Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Bioinformatica e Biologia Computazionale per la Medicina Molecolare"

Transcript

1 Facoltà di Ingegneria dell Informazione Laurea Specialistica e Magistrale in Ingegneria Informatica Facoltà di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica e Informazione Bioinformatica e Biologia Computazionale per la Medicina Molecolare Marco Masseroli, PhD

2 Bioinformatica e Biologia Computazionale per la Medicina Molecolare Misurazione dell Espressione Genica Marco Masseroli, PhD 2

3 Indice Introduzione Tecniche di analisi di espressione genica Northern blot Analisi di un singolo trascritto DNA microarrays Piattaforme tecnologiche - Filtri di nylon ad alta densità - cdna microarray (spotted) - Microarray di oligonucleotidi Confronto cdna vs oligonucleotidi Riassunto esperimento microarray Serial Analysis of Gene Expression (SAGE) Disegno sperimentale di studi del trascrittoma Esperimenti statici con microarray Esperimenti dinamici con microarray Analisi dati di espressione Acquisizione e pre-elaborazione segnale Data mining Problemi analisi dati di microarray Microarray and Gene Expression Data (MGED) Tools per l analisi dati da microarray 3

4 Introduzione Dai geni alle proteine 4

5 Introduzione Geni di cellula codificano un pool di informazione biologica Espressione genica: conversione di informazione codificata in un gene, prima in RNA messaggero, poi in proteina Non tutti geni sempre necessari alla vita di cellula Solo geni costitutivi sono sempre espressi Altri geni espressi quando serve Espressione geni è regolata da necessità cellula: condizioni ambiente e funzioni da svolgere (es. geni per sintesi lattosio) In organismi pluricellulari: L ambiente di una cellula è l organismo stesso A partire da una stessa cellula, meccanismo regolazione genica differenziale porta ad avere diverse cellule specializzate (tutte con stesso DNA) 5

6 Introduzione L informazione genica è la stessa in tutte le cellule somatiche di un organismo. Specifica la natura di tutte le proteine presenti nell organismo L espressione genica, e quindi proteica, si differenzia a seconda del tipo di cellula e della risposta all ambiente (stato della cellula) Il trascrittoma è l insieme completo dei trascritti e dei loro livelli di espressione in un particolare tipo di cellule o di tessuto in condizioni ben definite In una cellula viene espresso solo 20% circa del trascrittoma N.B. I livelli dei trascritti non si traducono necessariamente in espressione o attività di proteine (alcuni trascritti non sono tradotti; alcune proteine tradotte non funzionano ) 6

7 Introduzione Conoscere genoma e geni non basta per capire come un gene, una cellula, un organismo funzionano Per capire gli organismi biologici nel loro complesso (e complessità) bisogna studiare: regolazione ed espressione dei geni funzionalità delle proteine espresse occorrenze quantitative dei metaboliti effetti dei difetti dei geni sul fenotipo di un organismo Systems biology: studio delle interazioni tra i componenti di un sistema biologico, e di come tali interazioni determinano funzioni e comportamento del sistema 7

8 Introduzione Per l analisi funzionale dei genomi esistono metodi moderni: Trascrittomica Proteomica Metabolomica Generalmente utilizzano procedure high-throughput che richiedono rilevanti attività di gestione e analisi dei dati L obbiettivo è identificare i componenti del sistema (i.e. trascritti, proteine, metaboliti) e loro interazioni e funzioni Tali approcci di genotipizzazione (determinazione genotipo e suoi componenti di un individuo/organismo) devono essere correlati con, e completati da, analisi fenotipiche high-throughput di organismi modello e cellule in vitro 8

9 Tecniche di analisi di espressione genica Dopo sequenziamento (conoscenza della sequenza) e annotazione (conoscenza dei componenti: geni, elementi di regolazione, ) del genoma, l analisi del trascrittoma è importante area di ricerca della scienza genomica funzionale Come si misura l espressione genica? Metodi per esaminare il livello di espressione di un gene alla volta: RT-PCR (Reverse Transcriptase Polymerase Chain Reaction; amplifica numero di sequenze nucleotidiche specifiche derivate (per transcrittasi inversa) da mrna) Le principali tecniche di analisi di tutto il trascrittoma sono: Microarray a cdna Microarray di oligonucleotidi SAGE (Serial Analysis of Gene Expression) 9

10 Tecniche di analisi di espressione genica 1980: analisi RNA di uno o pochi geni alla volta: Northern Blotting PCR quantitativa (Q-RT-PCR, o real-time PCR) : analisi RNA dell intero genoma (DNA microarrays) Tecniche di biologia molecolare Micro/Nano tecnologie Informatica - Alta densità (potenzialmente misura l RNA di tutto il genoma della cellula) Due tecnologie principali di DNA microarrays: cdna spotted arrays (Schena et al. 1995) Oligonucleotide arrays (Lockhart et al. 1996) 10

11 Northern blot - Analisi di un singolo trascritto Northern blotting: tecnica di laboratorio per studiare l espressione genica individuando l RNA (o mrna isolato) in un campione Normale (riferimento) Patologico Espressione genica: quantificazione del livello di abbondanza di un trascritto in un singolo campione Regolazione genica: comportamento del trascritto in comparazione trattato-controllo Diminuzione dell attività di un gene Aumento dell attività di un gene Comparsa di una nuova attività genica 11

