Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA"

Transcript

1 Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

2 Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l analisi di sequenze biologiche, genomi e per la predizione della funzione e della struttura di macromolecole.

3 Bioinformatica Nasce alla fine degli anni 70 con il concomitante sviluppo delle tecnologie del DNA ricombinante e quindi la pubblicazione delle prime sequenze di acidi nucleici Le tecnologie informatiche ed il loro relativo progresso, hanno facilitato l archiviazione di grandi quantità di dati e la diffusione delle informazioni attraverso le reti telematiche

4 Banche di dati biologici Gli anni recenti hanno visto una crescita esplosiva della quantità di dati biologici disponibili La conservazione e distribuzione di questi dati pone un problema critico per tutta la comunità scientifica Alcune istituzioni, spesso pubbliche, si sono fatte carico di questi compiti

5 Banche di dati biologici Esistono banche che raccolgono dati biologici di diversa natura 4Bibliografici (es: PubMed) 4Tassonomici 4Linee cellulari 4Virus 4etc. etc

6 Banche dati di macromolecole biologiche Banche di dati di sequenza e struttura di acidi nucleici e proteine L accesso a tali dati è di vitale importanza per la ricerca biologica sperimentale e teorica Forte richiesta da parte comunità scientifica di facili ed efficienti sistemi di interrogazione basati sia su parole chiave che su similitudine di sequenza Estrazione ed elaborazione dell informazione contenuta nella massa di dati

7 Banche dati di macromolecole biologiche La banche dati possono essere distinte in primarie, secondarie o specializzate Le banche dati primarie raccolgono i dati grezzi prodotti dai laboratori, li organizzano, li controllano e li distribuiscono

8 Banche dati di macromolecole biologiche Le banche dati secondarie invece riorganizzano e rielaborano l informazione contenuta nelle primarie secondo particolari criteri analitici Tra queste, le banche dati specializzate raccolgono solo l informazione relativa ad uno specifico settore, per esempio sequenze da lieviti, da anticorpi, proteasi, etc

9 Principali banche dati primarie Sequenze nucleotidiche: EMBL nucleotide sequence database GenBank DDBJ (DNA Data Bank of Japan) Sequenze e strutture proteiche: Protein Information Resource (NBRF) SWISS-PROT Protein Data Bank

10 EMBL nucleotide sequence database Istituita nel 1980 presso lo European Molecular Biology Laboratory di Heidelberg, ora presso lo European Molecular Biology Laboratory (Hinxton, GB) Lavora in stretta collaborazione con La GenBank e la DNA Data Bank of Japan

11 EMBL nucleotide sequence database 16 Mag 2008

12 EMBL nucleotide sequence database 16 Mag 2008

13 EMBL nucleotide sequence database 16 Mag 2008

14 EMBL nucleotide sequence database 16 Mag 2008

15 GenBank E distribuita dal National center for Biotechnological information, National Library of medicine, National Institute of Health (USA ) Contiene sequenze nucleotidiche e proteiche Annotazioni funzionali e bibliografiche Lavora in stretta collaborazione con EBI/EMBL e la DNA Data Bank of Japan

16 GenBank Il sito Web nell NCBI fornisce: 4 strumenti per l accesso e l interrogazione on-line delle banche dati, per esempio Entrez 4 e alcuni potenti strumenti software per la ricerca di somiglianza fra sequenze in diverse banche dati

17 GenBank 7 Mar 2006

18 DDBJ (DNA Data Bank of Japan) Istituita nel 1986 presso il National Institute of Genetics Lavora in stretta collaborazione con EBI/EMBL e la NCBI/GenBank

19 EMBL/GenBank/DDBJ Apr 2008

20 EMBL/GenBank/DDBJ Apr 2008

21 EMBL/GenBank/DDBJ INSDC International Nucleotide Sequence Database Collaboration In August 2005, the INSDC announced the DNA sequence database exceeded 100 gigabases. GenBank is proud of its contributions toward this milestone.

22 INSDC 3 Gen 2007

23 PIR (Protein Information Resource) Istituita nel 1984 dalla National Biomedical Research Foundation Collaborazione con Munich Information Center for Protein Sequences (MIPS) Collaborazione con Japan International Protein Information Database (JIPID) Mantiene la Protein Sequence Database (PSD) + altre banche dati derivate (PIRSF, NREF, etc.)

