Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Bioinformatica e Biologia Computazionale per la Medicina Molecolare"

Transcript

1 Facoltà di Ingegneria dell Informazione Laurea Specialistica e Magistrale in Ingegneria Informatica Facoltà di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica e Informazione Bioinformatica e Biologia Computazionale per la Medicina Molecolare Marco Masseroli, PhD

2 Bioinformatica e Biologia Computazionale per la Medicina Molecolare Misurazione dell Espressione Genica Marco Masseroli, PhD 2

3 Indice Introduzione Tecniche di analisi di espressione genica Northern blot Analisi di un singolo trascritto DNA microarrays Piattaforme tecnologiche - Filtri di nylon ad alta densità - cdna microarray (spotted) - Microarray di oligonucleotidi Confronto cdna vs oligonucleotidi Riassunto esperimento microarray Serial Analysis of Gene Expression (SAGE) Disegno sperimentale di studi del trascrittoma Esperimenti statici con microarray Esperimenti dinamici con microarray Analisi dati di espressione Acquisizione e pre-elaborazione segnale Data mining Problemi analisi dati di microarray Microarray and Gene Expression Data (MGED) Tools per l analisi dati da microarray 3

4 Introduzione Dai geni alle proteine 4

5 Introduzione Geni di cellula codificano un pool di informazione biologica Espressione genica: conversione di informazione codificata in un gene, prima in RNA messaggero, poi in proteina Non tutti geni sempre necessari alla vita di cellula Solo geni costitutivi sono sempre espressi Altri geni espressi quando serve Espressione geni è regolata da necessità cellula: condizioni ambiente e funzioni da svolgere (es. geni per sintesi lattosio) In organismi pluricellulari: L ambiente di una cellula è l organismo stesso A partire da una stessa cellula, meccanismo regolazione genica differenziale porta ad avere diverse cellule specializzate (tutte con stesso DNA) 5

6 Introduzione L informazione genica è la stessa in tutte le cellule somatiche di un organismo. Specifica la natura di tutte le proteine presenti nell organismo L espressione genica, e quindi proteica, si differenzia a seconda del tipo di cellula e della risposta all ambiente (stato della cellula) Il trascrittoma è l insieme completo dei trascritti e dei loro livelli di espressione in un particolare tipo di cellule o di tessuto in condizioni ben definite In una cellula viene espresso solo 20% circa del trascrittoma N.B. I livelli dei trascritti non si traducono necessariamente in espressione o attività di proteine (alcuni trascritti non sono tradotti; alcune proteine tradotte non funzionano ) 6

7 Introduzione Conoscere genoma e geni non basta per capire come un gene, una cellula, un organismo funzionano Per capire gli organismi biologici nel loro complesso (e complessità) bisogna studiare: regolazione ed espressione dei geni funzionalità delle proteine espresse occorrenze quantitative dei metaboliti effetti dei difetti dei geni sul fenotipo di un organismo Systems biology: studio delle interazioni tra i componenti di un sistema biologico, e di come tali interazioni determinano funzioni e comportamento del sistema 7

8 Introduzione Per l analisi funzionale dei genomi esistono metodi moderni: Trascrittomica Proteomica Metabolomica Generalmente utilizzano procedure high-throughput che richiedono rilevanti attività di gestione e analisi dei dati L obbiettivo è identificare i componenti del sistema (i.e. trascritti, proteine, metaboliti) e loro interazioni e funzioni Tali approcci di genotipizzazione (determinazione genotipo e suoi componenti di un individuo/organismo) devono essere correlati con, e completati da, analisi fenotipiche high-throughput di organismi modello e cellule in vitro 8

9 Tecniche di analisi di espressione genica Dopo sequenziamento (conoscenza della sequenza) e annotazione (conoscenza dei componenti: geni, elementi di regolazione, ) del genoma, l analisi del trascrittoma è importante area di ricerca della scienza genomica funzionale Come si misura l espressione genica? Metodi per esaminare il livello di espressione di un gene alla volta: RT-PCR (Reverse Transcriptase Polymerase Chain Reaction; amplifica numero di sequenze nucleotidiche specifiche derivate (per transcrittasi inversa) da mrna) Le principali tecniche di analisi di tutto il trascrittoma sono: Microarray a cdna Microarray di oligonucleotidi SAGE (Serial Analysis of Gene Expression) 9

10 Tecniche di analisi di espressione genica 1980: analisi RNA di uno o pochi geni alla volta: Northern Blotting PCR quantitativa (Q-RT-PCR, o real-time PCR) : analisi RNA dell intero genoma (DNA microarrays) Tecniche di biologia molecolare Micro/Nano tecnologie Informatica - Alta densità (potenzialmente misura l RNA di tutto il genoma della cellula) Due tecnologie principali di DNA microarrays: cdna spotted arrays (Schena et al. 1995) Oligonucleotide arrays (Lockhart et al. 1996) 10

11 Northern blot - Analisi di un singolo trascritto Northern blotting: tecnica di laboratorio per studiare l espressione genica individuando l RNA (o mrna isolato) in un campione Normale (riferimento) Patologico Espressione genica: quantificazione del livello di abbondanza di un trascritto in un singolo campione Regolazione genica: comportamento del trascritto in comparazione trattato-controllo Diminuzione dell attività di un gene Aumento dell attività di un gene Comparsa di una nuova attività genica 11

12 Northern blot - Analisi di un singolo trascritto 12

13 Northern blot - Analisi di un singolo trascritto Northern blot: analisi di trascritti (mrna) (video: Southern blot: analisi di DNA (video: Western blot: analisi di proteine 13

14 RT-PCR - Analisi di un singolo trascritto La polymerase chain reaction (PCR) è una tecnica di laboratorio che sfrutta replicazione DNA per amplificare una singola o poche copie di specifica sequenza di DNA, lunga fino a ~10 kb, ma anche fino a 40 kb, sintetizzandone miliardi di copie (http://www.phgfoundation.org/ tutorials/dna/4.html) PCR si basa su cicli termici ripetuti di riscaldamento e raffreddamento di una soluzione in cui avviene la reazione di replicazione del DNA (video: v=_ygxcj4n-kq) 14

15 RT-PCR - Analisi di un singolo trascritto La reverse transcriptase polymerase chain reaction (RT-PCR) è variante della PCR, in cui un elica di RNA è prima retro-trascritta nel suo DNA complementare (cdna), usando l enzima trascrittase inversa, e il risultante cdna è amplificato mediante PCR tradizionale, o real-time PCR, realizzata in un ciclatore termico per il controllo automatico di tempi e temperatura RT-PCR non va confusa con la real-time polymerase chain reaction, o PCR quantitativa (Q-PCR, o qrt-pcr) Ciclatore termico per PCR 15

16 Clonaggio con plasmidi Altro metodo per replicare tratti di DNA sfrutta i plasmidi (DNA extranucleare) di batteri (es. E. coli) come vettori per clonare sequenze di DNA Frammenti di DNA da clonare, esogeno al batterio usato come vettore, vengono inseriti nella sequenza del DNA del plasmide utilizzando degli enzimi di restrizione, per tagliare il DNA del plasmide, e l enzima DNA ligase per legare al DNA del plasmide il frammento di DNA da clonare, creando così un plasmide ricombinante (video: 16

