Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA"


1 Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

2 Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l analisi di sequenze biologiche, genomi e per la predizione della funzione e della struttura di macromolecole.

3 Bioinformatica Nasce alla fine degli anni 70 con il concomitante sviluppo delle tecnologie del DNA ricombinante e quindi la pubblicazione delle prime sequenze di acidi nucleici Le tecnologie informatiche ed il loro relativo progresso, hanno facilitato l archiviazione di grandi quantità di dati e la diffusione delle informazioni attraverso le reti telematiche

4 Banche di dati biologici Gli anni recenti hanno visto una crescita esplosiva della quantità di dati biologici disponibili La conservazione e distribuzione di questi dati pone un problema critico per tutta la comunità scientifica Alcune istituzioni, spesso pubbliche, si sono fatte carico di questi compiti

5 Banche di dati biologici Esistono banche che raccolgono dati biologici di diversa natura 4Bibliografici (es: PubMed) 4Tassonomici 4Linee cellulari 4Virus 4etc. etc

6 Banche dati di macromolecole biologiche Banche di dati di sequenza e struttura di acidi nucleici e proteine L accesso a tali dati è di vitale importanza per la ricerca biologica sperimentale e teorica Forte richiesta da parte comunità scientifica di facili ed efficienti sistemi di interrogazione basati sia su parole chiave che su similitudine di sequenza Estrazione ed elaborazione dell informazione contenuta nella massa di dati

7 Banche dati di macromolecole biologiche La banche dati possono essere distinte in primarie, secondarie o specializzate Le banche dati primarie raccolgono i dati grezzi prodotti dai laboratori, li organizzano, li controllano e li distribuiscono

8 Banche dati di macromolecole biologiche Le banche dati secondarie invece riorganizzano e rielaborano l informazione contenuta nelle primarie secondo particolari criteri analitici Tra queste, le banche dati specializzate raccolgono solo l informazione relativa ad uno specifico settore, per esempio sequenze da lieviti, da anticorpi, proteasi, etc

9 Principali banche dati primarie Sequenze nucleotidiche: EMBL nucleotide sequence database GenBank DDBJ (DNA Data Bank of Japan) Sequenze e strutture proteiche: Protein Information Resource (NBRF) SWISS-PROT Protein Data Bank

10 EMBL nucleotide sequence database Istituita nel 1980 presso lo European Molecular Biology Laboratory di Heidelberg, ora presso lo European Molecular Biology Laboratory (Hinxton, GB) Lavora in stretta collaborazione con La GenBank e la DNA Data Bank of Japan

11 EMBL nucleotide sequence database 16 Mag 2008

12 EMBL nucleotide sequence database 16 Mag 2008

13 EMBL nucleotide sequence database 16 Mag 2008

14 EMBL nucleotide sequence database 16 Mag 2008

15 GenBank E distribuita dal National center for Biotechnological information, National Library of medicine, National Institute of Health (USA ) Contiene sequenze nucleotidiche e proteiche Annotazioni funzionali e bibliografiche Lavora in stretta collaborazione con EBI/EMBL e la DNA Data Bank of Japan

16 GenBank Il sito Web nell NCBI fornisce: 4 strumenti per l accesso e l interrogazione on-line delle banche dati, per esempio Entrez 4 e alcuni potenti strumenti software per la ricerca di somiglianza fra sequenze in diverse banche dati

17 GenBank 7 Mar 2006

18 DDBJ (DNA Data Bank of Japan) Istituita nel 1986 presso il National Institute of Genetics Lavora in stretta collaborazione con EBI/EMBL e la NCBI/GenBank

19 EMBL/GenBank/DDBJ Apr 2008

20 EMBL/GenBank/DDBJ Apr 2008

21 EMBL/GenBank/DDBJ INSDC International Nucleotide Sequence Database Collaboration In August 2005, the INSDC announced the DNA sequence database exceeded 100 gigabases. GenBank is proud of its contributions toward this milestone.

22 INSDC 3 Gen 2007

23 PIR (Protein Information Resource) Istituita nel 1984 dalla National Biomedical Research Foundation Collaborazione con Munich Information Center for Protein Sequences (MIPS) Collaborazione con Japan International Protein Information Database (JIPID) Mantiene la Protein Sequence Database (PSD) + altre banche dati derivate (PIRSF, NREF, etc.)