24 PIR (Protein Information Resource) Deriva dal lavoro pionieristico di M. Dayhoff con il suo Atlas of Protein Sequence and Structure ( ) Contiene circa sequenze di proteine Annotazioni + Referenze ad altre banche dati Classificazione in famiglie e superfamiglie Recentemente ha unito le forze con l EBI ed il SIB (Swiss Institute of Bioinformatics) per realizzare Uniprot, una risorsa centrale di sequenze e funzioni proteiche

25 SwissProt Creata nel 1987 presso il Dipartimento di Biochimica Medica dell Università di Ginevra Sviluppata congiuntamente allo European Bioinformatics Institute (EBI) e allo Swiss Institute of Bioinformatics (SIB).

26 SwissProt Elevata qualità e dettaglio delle annotazioni Ridondanza minima Elevata integrazione con altre banche dati Mantiene anche TrEMBL (contiene tutte le traduzioni delle sequenze nucleotidiche presenti in EMBL non ancora integrate in Swissprot) ed Uniprot

27 29 Apr 2008 SwissProt

28 29 Apr 2008 SwissProt/TrEMBL

29 The Protein Data Bank Contiene le coordinate spaziali di strutture di macromolecole biologiche E stata istituita nel 1971 presso i Brookhaven National Laboratories Dal 1998 è gestita dal Research Collaboratory for Structural Bioinformatics

30 The Protein Data Bank

31 Banche dati Secondarie: esempi Banca dati di famiglie proteiche e domini. Consiste di siti biologicamente significativi, pattern e profili, che aiutano a stabilire, in maniera efficace, se una nuova sequenza appartiene ad una data famiglia (29/04/ entries)-http://www.expasy.org/prosite/ EPD (Eukaryotic Promoter Database) è una collezione annotata, non ridondante di promotori eucariotici per la RNApol II, per i quali il sito d inizio della trascrizione è stato determinato sperimentalmente. Viene derivata dall EMBL Data Library, anche se rimane indipendente dalle descrizioni presenti nelle sequenze in EMBL (14/05/ entries)-http://www.epd.isb-sib.ch/

32 Banche dati Specializzate: esempi Banca dati per l informazione sulla genetica e la biologia molecolare della Drosophila. Include dati provenienti dai progetti di sequenziamento genomico e da letteratura Archivio delle strutture 3D, determinate sperimentalmente, delle proteasi e dei loro complessi con altre molecole, appartenenti ad HIV-1, HIV-2 e SIV (15/05/ entries).

33 Banca dati di malattie e disordini genetici. Nella sua prima edizione cartacea del 1966, all epoca ancora MIM, il numero di entries era limitato a 1487, per passare a circa 9000 alla dodicesima edizione del 1997 e nel Dicembre del Già dal 1999 si assiste ad una crescita esponenziale del database che in data 1 Ottobre 2001 conta entries, e recentemente (settembre 2004)

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica CL3 - Biotecnologie Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle

Dettagli

e-science Bioinformatics

e-science Bioinformatics Luciano Milanesi Luciano Milanesi Institute of Biomedical Technology CNR ABSTRACT. The Bioinformatics community was an early adopter of the Internet and contributed to the e-science development by publishing

Dettagli

Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

2D Gel Principles IEF SDS PAGE. Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma L elettroforesi bidimensionale separa le proteine in base alla loro carica (come nella IEF) e dimensioni

Dettagli

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006

Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Universita` di Verona Laura Specialistica in Biotecnologie Agro-Industriali Corso di Bioinformatica A.A. 2005-2006 Docente: Dr. Nicola Vitulo Dipartimento di Biologia, CRIBI Viale G.Colombo3, 35131 Padova

Dettagli

BIOINFORMATICA: Cosa è?

BIOINFORMATICA: Cosa è? BIOINFORMATICA: Cosa è? THE DEFINITIONS OF BIOINFORMATICS Bioinformatics is an integration of mathematical, statistical and computer methods to analyse biological, biochemical and biophysical data (Georgia

Dettagli

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma

Principi di proteomica. Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Principi di proteomica Elettroforesi bidimensionale e spettrometria di massa: determinazione del proteoma Proteoma: Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse

Dettagli

Basi di dati biologiche

Basi di dati biologiche Basi di dati biologiche Seminario per il corso di Basi di Dati II Luana Rinaldi luana.rinaldi@gmail.com AGENDA: Introduzione alla bioinformatica; Concetti Biologici; Banche dati biologiche; Collaborazioni

Dettagli

La ricerca bibliografica in ambito infermieristico

La ricerca bibliografica in ambito infermieristico La ricerca bibliografica in ambito infermieristico Per i tutor del corso di laurea in infermieristica A cura di Annalisa Bardelli, su materiale di Annalisa Maiorano Pubmed Pubmed: http: www.pubmed.gov

Dettagli

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma.

