Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA"

Transcript

1 Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

2 Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l analisi di sequenze biologiche, genomi e per la predizione della funzione e della struttura di macromolecole.

3 Bioinformatica Nasce alla fine degli anni 70 con il concomitante sviluppo delle tecnologie del DNA ricombinante e quindi la pubblicazione delle prime sequenze di acidi nucleici Le tecnologie informatiche ed il loro relativo progresso, hanno facilitato l archiviazione di grandi quantità di dati e la diffusione delle informazioni attraverso le reti telematiche

4 Banche di dati biologici Gli anni recenti hanno visto una crescita esplosiva della quantità di dati biologici disponibili La conservazione e distribuzione di questi dati pone un problema critico per tutta la comunità scientifica Alcune istituzioni, spesso pubbliche, si sono fatte carico di questi compiti

5 Banche di dati biologici Esistono banche che raccolgono dati biologici di diversa natura 4Bibliografici (es: PubMed) 4Tassonomici 4Linee cellulari 4Virus 4etc. etc

6 Banche dati di macromolecole biologiche Banche di dati di sequenza e struttura di acidi nucleici e proteine L accesso a tali dati è di vitale importanza per la ricerca biologica sperimentale e teorica Forte richiesta da parte comunità scientifica di facili ed efficienti sistemi di interrogazione basati sia su parole chiave che su similitudine di sequenza Estrazione ed elaborazione dell informazione contenuta nella massa di dati

7 Banche dati di macromolecole biologiche La banche dati possono essere distinte in primarie, secondarie o specializzate Le banche dati primarie raccolgono i dati grezzi prodotti dai laboratori, li organizzano, li controllano e li distribuiscono

8 Banche dati di macromolecole biologiche Le banche dati secondarie invece riorganizzano e rielaborano l informazione contenuta nelle primarie secondo particolari criteri analitici Tra queste, le banche dati specializzate raccolgono solo l informazione relativa ad uno specifico settore, per esempio sequenze da lieviti, da anticorpi, proteasi, etc

9 Principali banche dati primarie Sequenze nucleotidiche: EMBL nucleotide sequence database GenBank DDBJ (DNA Data Bank of Japan) Sequenze e strutture proteiche: Protein Information Resource (NBRF) SWISS-PROT Protein Data Bank

10 EMBL nucleotide sequence database Istituita nel 1980 presso lo European Molecular Biology Laboratory di Heidelberg, ora presso lo European Molecular Biology Laboratory (Hinxton, GB) Lavora in stretta collaborazione con La GenBank e la DNA Data Bank of Japan

11 EMBL nucleotide sequence database 16 Mag 2008

12 EMBL nucleotide sequence database 16 Mag 2008

13 EMBL nucleotide sequence database 16 Mag 2008

14 EMBL nucleotide sequence database 16 Mag 2008

15 GenBank E distribuita dal National center for Biotechnological information, National Library of medicine, National Institute of Health (USA ) Contiene sequenze nucleotidiche e proteiche Annotazioni funzionali e bibliografiche Lavora in stretta collaborazione con EBI/EMBL e la DNA Data Bank of Japan

16 GenBank Il sito Web nell NCBI fornisce: 4 strumenti per l accesso e l interrogazione on-line delle banche dati, per esempio Entrez 4 e alcuni potenti strumenti software per la ricerca di somiglianza fra sequenze in diverse banche dati

17 GenBank 7 Mar 2006

18 DDBJ (DNA Data Bank of Japan) Istituita nel 1986 presso il National Institute of Genetics Lavora in stretta collaborazione con EBI/EMBL e la NCBI/GenBank

19 EMBL/GenBank/DDBJ Apr 2008

20 EMBL/GenBank/DDBJ Apr 2008

21 EMBL/GenBank/DDBJ INSDC International Nucleotide Sequence Database Collaboration In August 2005, the INSDC announced the DNA sequence database exceeded 100 gigabases. GenBank is proud of its contributions toward this milestone.

22 INSDC 3 Gen 2007

23 PIR (Protein Information Resource) Istituita nel 1984 dalla National Biomedical Research Foundation Collaborazione con Munich Information Center for Protein Sequences (MIPS) Collaborazione con Japan International Protein Information Database (JIPID) Mantiene la Protein Sequence Database (PSD) + altre banche dati derivate (PIRSF, NREF, etc.)

