIA SEZIONE LOMBARDA Aggiornamenti 2011 Corso di aggiornamento per Tecnici di Laboratorio Gallarate 11 giugno 2011 ASSOCIAZIONE ITALIANA TECNICI di ISTOLOGIA e CITOLOGIA Azienda Ospedaliera S. Antonio Abate

Dettagli

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA.

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia

Dettagli

Virus Oncogeni. Ciclo vitale litico. Per la maggior parte dei virus è vero: proteine virali. Replicazione Lisi Progenie virale

Virus Oncogeni. Ciclo vitale litico. Per la maggior parte dei virus è vero: proteine virali. Replicazione Lisi Progenie virale Virus Oncogeni Per la maggior parte dei virus è vero: Genoma proteine virali Replicazione Lisi Progenie virale Ciclo vitale litico 1 Virus Oncogeni Ciclo vitale latente Virus Cellula Integrazione (generalmente)

Dettagli

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi IV Congresso Regionale I Congresso del Middle Management di Area Tecnica Federazione Italiana Tecnici di Laboratorio Biomedico Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi Dott.ssa

Dettagli

Gravedona 22 ottobre 2010. Ruolo dei farmaci anti HER 2. Marilena Visini- Renato Ciotti Oncologia Medica-Ospedale A.Manzoni-Lecco

Gravedona 22 ottobre 2010. Ruolo dei farmaci anti HER 2. Marilena Visini- Renato Ciotti Oncologia Medica-Ospedale A.Manzoni-Lecco Gravedona 22 ottobre 2010 Ruolo dei farmaci anti HER 2 Marilena Visini- Renato Ciotti Oncologia Medica-Ospedale A.Manzoni-Lecco LONG SURVIVORS IN MBC FARMACI ANTI HER2 TUMORE MAMMELLA 1950 Diagnosi Operabile

Dettagli

Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro

Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Le chinasi ATM e ATR sono coordinatrici di un fine meccanismo di controllo noto come checkpoint del

Dettagli

Fattori di crescita FATTORI DI CRESCITA. Recettori

Fattori di crescita FATTORI DI CRESCITA. Recettori FATTORI DI CRESCITA FATTORI DI CRESCITA Fattori di crescita FATTORI DI CRESCITA Recettori FATTORI DI CRESCITA Proliferazione Differenziamento FATTORI DI CRESCITA? Come fa una interazione tra due molecole

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

ONCOLOGIA MEDICA. Terapia medica Radioterapia

ONCOLOGIA MEDICA. Terapia medica Radioterapia ONCOLOGIA MEDICA Terapia medica Radioterapia Tipi di terapia medica Chemioterapia Ormonoterapia Immunoterapia Terapie biologiche e molecolari ( targeted therapy ) Terapie di supporto e palliative (+ varie

Dettagli

Analisi della Malattia Minima Residua

Analisi della Malattia Minima Residua XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Analisi della Malattia Minima Residua Dr.ssa Anna Gazzola Laboratorio di Patologia Molecolare, Sezione di Emolinfopatologia,

Dettagli

Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico

Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico rocessi biologici in cui sono coinvolti sistemi a due componenti Utilizzazione di elementi necessari alla crescita (azoto); NtrC Virulenza (BvgAS di Bordetella pertussis) Resistenza a metalli pesanti (pco)

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

INVECCHIAMENTO come PROCESSO FISIOLOGICO INVECCHIAMENTO DOVUTO ALL INSORGENZA DI PATOLOGIE. - malattie cardiovascolari - cancro

INVECCHIAMENTO come PROCESSO FISIOLOGICO INVECCHIAMENTO DOVUTO ALL INSORGENZA DI PATOLOGIE. - malattie cardiovascolari - cancro INVECCHIAMENTO come PROCESSO FISIOLOGICO INVECCHIAMENTO DOVUTO ALL INSORGENZA DI PATOLOGIE - malattie cardiovascolari - cancro Il processo di BIOSENESCENZA implica le caratteristiche seguenti: 1. è deleterio

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

forme diabetiche Diabete di tipo I o magro o giovanile (IDDM): carenza primaria di insulina, più frequente nei giovani e nei bambini. Il deficit insulinico consegue (per predisposizione ereditaria o per

Dettagli

Elenco dei test di patologia cromosomica e molecolare

Elenco dei test di patologia cromosomica e molecolare Elenco dei test di patologia cromosomica e molecolare Test Metodo utilizzato Osservazioni, indicazioni Amplificazione genica Her2/neu nei carcinoma mammari e gastrici L amplificazione genica di Her2/neu

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

La ricerca clinica nell ambito di una Rete Regionale. Lucio Crinò

La ricerca clinica nell ambito di una Rete Regionale. Lucio Crinò Conferenza Programmatica Regionale per l Oncologia La ricerca clinica nell ambito di una Rete Regionale Lucio Crinò Direttore S.C. di Oncologia Medica Azienda Ospedaliera di Perugia Perugia, 30 ottobre

Dettagli

Dr. ssa Roberta Sarmiento

Dr. ssa Roberta Sarmiento ANIMALI E UOMO ALLEATI CONTRO IL CANCRO: ATTUALITA E NUOVE PROSPETTIVE I tumori in medicina comparata: oncogenesi spontanea umana ed animale Dr. ssa Roberta Sarmiento U.O. Oncologia San Filippo Neri, Roma

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

Prof. Maria Nicola GADALETA DISPENSA N. 18

Prof. Maria Nicola GADALETA DISPENSA N. 18 Prof. Maria Nicola GADALETA E-mail: m.n.gadaleta@biologia.uniba.it Facoltà di Scienze Biotecnologiche Corso di Laurea in Biotecnologie Sanitarie e Farmaceutiche Biochimica e Tecnologie Biochimiche DISPENSA

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Proteine da stress e chaperon molecolari

Proteine da stress e chaperon molecolari Proteine da stress e chaperon molecolari Sono state recentemente descritte alcune proteine che sono coinvolte in generale nel ripiegamento di altre proteine. Furono, in origine, descritte come proteine

Dettagli

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

Introduzione. Colture cellulari in vitro: cellule isolate dal loro ambiente e messe in condizioni di vivere all'interno di un sistema definito

Introduzione. Colture cellulari in vitro: cellule isolate dal loro ambiente e messe in condizioni di vivere all'interno di un sistema definito Colture Cellulari Introduzione Colture cellulari in vitro: cellule isolate dal loro ambiente e messe in condizioni di vivere all'interno di un sistema definito strumento fondamentale per studi biochimici,

Dettagli

Terapie a bersaglio molecolare nel tumore del polmone

Terapie a bersaglio molecolare nel tumore del polmone Terapie a bersaglio molecolare nel tumore del polmone I A Cura di: Simona Carnio Divisione di Oncologia Toracica - A.O.U. San Luigi - Orbassano (TO) Silvia Novello Dipartimento di Oncologia - Università

Dettagli