12 Northern blot - Analisi di un singolo trascritto 12

13 Northern blot - Analisi di un singolo trascritto Northern blot: analisi di trascritti (mrna) (video: Southern blot: analisi di DNA (video: Western blot: analisi di proteine 13

14 RT-PCR - Analisi di un singolo trascritto La polymerase chain reaction (PCR) è una tecnica di laboratorio che sfrutta replicazione DNA per amplificare una singola o poche copie di specifica sequenza di DNA, lunga fino a ~10 kb, ma anche fino a 40 kb, sintetizzandone miliardi di copie (http://www.phgfoundation.org/ tutorials/dna/4.html) PCR si basa su cicli termici ripetuti di riscaldamento e raffreddamento di una soluzione in cui avviene la reazione di replicazione del DNA (video: v=_ygxcj4n-kq) 14

15 RT-PCR - Analisi di un singolo trascritto La reverse transcriptase polymerase chain reaction (RT-PCR) è variante della PCR, in cui un elica di RNA è prima retro-trascritta nel suo DNA complementare (cdna), usando l enzima trascrittase inversa, e il risultante cdna è amplificato mediante PCR tradizionale, o real-time PCR, realizzata in un ciclatore termico per il controllo automatico di tempi e temperatura RT-PCR non va confusa con la real-time polymerase chain reaction, o PCR quantitativa (Q-PCR, o qrt-pcr) Ciclatore termico per PCR 15

16 Clonaggio con plasmidi Altro metodo per replicare tratti di DNA sfrutta i plasmidi (DNA extranucleare) di batteri (es. E. coli) come vettori per clonare sequenze di DNA Frammenti di DNA da clonare, esogeno al batterio usato come vettore, vengono inseriti nella sequenza del DNA del plasmide utilizzando degli enzimi di restrizione, per tagliare il DNA del plasmide, e l enzima DNA ligase per legare al DNA del plasmide il frammento di DNA da clonare, creando così un plasmide ricombinante (video: 16

17 DNA microarrays Microarrays: disposizioni ordinate e miniaturizzate di frammenti di DNA con sequenze note su supporto solido Ciascuna posizione contiene un frammento di DNA (singola elica) specifico, chiamato sonda (probe), e complementare alla sequenza di un trascritto Quando il frammento è messo in presenza del frammento complementare, test, (mrna marcato con fluorocromo), questi tenderanno ad appaiarsi per complementarietà con interazione forte In scansione, quantità di segnale di fluorescenza derivante da una specifica posizione dell array è direttamente proporzionale ad abbondanza del trascritto corrispondente nel campione biologico utilizzato (http://www.phgfoundation.org/ tutorials/dna/6.html) A B C D E 17

18 DNA microarrays Applicazioni: non solo misurazione espressione genica: Misurazione abbondanza di un trascritto genico Caratterizzazione sequenza di un gene (es. esoni/introni) Caratterizzazione alterazioni del numero di copie di un dato gene o sequenza di DNA (es. dovute a mutazioni cromosomiche di duplicazione) Caratterizzazione interazioni DNA-proteine 18

19 DNA microarrays DNA microarrays: principio e passi principali: Costruzione del microarray (supporto solido sul quale sono immobilizzati, in posizioni ben definite, migliaia di sequenze di geni differenti (sonde, o probes)) Estrazione RNA totale di cellule da esaminare (test) - Retrotrascrizione a cdna (coding DNA), se necessaria - Amplificazione e marcatura Ibridazione (del test) al microarray Valutazione attività genica Poiché permettono di determinare il profilo di espressione della cellula in un dato stato, si dice anche che consentono expression profiling 19

20 DNA microarrays.. L intensità della fluorescenza è misurata con uno scanner (confocale) ad alta sensibilità 20

21 DNA microarrays Una tecnologia che sta cambiando il modo di affrontare la biologia molecolare I metodi tradizionali: un gene/alcuni geni osservati in un esperimento: manca una visione di insieme Ricerca guidata da ipotesi Tecnologia con microarrays: migliaia di geni su un array al fine di studiare la loro funzione simultaneamente Ricerca che genera ipotesi, guidata dai dati Due le tecnologie più utilizzate: cdna microarray e oligonucleotide chip Entrambe misurano il livello di espressione genica in termini di abbondanza di mrna 21

22 DNA microarrays Piattaforme tecnologiche High density filters (quasi obsoleti) cdna microarrays Oligonucleotide arrays (oligo chips) Dettaglio: Dettaglio: Dettaglio: ~2 400 cloni in 12 cm x 8 cm marcatura radioattiva 1 condizione sperimentale per filtro ~25'000 cloni in 5 cm x 2 cm marcatura fluorescente 2 condizioni sperimentali per array ~60'000 geni in 1.28 cm x 1.28 cm marcatura fluorescente 1 condizione sperimentale per array 22

23 DNA microarrays Filtri di nylon ad alta densità Ormai poco usati Devono essere comprati dal produttore Sulla membrana di nylon del filtro è spottato un set di cdna La rappresentatività del filtro è definita dal costruttore Filtro deve essere ibridizzato con cdna, un campione per filtro Campione è marcato con 33P-dCTP (marker radioattivo) Immagine del filtro ibridizzato è ottenuta con fosfoimager Intensità ibridizzazione valutata con software commerciali, ma ulteriori elaborazioni necessarie 23