24 PIR (Protein Information Resource) Deriva dal lavoro pionieristico di M. Dayhoff con il suo Atlas of Protein Sequence and Structure ( ) Contiene circa sequenze di proteine Annotazioni + Referenze ad altre banche dati Classificazione in famiglie e superfamiglie Recentemente ha unito le forze con l EBI ed il SIB (Swiss Institute of Bioinformatics) per realizzare Uniprot, una risorsa centrale di sequenze e funzioni proteiche

25 SwissProt Creata nel 1987 presso il Dipartimento di Biochimica Medica dell Università di Ginevra Sviluppata congiuntamente allo European Bioinformatics Institute (EBI) e allo Swiss Institute of Bioinformatics (SIB).

26 SwissProt Elevata qualità e dettaglio delle annotazioni Ridondanza minima Elevata integrazione con altre banche dati Mantiene anche TrEMBL (contiene tutte le traduzioni delle sequenze nucleotidiche presenti in EMBL non ancora integrate in Swissprot) ed Uniprot

27 29 Apr 2008 SwissProt

28 29 Apr 2008 SwissProt/TrEMBL

29 The Protein Data Bank Contiene le coordinate spaziali di strutture di macromolecole biologiche E stata istituita nel 1971 presso i Brookhaven National Laboratories Dal 1998 è gestita dal Research Collaboratory for Structural Bioinformatics

30 The Protein Data Bank

31 Banche dati Secondarie: esempi Banca dati di famiglie proteiche e domini. Consiste di siti biologicamente significativi, pattern e profili, che aiutano a stabilire, in maniera efficace, se una nuova sequenza appartiene ad una data famiglia (29/04/ entries)-http://www.expasy.org/prosite/ EPD (Eukaryotic Promoter Database) è una collezione annotata, non ridondante di promotori eucariotici per la RNApol II, per i quali il sito d inizio della trascrizione è stato determinato sperimentalmente. Viene derivata dall EMBL Data Library, anche se rimane indipendente dalle descrizioni presenti nelle sequenze in EMBL (14/05/ entries)-http://www.epd.isb-sib.ch/

32 Banche dati Specializzate: esempi Banca dati per l informazione sulla genetica e la biologia molecolare della Drosophila. Include dati provenienti dai progetti di sequenziamento genomico e da letteratura Archivio delle strutture 3D, determinate sperimentalmente, delle proteasi e dei loro complessi con altre molecole, appartenenti ad HIV-1, HIV-2 e SIV (15/05/ entries).

33 Banca dati di malattie e disordini genetici. Nella sua prima edizione cartacea del 1966, all epoca ancora MIM, il numero di entries era limitato a 1487, per passare a circa 9000 alla dodicesima edizione del 1997 e nel Dicembre del Già dal 1999 si assiste ad una crescita esponenziale del database che in data 1 Ottobre 2001 conta entries, e recentemente (settembre 2004)

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle

Dettagli

e-science Bioinformatics

e-science Bioinformatics Luciano Milanesi Luciano Milanesi Institute of Biomedical Technology CNR ABSTRACT. The Bioinformatics community was an early adopter of the Internet and contributed to the e-science development by publishing

Dettagli

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Docente: Dr. Nicola Vitulo Dipartimento di Biologia, CRIBI Viale G.Colombo3, 35131 Padova

Dettagli

Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli

BIOINFORMATICA: Cosa è?

BIOINFORMATICA: Cosa è? BIOINFORMATICA: Cosa è? THE DEFINITIONS OF BIOINFORMATICS Bioinformatics is an integration of mathematical, statistical and computer methods to analyse biological, biochemical and biophysical data (Georgia

Dettagli

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse

Dettagli

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche.

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche. I due centri maggiori, EBI e NCBI hanno sviluppato sistemi dedicati di RETRIEVAL allo scopo di ottenere il massimo delle informazioni con il minimo sforzo da parte dell utente SRS (Sequence Retrieval System)

Dettagli

Basi di dati biologiche

Basi di dati biologiche Basi di dati biologiche Seminario per il corso di Basi di Dati II Luana Rinaldi luana.rinaldi@gmail.com AGENDA: Introduzione alla bioinformatica; Concetti Biologici; Banche dati biologiche; Collaborazioni

Dettagli

F O R M A T O E U R O P E O

F O R M A T O E U R O P E O F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Indirizzo Telefono Fax E-mail CARRERA PAOLA Nazionalità Data di nascita Codice fiscale italiana CRR PLA 57T45

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences Il DNA e la cellula Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Corso di Laurea in BIOTECNOLOGIE

Corso di Laurea in BIOTECNOLOGIE Dipartimento di Scienze Biomolecolari Struttura Didattica di Biotecnologie Corso di Laurea in BIOTECNOLOGIE E-mail biotecnologie@uniurb.it Sito web www.uniurb.it/biotecnologie/ Attività Didattica Informazioni

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

BIOLOGA e BIOLOGO MOLECOLARE

BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE?

