Lezione 8. DNA sequencing informatics

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Lezione 8. DNA sequencing informatics"

Transcript

1 Lezione 8 DNA sequencing informatics

2 Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO NEXGDS)

3 History of sequencing informatics Algorithms for sequencing alignment Needleman and Wunsch (1970) Smith-Waterman (1981) Database searching FASTA, BLAST Tools to work with sanger sequencing STADEN package, DNA sequence assembly programs (ex. Sequencer, Mac vector, PC/Gene..) Phred/Phrap

4 Phred/Phrap cross_match, consed Sanger sequences from ABI With funding from the Human Genome Project (HGP) the University of Washington (Seattle) developed a set of bioinformatics tools for processing raw sanger sequences collected by ABI sequencing machines and for assembling overlapping reads into larger contigs Released ad a C source code suitable for compilation by skilled users on unix-based computers

5 Sanger sequences from ABI PHRED SCORE q = -10 Log 10 p PHRED Base calling + quality score Dove p è la probabilità di errore associata ad ogni base Quale sarà il Phred Score di una base chiamata con una probabilità di errore di 1/100 (accuratezza del 99%)? E di una con una p di 1/1000? q = 20 nel primo caso -> minimo considerato accettabile q = 30 nel secondo -> da 30 in su la qualità si considera alta

6 Sanger sequences from ABI PHRED Frammenti assemblati in contigs (Smith-Waterman algorithm+ some concepts from FASTA and BLAST) Base calling + quality score PHRAP CONSED GRAPHICAL EDITOR

7 Sanger sequences from ABI

8 Cosa è rimasto di tutto questo nelle analisi di dati prodotti da sequenziamenti NGS?

9 Analisi di dati NGS: Analytic flow 1. Produzione dei dati grezzi (raw data, reads) dal sequenziatore 2. Allineamento delle reads con un riferimento o tra loro (de novo) 3. Visualizzazione degli allineamenti e identificazione dei polimorfismi (se previsto dal progetto) 4. Interpretazione sulla base delle ipotesi e delle domande biologiche di partenza

10 De novo

11 1. Raw sequence Imaging (Illumina, 454, solid) or Ion detection (Ion torrent, Proton) I dati contengono 3 informazioni fondamentali: ID (identificatore individuale del campione) Sequenza Stima della qualità per ogni base chiamata Formato: FASTQ

12 FASTQ format formato di testo che include sia la sequenza (in genere nucleotidica) che la qualità di ogni base (score). Line 1: inizia con il carattere seguito da un identificatore e da una descrizione opzionale (come la linea del titolo nel formato FASTA). Line 2: raw sequence letters. Line 3: inizia col carattere '+' che può essere seguito da una descrizione (opzionale). Line 4: codifica la qualità della sequenza (PHRED SCORE) nella Line 2, deve contenere un numero di simboli pari al numero di lettere in 2:N:0:GCTGAGA GTTCATCTTGGCAGCTGGTTCCCGTATTTACTGAAGAGTATGTAGCACTTGCGTCGCTCGTGATTGAAAACAGATGGCAGCACGACACGGGCACGGTGCG

13 2. Allineamento In generale la parte più impegnativa dell analisi dei dati NGS La scelta dell algoritmo dipende da che tipo di dato abbiamo: de novo o con sequenza di riferimento? La sequenza di riferimento è vicina evolutivamente? Etc..

14 Alcuni programmi di allineamento per dati NGS Burrows Wheeler Transformation (BWT) based aligners: BWA, Bowtie, SOAP2 Allineamento di corte sequenze (tipico prodotto di NGS) ad un riferimento BWA produce un allineamento in SAM format, non chiama i siti polimorfici

15

16

17 Formato output di allineamento: SAM sequence alignment/map format De novo I file SAM sono molto grandi (comunemente decine di Gigabytes) -> si usa comprimerli per salvare spazio Contiene un titolo (opzionale) e una linea per ogni read con con 11 campi obbligatori

18

19

20

21

22 SAM files sono human-readable text files, i BAM files sono il loro equivalente binario, compresso e più adatto ad essere utilizzato dai programmi di analisi che operano i passaggi successivi.

23 De novo alignment Non c è una sequenza di riferimento Si usano comunemente approcci basati su de Brujin digraphs (capitolo 4 NGS DNA sequencing informatics) Ci sono diversi softwares, riprenderemo il problema durante la parte pratica

24 3. Visualizzazione degli allineamenti ed eventuale variant calling/genotyping Spesso per fare queste analisi esistono dei PACCHETTI di programmi che permettono di effettuare molti passaggi come visualizzazione, identificazione delle varianti, esclusione di artefatti Di seguito vedremo degli esempi, ma l elenco è ancora lungo

25 SAMtools Insieme di strumenti per interagire con ed effettuare il post processing di allineamenti di corte sequenze di DNA in formati SAM, BAM e CRAM. Questi files sono generati come output di allineatori di corte reads come BWA. Include sia strumenti semplici che complessi (variant calling, alignment viewing, sorting, indexing, data extraction, format conversion) Variant calling: Finding sequence variation within and between samples (SNPs, InDel..)

26 GATK (Genome Analysis Toolkit) Software package sviluppato al Broad Institute per analizzare dati di sequenza high-throughput. Il toolkit offre una vasta gamma di strumenti, principalmete focalizzati sulla scoperta di varianti e sulla genotipizzazione, con grande enfasi alla garanzia della qualità del dato.

27 Lo useremo nelle esercitazioni pratiche

28 Java-based stand-alone desktop software del Broad Institute che può visualizzare dati NGs in una varietà di formati (FASTA, FASTQ, SAM, BAM) Facile da installare (c è una versione anche per ipad!) I genomi di riferimento e le relative annotazioni devono essere installate manualmente

29 Robinson et al. Nature Biotechnology 29, (2011) Coverage plot and alignments from paired-end reads for a matched tumor/normal pair. Sequencing was performed on an Illumina GA2 platform and aligned with Maq (http://maq.sourceforge.net/). Alignments are represented as gray polygons with reads mismatching the reference indicated by color. Loci with a large percentage of mismatches relative to the reference are flagged in the coverage plot as color-coded bars. Alignments with unexpected inferred insert sizes are indicated by color. There is evidence for a ~10-kb deletion (removing two exons of AIDA) in the tumor sample not present in the normal.

30 BWA SAM tools GATK https://www.broadinstitute.org/gatk/

Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

DNA sequencing. Reading Genomes. Giovanni Bacci

DNA sequencing. Reading Genomes. Giovanni Bacci Reading Genomes Giovanni Bacci Evoluzione del sequenziamento 1977 Frederick Sanger Prima tecnica di sequenziamento 1987 Applyed Biosystems Prima macchina automatica per il sequenziamento del DNA 1998 Phil

Dettagli

Bioinformatica (modulo bioinf. dei genomi moderni )

Bioinformatica (modulo bioinf. dei genomi moderni ) Bioinformatica (modulo bioinf. dei genomi moderni ) Dr. Marco Fondi Lezione # 5 Corso di Laurea in Scienze Biologiche, AA 2011-2012 giovedì 3 novembre 2011 1 Sequenziamento ed analisi di genomi: la genomica

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

Corso di Elementi di Bionformatica

Corso di Elementi di Bionformatica Corso di Elementi di Bionformatica Laurea Triennale in Informatica Il formato FASTQ per la qualità delle sequenze Anno Accademico 2015-2016 Docente del laboratorio: Raffaella Rizzi 1 La qualità delle sequenze

Dettagli

Avanzamento dei sistemi di sequenziamento

Avanzamento dei sistemi di sequenziamento Avanzamento dei sistemi di sequenziamento Sistemi di sequenziamento capillare basati su: Lunghezza delle read: 800 basi Poche sequenze prodotte in una singola corsa Second Generation Sequencing (SGS):