24 DNA microarrays Filtri di nylon ad alta densità Vantaggi: Tecnicamente facili: non sono necessarie procedure di setup o di fabbricazione Di uso immediato: non richiedono strumentazione specifica Relativamente poco costosi Buona sensitività: sonde radioattive Svantaggi: Utente non ha il controllo di cosa c è effettivamente sul filtro Bassa qualità dei cloni spottati Qualità delle immagini bassa (alto background, macchie) Confronto tra due filtri è difficile (sono necessari vari esperimenti replicati ed efficiente sistema di analisi) Spesso sostituiti con cdna microarray miniaturizzati 24

25 DNA microarrays cdna microarrays (spotted) 1. Preparazione del cdna microarray: si utilizzano intere porzioni di ESTs (Expressed Sequence Tags, brevi sottosequenze di una sequenza di cdna trascritto) Si fissano per ogni gene molte copie di EST ( bp) ottenute da librerie di cdna (amplificate tramite RT-PCR) su uno spot di un vetrino (10-50 spot per mm 2 ). Ciascuna EST dovrebbe essere specifica (set unigenico) 25

26 DNA microarrays cdna microarrays (spotted) 2. Preparazione campioni : si preparano due campioni di mrna, retrotrascritti a cdna e resi fluorescenti con colori diversi (marcatori Cy3, verde, e Cy5, rosso). 3. Ibridizzazione: i campioni preparati sono messi a contatto con il cdna microarray preparato; i geni espressi nei campioni si ibridizzano con la loro sequenza complementare sul microarray 4. Misura espressione genica: la misura di fluorescenza in ogni spot del microarray determina quali geni sono espressi in ciascuno dei due campioni Esempio: misura di fluorescenza di Cy5 effettuata con laser elio-neon (HeNe) a 633 nm e l emissione avviene a 680 nm 26

27 DNA microarrays cdna microarrays (spotted) Preparazione del microarray: Collezione di cloni (plasmidi in E. Coli) Cloni di cdna sono selezionati e cresciuti Lisi dei batteri ed estrazione del DNA plasmidico Amplificazione del DNA in PCR Controllo su gel dei prodotti di PCR Preparazione in piastra da 384 (16x24) pozzetti Spotting su vetrino 27

28 DNA microarrays cdna microarrays (spotted) Dettagli tecnici : Possono esserci fino a elementi per vetrino (ma più spesso ce ne sono circa 5 000) I vetrini sono tipicamente grandi 2.5 x 2.5 cm Vetrini più lunghi possono essere usati ma richiedono campioni con una maggiore quantità di cdna marcato Gli spot distano tipicamente µm Vengono stampati da robot con testine contenenti da 4 a 32 puntine distanti tra di loro circa 1 cm Esistono puntine di varie forme Video: 28

29 DNA microarrays cdna microarrays (spotted) Vari tipi di puntine da stampa: A) I modelli a pinzetta, o a puntina divisa, trasferiscono piccolissime quantità (nanolitri) della soluzione di cdna all array tramite fenomeni di capillarità nel momento in cui la puntina tocca la superficie solida B) Le puntine e le estremità TeleChem TM applicano piccole goccioline tramite il contatto tra la puntina e il substrato 29

30 DNA microarrays cdna microarray (spotted) C) Il modello a puntina-e-ansa raccoglie il cdna in una piccola ansa e in seguito una puntina trasferisce la soluzione su un vetrino, mantenendo uniforme la densità D) I modelli a getto d inchiostro (es. di STMicroelectronics) spruzzano quantità ancora più piccole (picolitri) di goccioline di liquido sotto pressione 30

31 DNA microarrays cdna microarrays (spotted) Preparazione dei campioni, ibridizzazione e misura: 31

32 DNA microarrays cdna microarrays (spotted) Sono complessivamente piuttosto costosi a causa del setup della loro preparazione Si devono ottenere cloni di cdna attraverso amplificazione di EST tramite PCR (per ciascun spot occorrono 10 ng di materiale) Si usano cloni di lunghezza intorno alle 1-2 kb Le soluzioni contenenti i cloni amplificati possono essere utilizzate per produrre sino a vetrini Servono 2 giorni per produrre 100 microarray con geni Infine occorre produrre cdna marcati a partire dai campioni biologici, usando la trascrittasi inversa in presenza di nucleotidi resi fluorescenti o radioattivi 32

33 DNA microarrays cdna microarrays (spotted) Il principio dell analisi con microarray a cdna Dopo che frammenti di EST disposti in piastre da 96 o 384 pozzetti sono depositati ad alta densità su un vetrino da microscopio, si effettua una ibridizzazione sull array con due diversi tipi di cdna, contrassegnati con coloranti fluorescenti e derivati da campioni indipendenti di mrna. Dopo il lavaggio, un laser effettua una scansione del vetrino e si calcola il rapporto di fluorescenza indotta nei due campioni per ciascuna EST: questo valore indica la quantità relativa di trascritto per l EST presente nei campioni Video: 33