17 DNA microarrays Microarrays: disposizioni ordinate e miniaturizzate di frammenti di DNA con sequenze note su supporto solido Ciascuna posizione contiene un frammento di DNA (singola elica) specifico, chiamato sonda (probe), e complementare alla sequenza di un trascritto Quando il frammento è messo in presenza del frammento complementare, test, (mrna marcato con fluorocromo), questi tenderanno ad appaiarsi per complementarietà con interazione forte In scansione, quantità di segnale di fluorescenza derivante da una specifica posizione dell array è direttamente proporzionale ad abbondanza del trascritto corrispondente nel campione biologico utilizzato (http://www.phgfoundation.org/ tutorials/dna/6.html) A B C D E 17

18 DNA microarrays Applicazioni: non solo misurazione espressione genica: Misurazione abbondanza di un trascritto genico Caratterizzazione sequenza di un gene (es. esoni/introni) Caratterizzazione alterazioni del numero di copie di un dato gene o sequenza di DNA (es. dovute a mutazioni cromosomiche di duplicazione) Caratterizzazione interazioni DNA-proteine 18

19 DNA microarrays DNA microarrays: principio e passi principali: Costruzione del microarray (supporto solido sul quale sono immobilizzati, in posizioni ben definite, migliaia di sequenze di geni differenti (sonde, o probes)) Estrazione RNA totale di cellule da esaminare (test) - Retrotrascrizione a cdna (coding DNA), se necessaria - Amplificazione e marcatura Ibridazione (del test) al microarray Valutazione attività genica Poiché permettono di determinare il profilo di espressione della cellula in un dato stato, si dice anche che consentono expression profiling 19

20 DNA microarrays.. L intensità della fluorescenza è misurata con uno scanner (confocale) ad alta sensibilità 20

21 DNA microarrays Una tecnologia che sta cambiando il modo di affrontare la biologia molecolare I metodi tradizionali: un gene/alcuni geni osservati in un esperimento: manca una visione di insieme Ricerca guidata da ipotesi Tecnologia con microarrays: migliaia di geni su un array al fine di studiare la loro funzione simultaneamente Ricerca che genera ipotesi, guidata dai dati Due le tecnologie più utilizzate: cdna microarray e oligonucleotide chip Entrambe misurano il livello di espressione genica in termini di abbondanza di mrna 21

22 DNA microarrays Piattaforme tecnologiche High density filters (quasi obsoleti) cdna microarrays Oligonucleotide arrays (oligo chips) Dettaglio: Dettaglio: Dettaglio: ~2 400 cloni in 12 cm x 8 cm marcatura radioattiva 1 condizione sperimentale per filtro ~25'000 cloni in 5 cm x 2 cm marcatura fluorescente 2 condizioni sperimentali per array ~60'000 geni in 1.28 cm x 1.28 cm marcatura fluorescente 1 condizione sperimentale per array 22

23 DNA microarrays Filtri di nylon ad alta densità Ormai poco usati Devono essere comprati dal produttore Sulla membrana di nylon del filtro è spottato un set di cdna La rappresentatività del filtro è definita dal costruttore Filtro deve essere ibridizzato con cdna, un campione per filtro Campione è marcato con 33P-dCTP (marker radioattivo) Immagine del filtro ibridizzato è ottenuta con fosfoimager Intensità ibridizzazione valutata con software commerciali, ma ulteriori elaborazioni necessarie 23

24 DNA microarrays Filtri di nylon ad alta densità Vantaggi: Tecnicamente facili: non sono necessarie procedure di setup o di fabbricazione Di uso immediato: non richiedono strumentazione specifica Relativamente poco costosi Buona sensitività: sonde radioattive Svantaggi: Utente non ha il controllo di cosa c è effettivamente sul filtro Bassa qualità dei cloni spottati Qualità delle immagini bassa (alto background, macchie) Confronto tra due filtri è difficile (sono necessari vari esperimenti replicati ed efficiente sistema di analisi) Spesso sostituiti con cdna microarray miniaturizzati 24

25 DNA microarrays cdna microarrays (spotted) 1. Preparazione del cdna microarray: si utilizzano intere porzioni di ESTs (Expressed Sequence Tags, brevi sottosequenze di una sequenza di cdna trascritto) Si fissano per ogni gene molte copie di EST ( bp) ottenute da librerie di cdna (amplificate tramite RT-PCR) su uno spot di un vetrino (10-50 spot per mm 2 ). Ciascuna EST dovrebbe essere specifica (set unigenico) 25

26 DNA microarrays cdna microarrays (spotted) 2. Preparazione campioni : si preparano due campioni di mrna, retrotrascritti a cdna e resi fluorescenti con colori diversi (marcatori Cy3, verde, e Cy5, rosso). 3. Ibridizzazione: i campioni preparati sono messi a contatto con il cdna microarray preparato; i geni espressi nei campioni si ibridizzano con la loro sequenza complementare sul microarray 4. Misura espressione genica: la misura di fluorescenza in ogni spot del microarray determina quali geni sono espressi in ciascuno dei due campioni Esempio: misura di fluorescenza di Cy5 effettuata con laser elio-neon (HeNe) a 633 nm e l emissione avviene a 680 nm 26

27 DNA microarrays cdna microarrays (spotted) Preparazione del microarray: Collezione di cloni (plasmidi in E. Coli) Cloni di cdna sono selezionati e cresciuti Lisi dei batteri ed estrazione del DNA plasmidico Amplificazione del DNA in PCR Controllo su gel dei prodotti di PCR Preparazione in piastra da 384 (16x24) pozzetti Spotting su vetrino 27

28 DNA microarrays cdna microarrays (spotted) Dettagli tecnici : Possono esserci fino a elementi per vetrino (ma più spesso ce ne sono circa 5 000) I vetrini sono tipicamente grandi 2.5 x 2.5 cm Vetrini più lunghi possono essere usati ma richiedono campioni con una maggiore quantità di cdna marcato Gli spot distano tipicamente µm Vengono stampati da robot con testine contenenti da 4 a 32 puntine distanti tra di loro circa 1 cm Esistono puntine di varie forme Video: 28

29 DNA microarrays cdna microarrays (spotted) Vari tipi di puntine da stampa: A) I modelli a pinzetta, o a puntina divisa, trasferiscono piccolissime quantità (nanolitri) della soluzione di cdna all array tramite fenomeni di capillarità nel momento in cui la puntina tocca la superficie solida B) Le puntine e le estremità TeleChem TM applicano piccole goccioline tramite il contatto tra la puntina e il substrato 29

30 DNA microarrays cdna microarray (spotted) C) Il modello a puntina-e-ansa raccoglie il cdna in una piccola ansa e in seguito una puntina trasferisce la soluzione su un vetrino, mantenendo uniforme la densità D) I modelli a getto d inchiostro (es. di STMicroelectronics) spruzzano quantità ancora più piccole (picolitri) di goccioline di liquido sotto pressione 30

31 DNA microarrays cdna microarrays (spotted) Preparazione dei campioni, ibridizzazione e misura: 31

32 DNA microarrays cdna microarrays (spotted) Sono complessivamente piuttosto costosi a causa del setup della loro preparazione Si devono ottenere cloni di cdna attraverso amplificazione di EST tramite PCR (per ciascun spot occorrono 10 ng di materiale) Si usano cloni di lunghezza intorno alle 1-2 kb Le soluzioni contenenti i cloni amplificati possono essere utilizzate per produrre sino a vetrini Servono 2 giorni per produrre 100 microarray con geni Infine occorre produrre cdna marcati a partire dai campioni biologici, usando la trascrittasi inversa in presenza di nucleotidi resi fluorescenti o radioattivi 32