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? A Flusso di attività B - INPUT C Descrizione dell attività D RISULTATO E - SISTEMA PROFESSIONALE 0. RICHIESTA DI STUDIARE E/O INDIVIDUARE

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Progetto Cluster. Sottoprogetto Bioinformatica

Progetto Cluster. Sottoprogetto Bioinformatica Progetto Cluster Sottoprogetto Bioinformatica CRS4 (Centro di Ricerca, Sviluppo e Studi Superiori in Sardegna) Società costituita nel 1990 svolge attività di ricerca e sviluppo basate sulle tecnologie

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Curriculum Vitae Piero Pignataro

Curriculum Vitae Piero Pignataro INFORMAZIONI PERSONALI Piero Pignataro Via G.Marconi, 39, Baronissi(SA) C.A.P. 84081 089-954317 340-1796552 piero.pignataro@gmail.com Sesso M Data di nascita 30/06/1987 Nazionalità Italiana POSIZIONE RICOPERTA

Dettagli

DIDATTICA CON IL WEB Rassegna di siti utili per la didattica della biologia, chimica, scienze della Terra e dello spazio

DIDATTICA CON IL WEB Rassegna di siti utili per la didattica della biologia, chimica, scienze della Terra e dello spazio DIDATTICA CON IL WEB Rassegna di siti utili per la didattica della biologia, chimica, scienze della Terra e dello spazio di Giulia Realdon, BIOLOGIA 2can - The bioinformatics educational resource Biologia,

Dettagli

COMITATO NAZIONALE PER LA BIOSICUREZZA E LE BIOTECNOLOGIE. Gruppo di lavoro Bioinformatica

COMITATO NAZIONALE PER LA BIOSICUREZZA E LE BIOTECNOLOGIE. Gruppo di lavoro Bioinformatica COMITATO NAZIONALE PER LA BIOSICUREZZA E LE BIOTECNOLOGIE Gruppo di lavoro Bioinformatica Linee guida per la definizione di una strategia per lo sviluppo del settore della bioinformatica in Italia con

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale

26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale 26. Bioinformatica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Lo sviluppo delle Biotecnologie ha consentito di elevare

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico ALLEGATO 1 DESCRIZIONE DELLA FORNITURA PROCEDURA APERTA PER LA FORNITURA IN PIU LOTTI, IN MODALITA SERVICE, DI SISTEMI ANALITICI DI BIOLOGIA MOLECOLARE PER I LABORATORI ANALISI DELL AZIENDA ASL N. 8 DI

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Rappresentazione dei Dati Biologici

Rappresentazione dei Dati Biologici Rappresentazione dei Dati Biologici CORSO DI BIOINFORMATICA C.d.L. Ingegneria Informatica e Biomedica Outline Proteine ed Amminoacidi Rappresentazione di Amminoacidi Rappresentazione delle strutture Proteiche

Dettagli

Percorsi di ricerca di prove di efficacia nella letteratura scientifica e grigia

Percorsi di ricerca di prove di efficacia nella letteratura scientifica e grigia Progetto Gli infortuni (mortali) sul lavoro: Efficacia degli interventi Seminario dell Altana Calenzano 5-6 Marzo 2007 Percorsi di ricerca di prove di efficacia nella letteratura scientifica e grigia Progetto

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

UNA BASE DATI PER IL KNOWLEDGE DISCOVERY IN GENETICA MEDICA

UNA BASE DATI PER IL KNOWLEDGE DISCOVERY IN GENETICA MEDICA Alma Mater Studiorum Università dibologna SCUOLA DI SCIENZE Corso di Laurea in Informatica Magistrale UNA BASE DATI PER IL KNOWLEDGE DISCOVERY IN GENETICA MEDICA Tesi di Laurea in Complementi di Basi di

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

RELAZIONE E PROGRAMMA FINALE DI BIOCHIMICA e BIOLOGIA MOLECOLARE

RELAZIONE E PROGRAMMA FINALE DI BIOCHIMICA e BIOLOGIA MOLECOLARE Allegato A Istituto paritario di Istruzione Secondaria Superiore Ivo de Carneri Civezzano Indirizzo I.T.A.S. indirizzo Biologico RELAZIONE E PROGRAMMA FINALE DI BIOCHIMICA e BIOLOGIA MOLECOLARE A.S. 2012/2013