34 DNA microarrays cdna microarrays (spotted) Video: 34

35 DNA microarrays cdna microarrays (spotted) Immagini di cdna microarray Rosso: gene espresso, per es. nei trattati ma non nei controlli Verde: gene espresso, per es. nei controlli ma non nei trattati Giallo: gene espresso in entrambi i campioni Grigio: gene non espresso in nessuno dei campioni 35

36 DNA microarrays cdna microarrays (spotted) Dalle immagini ai dati: Tumor cell Healthy cell Allineamento della griglia: ogni sonda deve essere localizzata nell immagine dell array Segmentazione: identificazione dei pixels appartenenti a ogni spot Estrazione dell intensità: calcolo di un valore numerico che rappresenti il livello d espressione (media, mediana, ) Correzione del background: l intensità del background è calcolata e sottratta dal valore di intensità dello spot Qualità dello spot: sono calcolati parametri (es. circolarità, uniformità, diametro, ) per valutare la qualità di uno spot, di un vetrino e di un esperimento 36

37 DNA microarrays cdna microarrays (spotted) Pregi e difetti della tecnica spotted : Ibridazione competitiva: analisi su mrna da cellule in due condizioni diverse Vantaggio: misure relative (spesso espresse sotto forma di log 2 ) Svantaggio: definizione del riferimento, problemi colorimetrici, possibili differenze delle quantità dei due mrna Difficoltà di comparare risultati provenienti da differenti array: l intensità dipende dalle quantità di sonde depositate Si richiede molto mrna per preparare il target ( µg) 37

38 DNA microarrays Microarrays di oligonucleotidi Microarrays di oligonucleotidi: genechips di Affymetrix e altri Al posto delle EST ci sono oligonucleotidi lunghi basi progettati per rappresentare ORFs Composizione di ogni sequenza di oligonucleotidi: Perfect match (PM): una sequenza che può ibridizzarsi Mismatch (MM): una sequenza che non dovrebbe ibridizzarsi, dato che la base centrale e invertita PM ATGAGCTGATGCGATGCCATGAGAG MM ATGAGCTGATGCCATGCCATGAGAG Per ogni probe con sequenza di PM vi è sul chip un altro probe con sequenza di MM 38

39 DNA microarrays Microarrays di oligonucleotidi Ogni gene viene rappresentato da un insieme di oligonucleotidi (es. lunghi 25 bp nei chips Affymetrix), che corrispondono a varie posizioni sul gene che rappresentano 39

40 DNA microarrays Microarrays di oligonucleotidi Costruzione di arrays di oligonucleotidi (realizzata da aziende specializzate che vendono tali arrays) Gli oligonucleotidi sono sintetizzati in situ sul chip di silicio tramite litografia, usando un lampo di luce e una maschera per permettere alla luce di colpire solo i punti richiesti sulla superficie del chip (processo simile a quello per la produzione delle CPU dei calcolatori) 40

41 DNA microarrays Microarrays di oligonucleotidi In ciascun passaggio, il lampo di luce deprotegge (cioè libera) gli oligonucleotidi nel punto desiderato del chip; si aggiungono quindi nucleotidi protetti di uno dei quattro tipi possibili (A, C, G, o T), in modo che un solo nucleotide si aggiunga alle catene desiderate 41

42 DNA microarrays Microarrays di oligonucleotidi Sintesi oligonucleotidi in sito Su substrato di silicio vengono sintetizzati oligonucleotidi tramite cicli di addizione di uno specifico nucleotide in specifiche posizioni; I nucleotidi bloccati vengono deprotetti tramite esposizione alla luce Sono accessibili all aggiunta del nucleotide successivo soltanto quelli localizzati in corrispondenza dei buchi della maschera fotolitografica Vantaggi: - sequenze oligo verificate - lunghezza oligo predeterminata Video: 42

43 DNA microarrays Microarrays di oligonucleotidi La realizzazione di maschere fotolitografiche con risoluzione costantemente in aumento permette di sintetizzare sulla stessa superficie un numero di singole cellette sempre maggiore numero celle 25 µm 18 µm 11 µm 8 µm 5 µm Dimensioni cella (µm) Numero di celle sintetizzabili su standard array 12.8 mm

44 DNA microarrays Microarrays di oligonucleotidi Maskless Array Synthesis (MAS): invece di maschere fotolitografiche, viene utilizzato un DMD (Digital Micromirror Device) che utilizza migliaia di specchi che riflettono la luce in specifiche posizioni del supporto solido per effettuare la deprotezione del gruppo chimico 44

45 DNA microarrays Microarrays di oligonucleotidi Microarray scannerizzato (con laser confocale) Ciascuna cella misura il livello di espressione di una sequenza genica Livello di espressione genica quantificato dall intensità (I) della cella nell immagine scannerizzata Espressione = avg[i(pm)-i(mm)] 45

46 DNA microarrays Microarrays di oligonucleotidi Dalle immagini ai dati: stessi passi che per cdna microarrays 46

47 DNA microarrays Microarrays di oligonucleotidi Punteggio della detection Si calcola il seguente score: R i = [I(PM) i -I(MM) i ] / [I(PM) i + I(MM) i ] (range [1;-1]) Determina l abilità della sonda (probe) di identificare il target Detection p-value: si effettua il test di ipotesi che lo score differisca significativamente da una soglia vicina a zero (si valuta l evidenza di una ibridizzazione non casuale) Si usa il Wilcoxon signed ranked test 47