33 DNA microarrays cdna microarrays (spotted) Il principio dell analisi con microarray a cdna Dopo che frammenti di EST disposti in piastre da 96 o 384 pozzetti sono depositati ad alta densità su un vetrino da microscopio, si effettua una ibridizzazione sull array con due diversi tipi di cdna, contrassegnati con coloranti fluorescenti e derivati da campioni indipendenti di mrna. Dopo il lavaggio, un laser effettua una scansione del vetrino e si calcola il rapporto di fluorescenza indotta nei due campioni per ciascuna EST: questo valore indica la quantità relativa di trascritto per l EST presente nei campioni Video: 33

34 DNA microarrays cdna microarrays (spotted) Video: 34

35 DNA microarrays cdna microarrays (spotted) Immagini di cdna microarray Rosso: gene espresso, per es. nei trattati ma non nei controlli Verde: gene espresso, per es. nei controlli ma non nei trattati Giallo: gene espresso in entrambi i campioni Grigio: gene non espresso in nessuno dei campioni 35

36 DNA microarrays cdna microarrays (spotted) Dalle immagini ai dati: Tumor cell Healthy cell Allineamento della griglia: ogni sonda deve essere localizzata nell immagine dell array Segmentazione: identificazione dei pixels appartenenti a ogni spot Estrazione dell intensità: calcolo di un valore numerico che rappresenti il livello d espressione (media, mediana, ) Correzione del background: l intensità del background è calcolata e sottratta dal valore di intensità dello spot Qualità dello spot: sono calcolati parametri (es. circolarità, uniformità, diametro, ) per valutare la qualità di uno spot, di un vetrino e di un esperimento 36

37 DNA microarrays cdna microarrays (spotted) Pregi e difetti della tecnica spotted : Ibridazione competitiva: analisi su mrna da cellule in due condizioni diverse Vantaggio: misure relative (spesso espresse sotto forma di log 2 ) Svantaggio: definizione del riferimento, problemi colorimetrici, possibili differenze delle quantità dei due mrna Difficoltà di comparare risultati provenienti da differenti array: l intensità dipende dalle quantità di sonde depositate Si richiede molto mrna per preparare il target ( µg) 37

38 DNA microarrays Microarrays di oligonucleotidi Microarrays di oligonucleotidi: genechips di Affymetrix e altri Al posto delle EST ci sono oligonucleotidi lunghi basi progettati per rappresentare ORFs Composizione di ogni sequenza di oligonucleotidi: Perfect match (PM): una sequenza che può ibridizzarsi Mismatch (MM): una sequenza che non dovrebbe ibridizzarsi, dato che la base centrale e invertita PM ATGAGCTGATGCGATGCCATGAGAG MM ATGAGCTGATGCCATGCCATGAGAG Per ogni probe con sequenza di PM vi è sul chip un altro probe con sequenza di MM 38

39 DNA microarrays Microarrays di oligonucleotidi Ogni gene viene rappresentato da un insieme di oligonucleotidi (es. lunghi 25 bp nei chips Affymetrix), che corrispondono a varie posizioni sul gene che rappresentano 39

40 DNA microarrays Microarrays di oligonucleotidi Costruzione di arrays di oligonucleotidi (realizzata da aziende specializzate che vendono tali arrays) Gli oligonucleotidi sono sintetizzati in situ sul chip di silicio tramite litografia, usando un lampo di luce e una maschera per permettere alla luce di colpire solo i punti richiesti sulla superficie del chip (processo simile a quello per la produzione delle CPU dei calcolatori) 40

41 DNA microarrays Microarrays di oligonucleotidi In ciascun passaggio, il lampo di luce deprotegge (cioè libera) gli oligonucleotidi nel punto desiderato del chip; si aggiungono quindi nucleotidi protetti di uno dei quattro tipi possibili (A, C, G, o T), in modo che un solo nucleotide si aggiunga alle catene desiderate 41

42 DNA microarrays Microarrays di oligonucleotidi Sintesi oligonucleotidi in sito Su substrato di silicio vengono sintetizzati oligonucleotidi tramite cicli di addizione di uno specifico nucleotide in specifiche posizioni; I nucleotidi bloccati vengono deprotetti tramite esposizione alla luce Sono accessibili all aggiunta del nucleotide successivo soltanto quelli localizzati in corrispondenza dei buchi della maschera fotolitografica Vantaggi: - sequenze oligo verificate - lunghezza oligo predeterminata Video: 42

43 DNA microarrays Microarrays di oligonucleotidi La realizzazione di maschere fotolitografiche con risoluzione costantemente in aumento permette di sintetizzare sulla stessa superficie un numero di singole cellette sempre maggiore numero celle 25 µm 18 µm 11 µm 8 µm 5 µm Dimensioni cella (µm) Numero di celle sintetizzabili su standard array 12.8 mm

44 DNA microarrays Microarrays di oligonucleotidi Maskless Array Synthesis (MAS): invece di maschere fotolitografiche, viene utilizzato un DMD (Digital Micromirror Device) che utilizza migliaia di specchi che riflettono la luce in specifiche posizioni del supporto solido per effettuare la deprotezione del gruppo chimico 44

45 DNA microarrays Microarrays di oligonucleotidi Microarray scannerizzato (con laser confocale) Ciascuna cella misura il livello di espressione di una sequenza genica Livello di espressione genica quantificato dall intensità (I) della cella nell immagine scannerizzata Espressione = avg[i(pm)-i(mm)] 45

46 DNA microarrays Microarrays di oligonucleotidi Dalle immagini ai dati: stessi passi che per cdna microarrays 46

47 DNA microarrays Microarrays di oligonucleotidi Punteggio della detection Si calcola il seguente score: R i = [I(PM) i -I(MM) i ] / [I(PM) i + I(MM) i ] (range [1;-1]) Determina l abilità della sonda (probe) di identificare il target Detection p-value: si effettua il test di ipotesi che lo score differisca significativamente da una soglia vicina a zero (si valuta l evidenza di una ibridizzazione non casuale) Si usa il Wilcoxon signed ranked test 47

48 DNA microarrays Microarrays di oligonucleotidi Una detection call descrive se l ibridizzazione di un probe set è avvenuta (P, presente), non è avvenuta (A, assente) o è stata solo marginale (M) Viene assegnata sulla base del p-value Valori suggeriti: Presente: p-value < 0.04 Marginale: 0.04 p-value 0.06 Assente: altrimenti 0 1 p-value 48

49 DNA microarrays Microarrays di oligonucleotidi Commento Procedura molto rapida ed efficace, ma è molto costoso fare le maschere, per cui questa tecnica è realizzata da aziende specializzate e utilizzabile solo per organismi modello Richiede inoltre di progettare opportunamente la combinazione di sequenze di oligonucleotidi che discriminano tra le varie ORF N.B. Come campione (test) si usa mrna amplificato e marcato anziché cdna (come nei cdna microarray) 49

50 DNA microarrays Confronto cdna vs oligonucleotidi Microarrays a cdna: Possono essere applicati a qualunque organismo senza necessità di aver sequenziato il genoma completo Complessivamente più economici (ma setup costoso) Sono più flessibili e si affidano all ibridizzazione tra molte basi e non poche in tale modo superano anche alcuni problemi legati ai polimorfismi Attualmente esistono anche alcune altre soluzioni proposte da Agilent (http://www.home.agilent.com/) che usano oligonucleotidi più lunghi (con basi) e deposizione a getto d inchiostro 50

51 DNA microarrays Confronto cdna vs oligonucleotidi Chips di oligonucleotidi: Possono contenere una maggiore quantità di geni, anche geni previsti ma non ancora presenti in librerie di cdna Sono utilizzabili anche da chi non ha le possibilità di costruirsi un vetrino Hanno probabilmente minore variabilità tra un chip e l altro - E maggiormente possibile (anche se comunque difficoltosa) la comparazione dei dati prodotti da diversi gruppi di ricerca 51

52 DNA microarrays Confronto cdna vs oligonucleotidi Piattaforma a due colori: 2 campioni biologici su 1 unico array (cdna microarrays) Comparazione tra cellule normali tumorali Marcatura dei trascritti Microarray contenente una rappresentazione dell intero genoma Geni che si comportano in modo DIVERSO Pseudocolor image + = Pseudocolor image 52

53 DNA microarrays Confronto cdna vs oligonucleotidi Piattaforma a singolo colore: 1 campione biologico su 1 array (oligo chips) Comparazione tra cellule normali tumorali Marcatura dei trascritti Microarray contenente una rappresentazione dell intero genoma Geni che si comportano in modo DIVERSO VS = Immagine rappresenta variazione di espressione (asse y) di vari geni (linee) sovra- (arancione) e sotto- (azzurro) espressi in successivi istanti temporali (asse x) 53

54 Riassunto esperimento microarray Spotted microarray In-situ synthesized microarray 54

55 Riassunto esperimento microarray Risultati lettura array ID Trascritto Livello di espressione (rfu) [unità di fluorescenza relative] p-value I livelli di espressione di decine di migliaia di trascritti vengono quantificati in un unico esperimento Si parla quindi di analisi a livello genomico 55

56 Riassunto esperimento microarray Ricerca trascritti regolati (in comparazione trattato-controllo) L analisi comparativa permette di comparare, per ciascun trascritto rappresentato, il livello di espressione in una condizione rispetto ad un altra Comparando direttamente il livello di espressione del medesimo trascritto [probeset] E così possibile identificare e quantificare in modo accurato le alterazioni a livello trascrizionale tra due campioni Controllo p16 = rfu Trattato p16 = rfu rfu: relative fluorescent unit 56

57 Serial Analysis of Gene Expression (SAGE) Analisi SAGE Metodo per determinare l abbondanza (o concentrazione) assoluta di ciascun trascritto espresso in una popolazione di cellule mediante sequenziamento automatico in serie di marcatori specifici per ciascun gene, prodotti tramite tecniche molecolari collegate tra loro Principi su cui si basa la SAGE: Una sequenza corta di bp contiene informazioni sufficienti per identificare in modo univoco un trascritto - Queste sequenze possono essere attaccate le una alle altre per formare una sequenza più lunga Il numero di volte in cui appare una sequenza corta esprime livello di espressione di trascritto corrispondente 57

58 Serial Analysis of Gene Expression (SAGE) Vengono pertanto sequenziati in serie marcatori unici lunghi 15 bp In ciascuna reazione di sequenziamento vengono ottenuti fino a 50 marcatori Solitamente si usano due marcatori per gene, quindi occorrono circa marcatori per l intero genoma umano Procedura complessa e molto costosa (5 000 euro per campione) - Non adatta per ripetere gli esperimenti diverse volte Fornisce quella che si ritiene la misura esatta del numero di trascritti 58

59 Serial Analysis of Gene Expression (SAGE) Passi dell analisi SAGE: 1. Isolare l mrna del campione biologico da analizzare 2. Trascrivere mrna in cdna 3. Tagliare le opportune sequenze del cdna con enzimi di restrizione per ottenere brevi sequenze 4. Attaccare un adattatore creando un di-tag 5. Collegare i di-tag tra di loro 6. Amplificare in vettore batterico le catene lunghe di di-tag 7. Sequenziare le catene amplificate 8. Via software riconoscere le sequenze corte, contarle e associarle al relativo trascritto 59

60 Serial Analysis of Gene Expression (SAGE) 60

61 Microarray and Gene Expression Data (MGED) Sforzo di standardizzazione dei dati di microarray e annotazioni Il gruppo MGED (Microarray and Gene Expression Data): Obbiettivo del gruppo è di facilitare: l adozione di standards per l annotazione di esperimenti con DNA microarrays e la rappresentazione dei loro dati l introduzione di controlli sperimentali e di metodi di normalizzazione dati/risultati Coinvolge molti centri a livello mondiale (TIGR, Affymetrix, Stanford, Sanger, Agilent, Rosetta, ecc.) Coordinato da European Bioinformatics Institute (EBI) 61

62 Microarray and Gene Expression Data (MGED) Glossario MGED (http://www.mged.org/) MIAME (Minimum Information About a Microarray Experiment): standard per l annotazione degli esperimenti MAGE-OM (MicroArray Gene Expression - Object Model): modello dei dati generati con microarrays ArrayExpress (http://www.ebi.ac.uk/microarray-as/ae/): database basato su MAGE-OM MAGE-ML (MicroArray Gene Expression Markup Language): linguaggio di markup per condividere, fra database, gli esperimenti e i loro dati Expression Profiler (http://www.ebi.ac.uk/expressionprofiler/): strumento di analisi dei dati da microarrays che utilizza direttamente ArrayExpress 62

63 Microarray and Gene Expression Data (MGED) Principi generali di MIAME [Brazma et al., Nature Genetics, 2001] Le informazioni raccolte devono essere sufficienti per interpretare i risultati e replicare gli esperimenti L informazione deve essere strutturata in modo che l interrogazione e l analisi automatica siano fattibili 63

64 Microarray and Gene Expression Data (MGED) Contenuto del database dal punto di vista dell analisi dei dati Campioni Geni Annotazioni Annotazioni Espressioni geniche Livelli di espressione 64

65 Microarray and Gene Expression Data (MGED) ArrayExpress (http://www.ebi.ac.uk/microarray-as/ae/) Database di dati di esperimenti con microarrays, in cui le informazioni sono riportate in modo standard Conforme con MIAME Interfaccia Web: Queries: esperimenti, arrays, campioni Browsing: viste su esperimenti 65

66 Microarray and Gene Expression Data (MGED) ArrayExpress - queries 66

67 Microarray and Gene Expression Data (MGED) ArrayExpress - browsing: geni up o down regolati in esperimenti con Saccharomyces cerevisiae (lievito) in condizione di crescita rehydration 67

68 Disegno sperimentale di studi del trascrittoma Disegni sperimentali di studi di espressione genica: Esperimenti statici Due o più classi di soggetti (fenotipi/trattamenti diversi) - Esempio 1: Selezione di geni differenzialmente espressi (in diverse classi di soggetti) - Esempio 2: Classificazione (supervisionata) Esperimenti dinamici Un soggetto a tempi diversi - Serie temporali di espressione genica durante una perturbazione - Esempio 3: Selezione di geni differenzialmente espressi nel tempo Clustering 68

69 Esperimenti statici con microarray Due o più classi di soggetti (fenotipi/trattamenti diversi) 69

70 Esperimenti statici con microarray Esempio 1: Selezione di geni differenzialmente espressi (d.e.) 70

71 Esperimenti statici con microarray Esempio 2: Classificazione (supervisionata) 6 gruppi (tipologie) di Leucemia linfoblastica acuta (ALL) infantile M=m 1 +m 2 =132; N=

72 Esperimenti dinamici con microarray Un soggetto a tempi diversi 72

73 Esperimenti dinamici con microarray Esempio 3: Selezione di geni differenzialmente espressi nel tempo Clustering 379 geni insulina-regolati Principalmente geni del metabolismo dei lipidi e del trasporto di elettroni Principalmente geni della glicolisi 73

74 Esperimenti dinamici con microarray Esempio 3: Selezione di geni differenzialmente espressi nel tempo Reverse engineering Gene networks Synthetic biology 74

75 Analisi dati di espressione Dati di espressione Immagini scannerizzate da microarrays 75

76 Acquisizione e pre-elaborazione segnale Acquisizione e pre-elaborazione del segnale (intensità della fluorescenza) includono: Analisi dell immagine Normalizzazione di immagini/dati Trasformazioni dati Software: GenePix, MAS5, Immagini Dati 76

77 Acquisizione e pre-elaborazione segnale Analisi dell immagine Identificare la posizione delle sonde (probes) relative ad ogni gene (Gridding) Differenziare i pixel relativi a foreground e background (Segmentation) Estrazione delle intensità delle varie aree dell immagine 77

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Elementi di Statistica

Elementi di Statistica Elementi di Statistica Contenuti Contenuti di Statistica nel corso di Data Base Elementi di statistica descrittiva: media, moda, mediana, indici di dispersione Introduzione alle variabili casuali e alle

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza?