24 PIR (Protein Information Resource) Deriva dal lavoro pionieristico di M. Dayhoff con il suo Atlas of Protein Sequence and Structure ( ) Contiene circa sequenze di proteine Annotazioni + Referenze ad altre banche dati Classificazione in famiglie e superfamiglie Recentemente ha unito le forze con l EBI ed il SIB (Swiss Institute of Bioinformatics) per realizzare Uniprot, una risorsa centrale di sequenze e funzioni proteiche

25 SwissProt Creata nel 1987 presso il Dipartimento di Biochimica Medica dell Università di Ginevra Sviluppata congiuntamente allo European Bioinformatics Institute (EBI) e allo Swiss Institute of Bioinformatics (SIB).

26 SwissProt Elevata qualità e dettaglio delle annotazioni Ridondanza minima Elevata integrazione con altre banche dati Mantiene anche TrEMBL (contiene tutte le traduzioni delle sequenze nucleotidiche presenti in EMBL non ancora integrate in Swissprot) ed Uniprot

27 29 Apr 2008 SwissProt

28 29 Apr 2008 SwissProt/TrEMBL

29 The Protein Data Bank Contiene le coordinate spaziali di strutture di macromolecole biologiche E stata istituita nel 1971 presso i Brookhaven National Laboratories Dal 1998 è gestita dal Research Collaboratory for Structural Bioinformatics

30 The Protein Data Bank

31 Banche dati Secondarie: esempi Banca dati di famiglie proteiche e domini. Consiste di siti biologicamente significativi, pattern e profili, che aiutano a stabilire, in maniera efficace, se una nuova sequenza appartiene ad una data famiglia (29/04/ entries)- EPD (Eukaryotic Promoter Database) è una collezione annotata, non ridondante di promotori eucariotici per la RNApol II, per i quali il sito d inizio della trascrizione è stato determinato sperimentalmente. Viene derivata dall EMBL Data Library, anche se rimane indipendente dalle descrizioni presenti nelle sequenze in EMBL (14/05/ entries)-

32 Banche dati Specializzate: esempi Banca dati per l informazione sulla genetica e la biologia molecolare della Drosophila. Include dati provenienti dai progetti di sequenziamento genomico e da letteratura Archivio delle strutture 3D, determinate sperimentalmente, delle proteasi e dei loro complessi con altre molecole, appartenenti ad HIV-1, HIV-2 e SIV (15/05/ entries).

33 Banca dati di malattie e disordini genetici. Nella sua prima edizione cartacea del 1966, all epoca ancora MIM, il numero di entries era limitato a 1487, per passare a circa 9000 alla dodicesima edizione del 1997 e nel Dicembre del Già dal 1999 si assiste ad una crescita esponenziale del database che in data 1 Ottobre 2001 conta entries, e recentemente (settembre 2004)

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle


Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.


e-science Bioinformatics

e-science Bioinformatics Luciano Milanesi Luciano Milanesi Institute of Biomedical Technology CNR ABSTRACT. The Bioinformatics community was an early adopter of the Internet and contributed to the e-science development by publishing


2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma L elettroforesi bidimensionale separa le proteine in base alla loro carica (come nella IEF) e dimensioni


Banche Dati. Docente: Dr. Antinisca DI MARCO

Banche Dati. Docente: Dr. Antinisca DI MARCO Docente: Dr. Antinisca DI MARCO Email: La biologia molecolare produce una grande mole di dati che può essere memorizzata in database general-purpose o specialized (es. immunological):


Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Docente: Dr. Nicola Vitulo Dipartimento di Biologia, CRIBI Viale G.Colombo3, 35131 Padova






BIOINFORMATICA: Cosa è? BIOINFORMATICA: Cosa è? THE DEFINITIONS OF BIOINFORMATICS Bioinformatics is an integration of mathematical, statistical and computer methods to analyse biological, biochemical and biophysical data (Georgia


Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)


Corso di Elementi di Bioinformatica

Corso di Elementi di Bioinformatica Corso di Elementi di Bioinformatica Laurea Triennale in Informatica I dati e le banche dati in Bioinformatica Anno Accademico 2015-2016 Docente del laboratorio: Raffaella Rizzi 1 Il DNA (oggetto biologico)


SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche.