48 DNA microarrays Microarrays di oligonucleotidi Una detection call descrive se l ibridizzazione di un probe set è avvenuta (P, presente), non è avvenuta (A, assente) o è stata solo marginale (M) Viene assegnata sulla base del p-value Valori suggeriti: Presente: p-value < 0.04 Marginale: 0.04 p-value 0.06 Assente: altrimenti 0 1 p-value 48

49 DNA microarrays Microarrays di oligonucleotidi Commento Procedura molto rapida ed efficace, ma è molto costoso fare le maschere, per cui questa tecnica è realizzata da aziende specializzate e utilizzabile solo per organismi modello Richiede inoltre di progettare opportunamente la combinazione di sequenze di oligonucleotidi che discriminano tra le varie ORF N.B. Come campione (test) si usa mrna amplificato e marcato anziché cdna (come nei cdna microarray) 49

50 DNA microarrays Confronto cdna vs oligonucleotidi Microarrays a cdna: Possono essere applicati a qualunque organismo senza necessità di aver sequenziato il genoma completo Complessivamente più economici (ma setup costoso) Sono più flessibili e si affidano all ibridizzazione tra molte basi e non poche in tale modo superano anche alcuni problemi legati ai polimorfismi Attualmente esistono anche alcune altre soluzioni proposte da Agilent (http://www.home.agilent.com/) che usano oligonucleotidi più lunghi (con basi) e deposizione a getto d inchiostro 50

51 DNA microarrays Confronto cdna vs oligonucleotidi Chips di oligonucleotidi: Possono contenere una maggiore quantità di geni, anche geni previsti ma non ancora presenti in librerie di cdna Sono utilizzabili anche da chi non ha le possibilità di costruirsi un vetrino Hanno probabilmente minore variabilità tra un chip e l altro - E maggiormente possibile (anche se comunque difficoltosa) la comparazione dei dati prodotti da diversi gruppi di ricerca 51

52 DNA microarrays Confronto cdna vs oligonucleotidi Piattaforma a due colori: 2 campioni biologici su 1 unico array (cdna microarrays) Comparazione tra cellule normali tumorali Marcatura dei trascritti Microarray contenente una rappresentazione dell intero genoma Geni che si comportano in modo DIVERSO Pseudocolor image + = Pseudocolor image 52

53 DNA microarrays Confronto cdna vs oligonucleotidi Piattaforma a singolo colore: 1 campione biologico su 1 array (oligo chips) Comparazione tra cellule normali tumorali Marcatura dei trascritti Microarray contenente una rappresentazione dell intero genoma Geni che si comportano in modo DIVERSO VS = Immagine rappresenta variazione di espressione (asse y) di vari geni (linee) sovra- (arancione) e sotto- (azzurro) espressi in successivi istanti temporali (asse x) 53

54 Riassunto esperimento microarray Spotted microarray In-situ synthesized microarray 54

55 Riassunto esperimento microarray Risultati lettura array ID Trascritto Livello di espressione (rfu) [unità di fluorescenza relative] p-value I livelli di espressione di decine di migliaia di trascritti vengono quantificati in un unico esperimento Si parla quindi di analisi a livello genomico 55

56 Riassunto esperimento microarray Ricerca trascritti regolati (in comparazione trattato-controllo) L analisi comparativa permette di comparare, per ciascun trascritto rappresentato, il livello di espressione in una condizione rispetto ad un altra Comparando direttamente il livello di espressione del medesimo trascritto [probeset] E così possibile identificare e quantificare in modo accurato le alterazioni a livello trascrizionale tra due campioni Controllo p16 = rfu Trattato p16 = rfu rfu: relative fluorescent unit 56

57 Serial Analysis of Gene Expression (SAGE) Analisi SAGE Metodo per determinare l abbondanza (o concentrazione) assoluta di ciascun trascritto espresso in una popolazione di cellule mediante sequenziamento automatico in serie di marcatori specifici per ciascun gene, prodotti tramite tecniche molecolari collegate tra loro Principi su cui si basa la SAGE: Una sequenza corta di bp contiene informazioni sufficienti per identificare in modo univoco un trascritto - Queste sequenze possono essere attaccate le una alle altre per formare una sequenza più lunga Il numero di volte in cui appare una sequenza corta esprime livello di espressione di trascritto corrispondente 57

58 Serial Analysis of Gene Expression (SAGE) Vengono pertanto sequenziati in serie marcatori unici lunghi 15 bp In ciascuna reazione di sequenziamento vengono ottenuti fino a 50 marcatori Solitamente si usano due marcatori per gene, quindi occorrono circa marcatori per l intero genoma umano Procedura complessa e molto costosa (5 000 euro per campione) - Non adatta per ripetere gli esperimenti diverse volte Fornisce quella che si ritiene la misura esatta del numero di trascritti 58

59 Serial Analysis of Gene Expression (SAGE) Passi dell analisi SAGE: 1. Isolare l mrna del campione biologico da analizzare 2. Trascrivere mrna in cdna 3. Tagliare le opportune sequenze del cdna con enzimi di restrizione per ottenere brevi sequenze 4. Attaccare un adattatore creando un di-tag 5. Collegare i di-tag tra di loro 6. Amplificare in vettore batterico le catene lunghe di di-tag 7. Sequenziare le catene amplificate 8. Via software riconoscere le sequenze corte, contarle e associarle al relativo trascritto 59

60 Serial Analysis of Gene Expression (SAGE) 60

61 Microarray and Gene Expression Data (MGED) Sforzo di standardizzazione dei dati di microarray e annotazioni Il gruppo MGED (Microarray and Gene Expression Data): Obbiettivo del gruppo è di facilitare: l adozione di standards per l annotazione di esperimenti con DNA microarrays e la rappresentazione dei loro dati l introduzione di controlli sperimentali e di metodi di normalizzazione dati/risultati Coinvolge molti centri a livello mondiale (TIGR, Affymetrix, Stanford, Sanger, Agilent, Rosetta, ecc.) Coordinato da European Bioinformatics Institute (EBI) 61

62 Microarray and Gene Expression Data (MGED) Glossario MGED (http://www.mged.org/) MIAME (Minimum Information About a Microarray Experiment): standard per l annotazione degli esperimenti MAGE-OM (MicroArray Gene Expression - Object Model): modello dei dati generati con microarrays ArrayExpress (http://www.ebi.ac.uk/microarray-as/ae/): database basato su MAGE-OM MAGE-ML (MicroArray Gene Expression Markup Language): linguaggio di markup per condividere, fra database, gli esperimenti e i loro dati Expression Profiler (http://www.ebi.ac.uk/expressionprofiler/): strumento di analisi dei dati da microarrays che utilizza direttamente ArrayExpress 62

63 Microarray and Gene Expression Data (MGED) Principi generali di MIAME [Brazma et al., Nature Genetics, 2001] Le informazioni raccolte devono essere sufficienti per interpretare i risultati e replicare gli esperimenti L informazione deve essere strutturata in modo che l interrogazione e l analisi automatica siano fattibili 63

64 Microarray and Gene Expression Data (MGED) Contenuto del database dal punto di vista dell analisi dei dati Campioni Geni Annotazioni Annotazioni Espressioni geniche Livelli di espressione 64

65 Microarray and Gene Expression Data (MGED) ArrayExpress (http://www.ebi.ac.uk/microarray-as/ae/) Database di dati di esperimenti con microarrays, in cui le informazioni sono riportate in modo standard Conforme con MIAME Interfaccia Web: Queries: esperimenti, arrays, campioni Browsing: viste su esperimenti 65

66 Microarray and Gene Expression Data (MGED) ArrayExpress - queries 66

67 Microarray and Gene Expression Data (MGED) ArrayExpress - browsing: geni up o down regolati in esperimenti con Saccharomyces cerevisiae (lievito) in condizione di crescita rehydration 67

68 Disegno sperimentale di studi del trascrittoma Disegni sperimentali di studi di espressione genica: Esperimenti statici Due o più classi di soggetti (fenotipi/trattamenti diversi) - Esempio 1: Selezione di geni differenzialmente espressi (in diverse classi di soggetti) - Esempio 2: Classificazione (supervisionata) Esperimenti dinamici Un soggetto a tempi diversi - Serie temporali di espressione genica durante una perturbazione - Esempio 3: Selezione di geni differenzialmente espressi nel tempo Clustering 68

69 Esperimenti statici con microarray Due o più classi di soggetti (fenotipi/trattamenti diversi) 69

70 Esperimenti statici con microarray Esempio 1: Selezione di geni differenzialmente espressi (d.e.) 70

71 Esperimenti statici con microarray Esempio 2: Classificazione (supervisionata) 6 gruppi (tipologie) di Leucemia linfoblastica acuta (ALL) infantile M=m 1 +m 2 =132; N=

72 Esperimenti dinamici con microarray Un soggetto a tempi diversi 72

73 Esperimenti dinamici con microarray Esempio 3: Selezione di geni differenzialmente espressi nel tempo Clustering 379 geni insulina-regolati Principalmente geni del metabolismo dei lipidi e del trasporto di elettroni Principalmente geni della glicolisi 73

74 Esperimenti dinamici con microarray Esempio 3: Selezione di geni differenzialmente espressi nel tempo Reverse engineering Gene networks Synthetic biology 74

75 Analisi dati di espressione Dati di espressione Immagini scannerizzate da microarrays 75

76 Acquisizione e pre-elaborazione segnale Acquisizione e pre-elaborazione del segnale (intensità della fluorescenza) includono: Analisi dell immagine Normalizzazione di immagini/dati Trasformazioni dati Software: GenePix, MAS5, Immagini Dati 76

77 Acquisizione e pre-elaborazione segnale Analisi dell immagine Identificare la posizione delle sonde (probes) relative ad ogni gene (Gridding) Differenziare i pixel relativi a foreground e background (Segmentation) Estrazione delle intensità delle varie aree dell immagine 77

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Ibridizzazione in situ

Ibridizzazione in situ ANALISI DELL RNA Northen blot E un metodo simile a quello di traferimento e di ibridizzazione del DNA (Southern blot) e si usa per sondare molecole di RNA. Gli mrna sono molecole brevi, in genere meno

Dettagli

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà Bioinformatica Analisi del trascrittoma Dott. Alessandro Laganà Analisi del trascrittoma Regolazione dell espressione genica I microarray cdna microarray Oligo microarray Affymetrix Chip Analisi dei dati