PROTEOMA. Si definisce proteoma il complemento. tempo- e cellulo- specifico del genoma. PROTEOMA Si definisce proteoma il complemento tempo- e cellulo- specifico del genoma. Proteome = Proteins encoded by the genome Il proteoma comprende tutte le proteine espresse nello stesso momento in

Dettagli

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche.

SRS (Sequence Retrieval System) della EBI che mette a disposizione anche dello spazio sul server per memorizzare le richerche. I due centri maggiori, EBI e NCBI hanno sviluppato sistemi dedicati di RETRIEVAL allo scopo di ottenere il massimo delle informazioni con il minimo sforzo da parte dell utente SRS (Sequence Retrieval System)

Dettagli

Progetto Cluster. Sottoprogetto Bioinformatica

Progetto Cluster. Sottoprogetto Bioinformatica Progetto Cluster Sottoprogetto Bioinformatica CRS4 (Centro di Ricerca, Sviluppo e Studi Superiori in Sardegna) Società costituita nel 1990 svolge attività di ricerca e sviluppo basate sulle tecnologie

Dettagli

Corso di Laurea in BIOTECNOLOGIE

Corso di Laurea in BIOTECNOLOGIE Dipartimento di Scienze Biomolecolari Struttura Didattica di Biotecnologie Corso di Laurea in BIOTECNOLOGIE E-mail biotecnologie@uniurb.it Sito web www.uniurb.it/biotecnologie/ Attività Didattica Informazioni

Dettagli

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE?

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? A Flusso di attività B - INPUT C Descrizione dell attività D RISULTATO E - SISTEMA PROFESSIONALE 0. RICHIESTA DI STUDIARE E/O INDIVIDUARE

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

BIOLOGA e BIOLOGO MOLECOLARE

BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...

Dettagli

F O R M A T O E U R O P E O

F O R M A T O E U R O P E O F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Indirizzo Telefono Fax E-mail CARRERA PAOLA Nazionalità Data di nascita Codice fiscale italiana CRR PLA 57T45

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization Università degli Studi di Genova Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica Anno Accademico 2009/2010 Tesi di Laurea Specialistica Elaborazione di dati

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine

Dettagli

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences Il DNA e la cellula Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia

Dettagli

Gestione dei dati in proteomica

Gestione dei dati in proteomica Gestione dei dati in proteomica PROTEINE E PROTEOMICA CLINICA 1.1 Le proteine: natura e funzioni Le proteine sono i prodotti della policondensazione di numerose molecole α-amminoacidi, legate le une alle

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

UNIVERSITÀ DEGLI STUDI DI BARI

UNIVERSITÀ DEGLI STUDI DI BARI UNIVERSITÀ DEGLI STUDI DI BARI Nota: per le modalità concorsuali si prega cortesemente di fare sempre riferimento al Bando di Concorso A. A. 2005-2006 Parte A Informazioni generali Proposta d istituzione

Dettagli

TO61: Applicazione di metodi della fisica teorica a sistemi biologici

TO61: Applicazione di metodi della fisica teorica a sistemi biologici TO61: Applicazione di metodi della fisica teorica a sistemi biologici Obiettivi: Offrire l opportunita ai vari gruppi che in questi ultimi anni, all interno dell INFN, hanno cominciato a lavorare al confine

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

Curriculum Vitae Piero Pignataro

Curriculum Vitae Piero Pignataro INFORMAZIONI PERSONALI Piero Pignataro Via G.Marconi, 39, Baronissi(SA) C.A.P. 84081 089-954317 340-1796552 piero.pignataro@gmail.com Sesso M Data di nascita 30/06/1987 Nazionalità Italiana POSIZIONE RICOPERTA