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Con ALLIANCE Uvitec di Eppendorf Italia risparmi tempo e materiale di consumo, ottieni immagini quantificabili e ci guadagni anche in salute.

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

Preprocessamento dei Dati

Preprocessamento dei Dati Preprocessamento dei Dati Raramente i dati sperimentali sono pronti per essere utilizzati immediatamente per le fasi successive del processo di identificazione, a causa di: Offset e disturbi a bassa frequenza

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Istituto per l Energia Rinnovabile. Autori: David Moser, PhD; Daniele Vettorato, PhD. Bolzano, Gennaio 2013

Istituto per l Energia Rinnovabile. Autori: David Moser, PhD; Daniele Vettorato, PhD. Bolzano, Gennaio 2013 Istituto per l Energia Rinnovabile Catasto Solare Alta Val di Non Relazione Versione: 2.0 Autori: David Moser, PhD; Daniele Vettorato, PhD. Coordinamento e Revisione: dott. Daniele Vettorato, PhD (daniele.vettorato@eurac.edu)

Dettagli

Lezione 12: La visione robotica

Lezione 12: La visione robotica Robotica Robot Industriali e di Servizio Lezione 12: La visione robotica L'acquisizione dell'immagine L acquisizione dell immagine Sensori a tubo elettronico (Image-Orthicon, Plumbicon, Vidicon, ecc.)

Dettagli

Bus di sistema. Bus di sistema

Bus di sistema. Bus di sistema Bus di sistema Permette la comunicazione (scambio di dati) tra i diversi dispositivi che costituiscono il calcolatore E costituito da un insieme di fili metallici che danno luogo ad un collegamento aperto

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

AOT Lab Dipartimento di Ingegneria dell Informazione Università degli Studi di Parma. Unified Process. Prof. Agostino Poggi

AOT Lab Dipartimento di Ingegneria dell Informazione Università degli Studi di Parma. Unified Process. Prof. Agostino Poggi AOT Lab Dipartimento di Ingegneria dell Informazione Università degli Studi di Parma Unified Process Prof. Agostino Poggi Unified Process Unified Software Development Process (USDP), comunemente chiamato

Dettagli

Equilibrio Termico tra Due Corpi

Equilibrio Termico tra Due Corpi Equilibrio Termico tra Due Corpi www.lepla.eu OBIETTIVO L attività ha l obiettivo di fare acquisire allo sperimentatore la consapevolezza che: 1 il raggiungimento dell'equilibrio termico non è istantaneo

Dettagli

di4g: Uno strumento di clustering per l analisi integrata di dati geologici

di4g: Uno strumento di clustering per l analisi integrata di dati geologici di4g: Uno strumento di clustering per l analisi integrata di dati geologici Alice Piva 1, Giacomo Gamberoni 1, Denis Ferraretti 1, Evelina Lamma 2 1 intelliware snc, via J.F.Kennedy 15, 44122 Ferrara,

Dettagli

Analisi termografica su celle litio-ione sottoposte ad esperienze di "second life" Francesco D'Annibale, Francesco Vellucci. Report RdS/PAR2013/191

Analisi termografica su celle litio-ione sottoposte ad esperienze di second life Francesco D'Annibale, Francesco Vellucci. Report RdS/PAR2013/191 Agenzia nazionale per le nuove tecnologie, l energia e lo sviluppo economico sostenibile MINISTERO DELLO SVILUPPO ECONOMICO Analisi termografica su celle litio-ione sottoposte ad esperienze di "second

Dettagli

Analisi dei requisiti e casi d uso

Analisi dei requisiti e casi d uso Analisi dei requisiti e casi d uso Indice 1 Introduzione 2 1.1 Terminologia........................... 2 2 Modello del sistema 4 2.1 Requisiti hardware........................ 4 2.2 Requisiti software.........................

Dettagli

Progettazione Robusta

Progettazione Robusta Progettazione Robusta Perdita Consumatore qualità = f 1 (perdita Perdite di reputazione e quote di mercato Costi di garanzia per il produttore La qualità di un prodotto è la (minima perdita impartita alla

Dettagli

Sistemi di supporto alle decisioni Ing. Valerio Lacagnina

Sistemi di supporto alle decisioni Ing. Valerio Lacagnina Cosa è il DSS L elevato sviluppo dei personal computer, delle reti di calcolatori, dei sistemi database di grandi dimensioni, e la forte espansione di modelli basati sui calcolatori rappresentano gli sviluppi

Dettagli

Analisi statistica di dati biomedici Analysis of biologicalsignals

Analisi statistica di dati biomedici Analysis of biologicalsignals Analisi statistica di dati biomedici Analysis of biologicalsignals II Parte Verifica delle ipotesi (a) Agostino Accardo (accardo@units.it) Master in Ingegneria Clinica LM in Neuroscienze 2013-2014 e segg.

Dettagli

U N I V E R S I T À D E G L I S T U D I D I T O R I N O

U N I V E R S I T À D E G L I S T U D I D I T O R I N O U N I V E R S I T À D E G L I S T U D I D I T O R I N O Il Centro della Innovazione Nato inizialmente per ospitare alcune attività didattiche dell Università di Torino, il complesso polifunzionale di Via

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Il ciclo di vita del software

Il ciclo di vita del software Il ciclo di vita del software Il ciclo di vita del software Definisce un modello per il software, dalla sua concezione iniziale fino al suo sviluppo completo, al suo rilascio, alla sua successiva evoluzione,

Dettagli

PET. Radionuclidi più utilizzati nella PET. Elemento prodotto T 1/2 in minuti primi B5 20 C6 10 N7 2 F 9 O8 110

PET. Radionuclidi più utilizzati nella PET. Elemento prodotto T 1/2 in minuti primi B5 20 C6 10 N7 2 F 9 O8 110 PET L acronimo PET sta per Positron Emission Tomography. Come per la SPECT, anche in questo caso si ha a che fare con una tecnica tomografica d indagine di tipo emissivo in quanto la sorgente di radiazione

Dettagli

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le tre leggi di Mendel, che descrivono la trasmissione dei caratteri ereditari da una generazione all altra, segnano l inizio della

Dettagli

La ricerca non sperimentale

La ricerca non sperimentale La ricerca non sperimentale Definizione Ricerca osservazionale: : 1. naturalistica Ricerca osservazionale: : 2. osservatori partecipanti Ricerca d archiviod Casi singoli Sviluppo di teorie e verifica empirica