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche. I due centri maggiori, EBI e NCBI hanno sviluppato sistemi dedicati di RETRIEVAL allo scopo di ottenere il massimo delle informazioni con il minimo sforzo da parte dell utente SRS (Sequence Retrieval System)


Progetto Cluster. Sottoprogetto Bioinformatica

Progetto Cluster. Sottoprogetto Bioinformatica Progetto Cluster Sottoprogetto Bioinformatica CRS4 (Centro di Ricerca, Sviluppo e Studi Superiori in Sardegna) Società costituita nel 1990 svolge attività di ricerca e sviluppo basate sulle tecnologie


Basi di dati biologiche

Basi di dati biologiche Basi di dati biologiche Seminario per il corso di Basi di Dati II Luana Rinaldi AGENDA: Introduzione alla bioinformatica; Concetti Biologici; Banche dati biologiche; Collaborazioni


La ricerca bibliografica in ambito infermieristico

La ricerca bibliografica in ambito infermieristico La ricerca bibliografica in ambito infermieristico Per i tutor del corso di laurea in infermieristica A cura di Annalisa Bardelli, su materiale di Annalisa Maiorano Pubmed Pubmed: http:


Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli


Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse


Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica



MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli Emanuele Pascariello Emanuele Pascariello Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email Emanuele Pascariello


Corso di Laurea in BIOTECNOLOGIE

Corso di Laurea in BIOTECNOLOGIE Dipartimento di Scienze Biomolecolari Struttura Didattica di Biotecnologie Corso di Laurea in BIOTECNOLOGIE E-mail Sito web Attività Didattica Informazioni


Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences Il DNA e la cellula Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia


Banche dati molti dati sulle proteine derivano dalle banche dati primarie

Banche dati molti dati sulle proteine derivano dalle banche dati primarie Banche dati Banche dati Si possono raggruppare in varie categorie in base al tipo di dato biologico che raccolgono e organizzano, ma ce ne sono alcune che sono da considerarsi fondamentali: - banche dati


strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine


Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization Università degli Studi di Genova Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica Anno Accademico 2009/2010 Tesi di Laurea Specialistica Elaborazione di dati


TO61: Applicazione di metodi della fisica teorica a sistemi biologici

TO61: Applicazione di metodi della fisica teorica a sistemi biologici TO61: Applicazione di metodi della fisica teorica a sistemi biologici Obiettivi: Offrire l opportunita ai vari gruppi che in questi ultimi anni, all interno dell INFN, hanno cominciato a lavorare al confine


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e



F O R M A T O E U R O P E O F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Indirizzo Telefono Fax E-mail CARRERA PAOLA Nazionalità Data di nascita Codice fiscale italiana CRR PLA 57T45


PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma.

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma. PROTEOMA Si definisce proteoma il complemento tempo- e cellulo- specifico del genoma. Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse nello stesso momento in


Percorsi di ricerca di prove di efficacia nella letteratura scientifica e grigia

Percorsi di ricerca di prove di efficacia nella letteratura scientifica e grigia Progetto Gli infortuni (mortali) sul lavoro: Efficacia degli interventi Seminario dell Altana Calenzano 5-6 Marzo 2007 Percorsi di ricerca di prove di efficacia nella letteratura scientifica e grigia Progetto


Biobanche e Centri di Risorse Biologiche per la Salute umana e degli animali

Biobanche e Centri di Risorse Biologiche per la Salute umana e degli animali Associazione Giuseppe Dossetti Biobanche e Centri di Risorse Biologiche per la Salute umana e degli animali Roma, 21 Marzo 2013 Leonardo Santi Presidente Comitato Scientifico CNRB Presidente Onorario Comitato





PER RIVISTO 18/03/05. Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)?

PER RIVISTO 18/03/05. Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)? FAQ SULLA ICDL PER EDITORI, AUTORI, ILLUSTRATORI ED ALTRI DETENTORI DI DIRITTI RIVISTO 18/03/05 Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)? Chi


Bioinformatica ed applicazioni di bioinformatica strutturale!

Bioinformatica ed applicazioni di bioinformatica strutturale! Bioinformatica ed applicazioni di bioinformatica strutturale! Bioinformatica! Le banche dati! Programmi per estrarre ed analizzare i dati! I numeri! Cellule nell uomo! Geni nell uomo! Genoma umano Il dogma


Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,



LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:


Gestione dei dati in proteomica

Gestione dei dati in proteomica Gestione dei dati in proteomica PROTEINE E PROTEOMICA CLINICA 1.1 Le proteine: natura e funzioni Le proteine sono i prodotti della policondensazione di numerose molecole α-amminoacidi, legate le une alle


Finanziato dalla Unione Europea. Contratto No. FP6-RII3-026155

Finanziato dalla Unione Europea. Contratto No. FP6-RII3-026155 Finanziato dalla Unione Europea Contratto No. FP6-RII3-026155 Visione d insieme della struttura di FP6 2 Finanziato dalla Unione Europea EUPRIM-NET European Primate Network: Infrastrutture Specializzate


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


Laboratorio di Bioinformatica I. Parte 2. Dott. Sergio Marin Vargas (2014 / 2015)

Laboratorio di Bioinformatica I. Parte 2. Dott. Sergio Marin Vargas (2014 / 2015) Laboratorio di Bioinformatica I Banche dati Parte 2 Dott. Sergio Marin Vargas (2014 / 2015) Google Scholar E un motore di ricerca di Google, specializzato nella ricerca di articoli



BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...


Banche Dati Secondarie. geni trascritti proteine profili strutture

Banche Dati Secondarie. geni trascritti proteine profili strutture Banche Dati Secondarie geni trascritti proteine profili strutture definizione Banca dati il cui contenuto deriva da una banca dati primaria DB sec DB primario informazione PROSITE SWISS Prot patterns Profiles


Basi di dati. Basi di dati = database. Basi di dati

Basi di dati. Basi di dati = database. Basi di dati Basi di dati Da leggere: Cap. 6 Sawyer, Williams (testo A) Basi di dati = database Sono una delle applicazioni informatiche che hanno avuto il maggiore utilizzo in uffici, aziende, servizi -> oggi anche



LO STATO DELLA RICERCA SANITARIA IN ITALIA SAS Campus 2011 - Università di Milano-Bicocca, 22 novembre Business Intelligence e Analytics nell università, nel business e nel government per la crescita del Sistema Paese LO STATO DELLA RICERCA SANITARIA


Informatica Biomedica: Lezione 15. Informatica Biomedica. Other structure databanks. The Worldwide Protein Data Bank (wwpdb) Macromolecular structures

Informatica Biomedica: Lezione 15. Informatica Biomedica. Other structure databanks. The Worldwide Protein Data Bank (wwpdb) Macromolecular structures Informatica Biomedica: Lezione 15 Informatica Biomedica lezione15 Alberto*Paoluzzi Mauro*Ceccanti http : // paoluzzi/web/did/biomed/ Informatica e Automazione, "Roma Tre" Medicina Clinica,


Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva





LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,


Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli Fonti e testi di riferimento Dan Graur: >courses > bioinformatics


INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi


Crediti formativi 26 Partecipanti 50

Crediti formativi 26 Partecipanti 50 Corso di aggiornamento PROVIDER NAZIONALE 301 DIAGNOSTICA GENETICA ATTUALITA E PROSPETTIVE IL LABORATORIO DELLA GENETICA FORENSE 2015 Coordinamento scientifico Prof. Maurizio Margaglione Crediti formativi


Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica.

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. Concanavalina A Emoglobina subunità Trioso fosfato isomerasi Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. 1 La conformazione è


Curriculum Vitae Piero Pignataro

Curriculum Vitae Piero Pignataro INFORMAZIONI PERSONALI Piero Pignataro Via G.Marconi, 39, Baronissi(SA) C.A.P. 84081 089-954317 340-1796552 Sesso M Data di nascita 30/06/1987 Nazionalità Italiana POSIZIONE RICOPERTA



GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza


Genomica, proteomica, genomica strutturale, banche dati.

Genomica, proteomica, genomica strutturale, banche dati. Genomica, proteomica, genomica strutturale, banche dati. Alcune pietre miliari della biologia anno risultato 1866 Mendel scopre i geni 1944 il DNA è il materiale genetico 1951 prima sequenza di una proteina


LT in Biotecnologie Agripolis, 24 marzo 2015

LT in Biotecnologie Agripolis, 24 marzo 2015 BIOTECNOLOGIE APPLICATE A CELLULE ANIMALI Colture cellulari e le loro applicazioni: isolamento di cellule in coltura. Tipi di colture. Parametri per la caratterizzazione e il monitoraggio di cellule in


La GRID nella Medicina

La GRID nella Medicina La GRID nella Medicina Paola Di Giacomo Principali sfide della medicina Aumento Aumento popolazione anziana Malattie Malattie croniche (neurologiche, ecc.) Malattie Malattie