Dettagli

Percorsi di ricerca di prove di efficacia nella letteratura scientifica e grigia

Percorsi di ricerca di prove di efficacia nella letteratura scientifica e grigia Progetto Gli infortuni (mortali) sul lavoro: Efficacia degli interventi Seminario dell Altana Calenzano 5-6 Marzo 2007 Percorsi di ricerca di prove di efficacia nella letteratura scientifica e grigia Progetto

Dettagli

Laboratorio di Bioinformatica I. Parte 2. Dott. Sergio Marin Vargas (2014 / 2015)

Laboratorio di Bioinformatica I. Parte 2. Dott. Sergio Marin Vargas (2014 / 2015) Laboratorio di Bioinformatica I Banche dati Parte 2 Dott. Sergio Marin Vargas (2014 / 2015) Google Scholar https://scholar.google.it/ E un motore di ricerca di Google, specializzato nella ricerca di articoli

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

LT in Biotecnologie Agripolis, 24 marzo 2015

LT in Biotecnologie Agripolis, 24 marzo 2015 BIOTECNOLOGIE APPLICATE A CELLULE ANIMALI Colture cellulari e le loro applicazioni: isolamento di cellule in coltura. Tipi di colture. Parametri per la caratterizzazione e il monitoraggio di cellule in

Dettagli

WORKSHOP. competenze, risorse e strumenti HPH. Traiettoria Rete HPH Emilia-Romagna

WORKSHOP. competenze, risorse e strumenti HPH. Traiettoria Rete HPH Emilia-Romagna WORKSHOP Modelli e strumenti per lo sviluppo del progetto HPH elaborati nel Laboratorio interreti HPH Traiettoria Rete HPH Emilia-Romagna Ricerca in promozione della salute: competenze, risorse e strumenti

Dettagli

Basi di dati. Basi di dati = database. Basi di dati

Basi di dati. Basi di dati = database. Basi di dati Basi di dati Da leggere: Cap. 6 Sawyer, Williams (testo A) Basi di dati = database Sono una delle applicazioni informatiche che hanno avuto il maggiore utilizzo in uffici, aziende, servizi -> oggi anche

Dettagli

Formati di scambio dati

Formati di scambio dati Formati di scambio dati Genbank È il genetic sequence DataBase del NIH (National Institute of Health) Contiene sequenze (primarie) annotate di nucleotidi e di proteine I files sono ragguppati in divisioni

Dettagli

PER RIVISTO 18/03/05. Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)?

PER RIVISTO 18/03/05. Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)? FAQ SULLA ICDL PER EDITORI, AUTORI, ILLUSTRATORI ED ALTRI DETENTORI DI DIRITTI RIVISTO 18/03/05 Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)? Chi

Dettagli

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,

Dettagli

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Banche Dati Secondarie. geni trascritti proteine profili strutture

Banche Dati Secondarie. geni trascritti proteine profili strutture Banche Dati Secondarie geni trascritti proteine profili strutture definizione Banca dati il cui contenuto deriva da una banca dati primaria DB sec DB primario informazione PROSITE SWISS Prot patterns Profiles

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Corso di laurea magistrale in Scienze Biomolecolari e Biofunzionali

Corso di laurea magistrale in Scienze Biomolecolari e Biofunzionali Guida 200/08 della Classe 6/M - Biologia Facoltà: Scienze e Tecnologie Responsaile delle attività formative della Classe 6/M (ind. molecolare) Prof. Evandro Fioretti Tel. 040210 evandro.fioretti@unicam.it

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

DIDATTICA CON IL WEB Rassegna di siti utili per la didattica della biologia, chimica, scienze della Terra e dello spazio

DIDATTICA CON IL WEB Rassegna di siti utili per la didattica della biologia, chimica, scienze della Terra e dello spazio DIDATTICA CON IL WEB Rassegna di siti utili per la didattica della biologia, chimica, scienze della Terra e dello spazio di Giulia Realdon, BIOLOGIA 2can - The bioinformatics educational resource Biologia,

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

CORSO DI LAUREA IN BIOLOGIA MOLECOLARE

CORSO DI LAUREA IN BIOLOGIA MOLECOLARE UNIVERSITÀ DEGLI STUDI DI PARMA DIPARTIMENTO DI BIOSCIENZE CORSO DI LAUREA IN BIOLOGIA MOLECOLARE LAUREA MAGISTRALE CLASSE LM-6 BIOLOGIA ANNO ACCADEMICO 2015-2016 OBIETTIVI FORMATIVI Obiettivi formativi