Dettagli

Progettazione di sistemi Embedded

Progettazione di sistemi Embedded Progettazione di sistemi Embedded Corso introduttivo di progettazione di sistemi embedded A.S. 2013/2014 proff. Nicola Masarone e Stefano Salvatori Eccetto dove diversamente specificato, i contenuti di

Dettagli

Accuratezza di uno strumento

Accuratezza di uno strumento Accuratezza di uno strumento Come abbiamo già accennato la volta scora, il risultato della misurazione di una grandezza fisica, qualsiasi sia lo strumento utilizzato, non è mai un valore numerico X univocamente

Dettagli

SUPERCONDUTTIVITÀ. A cura di: Andrea Sosso I.N.RI.M. (IEN)

SUPERCONDUTTIVITÀ. A cura di: Andrea Sosso I.N.RI.M. (IEN) SUPERCONDUTTIVITÀ A cura di: Andrea Sosso I.N.RI.M. (IEN) Il fenomeno della superconduttività è stato osservato per la prima volta nel 1911 dal fisico olandese Heike Kamerlingh Onnes dell'università de

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 IT PROCESS EXPERT

Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 IT PROCESS EXPERT IT PROCESS EXPERT 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 3 3. DOVE LAVORA... 4 4. CONDIZIONI DI LAVORO... 5 5. COMPETENZE... 6 Quali competenze sono necessarie... 6 Conoscenze... 8 Abilità... 9 Comportamenti

Dettagli

Text mining ed analisi di dati codificati in linguaggio naturale. Analisi esplorative di dati testualilezione

Text mining ed analisi di dati codificati in linguaggio naturale. Analisi esplorative di dati testualilezione Text mining ed analisi di dati codificati in linguaggio naturale Analisi esplorative di dati testualilezione 2 Le principali tecniche di analisi testuale Facendo riferimento alle tecniche di data mining,

Dettagli

I n d i c e. 163 Appendice B Questionari su utilità e uso delle Strategie di Studio (QS1 e QS2)

I n d i c e. 163 Appendice B Questionari su utilità e uso delle Strategie di Studio (QS1 e QS2) I n d i c e 9 Introduzione 11 CAP. 1 I test di intelligenza potenziale 17 CAP. 2 La misura dell intelligenza potenziale nella scuola dell infanzia 31 CAP. 3 La misura dell intelligenza potenziale nella

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

CUT 20 P CUT 30 P GFAC_CUT 20P_30P_Brochure.indd 1 17.9.2009 9:29:45

CUT 20 P CUT 30 P GFAC_CUT 20P_30P_Brochure.indd 1 17.9.2009 9:29:45 CUT 20 P CUT 30 P UNA SOLUZIONE COMPLETA PRONTA ALL USO 2 Sommario Highlights Struttura meccanica Sistema filo Generatore e Tecnologia Unità di comando GF AgieCharmilles 4 6 8 12 16 18 CUT 20 P CUT 30

Dettagli

NUOVI STRUMENTI OTTICI PER IL CONTROLLO DI LABORATORIO E DI PROCESSO

NUOVI STRUMENTI OTTICI PER IL CONTROLLO DI LABORATORIO E DI PROCESSO NUOVI STRUMENTI OTTICI PER IL CONTROLLO DI LABORATORIO E DI PROCESSO Mariano Paganelli Expert System Solutions S.r.l. L'Expert System Solutions ha recentemente sviluppato nuove tecniche di laboratorio

Dettagli

L AUTOMAZIONE IN CITOLOGIA SU STRATO SOTTILE: CONTROLLO DELLE FASI OPERATIVE.

L AUTOMAZIONE IN CITOLOGIA SU STRATO SOTTILE: CONTROLLO DELLE FASI OPERATIVE. L AUTOMAZIONE IN CITOLOGIA SU STRATO SOTTILE: CONTROLLO DELLE FASI OPERATIVE. C. Sintoni C. Galli Servizio di Anatomia Patologica - Presidio Ospedaliero S. M. delle Croci - Ravenna Attualmente nel nostro

Dettagli

(accuratezza) ovvero (esattezza)

(accuratezza) ovvero (esattezza) Capitolo n 2 2.1 - Misure ed errori In un analisi chimica si misurano dei valori chimico-fisici di svariate grandezze; tuttavia ogni misura comporta sempre una incertezza, dovuta alla presenza non eliminabile

Dettagli

Conduzione di uno studio epidemiologico (osservazionale)

Conduzione di uno studio epidemiologico (osservazionale) Conduzione di uno studio epidemiologico (osservazionale) 1. Definisco l obiettivo e la relazione epidemiologica che voglio studiare 2. Definisco la base dello studio in modo che vi sia massimo contrasto

Dettagli

Vedere ciò che non si vede

Vedere ciò che non si vede Vedere ciò che non si vede LA LUCE UV È INVISIBILE Tuttavia essa influenza l aspetto finale dei prodotti stampati. Pertanto è importante conoscere le condizioni di visualizzazione in cui sono destinati

Dettagli

TECNOLOGIA LCD e CRT:

TECNOLOGIA LCD e CRT: TECNOLOGIA LCD e CRT: Domande più Frequenti FAQ_Screen Technology_ita.doc Page 1 / 6 MARPOSS, il logo Marposs ed i nomi dei prodotti Marposs indicati o rappresentati in questa pubblicazione sono marchi

Dettagli

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica).

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica). 3.4. I LIVELLI I livelli sono strumenti a cannocchiale orizzontale, con i quali si realizza una linea di mira orizzontale. Vengono utilizzati per misurare dislivelli con la tecnica di livellazione geometrica

Dettagli

Guida all applicazione (spruzzatura ad aria nebulizzata)

Guida all applicazione (spruzzatura ad aria nebulizzata) Guida all applicazione (spruzzatura ad aria nebulizzata) 1 Spruzzo convenzionale (aria nebulizzata) Una pistola a spruzzo convenzionale è uno strumento che utilizza aria compressa per atomizzare ( nebulizzare

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Che cos'è il radon? Il gas radon è rilevabile con i sensi?

Che cos'è il radon? Il gas radon è rilevabile con i sensi? Che cos'è il radon? Il Radon è un gas inodore e incolore presente in natura. Il suo isotopo (atomo di uno stesso elemento chimico con numero di protoni fisso e numero di neutroni variabile) 222Rn è radioattivo

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

E SE IL TUO SMARTPHONE INDOSSASSE GLI OCCHIALI?

E SE IL TUO SMARTPHONE INDOSSASSE GLI OCCHIALI? E SE IL TUO SMARTPHONE INDOSSASSE GLI OCCHIALI? Buona Caccia e Buon Volo, giovani amici di Eureka! Siete tra gli eletti che hanno deciso di passare al livello successivo: site pronti? Questo mese vi proponiamo

Dettagli

I METALLI PESANTI NEL LATTE

I METALLI PESANTI NEL LATTE I METALLI PESANTI NEL LATTE di Serraino Andrea Dipartimento di Sanità Pubblica Veterinaria e Patologia Animale - Facoltà Medicina Veterinaria - Università di Bologna - Alma Mater Studiorum. I metalli sono

Dettagli

WP5: LiDAR and Forest Accessibility Evaluation LiDAR e valutazione dell accessibilità dei popolamenti forestali

WP5: LiDAR and Forest Accessibility Evaluation LiDAR e valutazione dell accessibilità dei popolamenti forestali WP5: LiDAR and Forest Accessibility Evaluation LiDAR e valutazione dell accessibilità dei popolamenti forestali Marco Pellegrini Dipartimento TESAF Università degli Studi di Padova marco.pellegrini@unipd.it

Dettagli

1x1 qs-stat. Pacchetto Software per la Soluzione di Problemi Statistici nel Controllo Qualità. Versione: 1 / Marzo 2010 Doc. n.

1x1 qs-stat. Pacchetto Software per la Soluzione di Problemi Statistici nel Controllo Qualità. Versione: 1 / Marzo 2010 Doc. n. 1x1 qs-stat Pacchetto Software per la Soluzione di Problemi Statistici nel Controllo Qualità Versione: 1 / Marzo 2010 Doc. n.: PD-0012 Copyright 2010 Q-DAS GmbH & Co. KG Eisleber Str. 2 D - 69469 Weinheim

Dettagli

LA CORRETTA SCELTA DI UN IMPIANTO PER LA TEMPRA AD INDUZIONE Come calcolare la potenza necessaria

LA CORRETTA SCELTA DI UN IMPIANTO PER LA TEMPRA AD INDUZIONE Come calcolare la potenza necessaria LA CORRETTA SCELTA DI UN IMPIANTO PER LA TEMPRA AD INDUZIONE Come calcolare la potenza necessaria Quale frequenza di lavoro scegliere Geometria del pezzo da trattare e sue caratteristiche elettromagnetiche

Dettagli

Sensori di Posizione, Velocità, Accelerazione

Sensori di Posizione, Velocità, Accelerazione Sensori di Posizione, Velocità, Accelerazione POSIZIONE: Sensori di posizione/velocità Potenziometro Trasformatore Lineare Differenziale (LDT) Encoder VELOCITA Dinamo tachimetrica ACCELERAZIONE Dinamo

Dettagli

Progetto Didattico di Informatica Multimediale

Progetto Didattico di Informatica Multimediale Progetto Didattico di Informatica Multimediale VRAI - Vision, Robotics and Artificial Intelligence 20 aprile 2015 Rev. 18+ Introduzione Le videocamere di riconoscimento sono strumenti sempre più utilizzati

Dettagli

Cos è un analisi genetica (test genetico)?

Cos è un analisi genetica (test genetico)? 12 Cos è un analisi genetica (test genetico)? Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra Luglio 2008 Questo lavoro è sponsorizzato dal Consorzio EU-FP6 EuroGentest,

Dettagli

Volume HUMIGRAIN SYSTEM. Manuale d uso

Volume HUMIGRAIN SYSTEM. Manuale d uso Volume 1 HUMIGRAIN SYSTEM Manuale d uso Manuale d uso Fornasier Tiziano & C. S.a.s. Via Mercatelli Maglio, 26 31010 Ponte della Priula (TV) - ITALY tel. +39 0438 445354 fax +39 0438 759210 Sommario Principio

Dettagli

Introduzione al GIS (Geographic Information System)

Introduzione al GIS (Geographic Information System) Introduzione al GIS (Geographic Information System) Sommario 1. COS E IL GIS?... 3 2. CARATTERISTICHE DI UN GIS... 3 3. COMPONENTI DI UN GIS... 4 4. CONTENUTI DI UN GIS... 5 5. FASI OPERATIVE CARATTERIZZANTI

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

Metodi e Strumenti per la Caratterizzazione e la Diagnostica di Trasmettitori Digitali RF ing. Gianfranco Miele g.miele@unicas.it

Metodi e Strumenti per la Caratterizzazione e la Diagnostica di Trasmettitori Digitali RF ing. Gianfranco Miele g.miele@unicas.it Corso di laurea magistrale in Ingegneria delle Telecomunicazioni Metodi e Strumenti per la Caratterizzazione e la Diagnostica di Trasmettitori Digitali RF ing. Gianfranco Miele g.miele@unicas.it Trasmettitore

Dettagli

Altre novità della nostra ampia gamma di strumenti!

Altre novità della nostra ampia gamma di strumenti! L innovazione ad un prezzo interessante Altre novità della nostra ampia gamma di strumenti! Exacta+Optech Labcenter SpA Via Bosco n.21 41030 San Prospero (MO) Italia Tel: 059-808101 Fax: 059-908556 Mail:

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

LA MEMBRANA PLASMATICA

LA MEMBRANA PLASMATICA LA MEMBRANA PLASMATICA 1. LE FUNZIONI DELLA MEMBRANA PLASMATICA La membrana plasmatica svolge le seguenti funzioni: 1. tenere concentrate tutte le sostanze indispensabili alla vita: è proprio la membrana

Dettagli

RELAZIONE DI IMPATTO AMBIENTALE

RELAZIONE DI IMPATTO AMBIENTALE RELAZIONE DI IMPATTO AMBIENTALE Fattori di impatto ambientale Un sistema fotovoltaico non crea un impatto ambientale importante, visto che tale tecnologia è utilizzata per il risparmio energetico. I fattori

Dettagli

al via 1 Percorsi guidati per le vacanze di matematica e scienze UNITÀ CAMPIONE Edizioni del Quadrifoglio Evelina De Gregori Alessandra Rotondi

al via 1 Percorsi guidati per le vacanze di matematica e scienze UNITÀ CAMPIONE Edizioni del Quadrifoglio Evelina De Gregori Alessandra Rotondi Evelina De Gregori Alessandra Rotondi al via 1 Percorsi guidati per le vacanze di matematica e scienze per la Scuola secondaria di primo grado UNITÀ CAMPIONE Edizioni del Quadrifoglio Test d'ingresso NUMERI

Dettagli

Sistema theremino Collegare celle di carico ai Pin di tipo ADC

Sistema theremino Collegare celle di carico ai Pin di tipo ADC Sistema theremino Collegare celle di carico ai Pin di tipo ADC Sistema theremino Connecting Load Cells - 7 aprile 2015 - Pagina 1 Tutto è iniziato da qui Su ebay si trovano celle di carico che costano

Dettagli

L identificazione e la denominazione delle sostanze chimiche in ambito REACH

L identificazione e la denominazione delle sostanze chimiche in ambito REACH I DETERGENTI: COME CONIUGARE PRESTAZIONI ELEVATE E RISPETTO PER L AMBIENTE L identificazione e la denominazione delle sostanze chimiche in ambito REACH Resana, 5 ottobre 2007 FEDERICA CECCARELLI Ist. Sup.

Dettagli

Controllare un nastro trasportatore fischertechnik con Arduino

Controllare un nastro trasportatore fischertechnik con Arduino TITOLO ESPERIENZA: Controllare un nastro trasportatore fischertechnik con Arduino PRODOTTI UTILIZZATI: OBIETTIVO: AUTORE: RINGRAZIAMENTI: Interfacciare e controllare un modello di nastro trasportatore

Dettagli

Date da 10/2003 a 01/2004 Lavoro o posizione ricoperti Dirigente medico ex I livello, a tempo determinato, Disciplina di Medicina Interna

Date da 10/2003 a 01/2004 Lavoro o posizione ricoperti Dirigente medico ex I livello, a tempo determinato, Disciplina di Medicina Interna Principali attività e medico presso la Medicina e Chirurgia di Accettazione ed Urgenza (MCAU) del Pronto Soccorso Generale P.O. Garibaldi Centro. Attività svolta presso gli ambulatori di Medicina del Pronto

Dettagli

2. Infrastruttura e sicurezza (Equivalente al Pillar 2-3 e 4 della Ade)

2. Infrastruttura e sicurezza (Equivalente al Pillar 2-3 e 4 della Ade) AGENDA DIGITALE ITALIANA 1. Struttura dell Agenda Italia, confronto con quella Europea La cabina di regia parte con il piede sbagliato poiché ridisegna l Agenda Europea modificandone l organizzazione e