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Università Federico II, Napoli Facoltà di Scienze Corsi di Studio in Fisica

Università Federico II, Napoli Facoltà di Scienze Corsi di Studio in Fisica Università Federico II, Napoli Facoltà di Scienze Corsi di Studio in Fisica I Corsi di Studio in Fisica comprendono quattro percorsi didattici. Al termine di ciascun percorso si consegue uno dei seguenti


Biblioteche, centri di documentazione e musei digitali per la ricerca e la formazione superiore

Biblioteche, centri di documentazione e musei digitali per la ricerca e la formazione superiore Biblioteche, centri di documentazione e musei digitali per la ricerca e la formazione superiore Jacopo Di Cocco Direttore CIB, coordinatore CASA, CNC-SBN, GSB-CRUI, OTS-GARR 24-26 giugno 2002 Bologna:


Interazioni biomolecolari che coinvolgono proteine

Interazioni biomolecolari che coinvolgono proteine B015921 - INTERAZIONI BIOMOLECOLARI: METODI IN SILICO ED IN VITRO Metodi spettroscopici per lo screening di interazioni Modulo B015922 - INTERATTOMICA: STRUTTURA, TERMODINAMICA E CINETICA Definizione di


Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E3101Q116) AA 2016/2017 I dati in Bioinformatica Docente del laboratorio: Raffaella Rizzi 1 Il DNA (oggetto biologico)


WORKSHOP. competenze, risorse e strumenti HPH. Traiettoria Rete HPH Emilia-Romagna

WORKSHOP. competenze, risorse e strumenti HPH. Traiettoria Rete HPH Emilia-Romagna WORKSHOP Modelli e strumenti per lo sviluppo del progetto HPH elaborati nel Laboratorio interreti HPH Traiettoria Rete HPH Emilia-Romagna Ricerca in promozione della salute: competenze, risorse e strumenti


Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema

Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed Fare clic per modificare lo stile del sottotitolo dello schema La Fondazione Neuromed è un organizzazione relativamente giovane, nata nel





Organi Cellule Molecole

Organi Cellule Molecole Organi Cellule Molecole Il presupposto tradizionale delle scienze bio-mediche consiste nel fatto che se si conoscono tutti gli elementi costitutivi fondamentali delle cellule (le molecole) si e' allora


Reti informatiche L O R E N Z O D I S I L V E S T R O

Reti informatiche L O R E N Z O D I S I L V E S T R O L O R E N Z O D I S I L V E S T R O w w w. d m i. u n i c t. i t / ~ d i s i l v e s t r o d i s i l v e s t r o @ d m i. u n i c t. i t Internet Internet è il nome con cui viene indicata una estesa rete


Facoltà di Farmacia e Medicina e Facoltà di Scienze Matematiche Fisiche e Naturali

Facoltà di Farmacia e Medicina e Facoltà di Scienze Matematiche Fisiche e Naturali Corso di laurea triennale in Biotecnologie Università di Roma LA Sapienza Facoltà di Farmacia e Medicina e Facoltà di Scienze Matematiche Fisiche e Naturali Presidente: Prof. Giuseppe Macino Vice Presidente:


II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance


Scuola di specializzazione in GENETICA MEDICA.

Scuola di specializzazione in GENETICA MEDICA. Scuola di specializzazione in GENETICA MEDICA. La Scuola di specializzazione in Genetica medica afferisce all Area Servizi clinici sotto area Servizi clinici diagnostici e terapeutici, Classe dei Servizi


Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico



ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor


Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%



IL SISTEMA INFORMATIVO AZIENDALE IL SISTEMA INFORMATIVO AZIENDALE CL. 5ATP - A.S. 2006/2007 L azienda e i suoi elementi PERSONE AZIENDA BENI ECONOMICI ORGANIZZAZIONE L azienda è un insieme di beni organizzati e coordinati dall imprenditore


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici


Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,


Trovare nelle risorse della Bibliotecaper Infermieristica

Trovare nelle risorse della Bibliotecaper Infermieristica Trovare nelle risorse della Bibliotecaper Infermieristica di Laura Colombo Seminario per il primo anno del corso di laurea in Infermieristica Sede di Monza Università degli studi di Milano-Bicocca Monza,


Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina


Revisioni sistematiche Metanalisi Linee guida Health Technology Assessment report

Revisioni sistematiche Metanalisi Linee guida Health Technology Assessment report LE PUBBLICAZIONI SECONDARIE Sono così definite perché i ricercatori prendono i dati da studi già pubblicati (o anche non pubblicati), ne riassumono ed analizzano i risultati combinati, traggono conclusioni


RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)





Spettrometria di Massa applicata alla PROTEOMICA

Spettrometria di Massa applicata alla PROTEOMICA Spettrometria di Massa applicata alla PROTEOMICA 1. MALDI-TOF: Determinazione di mappe peptidiche mediante digestione in gel di spot separati su E-2D E da estratti proteici totali Identificazione rapida



LA MAPPATURA DELLE INFORMAZIONI DEL SETTORE PUBBLICO LA MAPPATURA DELLE INFORMAZIONI DEL SETTORE PUBBLICO L informazione del settore pubblico La definizione di informazione detenuta dal settore pubblico varia nei diversi Stati. Non esiste, infatti, una terminologia


Telerilevamento e SIT Prof. Ing. Giuseppe Mussumeci

Telerilevamento e SIT Prof. Ing. Giuseppe Mussumeci Corso di Laurea Magistrale in Ingegneria per l Ambiente e il Territorio A.A. 2012-2013 Telerilevamento e SIT Prof. Ing. Giuseppe Mussumeci Introduzione ai GIS Le attività dell uomo...... hanno sempre un


Rappresentazione dei Dati Biologici

Rappresentazione dei Dati Biologici Rappresentazione dei Dati Biologici CORSO DI BIOINFORMATICA C.d.L. Ingegneria Informatica e Biomedica Outline Proteine ed Amminoacidi Rappresentazione di Amminoacidi Rappresentazione delle strutture Proteiche


Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi



RIAPERTURA TERMINI ELENCO PROPOSTE INSERIMENTI MEDIANTE TIROCINIO. (durata 12 mesi) Dipartimento di Architettura ALLEGATO 1 RIAPERTURA TERMINI ELENCO PROPOSTE INSERIMENTI MEDIANTE TIROCINIO (durata 12 mesi) CODICE SELEZIONE TIR02 Dipartimento di Architettura Profilo : Specialista con competenze di base utili per


Formati di scambio dati

Formati di scambio dati Formati di scambio dati Genbank È il genetic sequence DataBase del NIH (National Institute of Health) Contiene sequenze (primarie) annotate di nucleotidi e di proteine I files sono ragguppati in divisioni


Introduzione alle basi di dati (prima parte)

Introduzione alle basi di dati (prima parte) Introduzione alle basi di dati (prima parte) Università degli Studi di Salerno Corso di Laurea in Scienze della Comunicazione Informatica generale (matr. Dispari) Docente: Angela Peduto A.A. 2007/2008


Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:


Università degli Studi di Trieste Facoltà di Medicina e Chirurgia Facoltà di Scienze Matematiche, Fisiche e Naturali

Università degli Studi di Trieste Facoltà di Medicina e Chirurgia Facoltà di Scienze Matematiche, Fisiche e Naturali Università degli Studi di Trieste Facoltà di Medicina e Chirurgia Facoltà di Scienze Matematiche, Fisiche e Naturali Regolamento didattico del Corso di Laurea interclasse ed interfacoltà in Scienze e Tecnologie



UNIVERSITÀ DEGLI STUDI DI BARI UNIVERSITÀ DEGLI STUDI DI BARI Nota: per le modalità concorsuali si prega cortesemente di fare sempre riferimento al Bando di Concorso A. A. 2005-2006 Parte A Informazioni generali Proposta d istituzione


Trovare nelle risorse della Biblioteca- per Infermieristica

Trovare nelle risorse della Biblioteca- per Infermieristica Trovare nelle risorse della Biblioteca- per Infermieristica di Laura Colombo Seminario per il primo anno del corso di laurea in Infermieristica Sede di Sesto Università degli studi di Milano-Bicocca Monza,


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze





Indice. Introduzione alle metodologie biochimiche 1 (Martino Luigi Di Salvo, Roberto Contestabile)

Indice. Introduzione alle metodologie biochimiche 1 (Martino Luigi Di Salvo, Roberto Contestabile) VII Indice Prefazione XII Capitolo 1 Introduzione alle metodologie biochimiche 1 (Martino Luigi Di Salvo, Roberto Contestabile) 1.1 La Biochimica, una scienza sperimentale 1 1.2 Come si progetta, si esegue


Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo


Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione
