Lezione 8. DNA sequencing informatics

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Lezione 8. DNA sequencing informatics"

Transcript

1 Lezione 8 DNA sequencing informatics

2 Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO NEXGDS)

3 History of sequencing informatics Algorithms for sequencing alignment Needleman and Wunsch (1970) Smith-Waterman (1981) Database searching FASTA, BLAST Tools to work with sanger sequencing STADEN package, DNA sequence assembly programs (ex. Sequencer, Mac vector, PC/Gene..) Phred/Phrap

4 Phred/Phrap cross_match, consed Sanger sequences from ABI With funding from the Human Genome Project (HGP) the University of Washington (Seattle) developed a set of bioinformatics tools for processing raw sanger sequences collected by ABI sequencing machines and for assembling overlapping reads into larger contigs Released ad a C source code suitable for compilation by skilled users on unix-based computers

5 Sanger sequences from ABI PHRED SCORE q = -10 Log 10 p PHRED Base calling + quality score Dove p è la probabilità di errore associata ad ogni base Quale sarà il Phred Score di una base chiamata con una probabilità di errore di 1/100 (accuratezza del 99%)? E di una con una p di 1/1000? q = 20 nel primo caso -> minimo considerato accettabile q = 30 nel secondo -> da 30 in su la qualità si considera alta

6 Sanger sequences from ABI PHRED Frammenti assemblati in contigs (Smith-Waterman algorithm+ some concepts from FASTA and BLAST) Base calling + quality score PHRAP CONSED GRAPHICAL EDITOR

7 Sanger sequences from ABI

8 Cosa è rimasto di tutto questo nelle analisi di dati prodotti da sequenziamenti NGS?

9 Analisi di dati NGS: Analytic flow 1. Produzione dei dati grezzi (raw data, reads) dal sequenziatore 2. Allineamento delle reads con un riferimento o tra loro (de novo) 3. Visualizzazione degli allineamenti e identificazione dei polimorfismi (se previsto dal progetto) 4. Interpretazione sulla base delle ipotesi e delle domande biologiche di partenza

10 De novo

11 1. Raw sequence Imaging (Illumina, 454, solid) or Ion detection (Ion torrent, Proton) I dati contengono 3 informazioni fondamentali: ID (identificatore individuale del campione) Sequenza Stima della qualità per ogni base chiamata Formato: FASTQ

12 FASTQ format formato di testo che include sia la sequenza (in genere nucleotidica) che la qualità di ogni base (score). Line 1: inizia con il carattere seguito da un identificatore e da una descrizione opzionale (come la linea del titolo nel formato FASTA). Line 2: raw sequence letters. Line 3: inizia col carattere '+' che può essere seguito da una descrizione (opzionale). Line 4: codifica la qualità della sequenza (PHRED SCORE) nella Line 2, deve contenere un numero di simboli pari al numero di lettere in 2:N:0:GCTGAGA GTTCATCTTGGCAGCTGGTTCCCGTATTTACTGAAGAGTATGTAGCACTTGCGTCGCTCGTGATTGAAAACAGATGGCAGCACGACACGGGCACGGTGCG

13 2. Allineamento In generale la parte più impegnativa dell analisi dei dati NGS La scelta dell algoritmo dipende da che tipo di dato abbiamo: de novo o con sequenza di riferimento? La sequenza di riferimento è vicina evolutivamente? Etc..

14 Alcuni programmi di allineamento per dati NGS Burrows Wheeler Transformation (BWT) based aligners: BWA, Bowtie, SOAP2 Allineamento di corte sequenze (tipico prodotto di NGS) ad un riferimento BWA produce un allineamento in SAM format, non chiama i siti polimorfici

15

16

17 Formato output di allineamento: SAM sequence alignment/map format De novo I file SAM sono molto grandi (comunemente decine di Gigabytes) -> si usa comprimerli per salvare spazio Contiene un titolo (opzionale) e una linea per ogni read con con 11 campi obbligatori

18

19

20

21

22 SAM files sono human-readable text files, i BAM files sono il loro equivalente binario, compresso e più adatto ad essere utilizzato dai programmi di analisi che operano i passaggi successivi.

23 De novo alignment Non c è una sequenza di riferimento Si usano comunemente approcci basati su de Brujin digraphs (capitolo 4 NGS DNA sequencing informatics) Ci sono diversi softwares, riprenderemo il problema durante la parte pratica

24 3. Visualizzazione degli allineamenti ed eventuale variant calling/genotyping Spesso per fare queste analisi esistono dei PACCHETTI di programmi che permettono di effettuare molti passaggi come visualizzazione, identificazione delle varianti, esclusione di artefatti Di seguito vedremo degli esempi, ma l elenco è ancora lungo

25 SAMtools Insieme di strumenti per interagire con ed effettuare il post processing di allineamenti di corte sequenze di DNA in formati SAM, BAM e CRAM. Questi files sono generati come output di allineatori di corte reads come BWA. Include sia strumenti semplici che complessi (variant calling, alignment viewing, sorting, indexing, data extraction, format conversion) Variant calling: Finding sequence variation within and between samples (SNPs, InDel..)

26 GATK (Genome Analysis Toolkit) Software package sviluppato al Broad Institute per analizzare dati di sequenza high-throughput. Il toolkit offre una vasta gamma di strumenti, principalmete focalizzati sulla scoperta di varianti e sulla genotipizzazione, con grande enfasi alla garanzia della qualità del dato.