Dettagli

Guida al backup. 1. Introduzione al backup. Backup dei dati una parte necessaria nella gestione dei rischi. Backup su nastro media ideale

Guida al backup. 1. Introduzione al backup. Backup dei dati una parte necessaria nella gestione dei rischi. Backup su nastro media ideale 1. Introduzione al backup Guida al backup Backup dei dati una parte necessaria nella gestione dei rischi Con l aumentare dei rischi associati a virus, attacchi informatici e rotture hardware, implementare

Dettagli

Sopra ogni aspettativa

Sopra ogni aspettativa Sopra ogni aspettativa Pipette elettroniche Eppendorf Xplorer e Eppendorf Xplorer plus »Un modo intuitivo di lavorare.«chi dà il massimo ogni giorno, merita anche il massimo in termini di strumenti ed

Dettagli

DBMS (Data Base Management System)

DBMS (Data Base Management System) Cos'è un Database I database o banche dati o base dati sono collezioni di dati, tra loro correlati, utilizzati per rappresentare una porzione del mondo reale. Sono strutturati in modo tale da consentire

Dettagli

BIENNIO DI SECONDO LIVELLO IN DISCIPLINE MUSICALI MUSICA ELETTRONICA E TECNOLOGIE DEL SUONO

BIENNIO DI SECONDO LIVELLO IN DISCIPLINE MUSICALI MUSICA ELETTRONICA E TECNOLOGIE DEL SUONO BIENNIO DI SECONDO LIVELLO IN DISCIPLINE MUSICALI MUSICA ELETTRONICA E TECNOLOGIE DEL SUONO Requisiti d'ammissione Dal Regolamento didattico del Conservatorio di Como Ex Art. 24: Ammissione ai corsi di

Dettagli

CAPITOLO I CORRENTE ELETTRICA. Copyright ISHTAR - Ottobre 2003 1

CAPITOLO I CORRENTE ELETTRICA. Copyright ISHTAR - Ottobre 2003 1 CAPITOLO I CORRENTE ELETTRICA Copyright ISHTAR - Ottobre 2003 1 INDICE CORRENTE ELETTRICA...3 INTENSITÀ DI CORRENTE...4 Carica elettrica...4 LE CORRENTI CONTINUE O STAZIONARIE...5 CARICA ELETTRICA ELEMENTARE...6

Dettagli

Strumenti Elettronici Analogici/Numerici

Strumenti Elettronici Analogici/Numerici Facoltà di Ingegneria Università degli Studi di Firenze Dipartimento di Elettronica e Telecomunicazioni Strumenti Elettronici Analogici/Numerici Ing. Andrea Zanobini Dipartimento di Elettronica e Telecomunicazioni

Dettagli

ISTITUTO COMPRENSIVO N 1 LANCIANO - SCUOLA SECONDARIA DI PRIMO GRADO CURRICOLO VERTICALE - Classe Prima MATEMATICA a.s. 2014/2015

ISTITUTO COMPRENSIVO N 1 LANCIANO - SCUOLA SECONDARIA DI PRIMO GRADO CURRICOLO VERTICALE - Classe Prima MATEMATICA a.s. 2014/2015 NUMERI. SPAZIO E FIGURE. RELAZIONI, FUNZIONI, MISURE, DATI E PREVISIONI Le sociali e ISTITUTO COMPRENSIVO N 1 LANCIANO - SCUOLA SECONDARIA DI PRIMO GRADO CURRICOLO VERTICALE - Classe Prima MATEMATICA procedure

Dettagli

LA CARTOGRAFIA E LA SCALA

LA CARTOGRAFIA E LA SCALA Corso di laurea in Urbanistica e Sistemi Informativi Territoriali Laboratorio di ingresso Prof. Salvemini Arch. Valeria Mercadante A.A. 2009/2010 LA CARTOGRAFIA E LA SCALA La scala numerica La scala numerica

Dettagli

ALLEGATO al verbale della riunione del 3 Settembre 2010, del Dipartimento di Elettrotecnica e Automazione.

ALLEGATO al verbale della riunione del 3 Settembre 2010, del Dipartimento di Elettrotecnica e Automazione. ALLEGATO al verbale della riunione del 3 Settembre 2010, del Dipartimento di Elettrotecnica e Automazione. COMPETENZE MINIME- INDIRIZZO : ELETTROTECNICA ED AUTOMAZIONE 1) CORSO ORDINARIO Disciplina: ELETTROTECNICA

Dettagli

Introduzione alla Programmazione ad Oggetti in C++

Introduzione alla Programmazione ad Oggetti in C++ Introduzione alla Programmazione ad Oggetti in C++ Lezione 1 Cosa è la Programmazione Orientata agli Oggetti Metodologia per costruire prodotti software di grosse dimensioni che siano affidabili e facilmente

Dettagli

F O R M A T O E U R O P E O

F O R M A T O E U R O P E O F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Indirizzo Laura Bacci, PMP Via Tezze, 36 46100 MANTOVA Telefono (+39) 348 6947997 Fax (+39) 0376 1810801

Dettagli

Appendice III. Criteri per l utilizzo dei metodi di valutazione diversi dalle misurazioni in siti fissi

Appendice III. Criteri per l utilizzo dei metodi di valutazione diversi dalle misurazioni in siti fissi Appendice III (articolo 5, comma 1 e art. 22 commi 5 e 7) Criteri per l utilizzo dei metodi di valutazione diversi dalle misurazioni in siti fissi 1. Tecniche di modellizzazione 1.1 Introduzione. In generale,

Dettagli

Cos'è esattamente la gelatina

Cos'è esattamente la gelatina Cos'è esattamente la gelatina LA GELATINA È PURA E NATURALE La gelatina attualmente in commercio viene prodotta in moderni stabilimenti operanti in conformità ai più rigorosi standard di igiene e sicurezza.

Dettagli

Corso di Amministrazione di Sistema Parte I ITIL 3

Corso di Amministrazione di Sistema Parte I ITIL 3 Corso di Amministrazione di Sistema Parte I ITIL 3 Francesco Clabot Responsabile erogazione servizi tecnici 1 francesco.clabot@netcom-srl.it Fondamenti di ITIL per la Gestione dei Servizi Informatici Il

Dettagli

Procedura corretta per mappare con ECM Titanium

Procedura corretta per mappare con ECM Titanium Procedura corretta per mappare con ECM Titanium Introduzione: In questo documento troverete tutte le informazioni utili per mappare correttamente con il software ECM Titanium, partendo dalla lettura del

Dettagli

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp.

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. RECENSIONI&REPORTS recensione Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. 154, 12 «Il vasto e importante e molto

Dettagli

MODULO TERMOSTATO A PANNELLO VM148

MODULO TERMOSTATO A PANNELLO VM148 MODULO TERMOSTATO A PANNELLO VM148 Modulo termostato a pannello 4 COLLEGAMENTO 9-12V DC/ 500mA L1 L2 ~ Riscaldatore/Aria condizionata Max. 3A Max. 2m Sensore di temperatura Per prolungare il sensore, utilizzare

Dettagli

Background (sfondo): Finestra: Una finestra serve a mostrare il contenuto di un disco o di una cartella -, chiamata anche directory.

Background (sfondo): Finestra: Una finestra serve a mostrare il contenuto di un disco o di una cartella -, chiamata anche directory. @ PC (Personal computer): Questa sigla identificò il primo personal IBM del 1981 a cura di R.Mangini Archiviazione: Il sistema operativo si occupa di archiviare i file. Background (sfondo): Cursore: Nei

Dettagli