Dettagli

La tecnologia dei microarray

La tecnologia dei microarray La tecnologia dei microarray I microarray I progetti di sequenziamento (progetti permesso di identificare migliaia di geni genoma) ) hanno Migliaia di geni (ed i loro prodotti, le proteine) operano in

Dettagli

SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica

SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica Prof. Francesco Michelotti SAPIENZA Università di Roma Facoltà di Ingegneria

Dettagli

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA 1 I PROGETTI OMICI Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA Studia il contenuto in mrna di una cellula (in differenti fasi di sviluppo, in risposta a vari stimoli o a

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Microarray. (in parte da Wikipedia)

Microarray. (in parte da Wikipedia) Microarray (in parte da Wikipedia) Un DNA microarray (comunemente conosciuto come gene chip, DNA chip, o biochip) è costituito da una collezione di microscopiche sonde di DNA attaccate ad una superficie

Dettagli

La tecnologia dei microarray

La tecnologia dei microarray La tecnologia dei microarray Introduzione per l analisi dell espressione genica: Affymetrix GeneChip spotted arrays L analisi dei dati Campi di applicazione dei microarray Introduzione I progetti di sequenziamento

Dettagli

Biosensori 3: Biosensori a DNA e Bio- Gene Chip

Biosensori 3: Biosensori a DNA e Bio- Gene Chip Biosensori 3: Biosensori a DNA e Bio- Gene Chip mazzei@di.unipi.it (materiale parzialmente tratto da: http://nestor.med.unibo.it/shared_files/seminari/sartini_21-10-2004.ppt) Biosensori ad affinità basati

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

La Tecnologia dei Microarray. Tor Vergata Aprile 2011 (Susana.Bueno@caspur.it)

La Tecnologia dei Microarray. Tor Vergata Aprile 2011 (Susana.Bueno@caspur.it) La Tecnologia dei Microarray Tor Vergata Aprile 2011 (Susana.Bueno@caspur.it) SH Friend and RB Stoughton, The Magic of Microarray, Scientific American, February. 2002, pp. 44-49 Vogliamo sapere velocemente

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

scaricato da www.sunhope.it LA TECNOLOGIA DEI MICROARRAYS

scaricato da www.sunhope.it LA TECNOLOGIA DEI MICROARRAYS LA TECNOLOGIA DEI MICROARRAYS 1 8 anni dopo: 4162 riferimenti bibliografici sui microarrays I microarrays misurano il livello di espressione degli mrna trascritti dai geni del sistema biologico di interesse

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

IL TEST DI CITOTOSSICITÀ

IL TEST DI CITOTOSSICITÀ IL TEST DI CITOTOSSICITÀ Questo test permette di valutare in vitro la capacità di un agente di inibire la crescita cellulare. La riduzione nel numero delle colonie può derivare sia dal blocco della proliferazione

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Qualità del frutto: strategie molecolari per il monitoraggio dei geni coinvolti. Gaetano Perrotta

Qualità del frutto: strategie molecolari per il monitoraggio dei geni coinvolti. Gaetano Perrotta Qualità del frutto: strategie molecolari per il monitoraggio dei geni coinvolti Gaetano Perrotta Principali Caratteristiche del Frutto Elevata variabilità Forma Pigmentazione Consistenza Sapore/Aroma Elementi

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

L espressione genica e il trascrittoma

L espressione genica e il trascrittoma L espressione genica e il trascrittoma Genoma Insieme delle informazioni genetiche che caratterizzano un organismo. Trascrittoma Insieme degli RNA messaggeri prodotti da una determinata popolazione cellulare.

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno

Dettagli

determinare il livello di espressione di vari trascritti in cellule diverse e in condizioni fisiologiche e patologiche diverse.

determinare il livello di espressione di vari trascritti in cellule diverse e in condizioni fisiologiche e patologiche diverse. Prefazione Nel corso degli ultimi anni, la rapida evoluzione delle metodiche e degli strumenti a disposizione della biologia molecolare, ha fatto sì che il sequenziamento del DNA divenisse una tecnica

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

Applicazione di tecnologie innovative per il monitoraggio dell esposizione ambientale. Bologna, 25 Giugno 2009

Applicazione di tecnologie innovative per il monitoraggio dell esposizione ambientale. Bologna, 25 Giugno 2009 Applicazione di tecnologie innovative per il monitoraggio dell esposizione ambientale Bologna, 25 Giugno 2009 Perché innovative? Tecnologie che trovano le loro basi dal sequenziamento del genoma umano/altri

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

Macro, Micro..& Chip. Gli Array

Macro, Micro..& Chip. Gli Array Macro, Micro..& Chip Gli Array Microarrays DNA microarray technology is an high throughput method for gaining information on gene function Microarray technology is based on the availability of gene sequences

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

ANALISI DI ESPRESSIONE SU LARGA SCALA

ANALISI DI ESPRESSIONE SU LARGA SCALA ANALISI DI ESPRESSIONE SU LARGA SCALA ANALISI DI ESPRESSIONE SU LARGA SCALA Studio dell espressione di un grande numero di geni (migliaia) allo stesso tempo Non richiede necessariamente il sequenziamento