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Elementi di Bioinformatica per lʼanalisi di dati NGS

Elementi di Bioinformatica per lʼanalisi di dati NGS Corso di Alta formazione in Elementi di Bioinformatica per lʼanalisi di dati NGS 21-23 Settembre 2011 Centro Didattico Morgagni Viale Morgagni 40, Firenze Presentazione del corso Il corso di alta formazione

Dettagli

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL Alcuni aspetti legati al calcolo bioinformatico su CRESCO Giuseppe Aprea UTMEA-CAL Principali attività bioinformatiche ENEA legate al calcolo Assemblaggio de Novo* Trascrittomica Analisi filogenetica Metagenomica*

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Metodologie informa/che per l analisi dei genomi

Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Perchè sono qui? Walter Sanseverino, CEO at !? Informa/cs = Genomics? We have a problem!!! Focus curve

Dettagli

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015 Next Generation Sequencers: from the bacterial culture to raw data Valeria Michelacci NGS course, June 2015 COSTS ASSOCIATED WITH DNA SEQUENCING 80-100 $ per Bacterial Genome!! Benefits from NGS Massive

Dettagli

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq):

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): Il vostro progetto Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): 1. Analisi di qualità 2. Mappatura sul genoma 3. Calcolo dell espressione 4. Test di espressione differenziale 5. Visualizzazione

Dettagli

Bioinformatica NGS Next Generation Sequencing

Bioinformatica NGS Next Generation Sequencing NGS Next Generation Sequencing NGS Le tecnologie di sequenziamento di DNA rappresentano uno strumento fondamentale per la ricerca nel campo della genetica e della biologia molecolare; Dal 2005, piattaforme

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Università degli Studi di Padova Dipartimento di Ingegneria dell Informazione Corso di Laurea in Ingegneria dell Informazione Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Laureando:

Dettagli

Conexio Assign per TruSight HLA - Nozioni di base: Trascrizione della Narrazione

Conexio Assign per TruSight HLA - Nozioni di base: Trascrizione della Narrazione 1 Conexio Assign per TruSight HLA - Nozioni di base: Trascrizione della narrazione Benvenuti Obiettivi del corso Benvenuti al corso Conexio Assign per TruSight HLA. Il corso copre gli elementi essenziali

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Guida di riferimento del software MiSeq Reporter per i saggi IVD

Guida di riferimento del software MiSeq Reporter per i saggi IVD Guida di riferimento del software MiSeq Reporter per i saggi IVD PER USO DIAGNOSTICO IN VITRO DI PROPRIETÀ DI ILLUMINA N. codice 15038356 Rev. A ITA Marzo 2014 Questo documento e il suo contenuto sono

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Compilatore risorse display grafico LCD serie IEC-line

Compilatore risorse display grafico LCD serie IEC-line Compilatore risorse display grafico LCD serie IEC-line aggiornamento: 22-11-2012 IEC-line by OVERDIGIT overdigit.com 1. Il display grafico LCD I PLC della serie IPC-line possono disporre opzionalmente

Dettagli

Sequence Alignment Algorithms

Sequence Alignment Algorithms Sequence Alignment Algorithms Algoritmi per l Allineamento di Sequenze Relatore: Prof. Giancarlo Mauri Correlatore: Prof. Gianluca Della Vedova Tesi di Laurea di: Mauro Baluda Matricola 038208 Part of

Dettagli

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Summer School 2015 Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Applicazioni della Next-Generation Sequencing con tecnologia Illumina Roberto Cusano 04-06

Dettagli

Introduzione al Python

Introduzione al Python Andrea Passerini passerini@disi.unitn.it Informatica Caratteristiche procedurale si specifica la procedura da eseguire sui dati strutturato concetto di visibililtà delle variabili orientato agli oggetti

Dettagli

Tecniche biofisiche basate su nanopori

Tecniche biofisiche basate su nanopori Tecniche biofisiche basate su nanopori -Pori di dimensione nanometrica -Attraverso membrane lipidiche o inorganiche -Di natura proteica o scavati con tecnologie top-down Possono essere impiegati per -Studiare

Dettagli

Analisi dei dati MLPA con il nuovo Coffalyser.NET. MRC-Holland

Analisi dei dati MLPA con il nuovo Coffalyser.NET. MRC-Holland Analisi dei dati MLPA con il nuovo Coffalyser.NET MRC-Holland Contenuti Che cos è il Coffalyser.NET Analisi dei frammenti e del Copy number Interpretazione dei dati Che cos è il Cofffalyser.NET Software

Dettagli

UNA BASE DATI PER IL KNOWLEDGE DISCOVERY IN GENETICA MEDICA

UNA BASE DATI PER IL KNOWLEDGE DISCOVERY IN GENETICA MEDICA Alma Mater Studiorum Università dibologna SCUOLA DI SCIENZE Corso di Laurea in Informatica Magistrale UNA BASE DATI PER IL KNOWLEDGE DISCOVERY IN GENETICA MEDICA Tesi di Laurea in Complementi di Basi di

Dettagli

Bioinformatica: DNA e Algoritmi

Bioinformatica: DNA e Algoritmi Bioinformatica: DNA e Algoritmi Alberto Policriti Dpt. of Mathematics and Informatics, University of Udine. Applied Genomics Institute Di cosa parleremo In generale Deniamo i termini: DNA & Algoritmi Tecnologie

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

Modellistica Medica. Maria Grazia Pia INFN Genova. Scuola di Specializzazione in Fisica Sanitaria Genova Anno Accademico 2002-2003

Modellistica Medica. Maria Grazia Pia INFN Genova. Scuola di Specializzazione in Fisica Sanitaria Genova Anno Accademico 2002-2003 Modellistica Medica Maria Grazia Pia INFN Genova Scuola di Specializzazione in Fisica Sanitaria Genova Anno Accademico 2002-2003 Lezione 1 Introduzione al corso Obiettivi Programma Esercitazioni Prerequisiti

Dettagli

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle

Dettagli

Richiami di informatica e programmazione

Richiami di informatica e programmazione Richiami di informatica e programmazione Il calcolatore E una macchina usata per Analizzare Elaborare Collezionare precisamente e velocemente una grande quantità di informazioni. Non è creativo Occorre

Dettagli

Manuale Knowledge Base

Manuale Knowledge Base (Riservato a rivenditori e agenzie) Versione Luglio 2010 SOMMARIO Introduzione... 2 Accesso... 2 Menu Conoscenze... 3 Bacheca... 4 Voci di menu... 5 Ricerca... 5 Ricerca Semplice... 6 Ricerca avanzata...

Dettagli

Politecnico di Milano

Politecnico di Milano Politecnico di Milano Scuola di Ingegneria Industriale e dell Informazione - Milano Leonardo Corso di Studi in Ingegneria Matematica Analisi di forma dei profili ChIP-Seq Relatore: Prof. Piercesare Secchi

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Modulo. Programmiamo in Pascal. Unità didattiche COSA IMPAREREMO...

Modulo. Programmiamo in Pascal. Unità didattiche COSA IMPAREREMO... Modulo A Programmiamo in Pascal Unità didattiche 1. Installiamo il Dev-Pascal 2. Il programma e le variabili 3. Input dei dati 4. Utilizziamo gli operatori matematici e commentiamo il codice COSA IMPAREREMO...

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

Lezione 5. Next Generation Sequencing

Lezione 5. Next Generation Sequencing Lezione 5 Next Generation Sequencing Perchè Next Generation Sequencing Si possono generare centinaia di milioni di corte sequenze (35bp-250bp) in una sola corsa in un tempo breve con un basso prezzo per

Dettagli

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA'.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale NGS: IMMUNOGENETICA E TRAPIANTI Michela Mazzocco S.C.Laboratorio di istocompatibilità

Dettagli

Tesi di Laurea di Mauro Baluda matr. 038208

Tesi di Laurea di Mauro Baluda matr. 038208 Università degli Studi di Milano Bicocca Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea in Informatica Algoritmi per l'allineamento di Sequenze Tesi di Laurea di matr. 038208 Relatore:

Dettagli

Debtags. Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini enrico@debian.org

Debtags. Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini enrico@debian.org Debtags Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini (enrico@debian.org) 1/14 Fondazioni teoretiche Classificazione a Faccette (sfaccettature) Scoperte del cognitivismo (capacità

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

Peripheral Interface Controller PIC MCU Families (Microchip)

Peripheral Interface Controller PIC MCU Families (Microchip) PIC Peripheral Interface Controller PIC MCU Families (Microchip) Parliamo di come programmeremo Hardware Microcontrollore PIC18Fxxx (452) ambiente di sviluppo software scrittura del codice Cross-compilatore

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Il software Epi Info

Il software Epi Info Il software Epi Info Descrizione e analisi dei dati dello studio sulla compliance: Modulo Analizza i dati I tipi di variabili (aleatorie) (1) Variabile: fenomeno misurato Aleatorio: il risultato di questa

Dettagli

METODI ALTERNATIVI PER LA VALUTAZIONE DELLA FLORA TOTALE NEL LATTE CRUDO: CONSIDERAZIONI E CRITERI DI VALIDAZIONE

METODI ALTERNATIVI PER LA VALUTAZIONE DELLA FLORA TOTALE NEL LATTE CRUDO: CONSIDERAZIONI E CRITERI DI VALIDAZIONE METODI ALTERNATIVI PER LA VALUTAZIONE DELLA FLORA TOTALE NEL LATTE CRUDO: CONSIDERAZIONI E CRITERI DI VALIDAZIONE Anna Maria Ferrini LNR per il latte e i prodotti a base di latte riunione tecnica a chiusura

Dettagli

Leica Application Suite

Leica Application Suite Leica Application Suite Macro Editor e Macro Runner Personalizzato e automatizzato A scelta, le istruzioni possono essere messe in attesa nel caso in cui la routine viene eseguita per interagire con le

Dettagli

2. Guida all uso del software IrfanView

2. Guida all uso del software IrfanView 2. Guida all uso del software IrfanView In questa breve guida verrà illustrato come operare sulle immagini utilizzando il software open source IrfanView. Installazione Il programma si scarica gratuitamente

Dettagli

Corso di Sistemi di Elaborazione delle informazioni

Corso di Sistemi di Elaborazione delle informazioni Corso di Sistemi di Elaborazione delle informazioni Basi di Dati Claudio Marrocco I report I Report sono lo strumento più adatto per ottenere una copia stampata dei dati e delle informazioni ricavate dalle

Dettagli

Introduzione al software SAS

Introduzione al software SAS Introduzione al software SAS Metodi Quantitativi per Economia, Finanza e Management Esercitazione n 1 Orario di ricevimento Alberto Saccardi alberto.saccardi@nunatac.it asaccardi@liuc.it Lunedì 17-18 Aula

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT

Dettagli

Introduzione all ambiente di sviluppo

Introduzione all ambiente di sviluppo Laboratorio II Raffaella Brighi, a.a. 2005/06 Corso di Laboratorio II. A.A. 2006-07 CdL Operatore Informatico Giuridico. Introduzione all ambiente di sviluppo Raffaella Brighi, a.a. 2005/06 Corso di Laboratorio

Dettagli

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione in campo medico e biotecnologico Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione delle sequenze di acido nucleico Elena Comoglio Jacobacci & Partners S.p.A. Brevetti

Dettagli

Versione 2.0. Biblioteca Centralizzata Clinica A cura di Claudia Cavicchi

Versione 2.0. Biblioteca Centralizzata Clinica A cura di Claudia Cavicchi Versione 2.0 Biblioteca Centralizzata Clinica A cura di Claudia Cavicchi 1 Cos è? E un software gratuito, estensione del browser Mozilla Firefox ed è sviluppato dal Center for History and New Media della

Dettagli

GIUSEPPE DI GRANDE CORSO DI FORMAZIONE SU BIBLOS

GIUSEPPE DI GRANDE CORSO DI FORMAZIONE SU BIBLOS CORSO DI FORMAZIONE SU BIBLOS - 1ª LEZIONE - Pagina 1 GIUSEPPE DI GRANDE CORSO DI FORMAZIONE SU BIBLOS Strategie e tecniche per produrre libri braille in completa autonomia Revisione del 28 luglio 2012

Dettagli

MICROSOFT WORD Word è un applicazione che permette di scrivere ed elaborare testi.

MICROSOFT WORD Word è un applicazione che permette di scrivere ed elaborare testi. MICROSOFT WORD Word è un applicazione che permette di scrivere ed elaborare testi. Non è solo un text editor ma è un word processor (permette cioè di modificare l impaginazione, di inserire immagini e

Dettagli

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY) http://www.molecularstation.com/molecular-biology-images/data/502/human-genome-gene.png

Dettagli

Gruppo di lavoro 1 Metadati e RNDT. Incontro del 22 luglio 2014

Gruppo di lavoro 1 Metadati e RNDT. Incontro del 22 luglio 2014 Gruppo di lavoro 1 Metadati e RNDT Incontro del 1 Piano di lavoro 1. Condivisione nuova versione guide operative RNDT 2. Revisione regole tecniche RNDT (allegati 1 e 2 del Decreto 10 novembre 2011) a)

Dettagli

Data Mining e Analisi dei Dati

Data Mining e Analisi dei Dati e Analisi dei Dati Rosaria Lombardo Dipartimento di Economia, Seconda Università di Napoli La scienza che estrae utili informazioni da grandi databases è conosciuta come E una disciplina nuova che interseca

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Aggiornare applicazioni virtualizzate con App-V

Aggiornare applicazioni virtualizzate con App-V Aggiornare applicazioni virtualizzate con App-V di Nicola Ferrini MCT MCSA MCSE MCTS MCITP Introduzione Mantenere un infrastruttura virtuale basata su Application Virtualization aiuta a diminuire sensibilmente

Dettagli

La Tecnologia dei Microarray. Tor Vergata Aprile 2011 (Susana.Bueno@caspur.it)

La Tecnologia dei Microarray. Tor Vergata Aprile 2011 (Susana.Bueno@caspur.it) La Tecnologia dei Microarray Tor Vergata Aprile 2011 (Susana.Bueno@caspur.it) SH Friend and RB Stoughton, The Magic of Microarray, Scientific American, February. 2002, pp. 44-49 Vogliamo sapere velocemente

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Comandi filtro: sed. Se non si specificano azioni, sed stampa sullo standard output le linee in input, lasciandole inalterate.

Comandi filtro: sed. Se non si specificano azioni, sed stampa sullo standard output le linee in input, lasciandole inalterate. Comandi filtro: sed Il nome del comando sed sta per Stream EDitor e la sua funzione è quella di permettere di editare il testo passato da un comando ad un altro in una pipeline. Ciò è molto utile perché

Dettagli

TECNICHE DI COMPRESSIONE DATI

TECNICHE DI COMPRESSIONE DATI TECNICHE DI COMPRESSIONE DATI COMPRESSIONE DATI La compressione produce una rappresentazione più compatta delle informazioni è come se si usassero meno parole per dire la stessa cosa in modo diverso. Esistono

Dettagli

BACHECA CLIENTE/SERVER

BACHECA CLIENTE/SERVER BACHECA CLIENTE/SERVER Manuale Software MAREL srl - FABRIANO (AN) Italy www.marelsrl.com Indice generale...3 Installazione...3 Inizio...3 Menu Files...5 Menu Sequenze...7 Menù Dispositivi...12 Gestione

Dettagli

BREVE GUIDA ALL UTILIZZO DI BFTC

BREVE GUIDA ALL UTILIZZO DI BFTC BREVE GUIDA ALL UTILIZZO DI BFTC Rev. 1.0.0 11 Ottobre 2014 Digital Technology Art srl Digital Technology Art srl BFTC Introduzione 1 INDICE INTRODUZIONE INSTALLAZIONE IMPOSTARE IL PLUG IN CREARE UN NUOVO

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Esercitazione 05. Sommario. Packet Filtering [ ICMP ] Esercitazione Descrizione generale. Angelo Di Iorio (Paolo Marinelli)

Esercitazione 05. Sommario. Packet Filtering [ ICMP ] Esercitazione Descrizione generale. Angelo Di Iorio (Paolo Marinelli) Sommario Esercitazione 05 Angelo Di Iorio (Paolo Marinelli)! Packet Filtering ICMP! Descrizione esercitazione! Applicazioni utili: " Firewall: wipfw - netfilter " Packet sniffer: wireshark!"#!$#!%&'$(%)*+,')#$-!"#!$#!%&'$(%)*+,')#$-

Dettagli

Software. Definizione, tipologie, progettazione

Software. Definizione, tipologie, progettazione Software Definizione, tipologie, progettazione Definizione di software Dopo l hardware analizziamo l altra componente fondamentale di un sistema di elaborazione. La macchina come insieme di componenti

Dettagli

Introduzione al Linguaggio C

Introduzione al Linguaggio C Introduzione al Linguaggio C File I/O Daniele Pighin April 2009 Daniele Pighin Introduzione al Linguaggio C 1/15 Outline File e dati Accesso ai file File I/O Daniele Pighin Introduzione al Linguaggio C

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

Controlli di Qualità e Protocolli in Radiologia Digitale Diretta Cremona 15/05/2012 - ISTITUTI OSPITALIERI DI CREMONA

Controlli di Qualità e Protocolli in Radiologia Digitale Diretta Cremona 15/05/2012 - ISTITUTI OSPITALIERI DI CREMONA Controlli di Qualità e Protocolli in Radiologia Digitale Diretta Cremona 15/05/2012 - ISTITUTI OSPITALIERI DI CREMONA QA-DISTRI http://sourceforge.net/projects/qadistri/files/ QCDR http://www.qcdr.org

Dettagli

Terminologia per gli ipertesti sul web

Terminologia per gli ipertesti sul web Terminologia per gli ipertesti sul web browser: programma applicativo per navigare in rete page (pagina): singolo foglio di un ipertesto home-page: punto di ingresso di un sito web hotspot, hotword: porzione

Dettagli

ENVIRONMENTAL CONTROL & LEAK DETECTION SYSTEM

ENVIRONMENTAL CONTROL & LEAK DETECTION SYSTEM ENVIRONMENTAL CONTROL & LEAK DETECTION SYSTEM YEAR: 2009-2010 CUSTOMER: THE PROJECT Il Progetto S.E.I.C. developed the Environmental Control & Leak Detection System (ecolds) for Rho - Malpensa Pipeline

Dettagli

Il campionamento non-invasivo come routine nella gestione della fauna selvatica: il caso di Lepus corsicanus

Il campionamento non-invasivo come routine nella gestione della fauna selvatica: il caso di Lepus corsicanus Conservazione di Lepus corsicanus De Winton, 1898 e stato delle conoscenze, de Filippo et al. (a cura di), 2007, IGF publ. Il campionamento non-invasivo come routine nella gestione della fauna selvatica:

Dettagli

THETIS Water Management System for Settignano acqueduct (Firenze, Italy) Water Management System for Settignano aqueduct (Firenze, Italy)

THETIS Water Management System for Settignano acqueduct (Firenze, Italy) Water Management System for Settignano aqueduct (Firenze, Italy) THETIS for Settignano aqueduct (Firenze, Italy) YEAR: 2003 CUSTOMERS: S.E.I.C. Srl developed the Water Monitoring System for the distribution network of Settignano Municipality Aqueduct. THE PROJECT Il

Dettagli

Capitolo 1 Introduzione a Gambas

Capitolo 1 Introduzione a Gambas Capitolo 1 Introduzione a Gambas Gambas è stato creato inizialmente da Benoit Minisini, un residente della periferia di Parigi. Secondo Benoit, Gambas è un linguaggio Basic con estensioni per la programmazione

Dettagli

Introduzione all elaborazione di immagini Part II

Introduzione all elaborazione di immagini Part II Introduzione all elaborazione di immagini Part II Obiettivi delle tecniche di elaborazione di immagini: miglioramento di qualità (image enhancement) ripristino di qualità o restauro (image restoration)

Dettagli

Utilizzare il NetBeans GUI Builder. Dott. Ing. M. Banci, PhD

Utilizzare il NetBeans GUI Builder. Dott. Ing. M. Banci, PhD Utilizzare il NetBeans GUI Builder Dott. Ing. M. Banci, PhD Lavorare con i Beans Queste slide ci guidano nel processo di creazione di un bean pattern nel progetto NetBeans 15 Giugno 2007 Esercitazione

Dettagli

Human Genome Variants Analysis. Marin Vargas, Sergio Paul

Human Genome Variants Analysis. Marin Vargas, Sergio Paul Human Genme Variants Analysis Marin Vargas, Sergi Paul 2013 Why make predictive diagnsis f a genetic disease using the whle genme? Genme sequencing is the nly way t get all genetic infrmatin. The cst f

Dettagli

Foglio di calcolo. Foglio di calcolo: nomi celle

Foglio di calcolo. Foglio di calcolo: nomi celle Foglio di calcolo L'astrazione offerta da un programma di gestione di fogli di calcolo è quella di una matrice (un foglio a quadretti). Colonne: A, B, C,... Righe: 1, 2, 3,... Ogni cella ha un nome composto

Dettagli

Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli

Corso di Informatica

Corso di Informatica Corso di Informatica Modulo T2 1 Sistema software 1 Prerequisiti Utilizzo elementare di un computer Significato elementare di programma e dati Sistema operativo 2 1 Introduzione In questa Unità studiamo

Dettagli

Alla scoperta dei Graph Database

Alla scoperta dei Graph Database Alla scoperta dei Graph Database Matteo Pani 24 ottobre 2015 One size doesn t fit all Modellare le relazioni I Graph Database Il Labeled Property Graph Model I Graph-DBMS Neo4j Neo4j Internals Cypher Interagire

Dettagli

Analisi di dati RNA-Seq. Alberto Ferrarini

Analisi di dati RNA-Seq. Alberto Ferrarini Analisi di dati RNA-Seq Alberto Ferrarini Il dogma centrale della biologia molecolare DNA Replicazione RNA Trascrizione Traduzione PROTEIN Geni sono trascritti da DNA ad mrnache lascia il nucleo e viene

Dettagli

Streaming unicast. Live media source. Media store. server. internet. Client player. control. 5. Multimedia streaming Pag. 1

Streaming unicast. Live media source. Media store. server. internet. Client player. control. 5. Multimedia streaming Pag. 1 5. Multimedia streaming Pag. 1 Streaming unicast Live media source Unicast streaming is provided in a classic client- fashion At least two flows are established between client and. A distribution flow

Dettagli