Dettagli

Regolamento didattico del Corso di Laurea magistrale in Biotecnologie Mediche

Regolamento didattico del Corso di Laurea magistrale in Biotecnologie Mediche Regolamento didattico del Corso di Laurea magistrale in Biotecnologie Mediche 1. Denominazione e durata del Corso di Laurea Il Corso di Laurea magistrale o specialistica in Biotecnologie Mediche appartiene

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Il Corso di laurea in Biotecnologia e il curriculum biologicoindustriale

Il Corso di laurea in Biotecnologia e il curriculum biologicoindustriale Perche studiare biotecnologia? Che cosa sono le biotecnologie? I colori delle biotecnologie Gli strumenti del biotecnologo Le biotecnologie industriali Il Corso di laurea in Biotecnologia e il curriculum

Dettagli

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA INDICE pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA 1.1. Il concetto d identificazione... 9 1.2. L identificazione nella storia....

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

ANALISI BIOINFORMATICA DELLE PROTEINE. Matteo Ramazzotti matteo.ramazzotti@unifi.it

ANALISI BIOINFORMATICA DELLE PROTEINE. Matteo Ramazzotti matteo.ramazzotti@unifi.it ANALISI BIOINFORMATICA DELLE PROTEINE Matteo Ramazzotti matteo.ramazzotti@unifi.it Programma Banche dati proteiche. Interrogazione delle banche dati. Allineamento di sequenze proteiche. Matrici di sostituzione.

Dettagli

BIOINFOSTAT. L industria farmaceutica utilizza queste informazioni e metodologie e conoscenze al fine di

BIOINFOSTAT. L industria farmaceutica utilizza queste informazioni e metodologie e conoscenze al fine di BIOINFORMATICA Gruppo di lavoro Bioinformatica Linee guida per la definizione di una strategia per lo sviluppo del settore della bioinformatica in Italia con particolare attenzione all ambito biomedico

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica.

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. Concanavalina A Emoglobina subunità Trioso fosfato isomerasi Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. 1 La conformazione è

Dettagli

Approfondimento: i sistemi di gestione delle basi di dati (DBMS)

Approfondimento: i sistemi di gestione delle basi di dati (DBMS) Approfondimento: i sistemi di gestione delle basi di dati (DBMS) Prerequisito essenziale della funzionalità delle basi di dati è il controllo e la fruibilità dell informazione in esse contenuta: a tale

Dettagli

3B BIO classe partecipante al progetto Generazione Web

3B BIO classe partecipante al progetto Generazione Web Anno scolastico 2012-13 ISTITUTO TECNICO SETTORE TECNOLOGICO INDIRIZZO CHIMICA, MATERIALI E BIOTECNOLOGIE (Articolazione: Biotecnologie sanitarie) PROGRAMMA PREVENTIVO MATERIA Biologia, Microbiologia e

Dettagli

CORSO DI LAUREA IN BIOLOGIA MOLECOLARE

CORSO DI LAUREA IN BIOLOGIA MOLECOLARE UNIVERSITÀ DEGLI STUDI DI PARMA DIPARTIMENTO DI BIOSCIENZE CORSO DI LAUREA IN BIOLOGIA MOLECOLARE LAUREA MAGISTRALE CLASSE LM-6 BIOLOGIA ANNO ACCADEMICO 2015-2016 OBIETTIVI FORMATIVI Obiettivi formativi

Dettagli

Guglielmo Paganetto Giovanni Braga Network biologici

Guglielmo Paganetto Giovanni Braga Network biologici A05 Guglielmo Paganetto Giovanni Braga Network biologici Copyright MMXV Aracne editrice int.le S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Quarto Negroni, 15 00040 Ariccia (RM) (06) 93781065

Dettagli

PER RIVISTO 18/03/05. Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)?

PER RIVISTO 18/03/05. Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)? FAQ SULLA ICDL PER EDITORI, AUTORI, ILLUSTRATORI ED ALTRI DETENTORI DI DIRITTI RIVISTO 18/03/05 Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)? Chi

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Modellazione dinamica e strumenti per la valutazione sperimentale del comportamento della via EGFR-IGF1R per la linea cellulare H1650

Modellazione dinamica e strumenti per la valutazione sperimentale del comportamento della via EGFR-IGF1R per la linea cellulare H1650 Università deglistudidiperugia FacoltàdiIngegneria Tesi di Laurea Magistrale in Ingegneria Informatica e dell Automazione Anno Accademico 2011/2012 Modellazione dinamica e strumenti per la valutazione

Dettagli

1. Le banche dati biologiche

1. Le banche dati biologiche 1. Le banche dati biologiche NCBI, ENTREZ, MEDLINE, PUBMED Il National Center for Biotechnology Information (NCBI), un ente governativo americano, gestisce un sito web (www.ncbi.nlm.nih.gov) attraverso

Dettagli

UNIVERSITÀ DEGLI STUDI DI BARI

UNIVERSITÀ DEGLI STUDI DI BARI UNIVERSITÀ DEGLI STUDI DI BARI Nota: per le modalità concorsuali si prega cortesemente di fare sempre riferimento al Bando di Concorso A. A. 2005-2006 Parte A Informazioni generali Proposta d istituzione

Dettagli

Trovare nelle risorse della Biblioteca- per Infermieristica

Trovare nelle risorse della Biblioteca- per Infermieristica Trovare nelle risorse della Biblioteca- per Infermieristica di Laura Colombo Seminario per il primo anno del corso di laurea in Infermieristica Sede di Sesto Università degli studi di Milano-Bicocca Monza,

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

Trovare nelle risorse della Bibliotecaper Infermieristica

Trovare nelle risorse della Bibliotecaper Infermieristica Trovare nelle risorse della Bibliotecaper Infermieristica di Laura Colombo Seminario per il primo anno del corso di laurea in Infermieristica Sede di Monza Università degli studi di Milano-Bicocca Monza,

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

UNIVERSITÀ DEGLI STUDI DELL INSUBRIA BANDO PER L AMMISSIONE AL MASTER DI I LIVELLO IN BIOINFORMATICA

UNIVERSITÀ DEGLI STUDI DELL INSUBRIA BANDO PER L AMMISSIONE AL MASTER DI I LIVELLO IN BIOINFORMATICA UNIVERSITÀ DEGLI STUDI DELL INSUBRIA BANDO PER L AMMISSIONE AL MASTER DI I LIVELLO IN BIOINFORMATICA L Università degli Studi dell Insubria, in collaborazione con la Fondazione per le Biotecnologie di

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

POLITECNICO DI TORINO. Tesi di Laurea. Classificazione di dati genetici

POLITECNICO DI TORINO. Tesi di Laurea. Classificazione di dati genetici POLITECNICO DI TORINO Facoltà di Ingegneria dell Informazione Corso di Laurea in Ingegneria Informatica Tesi di Laurea Classificazione di dati genetici Relatore prof. Elena Baralis Candidato Alessandro

Dettagli

Microarray reale e virtuale: Passo dopo passo

Microarray reale e virtuale: Passo dopo passo Microarray reale e virtuale: Passo dopo passo Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

liceo scienze applicate

liceo scienze applicate imparare è un esperienza, tutto il resto è informazione A. Einstein liceo scienze applicate liceo scientifico SCIENZE APPLICATE LICEO SCIENTIFICO, PERCHè L ISTITUTO SOBRERO RAPPRESENTA UN POLO FORMATIVO

Dettagli

WORKSHOP. competenze, risorse e strumenti HPH. Traiettoria Rete HPH Emilia-Romagna

WORKSHOP. competenze, risorse e strumenti HPH. Traiettoria Rete HPH Emilia-Romagna WORKSHOP Modelli e strumenti per lo sviluppo del progetto HPH elaborati nel Laboratorio interreti HPH Traiettoria Rete HPH Emilia-Romagna Ricerca in promozione della salute: competenze, risorse e strumenti

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche I T A L B I O F O R M A i n c o l l a b o r a z i o n e c o n O R D I N E N A Z I O N A L E D E I B I O L O G I o r g a n i z z a i l c o r s o d i a g g i o r n a m e n t o BIOLOGIA MOLECOLARE: introduzione

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

10. Previsione della struttura tridimensionale di una proteina

10. Previsione della struttura tridimensionale di una proteina 10. Previsione della struttura tridimensionale di una proteina Lo scopo di questa esercitazione è di comprendere la logica alla base della modellizzazione per omologia attraverso la previsione della struttura

Dettagli

L enigma del XXI secolo: decifrare il codice della vita

L enigma del XXI secolo: decifrare il codice della vita L enigma del XXI secolo: decifrare il codice della vita David Horner Dipar9mento di Bioscienze Università degli Studi di Milano Via Celoria 26 Milano 20133 david.horner@unimi.it Regola di Chargaff %A =

Dettagli

LA MOLTIPLICAZIONE DEI VIRUS

LA MOLTIPLICAZIONE DEI VIRUS LA MOLTIPLICAZIONE DEI VIRUS I virioni, rappresentano la fase biologicamente inattiva, dei singoli virus. Le diverse famiglie di virus utilizzano strategie replicative a causa della differente organizzazione

Dettagli

SESSIONE ANTICIPATA PER GLI STUDENTI DELLE SCUOLE SUPERIORI. 17-31 marzo 2015. Informazioni e istruzioni. per gli Studenti

SESSIONE ANTICIPATA PER GLI STUDENTI DELLE SCUOLE SUPERIORI. 17-31 marzo 2015. Informazioni e istruzioni. per gli Studenti Conferenza Nazionale dei Presidenti e dei Direttori delle Strutture Universitarie di Scienze e Tecnologie Piano Nazionale Lauree Scientifiche VERIFICA DELLE CONOSCENZE PER L INGRESSO SESSIONE ANTICIPATA

Dettagli

Corso di Laurea Magistrale in BIOTECNOLOGIE MEDICHE Classe delle lauree magistrali in biotecnologie mediche, veterinarie e farmaceutiche (LM-9)

Corso di Laurea Magistrale in BIOTECNOLOGIE MEDICHE Classe delle lauree magistrali in biotecnologie mediche, veterinarie e farmaceutiche (LM-9) La presente scheda di approfondimento si riferisce ai corsi a immatricolazione nell a. a. 00-0. Per ulteriori informazioni si rimanda all Ufficio di Presidenza di Facoltà. Corso di Laurea Magistrale in

Dettagli

Competenze Laboratori (Med-CHHAB)

Competenze Laboratori (Med-CHHAB) Competenze Laboratori (Med-CHHAB) Asse Portante Tematiche Campi d azione Servizi offerti Applicazioni Polimeri Biocompatibili Preparazione e caratterizzazione chimicofisica di materiali polimerici biocompatibili

Dettagli

Il Centro Biblioteche e Documentazione (CBD)

Il Centro Biblioteche e Documentazione (CBD) Il Centro Biblioteche e Documentazione (CBD) E stato istituito con delibera del C.d.A. dell'università degli Studi di Catania nella seduta del 31/07/1992. E l organismo di Coordinamento Tecnico delle Biblioteche

Dettagli

Sperimenta il BioLab

Sperimenta il BioLab Progetto Sperimenta il BioLab Centro Università di Milano - Scuola per le Bioscienze e le Biotecnologie http://www.cusmibio.unimi.it/ I laboratori del Cus-Mi-Bio dedicati a "SPERIMENTA IL BIOLAB" si trovano

Dettagli

Reti informatiche L O R E N Z O D I S I L V E S T R O

Reti informatiche L O R E N Z O D I S I L V E S T R O L O R E N Z O D I S I L V E S T R O w w w. d m i. u n i c t. i t / ~ d i s i l v e s t r o d i s i l v e s t r o @ d m i. u n i c t. i t Internet Internet è il nome con cui viene indicata una estesa rete

Dettagli

Finanziato dalla Unione Europea. Contratto No. FP6-RII3-026155

Finanziato dalla Unione Europea. Contratto No. FP6-RII3-026155 Finanziato dalla Unione Europea Contratto No. FP6-RII3-026155 Visione d insieme della struttura di FP6 2 Finanziato dalla Unione Europea EUPRIM-NET European Primate Network: Infrastrutture Specializzate

Dettagli

Metodi per la ricerca bibliografica e gestione della bibliografia BIOINGEGNERIA ED INFORMATICA MEDICA

Metodi per la ricerca bibliografica e gestione della bibliografia BIOINGEGNERIA ED INFORMATICA MEDICA Metodi per la ricerca bibliografica e gestione della bibliografia BIOINGEGNERIA ED INFORMATICA MEDICA 1 Cos è la bibliometria? La bibliometria è una scienza che utilizza tecniche matematiche e statistiche

Dettagli

Analisi filogenetica delle famiglie di proteine omologhe

Analisi filogenetica delle famiglie di proteine omologhe Testo originale in russo http://zbio.net/bio/001/003.html Traduzione a cura di M.T. Carreras http://geneproject.altervista.org/ Analisi filogenetica delle famiglie di proteine omologhe 1. Oggetto di analisi

Dettagli