27 Lo useremo nelle esercitazioni pratiche

28 Java-based stand-alone desktop software del Broad Institute che può visualizzare dati NGs in una varietà di formati (FASTA, FASTQ, SAM, BAM) Facile da installare (c è una versione anche per ipad!) I genomi di riferimento e le relative annotazioni devono essere installate manualmente

29 Robinson et al. Nature Biotechnology 29, (2011) Coverage plot and alignments from paired-end reads for a matched tumor/normal pair. Sequencing was performed on an Illumina GA2 platform and aligned with Maq (http://maq.sourceforge.net/). Alignments are represented as gray polygons with reads mismatching the reference indicated by color. Loci with a large percentage of mismatches relative to the reference are flagged in the coverage plot as color-coded bars. Alignments with unexpected inferred insert sizes are indicated by color. There is evidence for a ~10-kb deletion (removing two exons of AIDA) in the tumor sample not present in the normal.

30 BWA SAM tools GATK https://www.broadinstitute.org/gatk/

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

RefWorks Guida all utente Versione 4.0

RefWorks Guida all utente Versione 4.0 Accesso a RefWorks per utenti registrati RefWorks Guida all utente Versione 4.0 Dalla pagina web www.refworks.com/refworks Inserire il proprio username (indirizzo e-mail) e password NB: Agli utenti remoti

Dettagli

Informatica. Scopo della lezione

Informatica. Scopo della lezione 1 Informatica per laurea diarea non informatica LEZIONE 1 - Cos è l informatica 2 Scopo della lezione Introdurre le nozioni base della materia Definire le differenze tra hardware e software Individuare

Dettagli

Comandi filtro: sed. Se non si specificano azioni, sed stampa sullo standard output le linee in input, lasciandole inalterate.

Comandi filtro: sed. Se non si specificano azioni, sed stampa sullo standard output le linee in input, lasciandole inalterate. Comandi filtro: sed Il nome del comando sed sta per Stream EDitor e la sua funzione è quella di permettere di editare il testo passato da un comando ad un altro in una pipeline. Ciò è molto utile perché

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

Introduzione a MySQL

Introduzione a MySQL Introduzione a MySQL Cinzia Cappiello Alessandro Raffio Politecnico di Milano Prima di iniziare qualche dettaglio su MySQL MySQL è un sistema di gestione di basi di dati relazionali (RDBMS) composto da

Dettagli

Modulo. Programmiamo in Pascal. Unità didattiche COSA IMPAREREMO...

Modulo. Programmiamo in Pascal. Unità didattiche COSA IMPAREREMO... Modulo A Programmiamo in Pascal Unità didattiche 1. Installiamo il Dev-Pascal 2. Il programma e le variabili 3. Input dei dati 4. Utilizziamo gli operatori matematici e commentiamo il codice COSA IMPAREREMO...

Dettagli

LA TECHNOLOGY TRANSFER PRESENTA SUZANNE ROBERTSON MASTERING THE REQUIREMENTS PROCESS COME COSTRUIRE IL SISTEMA CHE IL VOSTRO UTENTE DESIDERA

LA TECHNOLOGY TRANSFER PRESENTA SUZANNE ROBERTSON MASTERING THE REQUIREMENTS PROCESS COME COSTRUIRE IL SISTEMA CHE IL VOSTRO UTENTE DESIDERA LA TECHNOLOGY TRANSFER PRESENTA SUZANNE ROBERTSON MASTERING THE REQUIREMENTS PROCESS COME COSTRUIRE IL SISTEMA CHE IL VOSTRO UTENTE DESIDERA ROMA 20-22 OTTOBRE 2014 RESIDENZA DI RIPETTA - VIA DI RIPETTA,

Dettagli

Intalio. Leader nei Sistemi Open Source per il Business Process Management. Andrea Calcagno Amministratore Delegato

Intalio. Leader nei Sistemi Open Source per il Business Process Management. Andrea Calcagno Amministratore Delegato Intalio Convegno Open Source per la Pubblica Amministrazione Leader nei Sistemi Open Source per il Business Process Management Navacchio 4 Dicembre 2008 Andrea Calcagno Amministratore Delegato 20081129-1

Dettagli

Analisi di massima: L utente dovrà inserire un numero limite, e tramite vari calcoli verrà stampato a video la sequenza.

Analisi di massima: L utente dovrà inserire un numero limite, e tramite vari calcoli verrà stampato a video la sequenza. Relazione tecnica Fibonacci ANDENA GIANMARCO Traccia: Creare un algoritmo che permetta, dato un valore intero e positivo, di stabilire la sequenza utilizzando la regola di fibonacci dei numeri fino al

Dettagli

Dati importati/esportati

Dati importati/esportati Dati importati/esportati Dati importati Al workspace MATLAB script Dati esportati file 1 File di testo (.txt) Spreadsheet Database Altro Elaborazione dati Grafici File di testo Relazioni Codice Database

Dettagli

GESTIRE LA BIBLIOGRAFIA

GESTIRE LA BIBLIOGRAFIA GESTIRE LA BIBLIOGRAFIA STRUMENTI DI GESTIONE BIBLIOGRAFICA I software di gestione bibliografica permettono di raccogliere, catalogare e organizzare diverse tipologie di materiali, prendere appunti, formattare

Dettagli

DBMS (Data Base Management System)

DBMS (Data Base Management System) Cos'è un Database I database o banche dati o base dati sono collezioni di dati, tra loro correlati, utilizzati per rappresentare una porzione del mondo reale. Sono strutturati in modo tale da consentire

Dettagli

Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale.

Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale. Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale. L analisi modale è un approccio molto efficace al comportamento dinamico delle strutture, alla verifica di modelli di calcolo

Dettagli

Processi (di sviluppo del) software. Fase di Analisi dei Requisiti. Esempi di Feature e Requisiti. Progettazione ed implementazione

Processi (di sviluppo del) software. Fase di Analisi dei Requisiti. Esempi di Feature e Requisiti. Progettazione ed implementazione Processi (di sviluppo del) software Fase di Analisi dei Requisiti Un processo software descrive le attività (o task) necessarie allo sviluppo di un prodotto software e come queste attività sono collegate

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Cos'é Code::Blocks? Come Creare un progetto Come eseguire un programma Risoluzione problemi istallazione Code::Blocks Che cos è il Debug e come si usa

Cos'é Code::Blocks? Come Creare un progetto Come eseguire un programma Risoluzione problemi istallazione Code::Blocks Che cos è il Debug e come si usa di Ilaria Lorenzo e Alessandra Palma Cos'é Code::Blocks? Come Creare un progetto Come eseguire un programma Risoluzione problemi istallazione Code::Blocks Che cos è il Debug e come si usa Code::Blocks

Dettagli

Principal Component Analysis

Principal Component Analysis Principal Component Analysis Alessandro Rezzani Abstract L articolo descrive una delle tecniche di riduzione della dimensionalità del data set: il metodo dell analisi delle componenti principali (Principal

Dettagli

Indicizzazione terza parte e modello booleano

Indicizzazione terza parte e modello booleano Reperimento dell informazione (IR) - aa 2014-2015 Indicizzazione terza parte e modello booleano Gruppo di ricerca su Sistemi di Gestione delle Informazioni (IMS) Dipartimento di Ingegneria dell Informazione

Dettagli

AOT Lab Dipartimento di Ingegneria dell Informazione Università degli Studi di Parma. Unified Process. Prof. Agostino Poggi

AOT Lab Dipartimento di Ingegneria dell Informazione Università degli Studi di Parma. Unified Process. Prof. Agostino Poggi AOT Lab Dipartimento di Ingegneria dell Informazione Università degli Studi di Parma Unified Process Prof. Agostino Poggi Unified Process Unified Software Development Process (USDP), comunemente chiamato

Dettagli

PRESENTAZIONE DI UN SMS AL GATEWAY

PRESENTAZIONE DI UN SMS AL GATEWAY Interfaccia Full Ascii Con questa interfaccia è possibile inviare i dati al Server utilizzando solo caratteri Ascii rappresentabili e solo i valori che cambiano tra un sms e l altro, mantenendo la connessione

Dettagli

Web of Science SM QUICK REFERENCE GUIDE IN COSA CONSISTE WEB OF SCIENCE? General Search

Web of Science SM QUICK REFERENCE GUIDE IN COSA CONSISTE WEB OF SCIENCE? General Search T TMTMTt QUICK REFERENCE GUIDE Web of Science SM IN COSA CONSISTE WEB OF SCIENCE? Consente di effettuare ricerche in oltre 12.000 riviste e 148.000 atti di convegni nel campo delle scienze, delle scienze

Dettagli

RUP (Rational Unified Process)

RUP (Rational Unified Process) RUP (Rational Unified Process) Caratteristiche, Punti di forza, Limiti versione del tutorial: 3.3 (febbraio 2007) Pag. 1 Unified Process Booch, Rumbaugh, Jacobson UML (Unified Modeling Language) notazione

Dettagli

La gestione documentale con il programma Filenet ed il suo utilizzo tramite la tecnologia.net. di Emanuele Mattei (emanuele.mattei[at]email.

La gestione documentale con il programma Filenet ed il suo utilizzo tramite la tecnologia.net. di Emanuele Mattei (emanuele.mattei[at]email. La gestione documentale con il programma Filenet ed il suo utilizzo tramite la tecnologia.net di Emanuele Mattei (emanuele.mattei[at]email.it) Introduzione In questa serie di articoli, vedremo come utilizzare

Dettagli

Esercizi per il corso di Algoritmi e Strutture Dati

Esercizi per il corso di Algoritmi e Strutture Dati 1 Esercizi per il corso di Algoritmi e Strutture Dati Esercizi sulla Tecnica Divide et Impera N.B. Tutti gli algoritmi vanno scritti in pseudocodice (non in Java, né in C++, etc. ). Di tutti gli algoritmi

Dettagli

Istituto Tecnico Commerciale Indirizzo AFM articolazione SIA PERCHE???

Istituto Tecnico Commerciale Indirizzo AFM articolazione SIA PERCHE??? Istituto Tecnico Commerciale Indirizzo AFM articolazione SIA PERCHE??? Opportunità di lavoro: ICT - Information and Communication Technology in Azienda Vendite Acquisti Produzione Logistica AFM SIA ICT

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

explorer 2 Manuale dell Installatore e Technical Reference Ver. 2.2.6 del 14 Dicembre 2012

explorer 2 Manuale dell Installatore e Technical Reference Ver. 2.2.6 del 14 Dicembre 2012 explorer 2 Manuale dell Installatore e Technical Reference Ver. 2.2.6 del 14 Dicembre 2012 1 Indice 1. Descrizione del sistema e Requisiti hardware e software per l installazione... 4 1.1 Descrizione del

Dettagli

WWW.TINYLOC.COM CUSTOMER SERVICE GPS/ RADIOTRACKING DOG COLLAR. T. (+34) 937 907 971 F. (+34) 937 571 329 sales@tinyloc.com

WWW.TINYLOC.COM CUSTOMER SERVICE GPS/ RADIOTRACKING DOG COLLAR. T. (+34) 937 907 971 F. (+34) 937 571 329 sales@tinyloc.com WWW.TINYLOC.COM CUSTOMER SERVICE T. (+34) 937 907 971 F. (+34) 937 571 329 sales@tinyloc.com GPS/ RADIOTRACKING DOG COLLAR MANUALE DI ISTRUZIONI ACCENSIONE / SPEGNERE DEL TAG HOUND Finder GPS Il TAG HOUND

Dettagli

Dal modello concettuale al modello logico

Dal modello concettuale al modello logico Dal modello concettuale al modello logico Traduzione dal modello Entita - Associazione al modello Relazionale Ciclo di sviluppo di una base di dati (da parte dell utente) Analisi dello scenario Modello

Dettagli

Introduzione agli algoritmi e alla programmazione in VisualBasic.Net

Introduzione agli algoritmi e alla programmazione in VisualBasic.Net Lezione 1 Introduzione agli algoritmi e alla programmazione in VisualBasic.Net Definizione di utente e di programmatore L utente è qualsiasi persona che usa il computer anche se non è in grado di programmarlo

Dettagli

Text mining ed analisi di dati codificati in linguaggio naturale. Analisi esplorative di dati testualilezione

Text mining ed analisi di dati codificati in linguaggio naturale. Analisi esplorative di dati testualilezione Text mining ed analisi di dati codificati in linguaggio naturale Analisi esplorative di dati testualilezione 2 Le principali tecniche di analisi testuale Facendo riferimento alle tecniche di data mining,

Dettagli

Proposition for a case-study identification process. 6/7 May 2008 Helsinki

Proposition for a case-study identification process. 6/7 May 2008 Helsinki Conférence des Régions Périphériques Maritimes d Europe Conference of Peripheral Maritime Regions of Europe ANALYSIS PARTICIPATION TO THE FP THROUGH A TERRITORIAL AND REGIONAL PERSPECTIVE MEETING WITH

Dettagli

Modificazioni dello spazio affettivo nel ciclo di vita

Modificazioni dello spazio affettivo nel ciclo di vita Modificazioni dello spazio affettivo nel ciclo di vita di Francesca Battisti Come gestiamo le nostre emozioni? Assistiamo ad esse passivamente o le ignoriamo? Le incoraggiamo o le sopprimiamo? Ogni cultura

Dettagli

User guide Conference phone Konftel 100

User guide Conference phone Konftel 100 User guide Conference phone Konftel 100 Dansk I Deutsch I English I Español I Français I Norsk Suomi I Svenska Conference phones for every situation Sommario Descrizione Connessioni, accessoires, ricambi

Dettagli

Guida ai Parametri di negoziazione dei mercati regolamentati organizzati e gestiti da Borsa Italiana

Guida ai Parametri di negoziazione dei mercati regolamentati organizzati e gestiti da Borsa Italiana Guida ai Parametri di negoziazione dei mercati regolamentati organizzati e gestiti da Borsa Italiana Versione 04 1/28 INTRODUZIONE La Guida ai Parametri contiene la disciplina relativa ai limiti di variazione

Dettagli

Zeroshell come client OpenVPN

Zeroshell come client OpenVPN Zeroshell come client OpenVPN (di un server OpenVpn Linux) Le funzionalità di stabilire connessioni VPN di Zeroshell vede come scenario solito Zeroshell sia come client sia come server e per scelta architetturale,

Dettagli

Guida per Auto Valutazione Secondo l EFQM GUIDA PER L APPLICAZIONE IONE DELLA METODOLOGIA DI AUTO VALUTAZIONE EFQM NEL PARTENARIATO

Guida per Auto Valutazione Secondo l EFQM GUIDA PER L APPLICAZIONE IONE DELLA METODOLOGIA DI AUTO VALUTAZIONE EFQM NEL PARTENARIATO GUIDA PER L APPLICAZIONE IONE DELLA METODOLOGIA DI AUTO VALUTAZIONE EFQM NEL PARTENARIATO 1 INDICE 1. INTRODUZIONE... 3 2. LA METODOLOGIA EFQM E IL QUESTIONARIO DI AUTO VALUTAZIONE... 4 3. LA METODOLOGIA

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

Energy risk management

Energy risk management Il sistema di supporto alle tue decisioni Energy risk management Un approccio orientato agli attori M.B.I. Srl, Via Francesco Squartini 7-56121 Pisa, Italia - tel. 050 3870888 - fax. 050 3870808 www.powerschedo.it

Dettagli

Le novità di QuarkXPress 10.1

Le novità di QuarkXPress 10.1 Le novità di QuarkXPress 10.1 INDICE Indice Le novit di QuarkXPress 10.1...3 Nuove funzionalit...4 Guide dinamiche...4 Note...4 Libri...4 Redline...5 Altre nuove funzionalit...5 Note legali...6 ii LE NOVITÀ

Dettagli

Manuale d uso Apache OpenMeetings (Manuale Utente + Manuale Amministratore)

Manuale d uso Apache OpenMeetings (Manuale Utente + Manuale Amministratore) Manuale d uso Apache OpenMeetings (Manuale Utente + Manuale Amministratore) Autore: Matteo Veroni Email: matver87@gmail.com Sito web: matteoveroni@altervista.org Fonti consultate: http://openmeetings.apache.org/

Dettagli

Process mining & Optimization Un approccio matematico al problema

Process mining & Optimization Un approccio matematico al problema Res User Meeting 2014 con la partecipazione di Scriviamo insieme il futuro Paolo Ferrandi Responsabile Tecnico Research for Enterprise Systems Federico Bonelli Engineer Process mining & Optimization Un

Dettagli

CA RC/Update for DB2 for z/os

CA RC/Update for DB2 for z/os SCHEDA PRODOTTO CA RC/Update for DB2 for z/os CA RC/Update for DB2 for z/os CA RC/Update for DB2 for z/os (CA RC/Update) è uno strumento di gestione di dati e oggetti DB2 che consente agli amministratori

Dettagli

Rappresentazione dei numeri in un calcolatore

Rappresentazione dei numeri in un calcolatore Corso di Calcolatori Elettronici I A.A. 2010-2011 Rappresentazione dei numeri in un calcolatore Lezione 2 Università degli Studi di Napoli Federico II Facoltà di Ingegneria Rappresentazione dei numeri

Dettagli

Teoria della misurazione e misurabilità di grandezze non fisiche

Teoria della misurazione e misurabilità di grandezze non fisiche Teoria della misurazione e misurabilità di grandezze non fisiche Versione 12.6.05 Teoria della misurazione e misurabilità di grandezze non fisiche 1 Il contesto del discorso (dalla lezione introduttiva)

Dettagli

Definizione di una policy per l archivio istituzionale ISS

Definizione di una policy per l archivio istituzionale ISS CONFERENCE Institutional archives for research: experiences and projects in open access Istituto Superiore di Sanità Rome, 30/11-1/12 2006 Definizione di una policy per l archivio istituzionale ISS Paola

Dettagli

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07.

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07. Istruzione N 62 Data creazione 18/ 12/2009 Versione N 00 Ultima modifica TIPO ISTRUZIONE ASSEMBLAGGIO COLLAUDO TRAINING MODIFICA TEST FUNZIONALE RIPARAZIONE/SOSTITUZIONE IMBALLO TITOLO DELL ISTRUZIONE

Dettagli

Corso di Informatica

Corso di Informatica CdLS in Odontoiatria e Protesi Dentarie Corso di Informatica Prof. Crescenzio Gallo crescenzio.gallo@unifg.it L Informatica!2 Informatica Il termine informatica deriva dal francese Informatique Inform(ation

Dettagli

Esiste la versione per Linux di GeCo? Allo stato attuale non è prevista la distribuzione di una versione di GeCo per Linux.

Esiste la versione per Linux di GeCo? Allo stato attuale non è prevista la distribuzione di una versione di GeCo per Linux. FAQ su GeCo Qual è la differenza tra la versione di GeCo con installer e quella portabile?... 2 Esiste la versione per Linux di GeCo?... 2 Quali sono le credenziali di accesso a GeCo?... 2 Ho smarrito

Dettagli

I presupposti giuridici della valutazione degli intangibles.

I presupposti giuridici della valutazione degli intangibles. Ufficio di Modena: Via M. Vellani Marchi, 20 Tel: 059 2916511 Fax: 059 2921132 Email: masetti@bugnion.it www.bugnion.it Avv. Rossella Masetti Email: masetti@bugnion.it LA GESTIONE E LA VALORIZZAZIONE DI

Dettagli

Guida alle offerte di finanziamento per le medie imprese

Guida alle offerte di finanziamento per le medie imprese IBM Global Financing Guida alle offerte di finanziamento per le medie imprese Realizzata da IBM Global Financing ibm.com/financing/it Guida alle offerte di finanziamento per le medie imprese La gestione

Dettagli

Sistemi di gestione dei dati e dei processi aziendali. Information Technology General Controls

Sistemi di gestione dei dati e dei processi aziendali. Information Technology General Controls Information Technology General Controls Indice degli argomenti Introduzione agli ITGC ITGC e altre componenti del COSO Framework Sviluppo e manutenzione degli applicativi Gestione operativa delle infrastrutture

Dettagli

Nella prima lezione... Che cos è il Digitale. Prima parte: Che cos è il Digitale. Che cos è il Digitale. Che cos è il Digitale

Nella prima lezione... Che cos è il Digitale. Prima parte: Che cos è il Digitale. Che cos è il Digitale. Che cos è il Digitale !"$#%!" #% Nella prima lezione... Definizione di Informatica Cosa è una soluzione algoritmica Esempi di algoritmi cicalese@dia.unisa.it 2 Prima parte: Società dell informazione Ma cosa vuol dire società

Dettagli

Marco Giorgi. Palazzo di Giustizia di Torino 30 marzo 2012

Marco Giorgi. Palazzo di Giustizia di Torino 30 marzo 2012 Marco Giorgi Palazzo di Giustizia di Torino 30 marzo 2012 Post mortem (Dopo lo spegnimento del sistema) Si smonta il dispositivo e lo si collega ad un PC dedicato all'acquisizione Live forensics (Direttamente

Dettagli

Mini manuale di Audacity.

Mini manuale di Audacity. Mini manuale di Audacity. Questo mini manuale è parte del corso on-line Usare il software libero di Altrascuola. Il corso è erogato all'interno del portale per l'e-learning Altrascuola con la piattaforma

Dettagli

LE NOVITÀ DELL EDIZIONE 2011 DELLO STANDARD ISO/IEC 20000-1 E LE CORRELAZIONI CON IL FRAMEWORK ITIL

LE NOVITÀ DELL EDIZIONE 2011 DELLO STANDARD ISO/IEC 20000-1 E LE CORRELAZIONI CON IL FRAMEWORK ITIL Care Colleghe, Cari Colleghi, prosegue la nuova serie di Newsletter legata agli Schemi di Certificazione di AICQ SICEV. Questa volta la pillola formativa si riferisce alle novità dell edizione 2011 dello

Dettagli

IBM Cognos 8 BI Midmarket Reporting Packages Per soddisfare tutte le vostre esigenze di reporting restando nel budget

IBM Cognos 8 BI Midmarket Reporting Packages Per soddisfare tutte le vostre esigenze di reporting restando nel budget Data Sheet IBM Cognos 8 BI Midmarket Reporting Packages Per soddisfare tutte le vostre esigenze di reporting restando nel budget Panoramica Le medie aziende devono migliorare nettamente le loro capacità

Dettagli

Informazioni su questo libro

Informazioni su questo libro Informazioni su questo libro Si tratta della copia digitale di un libro che per generazioni è stato conservata negli scaffali di una biblioteca prima di essere digitalizzato da Google nell ambito del progetto

Dettagli

Serduino - SERRA CON ARDUINO

Serduino - SERRA CON ARDUINO Serduino - SERRA CON ARDUINO 1 Componenti Facchini Riccardo (responsabile parte hardware) Guglielmetti Andrea (responsabile parte software) Laurenti Lorenzo (progettazione hardware) Rigolli Andrea (reparto

Dettagli

Ragazzi vietnamiti: (VIET L ANIMA HCM USSH) CLASSE 5 C: (21 TORTELLINI) 1. Trần Yến Ngọc 2. Nguyễn Ngọc Bách Châu AUTORI PROGETTO:

Ragazzi vietnamiti: (VIET L ANIMA HCM USSH) CLASSE 5 C: (21 TORTELLINI) 1. Trần Yến Ngọc 2. Nguyễn Ngọc Bách Châu AUTORI PROGETTO: Due mondi, due culture, due storie che si incontrano per dare vita a qualcosa di unico: la scoperta di ciò che ci rende unici ma fratelli. Per andare insieme verso EXPO 2015 Tutt altra storia Il viaggio

Dettagli

Approvazione delle modifiche al modello di versamento F24 enti pubblici ed alle relative specifiche tecniche Introduzione del secondo codice fiscale

Approvazione delle modifiche al modello di versamento F24 enti pubblici ed alle relative specifiche tecniche Introduzione del secondo codice fiscale Prot. n. 2012/140335 Approvazione delle modifiche al modello di versamento F24 enti pubblici ed alle relative specifiche tecniche Introduzione del secondo codice fiscale IL DIRETTORE DELL AGENZIA In base

Dettagli

LEAR ITALIA MES/LES PROJECT

LEAR ITALIA MES/LES PROJECT LEAR ITALIA MES/LES PROJECT La peculiarità del progetto realizzato in Lear Italia da Hermes Reply è quello di integrare in un unica soluzione l execution della produzione (con il supporto dell RFID), della

Dettagli

INTRODUZIONE, LINGUAGGIO, HANDS ON. Giuseppe Cirillo g.cirillo@unina.it

INTRODUZIONE, LINGUAGGIO, HANDS ON. Giuseppe Cirillo g.cirillo@unina.it INTRODUZIONE, LINGUAGGIO, HANDS ON Giuseppe Cirillo g.cirillo@unina.it Il linguaggio C 1972-Dennis Ritchie 1978-Definizione 1990-ANSI C 1966 Martin Richars (MIT) Semplificando CPL usato per sviluppare

Dettagli

Introduzione Perché ti può aiutare la Smart Data Capture?

Introduzione Perché ti può aiutare la Smart Data Capture? 01 Introduzione Perché ti può aiutare la Smart Data Capture? Gestisci ogni giorno un elevato numero di fatture e documenti? Se hai un elevato numero di fatture da registrare, note di credito e documenti

Dettagli

ISTRUZIONI PER IL SERVIZIO SPCOOP - RICEZIONE

ISTRUZIONI PER IL SERVIZIO SPCOOP - RICEZIONE ISTRUZIONI PER IL SERVIZIO SPCOOP - RICEZIONE Pag. 1 di 14 INDICE 1. Glossario... 3 2. il servizio SPCoop - Ricezione... 5 3. Il web-service RicezioneFatture... 8 3.1 Operazione RiceviFatture... 9 3.1.1

Dettagli

Manipolazione di testi: espressioni regolari

Manipolazione di testi: espressioni regolari Manipolazione di testi: espressioni regolari Un meccanismo per specificare un pattern, che, di fatto, è la rappresentazione sintetica di un insieme (eventualmente infinito) di stringhe: il pattern viene

Dettagli

Lavorazione artigianale Italiana Handmade in Italy. da noi ogni sapone è unico. Authentically Made in Italy Florence

Lavorazione artigianale Italiana Handmade in Italy. da noi ogni sapone è unico. Authentically Made in Italy Florence Lavorazione artigianale Italiana Handmade in Italy da noi ogni sapone è unico alveare soap gori 1919 soap factory lavorazione artigianale italiana Handmade in Italy I nostri saponi sono il frutto di un

Dettagli

VIRTUALIZE IT. www.digibyte.it - digibyte@digibyte.it

VIRTUALIZE IT. www.digibyte.it - digibyte@digibyte.it il server? virtualizzalo!! Se ti stai domandando: ma cosa stanno dicendo? ancora non sai che la virtualizzazione è una tecnologia software, oggi ormai consolidata, che sta progressivamente modificando

Dettagli

BUSINESS INTELLIGENCE & PERFORMANCE MANAGEMENT

BUSINESS INTELLIGENCE & PERFORMANCE MANAGEMENT BUSINESS INTELLIGENCE & PERFORMANCE MANAGEMENT BOLOGNA BUSINESS school Dal 1088, studenti da tutto il mondo vengono a studiare a Bologna dove scienza, cultura e tecnologia si uniscono a valori, stile di

Dettagli

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza Simona Giampaoli, Anna Rita Ciccaglione Istituto Superiore di Sanità Prevalenza e carico dell infezione cronica da virus dell epatite

Dettagli

VC-dimension: Esempio

VC-dimension: Esempio VC-dimension: Esempio Quale è la VC-dimension di. y b = 0 f() = 1 f() = 1 iperpiano 20? VC-dimension: Esempio Quale è la VC-dimension di? banale. Vediamo cosa succede con 2 punti: 21 VC-dimension: Esempio

Dettagli

Ambienti di sviluppo integrato

Ambienti di sviluppo integrato Ambienti di sviluppo integrato Un ambiente di sviluppo integrato (IDE - Integrated Development Environment) è un ambiente software che assiste i programmatori nello sviluppo di programmi Esso è normalmente

Dettagli

ITIL v3 e' parte di un processo teso a migliorare le best practices ITIL. In effetti, ITIL predica il "continuous improvement" ed e'

ITIL v3 e' parte di un processo teso a migliorare le best practices ITIL. In effetti, ITIL predica il continuous improvement ed e' ITIL v3 ITIL v3 e' parte di un processo teso a migliorare le best practices ITIL. In effetti, ITIL predica il "continuous improvement" ed e' giusto che lo applichi anche a se' stessa... Naturalmente una

Dettagli

Cenni su algoritmi, diagrammi di flusso, strutture di controllo

Cenni su algoritmi, diagrammi di flusso, strutture di controllo Cenni su algoritmi, diagrammi di flusso, strutture di controllo Algoritmo Spesso, nel nostro vivere quotidiano, ci troviamo nella necessità di risolvere problemi. La descrizione della successione di operazioni

Dettagli

Progettare Qualità di Vita nell ambito delle Disabilità Intellettive ed Evolutive:

Progettare Qualità di Vita nell ambito delle Disabilità Intellettive ed Evolutive: Progettare Qualità di Vita nell ambito delle Disabilità Intellettive ed Evolutive: Dai diritti alla costruzione di un sistema di sostegni orientato al miglioramento della Qualità di Vita A cura di: Luigi

Dettagli

Equilibrio Termico tra Due Corpi

Equilibrio Termico tra Due Corpi Equilibrio Termico tra Due Corpi www.lepla.eu OBIETTIVO L attività ha l obiettivo di fare acquisire allo sperimentatore la consapevolezza che: 1 il raggiungimento dell'equilibrio termico non è istantaneo

Dettagli

LINEE GUIDA PER LA REVISIONE SISTEMATICA DI LETTERATURA

LINEE GUIDA PER LA REVISIONE SISTEMATICA DI LETTERATURA LINEE GUIDA PER LA REVISIONE SISTEMATICA DI LETTERATURA report tecnico nr. 03/08 v. 1 indice dei contenuti 1. Utilità delle RSL Pag. 1 2. Principali metodi Pag. 2 3. Esempi di RSL Pag. 3 4. Protocollo

Dettagli

RSYNC e la sincronizzazione dei dati

RSYNC e la sincronizzazione dei dati RSYNC e la sincronizzazione dei dati Introduzione Questo breve documento intende spiegare come effettuare la sincronizzazione dei dati tra due sistemi, supponendo un sistema in produzione (master) ed uno

Dettagli

Lezione 12: La visione robotica

Lezione 12: La visione robotica Robotica Robot Industriali e di Servizio Lezione 12: La visione robotica L'acquisizione dell'immagine L acquisizione dell immagine Sensori a tubo elettronico (Image-Orthicon, Plumbicon, Vidicon, ecc.)

Dettagli

Avviso di selezione per n. 4 contratti di collaborazione a progetto della Fondazione Bologna Business School.

Avviso di selezione per n. 4 contratti di collaborazione a progetto della Fondazione Bologna Business School. Avviso 2014C-01 del 30/12/2014 Avviso di selezione per n. 4 contratti di collaborazione a progetto della Fondazione Bologna Business School. La Fondazione Bologna University Business School (d ora in poi

Dettagli

Introduzione. E un sistema EAI molto flessibile, semplice ed efficace:

Introduzione. E un sistema EAI molto flessibile, semplice ed efficace: Overview tecnica Introduzione E un sistema EAI molto flessibile, semplice ed efficace: Introduce un architettura ESB nella realtà del cliente Si basa su standard aperti Utilizza un qualsiasi Application

Dettagli

Profilo Aziendale ISO 9001: 2008. METISOFT spa - p.iva 00702470675 - www.metisoft.it - info@metisoft.it

Profilo Aziendale ISO 9001: 2008. METISOFT spa - p.iva 00702470675 - www.metisoft.it - info@metisoft.it ISO 9001: 2008 Profilo Aziendale METISOFT spa - p.iva 00702470675 - www.metisoft.it - info@metisoft.it Sede legale: * Viale Brodolini, 117-60044 - Fabriano (AN) - Tel. 0732.251856 Sede amministrativa:

Dettagli

Il business risk reporting: lo. gestione continua dei rischi

Il business risk reporting: lo. gestione continua dei rischi 18 ottobre 2012 Il business risk reporting: lo strumento essenziale per la gestione continua dei rischi Stefano Oddone, EPM Sales Consulting Senior Manager di Oracle 1 AGENDA L importanza di misurare Business

Dettagli

Introduzione alle applicazioni di rete

Introduzione alle applicazioni di rete Introduzione alle applicazioni di rete Definizioni base Modelli client-server e peer-to-peer Socket API Scelta del tipo di servizio Indirizzamento dei processi Identificazione di un servizio Concorrenza

Dettagli

Mod. VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES

Mod. VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES Mod VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES Mod VS/AM 65 1 2 VS/AM 65 STANDARD VS/AM 65 CON RACCORDI VS/AM 65

Dettagli

Routing (instradamento) in Internet. Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi:

Routing (instradamento) in Internet. Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi: Routing (instradamento) in Internet Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi: Stub AS: istituzione piccola Multihomed AS: grande istituzione (nessun ( transito Transit AS: provider

Dettagli

Il Form C cartaceo ed elettronico

Il Form C cartaceo ed elettronico Il Form C cartaceo ed elettronico Giusy Lo Grasso Roma, 9 luglio 2012 Reporting DURANTE IL PROGETTO VENGONO RICHIESTI PERIODIC REPORT entro 60 giorni dalla fine del periodo indicato all Art 4 del GA DELIVERABLES

Dettagli

Analisi Costi e Benefici Laura Vici laura.vici@unibo.it LEZIONE 5

Analisi Costi e Benefici Laura Vici laura.vici@unibo.it LEZIONE 5 Analisi Costi e Benefici Laura Vici laura.vici@unibo.it LEZIONE 5 Rimini, 26 aprile 2006 1 The Inter temporal Effects of International Trade Valore in $ del consumo di beni oggi G D F H 1/(1+r) G Valore

Dettagli

DICHIARAZIONE DEI DIRITTI SESSUALI

DICHIARAZIONE DEI DIRITTI SESSUALI DICHIARAZIONE DEI DIRITTI SESSUALI Riconoscendo che i diritti sessuali sono essenziali per l ottenimento del miglior standard di salute sessuale raggiungibile, la World Association for Sexual Health (WAS):

Dettagli

Ricapitoliamo. Ricapitoliamo

Ricapitoliamo. Ricapitoliamo Ricapitoliamo Finora ci siamo concentrati sui processi computazionali e sul ruolo che giocano le procedure nella progettazione dei programmi In particolare, abbiamo visto: Come usare dati primitivi (numeri)

Dettagli

Gli asteroidi. Informazioni e contatti: http://vo-for-education.oats.inaf.it - iafrate@oats.inaf.it

Gli asteroidi. Informazioni e contatti: http://vo-for-education.oats.inaf.it - iafrate@oats.inaf.it Esempio sull'utilizzo dell'osservatorio Virtuale Gli asteroidi Informazioni e contatti: http://vo-for-education.oats.inaf.it - iafrate@oats.inaf.it Distribuzione degli asteroidi Il Sistema Solare è composto

Dettagli

Quali dati potremmo modificare? Impostazioni sul campionato, risultati, designazioni, provvedimenti disciplinari, statistiche e tanto ancora.

Quali dati potremmo modificare? Impostazioni sul campionato, risultati, designazioni, provvedimenti disciplinari, statistiche e tanto ancora. WCM Sport è un software che tramite un sito web ha l'obbiettivo di aiutare l'organizzazione e la gestione di un campionato sportivo supportando sia i responsabili del campionato sia gli utilizzatori/iscritti

Dettagli

1x1 qs-stat. Pacchetto Software per la Soluzione di Problemi Statistici nel Controllo Qualità. Versione: 1 / Marzo 2010 Doc. n.

1x1 qs-stat. Pacchetto Software per la Soluzione di Problemi Statistici nel Controllo Qualità. Versione: 1 / Marzo 2010 Doc. n. 1x1 qs-stat Pacchetto Software per la Soluzione di Problemi Statistici nel Controllo Qualità Versione: 1 / Marzo 2010 Doc. n.: PD-0012 Copyright 2010 Q-DAS GmbH & Co. KG Eisleber Str. 2 D - 69469 Weinheim

Dettagli

Esercizi per il recupero del debito formativo:

Esercizi per il recupero del debito formativo: ANNO SCOLASTICO 2005/2006 CLASSE 3 ISC Esercizi per il recupero del debito formativo: Disegnare il diagramma e scrivere la matrice delle transizioni di stato degli automi a stati finiti che rappresentano

Dettagli

Mai più senza smartphone.

Mai più senza smartphone. Mai più senza smartphone. Il telefonino ha superato il pc come mezzo di consultazione del web: 14,5 milioni contro 12,5 milioni.* Sempre più presente, lo smartphone è ormai parte integrante delle nostre

Dettagli

Risolvere un problema significa individuare un procedimento che permetta di arrivare al risultato partendo dai dati

Risolvere un problema significa individuare un procedimento che permetta di arrivare al risultato partendo dai dati Algoritmi Algoritmi Risolvere un problema significa individuare un procedimento che permetta di arrivare al risultato partendo dai dati Il procedimento (chiamato algoritmo) è composto da passi elementari

Dettagli

MODBUS-RTU per. Specifiche protocollo di comunicazione MODBUS-RTU per controllo in rete dispositivi serie. Expert NANO 2ZN

MODBUS-RTU per. Specifiche protocollo di comunicazione MODBUS-RTU per controllo in rete dispositivi serie. Expert NANO 2ZN per Expert NANO 2ZN Specifiche protocollo di comunicazione MODBUS-RTU per controllo in rete dispositivi serie Expert NANO 2ZN Nome documento: MODBUS-RTU_NANO_2ZN_01-12_ITA Software installato: NANO_2ZN.hex

Dettagli

Linguaggio di bash per esempi. Tre modi per quotare. Esempio. quotare: significa trattare caratteri speciali come normali caratteri

Linguaggio di bash per esempi. Tre modi per quotare. Esempio. quotare: significa trattare caratteri speciali come normali caratteri Linguaggio di bash per esempi Tre modi per quotare quotare: signica trattare caratteri speciali come normali caratteri es. di aratteri speciali: $, blank, apici, 1. backslash: per quotare un solo carattere

Dettagli