Dettagli

UNIVERSITÀ DEGLI STUDI DELLA TUSCIA DI VITERBO

UNIVERSITÀ DEGLI STUDI DELLA TUSCIA DI VITERBO UNIVERSITÀ DEGLI STUDI DELLA TUSCIA DI VITERBO DIPARTIMENTO DI PRODUZIONI ANIMALI CORSO DI DOTTORATO DI RICERCA IN ECOLOGIE E GESTIONE DELLE RISORSE BIOLOGICHE - XXIII Ciclo. STUDIO DELLA DIVERGENZA DOVUTA

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria

Dettagli

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 21/02/2011 Progetto di ricerca: Utilizzo di oligonucleotidi antisenso per correggere l effetto di mutazioni di splicing in pazienti

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

La genomica funzionale come approccio innovativo nella definizione della qualità degli alimenti e nello studio della risposta a stress ambientali

La genomica funzionale come approccio innovativo nella definizione della qualità degli alimenti e nello studio della risposta a stress ambientali I nuovi approcci biomolecolari e l'analisi del rischio in sicurezza alimentare: quali problemi e quali prospettive La genomica funzionale come approccio innovativo nella definizione della qualità degli

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

Introduzione al Pattern Recognition Statistico

Introduzione al Pattern Recognition Statistico Introduzione al Pattern Recognition Statistico Roberto Tagliaferri Dipartimento di Informatica Università di Salerno ( Sa ) 84084 Fisciano e-mail robtag@unisa.it Statistical Pattern Recognition Introduzione

Dettagli

Microarray reale e virtuale: Passo dopo passo

Microarray reale e virtuale: Passo dopo passo Microarray reale e virtuale: Passo dopo passo Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 Domande concettuali C1. Si potrebbe concludere che la donna porta una delezione nel gene che è riconosciuto dalla sonda. Per clonare questo gene, potresti iniziare

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

Lo studio prenatale dei cromosomi fetali:

Lo studio prenatale dei cromosomi fetali: Laboratorio di Genetica Medica Lo studio prenatale dei cromosomi fetali: esame citogenetico standard vs array Bologna, 06 Giugno 2014 Giorgio Lucci La citogenetica classica Inizio della citogenetica umana

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

ELETTROFORESI SU GEL

ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi

Dettagli

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA Sequenziamento del DNA Preparazione di librerie Library di cdna e di DNA genomico Analisi di librerie Sequenziamento del DNA 1) Metodo di Maxam&Gilbert (taglio chimico): il DNA viene marcato ad un estremità

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini Università di Bologna Dipartimento di Medicina Clinica Specialistica e Sperimentale Sezione di Microbiologia RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI

Dettagli

ABI-7700 User Bulletin #5

ABI-7700 User Bulletin #5 ABI-7700 User Bulletin #5 1. halogen tungsten lamp 2b. emission filters 3. intensifier 5. ccd detector 350,000 pixels 2a. excitation filters 4. sample plate www.biorad.com 3 Real-time qpcr - La fluorescenza

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

I NOSTRI GENI SU UN MICROCHIP

I NOSTRI GENI SU UN MICROCHIP I NOSTRI GENI SU UN MICROCHIP L'espressione genica è il processo attraverso il quale l informazione contenuta in un gene è usata per la sintesi di un prodotto genico funzionale. Questi prodotti genici

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 3 Biotecnologie avanzate 3 L evoluzione delle biotecnologie Le biotecnologie hanno conosciuto un evoluzione continua, grazie anche agli avanzamenti tecnologici. Infatti

Dettagli

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA.

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA. ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE Margherita Vinciguerra U.O. Ematologia II Laboratorio per lo Studio e la Diagnosi Molecolare Prenatale di Talassemia A.O. V. Cervello, Palermo. Analisi di sequenza

Dettagli

DNA RICOMBINANTE E BIOTECNOLOGIE

DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi

Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Indice IX X Prefazione Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Capitolo 1 LA MANIPOLAZIONE GENICA, UNA TECNICA DALLE VASTE 1 APPLICAZIONI 1 Introduzione 1 Sequenziamento

Dettagli

Dov Stekel: Bioinformatica dei Microarray - Capitoli 4-10 copyright Stekel 2003 Tradotto e stampato su licenza della Cambridge University Press

Dov Stekel: Bioinformatica dei Microarray - Capitoli 4-10 copyright Stekel 2003 Tradotto e stampato su licenza della Cambridge University Press Dov Stekel: Bioinformatica dei Microarray - Capitoli 4-10 copyright Stekel 2003 Tradotto e stampato su licenza della Cambridge University Press Traduzione: Enrico D Ascenzo Revisione: Rodolfo Negri Editing:

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Identificazione e quantificazione degli acidi nucleici DNA RNA

Identificazione e quantificazione degli acidi nucleici DNA RNA BIOLOGIA MOLECOLARE Identificazione e quantificazione degli acidi nucleici DNA RNA ESTRAZIONE DEGLI ACIDI NUCLEICI DNA genomico RNA totale messaggero 1) OMOGENIZZAZIONE LISI Soluzione alcalina concentrata

Dettagli

Lezione IX-X martedì 25-X-2011

Lezione IX-X martedì 25-X-2011 Lezione IX-X martedì 25-X-2011 corso di genomica laurea magistrale Biotecnologia Industriale aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 non ci sarà lezione martedì 1 e giovedì 3 Novembre

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli