Lezione 8. DNA sequencing informatics

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Lezione 8. DNA sequencing informatics"

Transcript

1 Lezione 8 DNA sequencing informatics

2 Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO NEXGDS)

3 History of sequencing informatics Algorithms for sequencing alignment Needleman and Wunsch (1970) Smith-Waterman (1981) Database searching FASTA, BLAST Tools to work with sanger sequencing STADEN package, DNA sequence assembly programs (ex. Sequencer, Mac vector, PC/Gene..) Phred/Phrap

4 Phred/Phrap cross_match, consed Sanger sequences from ABI With funding from the Human Genome Project (HGP) the University of Washington (Seattle) developed a set of bioinformatics tools for processing raw sanger sequences collected by ABI sequencing machines and for assembling overlapping reads into larger contigs Released ad a C source code suitable for compilation by skilled users on unix-based computers

5 Sanger sequences from ABI PHRED SCORE q = -10 Log 10 p PHRED Base calling + quality score Dove p è la probabilità di errore associata ad ogni base Quale sarà il Phred Score di una base chiamata con una probabilità di errore di 1/100 (accuratezza del 99%)? E di una con una p di 1/1000? q = 20 nel primo caso -> minimo considerato accettabile q = 30 nel secondo -> da 30 in su la qualità si considera alta

6 Sanger sequences from ABI PHRED Frammenti assemblati in contigs (Smith-Waterman algorithm+ some concepts from FASTA and BLAST) Base calling + quality score PHRAP CONSED GRAPHICAL EDITOR

7 Sanger sequences from ABI

8 Cosa è rimasto di tutto questo nelle analisi di dati prodotti da sequenziamenti NGS?

9 Analisi di dati NGS: Analytic flow 1. Produzione dei dati grezzi (raw data, reads) dal sequenziatore 2. Allineamento delle reads con un riferimento o tra loro (de novo) 3. Visualizzazione degli allineamenti e identificazione dei polimorfismi (se previsto dal progetto) 4. Interpretazione sulla base delle ipotesi e delle domande biologiche di partenza

10 De novo

11 1. Raw sequence Imaging (Illumina, 454, solid) or Ion detection (Ion torrent, Proton) I dati contengono 3 informazioni fondamentali: ID (identificatore individuale del campione) Sequenza Stima della qualità per ogni base chiamata Formato: FASTQ

12 FASTQ format formato di testo che include sia la sequenza (in genere nucleotidica) che la qualità di ogni base (score). Line 1: inizia con il carattere seguito da un identificatore e da una descrizione opzionale (come la linea del titolo nel formato FASTA). Line 2: raw sequence letters. Line 3: inizia col carattere '+' che può essere seguito da una descrizione (opzionale). Line 4: codifica la qualità della sequenza (PHRED SCORE) nella Line 2, deve contenere un numero di simboli pari al numero di lettere in 2:N:0:GCTGAGA GTTCATCTTGGCAGCTGGTTCCCGTATTTACTGAAGAGTATGTAGCACTTGCGTCGCTCGTGATTGAAAACAGATGGCAGCACGACACGGGCACGGTGCG

13 2. Allineamento In generale la parte più impegnativa dell analisi dei dati NGS La scelta dell algoritmo dipende da che tipo di dato abbiamo: de novo o con sequenza di riferimento? La sequenza di riferimento è vicina evolutivamente? Etc..

14 Alcuni programmi di allineamento per dati NGS Burrows Wheeler Transformation (BWT) based aligners: BWA, Bowtie, SOAP2 Allineamento di corte sequenze (tipico prodotto di NGS) ad un riferimento BWA produce un allineamento in SAM format, non chiama i siti polimorfici

15

16

17 Formato output di allineamento: SAM sequence alignment/map format De novo I file SAM sono molto grandi (comunemente decine di Gigabytes) -> si usa comprimerli per salvare spazio Contiene un titolo (opzionale) e una linea per ogni read con con 11 campi obbligatori

18

19

20

21

22 SAM files sono human-readable text files, i BAM files sono il loro equivalente binario, compresso e più adatto ad essere utilizzato dai programmi di analisi che operano i passaggi successivi.

23 De novo alignment Non c è una sequenza di riferimento Si usano comunemente approcci basati su de Brujin digraphs (capitolo 4 NGS DNA sequencing informatics) Ci sono diversi softwares, riprenderemo il problema durante la parte pratica

24 3. Visualizzazione degli allineamenti ed eventuale variant calling/genotyping Spesso per fare queste analisi esistono dei PACCHETTI di programmi che permettono di effettuare molti passaggi come visualizzazione, identificazione delle varianti, esclusione di artefatti Di seguito vedremo degli esempi, ma l elenco è ancora lungo

25 SAMtools Insieme di strumenti per interagire con ed effettuare il post processing di allineamenti di corte sequenze di DNA in formati SAM, BAM e CRAM. Questi files sono generati come output di allineatori di corte reads come BWA. Include sia strumenti semplici che complessi (variant calling, alignment viewing, sorting, indexing, data extraction, format conversion) Variant calling: Finding sequence variation within and between samples (SNPs, InDel..)

26 GATK (Genome Analysis Toolkit) Software package sviluppato al Broad Institute per analizzare dati di sequenza high-throughput. Il toolkit offre una vasta gamma di strumenti, principalmete focalizzati sulla scoperta di varianti e sulla genotipizzazione, con grande enfasi alla garanzia della qualità del dato.

27 Lo useremo nelle esercitazioni pratiche

28 Java-based stand-alone desktop software del Broad Institute che può visualizzare dati NGs in una varietà di formati (FASTA, FASTQ, SAM, BAM) Facile da installare (c è una versione anche per ipad!) I genomi di riferimento e le relative annotazioni devono essere installate manualmente

29 Robinson et al. Nature Biotechnology 29, (2011) Coverage plot and alignments from paired-end reads for a matched tumor/normal pair. Sequencing was performed on an Illumina GA2 platform and aligned with Maq (http://maq.sourceforge.net/). Alignments are represented as gray polygons with reads mismatching the reference indicated by color. Loci with a large percentage of mismatches relative to the reference are flagged in the coverage plot as color-coded bars. Alignments with unexpected inferred insert sizes are indicated by color. There is evidence for a ~10-kb deletion (removing two exons of AIDA) in the tumor sample not present in the normal.

30 BWA SAM tools GATK https://www.broadinstitute.org/gatk/

Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

DNA sequencing. Reading Genomes. Giovanni Bacci

DNA sequencing. Reading Genomes. Giovanni Bacci Reading Genomes Giovanni Bacci Evoluzione del sequenziamento 1977 Frederick Sanger Prima tecnica di sequenziamento 1987 Applyed Biosystems Prima macchina automatica per il sequenziamento del DNA 1998 Phil

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

Avanzamento dei sistemi di sequenziamento

Avanzamento dei sistemi di sequenziamento Avanzamento dei sistemi di sequenziamento Sistemi di sequenziamento capillare basati su: Lunghezza delle read: 800 basi Poche sequenze prodotte in una singola corsa Second Generation Sequencing (SGS):

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015 Next Generation Sequencers: from the bacterial culture to raw data Valeria Michelacci NGS course, June 2015 COSTS ASSOCIATED WITH DNA SEQUENCING 80-100 $ per Bacterial Genome!! Benefits from NGS Massive

Dettagli

Bioinformatica NGS Next Generation Sequencing

Bioinformatica NGS Next Generation Sequencing NGS Next Generation Sequencing NGS Le tecnologie di sequenziamento di DNA rappresentano uno strumento fondamentale per la ricerca nel campo della genetica e della biologia molecolare; Dal 2005, piattaforme

Dettagli

Elementi di Bioinformatica per lʼanalisi di dati NGS

Elementi di Bioinformatica per lʼanalisi di dati NGS Corso di Alta formazione in Elementi di Bioinformatica per lʼanalisi di dati NGS 21-23 Settembre 2011 Centro Didattico Morgagni Viale Morgagni 40, Firenze Presentazione del corso Il corso di alta formazione

Dettagli

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL Alcuni aspetti legati al calcolo bioinformatico su CRESCO Giuseppe Aprea UTMEA-CAL Principali attività bioinformatiche ENEA legate al calcolo Assemblaggio de Novo* Trascrittomica Analisi filogenetica Metagenomica*

Dettagli

Metodologie informa/che per l analisi dei genomi

Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Perchè sono qui? Walter Sanseverino, CEO at !? Informa/cs = Genomics? We have a problem!!! Focus curve

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Università degli Studi di Padova Dipartimento di Ingegneria dell Informazione Corso di Laurea in Ingegneria dell Informazione Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Laureando:

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Guida di riferimento del software MiSeq Reporter per i saggi IVD

Guida di riferimento del software MiSeq Reporter per i saggi IVD Guida di riferimento del software MiSeq Reporter per i saggi IVD PER USO DIAGNOSTICO IN VITRO DI PROPRIETÀ DI ILLUMINA N. codice 15038356 Rev. A ITA Marzo 2014 Questo documento e il suo contenuto sono

Dettagli

UNA BASE DATI PER IL KNOWLEDGE DISCOVERY IN GENETICA MEDICA

UNA BASE DATI PER IL KNOWLEDGE DISCOVERY IN GENETICA MEDICA Alma Mater Studiorum Università dibologna SCUOLA DI SCIENZE Corso di Laurea in Informatica Magistrale UNA BASE DATI PER IL KNOWLEDGE DISCOVERY IN GENETICA MEDICA Tesi di Laurea in Complementi di Basi di

Dettagli

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Summer School 2015 Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Applicazioni della Next-Generation Sequencing con tecnologia Illumina Roberto Cusano 04-06

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Tecniche biofisiche basate su nanopori

Tecniche biofisiche basate su nanopori Tecniche biofisiche basate su nanopori -Pori di dimensione nanometrica -Attraverso membrane lipidiche o inorganiche -Di natura proteica o scavati con tecnologie top-down Possono essere impiegati per -Studiare

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Lezione 5. Next Generation Sequencing

Lezione 5. Next Generation Sequencing Lezione 5 Next Generation Sequencing Perchè Next Generation Sequencing Si possono generare centinaia di milioni di corte sequenze (35bp-250bp) in una sola corsa in un tempo breve con un basso prezzo per

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Politecnico di Milano

Politecnico di Milano Politecnico di Milano Scuola di Ingegneria Industriale e dell Informazione - Milano Leonardo Corso di Studi in Ingegneria Matematica Analisi di forma dei profili ChIP-Seq Relatore: Prof. Piercesare Secchi

Dettagli

e dei genotipi tossici

e dei genotipi tossici Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle

Dettagli

Analisi di dati RNA-Seq. Alberto Ferrarini

Analisi di dati RNA-Seq. Alberto Ferrarini Analisi di dati RNA-Seq Alberto Ferrarini Il dogma centrale della biologia molecolare DNA Replicazione RNA Trascrizione Traduzione PROTEIN Geni sono trascritti da DNA ad mrnache lascia il nucleo e viene

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Gruppo di lavoro 1 Metadati e RNDT. Incontro del 22 luglio 2014

Gruppo di lavoro 1 Metadati e RNDT. Incontro del 22 luglio 2014 Gruppo di lavoro 1 Metadati e RNDT Incontro del 1 Piano di lavoro 1. Condivisione nuova versione guide operative RNDT 2. Revisione regole tecniche RNDT (allegati 1 e 2 del Decreto 10 novembre 2011) a)

Dettagli

Tesi di Laurea di Mauro Baluda matr. 038208

Tesi di Laurea di Mauro Baluda matr. 038208 Università degli Studi di Milano Bicocca Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea in Informatica Algoritmi per l'allineamento di Sequenze Tesi di Laurea di matr. 038208 Relatore:

Dettagli

THETIS Water Management System for Settignano acqueduct (Firenze, Italy) Water Management System for Settignano aqueduct (Firenze, Italy)

THETIS Water Management System for Settignano acqueduct (Firenze, Italy) Water Management System for Settignano aqueduct (Firenze, Italy) THETIS for Settignano aqueduct (Firenze, Italy) YEAR: 2003 CUSTOMERS: S.E.I.C. Srl developed the Water Monitoring System for the distribution network of Settignano Municipality Aqueduct. THE PROJECT Il

Dettagli

Sequence Alignment Algorithms

Sequence Alignment Algorithms Sequence Alignment Algorithms Algoritmi per l Allineamento di Sequenze Relatore: Prof. Giancarlo Mauri Correlatore: Prof. Gianluca Della Vedova Tesi di Laurea di: Mauro Baluda Matricola 038208 Part of

Dettagli

Human Genome Variants Analysis. Marin Vargas, Sergio Paul

Human Genome Variants Analysis. Marin Vargas, Sergio Paul Human Genme Variants Analysis Marin Vargas, Sergi Paul 2013 Why make predictive diagnsis f a genetic disease using the whle genme? Genme sequencing is the nly way t get all genetic infrmatin. The cst f

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

Richiami di informatica e programmazione

Richiami di informatica e programmazione Richiami di informatica e programmazione Il calcolatore E una macchina usata per Analizzare Elaborare Collezionare precisamente e velocemente una grande quantità di informazioni. Non è creativo Occorre

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Debtags. Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini enrico@debian.org

Debtags. Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini enrico@debian.org Debtags Dare un senso a 20000 pacchetti. 16 settembre 2006 14 slides Enrico Zini (enrico@debian.org) 1/14 Fondazioni teoretiche Classificazione a Faccette (sfaccettature) Scoperte del cognitivismo (capacità

Dettagli

Il sequenziamento del genoma umano

Il sequenziamento del genoma umano Il sequenziamento del genoma umano 1. storia e risultati dei due progetti: HGP e Celera. 2. innovazioni e problematiche di ricerca connesse al progetto genoma umano: (a) sequenziamento su larga scala (b)

Dettagli

Modellistica Medica. Maria Grazia Pia INFN Genova. Scuola di Specializzazione in Fisica Sanitaria Genova Anno Accademico 2002-2003

Modellistica Medica. Maria Grazia Pia INFN Genova. Scuola di Specializzazione in Fisica Sanitaria Genova Anno Accademico 2002-2003 Modellistica Medica Maria Grazia Pia INFN Genova Scuola di Specializzazione in Fisica Sanitaria Genova Anno Accademico 2002-2003 Lezione 1 Introduzione al corso Obiettivi Programma Esercitazioni Prerequisiti

Dettagli

Data Mining e Analisi dei Dati

Data Mining e Analisi dei Dati e Analisi dei Dati Rosaria Lombardo Dipartimento di Economia, Seconda Università di Napoli La scienza che estrae utili informazioni da grandi databases è conosciuta come E una disciplina nuova che interseca

Dettagli

L invenzione delle razze. Guido Barbujani Dipartimento di Biologia ed Evoluzione, Università di Ferrara g.barbujani@unife.it Mestre, 26 marzo 2011

L invenzione delle razze. Guido Barbujani Dipartimento di Biologia ed Evoluzione, Università di Ferrara g.barbujani@unife.it Mestre, 26 marzo 2011 L invenzione delle razze Guido Barbujani Dipartimento di Biologia ed Evoluzione, Università di Ferrara g.barbujani@unife.it Mestre, 26 marzo 2011 Razzismo scientifico: Il decalogo del Manifesto 1. Le

Dettagli

Aggiornamento dispositivo di firma digitale

Aggiornamento dispositivo di firma digitale Aggiornamento dispositivo di firma digitale Updating digital signature device Questo documento ha il compito di descrivere, passo per passo, il processo di aggiornamento manuale del dispositivo di firma

Dettagli

Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli

Progetto CIMDL. Analisi genetica di pazienti affetti da lesioni distruttive della linea mediana indotte da Cocaina (CIMDL) tramite exome sequencing

Progetto CIMDL. Analisi genetica di pazienti affetti da lesioni distruttive della linea mediana indotte da Cocaina (CIMDL) tramite exome sequencing Progetto CIMDL Analisi genetica di pazienti affetti da lesioni distruttive della linea mediana indotte da Cocaina (CIMDL) tramite exome sequencing Centro Collaborativo DPA IRCCS Ospedale San Raffaele -

Dettagli

Riconoscimento e recupero dell informazione per bioinformatica

Riconoscimento e recupero dell informazione per bioinformatica Riconoscimento e recupero dell informazione per bioinformatica Clustering: similarità Manuele Bicego Corso di Laurea in Bioinformatica Dipartimento di Informatica - Università di Verona Definizioni preliminari

Dettagli

Il sequenziamento del DNA

Il sequenziamento del DNA Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

PMBOK Guide 3 rd Edition 2004

PMBOK Guide 3 rd Edition 2004 PMBOK Guide 3 rd Edition 2004 Un modello di riferimento per la gestione progetti a cura di Tiziano Villa, PMP febbraio 2006 PMI, PMP, CAPM, PMBOK, PgMP SM, OPM3 are either marks or registered marks of

Dettagli

L enigma del XXI secolo: decifrare il codice della vita

L enigma del XXI secolo: decifrare il codice della vita L enigma del XXI secolo: decifrare il codice della vita David Horner Dipar9mento di Bioscienze Università degli Studi di Milano Via Celoria 26 Milano 20133 david.horner@unimi.it Regola di Chargaff %A =

Dettagli

Get Inspired! Un toolkit di armonizzazione per i servizi di conversione

Get Inspired! Un toolkit di armonizzazione per i servizi di conversione Get Inspired! Un toolkit di armonizzazione per i servizi di conversione Pasquale Di Donato, Mauro Salvemini, Laura Berardi, Valeria Mercadante LABSITA Sapienza Università di Roma, Piazza Borghese 9, 00186

Dettagli

Kickoff Progetto DaSSIA 29 Settembre 2014

Kickoff Progetto DaSSIA 29 Settembre 2014 www.crs4.it Kickoff Progetto DaSSIA 29 Settembre 2014 Ordine del giorno Breve Presentazione del CRS4 CRS4 & Big Data Il Progetto DaSSIA Sviluppo di un caso test paradigmatico L'Attività di Formazione Discussione

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

RefWorks Guida all utente Versione 4.0

RefWorks Guida all utente Versione 4.0 Accesso a RefWorks per utenti registrati RefWorks Guida all utente Versione 4.0 Dalla pagina web www.refworks.com/refworks Inserire il proprio username (indirizzo e-mail) e password NB: Agli utenti remoti

Dettagli

MS WINDOWS SERVER 2008 - AUTOMATING ADMINISTRATION WITH WINDOWS POWERSHELL

MS WINDOWS SERVER 2008 - AUTOMATING ADMINISTRATION WITH WINDOWS POWERSHELL MS WINDOWS SERVER 2008 - AUTOMATING ADMINISTRATION WITH WINDOWS POWERSHELL UN BUON MOTIVO PER [cod. E102] L obiettivo del Corso è fornire ai partecipanti la preparazione e le competenze necessarie per

Dettagli

Introduzione al Python

Introduzione al Python Andrea Passerini passerini@disi.unitn.it Informatica Caratteristiche procedurale si specifica la procedura da eseguire sui dati strutturato concetto di visibililtà delle variabili orientato agli oggetti

Dettagli

Utilizzare il NetBeans GUI Builder. Dott. Ing. M. Banci, PhD

Utilizzare il NetBeans GUI Builder. Dott. Ing. M. Banci, PhD Utilizzare il NetBeans GUI Builder Dott. Ing. M. Banci, PhD Lavorare con i Beans Queste slide ci guidano nel processo di creazione di un bean pattern nel progetto NetBeans 15 Giugno 2007 Esercitazione

Dettagli

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà Bioinformatica Analisi del trascrittoma Dott. Alessandro Laganà Analisi del trascrittoma Regolazione dell espressione genica I microarray cdna microarray Oligo microarray Affymetrix Chip Analisi dei dati

Dettagli

Modello di sicurezza Datocentrico

Modello di sicurezza Datocentrico Modello di sicurezza Datocentrico I dati sono ovunque Chi accede ai dati, a dove accede ai dati e a quali dati accede? Public Cloud Desktop Virtualization Private Cloud Server Virtualization Proteggere

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

Next-generation sequencing : dalla ricerca di base alla diagnostica*

Next-generation sequencing : dalla ricerca di base alla diagnostica* Next-generation sequencing : dalla ricerca di base alla diagnostica* Karl V. Voelkerding 1,2, Shale A. Dames 1, Jacob D. Durtschi 1 1ARUP Institute for Experimental and Clinical Pathology, Salt Lake City,

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

Service Design Programme

Service Design Programme Service Design Programme SERVICE DESIGN - cosa è Il Service Design è l attività di pianificazione e organizzazione di un servizio, con lo scopo di migliorarne l esperienza in termini di qualità ed interazione

Dettagli

DOTTORATO DI RICERCA TITOLO TESI

DOTTORATO DI RICERCA TITOLO TESI Università degli Studi di Cagliari DOTTORATO DI RICERCA Terapia Pediatrica e Farmacologia dello Sviluppo Ciclo xxv TITOLO TESI Nuovi approcci molecolari per lo studio di malattie monogeniche rare: utilizzo

Dettagli

documenta PLM certificato da Autodesk

documenta PLM certificato da Autodesk documenta PLM documenta PLM certificato da Autodesk Implementare un progetto PLM significa spesso riorganizzare e razionalizzare molti dei processi aziendali legati alla progettazione e produzione. In

Dettagli

Sistemi Operativi II Corso di Laurea in Ingegneria Informatica

Sistemi Operativi II Corso di Laurea in Ingegneria Informatica www.dis.uniroma1.it/~midlab Sistemi Operativi II Corso di Laurea in Ingegneria Informatica Prof. Roberto Baldoni Complementi: Deadlock Tecniche di gestione del deadlock: 1. Caratterizzazione del deadlock

Dettagli

History of DNA Sequencing

History of DNA Sequencing History of DNA Sequencing Adapted from Eric Green, NIH; Adapted from Messing & Llaca, PNAS (1998) Efficiency (bp/person/year) 1 1870 1940 1953 Miescher: Discovers DNA Avery: Proposes DNA as Genetic Material

Dettagli

Analisi dei dati MLPA con il nuovo Coffalyser.NET. MRC-Holland

Analisi dei dati MLPA con il nuovo Coffalyser.NET. MRC-Holland Analisi dei dati MLPA con il nuovo Coffalyser.NET MRC-Holland Contenuti Che cos è il Coffalyser.NET Analisi dei frammenti e del Copy number Interpretazione dei dati Che cos è il Cofffalyser.NET Software

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Riassunto del corso e cenni ad argomenti avanzati

Riassunto del corso e cenni ad argomenti avanzati In breve Riassunto del corso e cenni ad argomenti avanzati.. Sono tutte sequenze di bit! 1 1 0 1 0 1 0 0 0 1 2 In breve In breve > Ipertesti in HTML Informazioni di natura non omogenea, cui si

Dettagli

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA per l assegnazione di una borsa di studio a favore di candidati in possesso del Diploma di laurea specialistica o magistrale

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

INFORMAZIONE AGLI UTENTI DI APPARECCHIATURE DOMESTICHE O PROFESSIONALI

INFORMAZIONE AGLI UTENTI DI APPARECCHIATURE DOMESTICHE O PROFESSIONALI INFORMAZIONE AGLI UTENTI DI APPARECCHIATURE DOMESTICHE O PROFESSIONALI Ai sensi dell art. 13 del Decreto Legislativo 25 luglio 2005, n. 151 "Attuazione delle Direttive 2002/95/CE, 2002/96/CE e 2003/108/CE,

Dettagli

gli approcci al problema gli standard Università degli Studi di Bergamo Caterina Rizzi 2

gli approcci al problema gli standard Università degli Studi di Bergamo Caterina Rizzi 2 IL PROBLEMA DELLO SCAMBIO DATI CATERINA RIZZI DIPARTIMENTO DI INGEGNERIA I NGEGNERIA INDUSTRIALE ILPROBLEMA DEL DATA EXCHANGE le motivazioni gli approcci al problema gli standard Caterina Rizzi 2 1 I DUE

Dettagli

Definizione e sintesi di modelli del traffico di rete per la rilevazione in tempo reale delle intrusioni in reti di calcolatori

Definizione e sintesi di modelli del traffico di rete per la rilevazione in tempo reale delle intrusioni in reti di calcolatori Definizione e sintesi di modelli del traffico di rete per la rilevazione in tempo reale delle intrusioni in reti di calcolatori Francesco Oliviero folivier@unina.it Napoli, 22 Febbraio 2005 ipartimento

Dettagli

"Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là".

Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là. Lentamente muore chi diventa schiavo dell'abitudine, ripetendo ogni giorno gli stessi percorsi, chi non cambia la marca, chi non rischia e cambia colore dei vestiti, chi non parla a chi non conosce. Muore

Dettagli

TECNICHE DI COMPRESSIONE DATI

TECNICHE DI COMPRESSIONE DATI TECNICHE DI COMPRESSIONE DATI COMPRESSIONE DATI La compressione produce una rappresentazione più compatta delle informazioni è come se si usassero meno parole per dire la stessa cosa in modo diverso. Esistono

Dettagli

Apprendimento Automatico

Apprendimento Automatico Metodologie per Sistemi Intelligenti Apprendimento Automatico Prof. Pier Luca Lanzi Laurea in Ingegneria Informatica Politecnico di Milano Polo regionale di Como Intelligenza Artificiale "making a machine

Dettagli

Compilatore risorse display grafico LCD serie IEC-line

Compilatore risorse display grafico LCD serie IEC-line Compilatore risorse display grafico LCD serie IEC-line aggiornamento: 22-11-2012 IEC-line by OVERDIGIT overdigit.com 1. Il display grafico LCD I PLC della serie IPC-line possono disporre opzionalmente

Dettagli

Tecniche di DM: Link analysis e Association discovery

Tecniche di DM: Link analysis e Association discovery Tecniche di DM: Link analysis e Association discovery Vincenzo Antonio Manganaro vincenzomang@virgilio.it, www.statistica.too.it Indice 1 Architettura di un generico algoritmo di DM. 2 2 Regole di associazione:

Dettagli

Fondamenti di Informatica

Fondamenti di Informatica Fondamenti di Informatica Corso di Laurea in Scienze dell'educazione, 2014-15 Lorenzo Bettini http://www.di.unito.it/~bettini Informazioni generali Ricevimento studenti su appuntamento Dipartimento di

Dettagli

SCHEDA PROGRAMMA INSEGNAMENTI A.A. 2012/2013

SCHEDA PROGRAMMA INSEGNAMENTI A.A. 2012/2013 SCHEDA PROGRAMMA INSEGNAMENTI A.A. 2012/2013 CORSO DI LAUREA IN Beni Culturali Insegnamento: Applicazioni informatiche all archeologia Docente Giuliano De Felice S.S.D. dell insegnamento L-ANT/10 Anno

Dettagli

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in

Dettagli

JDBC di base. Le classi/interfacce principali di JDBC

JDBC di base. Le classi/interfacce principali di JDBC JDBC di base Java Database Connectivity è il package Java per l accesso a database relazionali il package contiene interfacce e classi astratte completa indipendenza del codice dal tipo di database o di

Dettagli

FormScape V3.1: SUPPORTO XML

FormScape V3.1: SUPPORTO XML FormScape V3.1: SUPPORTO Maggio 2004 FormScape V3, la Soluzione Intelligente per Creare, Gestire, Visualizzare e Distribuire i Tuoi Documenti FormScape V3 Page 1 Introduzione Il formato si sta affermando

Dettagli

Esercizi SQL. Dato il seguente schema di una base di dati dove gli attributi che compongono la chiave sono scritti in grassetto

Esercizi SQL. Dato il seguente schema di una base di dati dove gli attributi che compongono la chiave sono scritti in grassetto Dato il seguente schema di una base di dati dove gli attributi che compongono la chiave sono scritti in grassetto Studenti data matricola nomeesame voto 12/09/2005 78 Analisi 30 23/12/2004 8 Statistica

Dettagli