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale

26. Bioinformatica. contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale 26. Bioinformatica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Lo sviluppo delle Biotecnologie ha consentito di elevare

Dettagli

UNIVERSITÀ DEGLI STUDI DI PAVIA Servizio Qualità della Didattica e Servizi agli Studenti

UNIVERSITÀ DEGLI STUDI DI PAVIA Servizio Qualità della Didattica e Servizi agli Studenti All. B al bando di ammissione pubblicato in data 16/11/2015 ART. 1 - TIPOLOGIA L Università degli Studi di Pavia attiva, per l a.a. 2015/2016, il Master Universitario di II livello in Genetica Oncologica,

Dettagli

Indice. Introduzione alle metodologie biochimiche 1 (Martino Luigi Di Salvo, Roberto Contestabile)

Indice. Introduzione alle metodologie biochimiche 1 (Martino Luigi Di Salvo, Roberto Contestabile) VII Indice Prefazione XII Capitolo 1 Introduzione alle metodologie biochimiche 1 (Martino Luigi Di Salvo, Roberto Contestabile) 1.1 La Biochimica, una scienza sperimentale 1 1.2 Come si progetta, si esegue

Dettagli

Reti informatiche L O R E N Z O D I S I L V E S T R O

Reti informatiche L O R E N Z O D I S I L V E S T R O L O R E N Z O D I S I L V E S T R O w w w. d m i. u n i c t. i t / ~ d i s i l v e s t r o d i s i l v e s t r o @ d m i. u n i c t. i t Internet Internet è il nome con cui viene indicata una estesa rete

Dettagli

Genomica, proteomica, genomica strutturale, banche dati.

Genomica, proteomica, genomica strutturale, banche dati. Genomica, proteomica, genomica strutturale, banche dati. Alcune pietre miliari della biologia anno risultato 1866 Mendel scopre i geni 1944 il DNA è il materiale genetico 1951 prima sequenza di una proteina

Dettagli

RELAZIONE E PROGRAMMA FINALE DI BIOCHIMICA e BIOLOGIA MOLECOLARE

RELAZIONE E PROGRAMMA FINALE DI BIOCHIMICA e BIOLOGIA MOLECOLARE Allegato A Istituto paritario di Istruzione Secondaria Superiore Ivo de Carneri Civezzano Indirizzo I.T.A.S. indirizzo Biologico RELAZIONE E PROGRAMMA FINALE DI BIOCHIMICA e BIOLOGIA MOLECOLARE A.S. 2012/2013

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze Curriculum Vitae SARA GRAZIANO Informazioni personali Cognome Nome Indirizzo Telefono E-mail Cittadinanza Data di nascita Sesso Settore professionale Graziano Sara sara.graziano1985@libero.it Italiana

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

COMITATO NAZIONALE PER LA BIOSICUREZZA E LE BIOTECNOLOGIE. Gruppo di lavoro Bioinformatica

COMITATO NAZIONALE PER LA BIOSICUREZZA E LE BIOTECNOLOGIE. Gruppo di lavoro Bioinformatica COMITATO NAZIONALE PER LA BIOSICUREZZA E LE BIOTECNOLOGIE Gruppo di lavoro Bioinformatica Linee guida per la definizione di una strategia per lo sviluppo del settore della bioinformatica in Italia con

Dettagli

Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema

Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed Fare clic per modificare lo stile del sottotitolo dello schema La Fondazione Neuromed è un organizzazione relativamente giovane, nata nel

Dettagli

BIOTECNOLOGIE UNIVERSITA DI UDINE. CORSO DI STUDIO in

BIOTECNOLOGIE UNIVERSITA DI UDINE. CORSO DI STUDIO in UNIVERSITA DI UDINE 1. DIPARTIMENTO DI CHIMICA, FISICA E AMBIENTE 2. DIPARTIMENTO DI SCIENZE DEGLI ALIMENTI 3. DIPARTIMENTO DI SCIENZE AGRARIE ED AMBIENTALI 4. DIPARTIMENTO DI MATEMATICA ED INFORMATICA

Dettagli

MANIFESTO DEGLI STUDI A.A. 2013/2014 CORSO DI LAUREA MAGISTRALE IN BIOLOGIA CELLULARE E MOLECOLARE Classe LM-6 FACOLTA SCIENZE MM.FF.NN.

MANIFESTO DEGLI STUDI A.A. 2013/2014 CORSO DI LAUREA MAGISTRALE IN BIOLOGIA CELLULARE E MOLECOLARE Classe LM-6 FACOLTA SCIENZE MM.FF.NN. MANIFESTO DEGLI STUDI A.A. 2013/2014 CORSO DI LAUREA MAGISTRALE IN BIOLOGIA CELLULARE E MOLECOLARE Classe LM- FACOLTA SCIENZE MM.FF.NN. 1.ASPETTI GENERALI Il Corso di Laurea Magistrale in Biologia Cellulare

Dettagli

Rappresentazione dei Dati Biologici

Rappresentazione dei Dati Biologici Rappresentazione dei Dati Biologici CORSO DI BIOINFORMATICA C.d.L. Ingegneria Informatica e Biomedica Outline Proteine ed Amminoacidi Rappresentazione di Amminoacidi Rappresentazione delle strutture Proteiche

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

MASTER IN BIOTECNOLOGIE AVANZATE PER DIAGNOSI E TERAPIA MOLECOLARE

MASTER IN BIOTECNOLOGIE AVANZATE PER DIAGNOSI E TERAPIA MOLECOLARE UNIONE EUROPEA Fondo sociale europeo ab MINISTERO DELL ISTRUZIONE DELL UNIVERSITA E DELLA RICERCA BIOTECNOLOGIE AVANZATE LISTENING TO BIOMOLECULES TO SILENCE DISEASE UNIVERSITÀ DEGLI STUDI DI NAPOLI FEDERICO

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Finanziato dalla Unione Europea. Contratto No. FP6-RII3-026155

Finanziato dalla Unione Europea. Contratto No. FP6-RII3-026155 Finanziato dalla Unione Europea Contratto No. FP6-RII3-026155 Visione d insieme della struttura di FP6 2 Finanziato dalla Unione Europea EUPRIM-NET European Primate Network: Infrastrutture Specializzate

Dettagli

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA INDICE pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA 1.1. Il concetto d identificazione... 9 1.2. L identificazione nella storia....

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico

Abbreviazioni Denominazione Presidi: Ospedale SS. Trinità Ospedale Businco Ospedale Binaghi Ospedale Microcitemico ALLEGATO 1 DESCRIZIONE DELLA FORNITURA PROCEDURA APERTA PER LA FORNITURA IN PIU LOTTI, IN MODALITA SERVICE, DI SISTEMI ANALITICI DI BIOLOGIA MOLECOLARE PER I LABORATORI ANALISI DELL AZIENDA ASL N. 8 DI

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Biobanche e Centri di Risorse Biologiche per la Salute umana e degli animali

Biobanche e Centri di Risorse Biologiche per la Salute umana e degli animali Associazione Giuseppe Dossetti Biobanche e Centri di Risorse Biologiche per la Salute umana e degli animali Roma, 21 Marzo 2013 Leonardo Santi Presidente Comitato Scientifico CNRB Presidente Onorario Comitato

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

Facoltà di Farmacia e Medicina e Facoltà di Scienze Matematiche Fisiche e Naturali

Facoltà di Farmacia e Medicina e Facoltà di Scienze Matematiche Fisiche e Naturali Corso di laurea triennale in Biotecnologie Università di Roma LA Sapienza Facoltà di Farmacia e Medicina e Facoltà di Scienze Matematiche Fisiche e Naturali Presidente: Prof. Giuseppe Macino Vice Presidente:

Dettagli

CLASSE I classico A e B

CLASSE I classico A e B LICEO SCIENTIFICO "A. APROSIO" VENTIMIGLIA CLASSE I classico A e B Anno scolastico 2011-2012 UNITA' DIDATTICA N 1 METODI ED ORGANIZZAZIONE DEI CONCETTI IN BIOLOGIA 1.1 LE CARATTERISTICHE COMUNI A TUTTI

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

PROGRAMMA DI BIOLOGIA. CLASSE 2^ F a. s. 2014 2015. Prof.ssa RUBINO ALESSANDRA

PROGRAMMA DI BIOLOGIA. CLASSE 2^ F a. s. 2014 2015. Prof.ssa RUBINO ALESSANDRA ISTITUTO TECNICO INDUSTRIALE DI STATO "ENRICO FERMI" Via Luosi n. 23-41124 Modena Tel. 059211092 059236398 - (Fax): 059226478 E-mail: info@fermi.mo.it Pagina web: www.fermi.mo.it PROGRAMMA DI BIOLOGIA

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Il Centro Biblioteche e Documentazione (CBD)

Il Centro Biblioteche e Documentazione (CBD) Il Centro Biblioteche e Documentazione (CBD) E stato istituito con delibera del C.d.A. dell'università degli Studi di Catania nella seduta del 31/07/1992. E l organismo di Coordinamento Tecnico delle Biblioteche

Dettagli

Corso di Laurea Magistrale in BIOTECNOLOGIE MEDICHE Classe delle lauree magistrali in biotecnologie mediche, veterinarie e farmaceutiche (LM-9)

Corso di Laurea Magistrale in BIOTECNOLOGIE MEDICHE Classe delle lauree magistrali in biotecnologie mediche, veterinarie e farmaceutiche (LM-9) La presente scheda di approfondimento si riferisce ai corsi a immatricolazione nell a. a. 00-0. Per ulteriori informazioni si rimanda all Ufficio di Presidenza di Facoltà. Corso di Laurea Magistrale in

Dettagli

Crediti formativi 26 Partecipanti 50

Crediti formativi 26 Partecipanti 50 Corso di aggiornamento PROVIDER NAZIONALE 301 DIAGNOSTICA GENETICA ATTUALITA E PROSPETTIVE IL LABORATORIO DELLA GENETICA FORENSE 2015 Coordinamento scientifico Prof. Maurizio Margaglione Crediti formativi

Dettagli

CONVENZIONE PER L ATTIVAZIONE E IL FUNZIONAMENTO DEL MASTER UNIVERSITARIO DI II LIVELLO IN BIOINFORMATICA Sede C.R.F.P.

CONVENZIONE PER L ATTIVAZIONE E IL FUNZIONAMENTO DEL MASTER UNIVERSITARIO DI II LIVELLO IN BIOINFORMATICA Sede C.R.F.P. CONVENZIONE PER L ATTIVAZIONE E IL FUNZIONAMENTO DEL MASTER UNIVERSITARIO DI II LIVELLO IN BIOINFORMATICA Sede C.R.F.P. di CAGLIARI ANNO ACCADEMICO 2011/2012 TRA La Regione Autonoma della Sardegna Assessorato

Dettagli

Corso di INFORMATICA (2 CFU - 20 ore)

Corso di INFORMATICA (2 CFU - 20 ore) Corso di INFORMATICA (2 CFU - 20 ore) Dipartimenti di Area Medica - Università di Foggia Corso di Laurea in Tecniche Sanitarie di Radiologia Medica I anno - I semestre a.a. 2014/2015 Prof. Crescenzio Gallo

Dettagli

Trovare nelle risorse della Bibliotecaper Infermieristica

Trovare nelle risorse della Bibliotecaper Infermieristica Trovare nelle risorse della Bibliotecaper Infermieristica di Laura Colombo Seminario per il primo anno del corso di laurea in Infermieristica Sede di Monza Università degli studi di Milano-Bicocca Monza,

Dettagli

INFORMAZIONI PERSONALI VALERIA LAPAGLIA C U R R I C U L U M V I T A E. Nome Indirizzo Telefono Fax E-mail. Luogo e Data di nascita

INFORMAZIONI PERSONALI VALERIA LAPAGLIA C U R R I C U L U M V I T A E. Nome Indirizzo Telefono Fax E-mail. Luogo e Data di nascita C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Indirizzo Telefono Fax E-mail VALERIA LAPAGLIA Nazionalità Italiana Luogo e Data di nascita Pagina 1 - Curriculum vitae di ESPERIENZA LAVORATIVA

Dettagli

RIAPERTURA TERMINI ELENCO PROPOSTE INSERIMENTI MEDIANTE TIROCINIO. (durata 12 mesi) Dipartimento di Architettura

RIAPERTURA TERMINI ELENCO PROPOSTE INSERIMENTI MEDIANTE TIROCINIO. (durata 12 mesi) Dipartimento di Architettura ALLEGATO 1 RIAPERTURA TERMINI ELENCO PROPOSTE INSERIMENTI MEDIANTE TIROCINIO (durata 12 mesi) CODICE SELEZIONE TIR02 Dipartimento di Architettura Profilo : Specialista con competenze di base utili per

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli