Determinare la sequenza del DNA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Determinare la sequenza del DNA"

Transcript

1 Corso di Laurea in Chimica e Tecnologie Farmaceu9che a.a Università di Catania Determinare la sequenza del DNA Sequenziamento Sanger, NGS e Bioinforma9ca Stefano Forte

2 Sequenziare significa determinare la successione dei monomeri che costituiscono un polimero biologico PROTEINE (sequenza di Aminoacidi) DNA (sequenza di nucleotidi) DNA Genomico cdna Sequenziamento

3 Principi del sequenziamento del DNA Molte tecniche di biologia molecolare si basano sulla possibilità di replicare molecole di DNA in vitro: - Molecola stampo - Nucleotidi trifosfato - DNA polimerasi - Primers - Appropriato buffer di reazione

4 Metodo di Sanger

5 Metodo di Sanger

6 Sequenziamento automatico Stesso principio del metodo di Sanger Il primer o i ddntp sono marcati con un marcatore fuorescente Lettura tramite laser della molecola appena questa esce dal gel Utilizzo di una sola corsia Se si marca il primer? Se si marcano i ddntp Gel di poliacrillamide o capillare Dato di sequenza acquisito automaticamente e trasferito al computer

7 Interpretazione automatica del dato elettroferogramma

8 Allungare la sequenza Con i metodi automatici è possibile ottenere sequenze oltre il migliaio di basi Con l allungamento della sequenza diminuisce la risoluzione e l intensità del segnale Aumento probabilità che una struttura secondaria termini la sintesi L affidabilità diminuisce allontanandosi dal primer

9 Walking

10 Sequenziamento shotgun Per sequenziare un frammento lungo la migliore stratgia è quella di dividerlo in framenti più piccoli. Il DNA può essere frammentato e clonato in una librerie M13 o in plasmidi. La libreria deve contenere frammenti parzialmente sovrapposti Dalla libreria si prelevano cloni a caso e si sequenziano

11 Sequenziamento shotgun

12 Diminuzione della produttività Una accurata determinazione del 90% della sequenza può essere ottenuta molto rapidamente Per ottenere un ulteriore 9% sarà necessario un tempo paragonabile a quello utilizzato per ottenere il 90% Una quantità simile di lavoro sarà necessaria per ottenere un ulteriore 0,9%

13 Le piahaforme di NGS Tra le piahaforme disponibili descriviamo: Tecnologia 454 (pirosequenziamento) PiaHaforma Solexa/Illumina PiaHaforma Ion Torrent Sistema SOLid

14 Il pirosequenziamento Il pirosequenziamento si basa sulla possibilità di rilevare la luminescenza emessa dalla luciferasi che viene attivata (per produzione di ATP) da una reazione accoppiata alla sintesi del DNA. - Il primer si lega allo stampo e viene incubato con: DNA polimerasi, ATP solforilasi, luciferasi e luciferina, apirasi, dntp, adenosin 5 fosfosolfato (APS) -nucleotidi trifosfato complementare alla prima base dello stampo viene incorporato dalla polimerasi. Viene rilasciato pirofosfato (PPi) -In presenza di APS, la solforilasi converte stechiometricamente il PPi ad ATP. La luciferasi utilizza l'atp per produrre (tramite la conversione della luciferina ad ossiluciferina) luce.

15 Il pirosequenziamento Il pirosequenziamento può essere automatizzato grazie all utilizzo di una tecnologia con micropozzetti. Un pozzetto ha il volume inferiore a 100 pl In un vetrino 6x6 cm possono essere contenuti più di un milione di pozzetti. Il pirosequenziamento può determinare sequenze più corte rispetto al metodo di Sanger ma è possibile parallelizzare il processo per ottenere globalmente sequenze molto più lunghe

16 PiaHaforma illumina - Produzione di frammen9 con protrusione di A - Ligazione di adahatori - Ligazione sulla superficie di una cella a flusso - Amplificazione a ponte - Denaturazione e generazione di cluster clonali - Aggiunta dei 4 nucleo9di con fluoroforo e gruppo bloccante - Lavaggio - Rilevazione della fluorescenza - Sbloccaggio

17 Ion Torrent

18 Sistema SOLid

19

20 Confronto fra Biosequenze I polimeri biologici a più alto ocntenuto di informazione sono gli acidi nucleici e le proteine. Le unità informa9ve di base sono rispexvamente le 4 basi azotate ed i 20 aminocidi. Perché è possibile confrontare biosequenze? Quali sono gli obie9vi di un confronto di sequenze? Filogenesi molecolare; Evoluzione dei singoli genomi (confronto tra banche da9); CaraHerizzazione di proteine con funzione sconosciuta (ed iden9ficazione di domini funzionali). Possibilità di iden9ficare mutazioni responsabili di un feno9po

21 Confronto fra biosequenze (2) La filogenesi classica è basata sull osservazione di caraheris9che morfologiche e fisologiche. La filogenesi molecolare è basata sulla tendenza a divergere che hanno sequenze nucleo9diche o aminoacidiche originatesi da un progenitore comune. Consente di costruire alberi filogene9ci che illustrino le distanze ed i rappor9 evolu9vi tra le molecole analizzate.

22 Similarità e Omologia Similarità: somiglianza nella composizione di due sequenze biologiche Omologia: relazione filogene9ca tra due sequenze. Spesso 2 sequenze omologhe hanno un elevato grado di omologia, ma possono divergere per mutazione ed evoluzione: possono restare omologhe anche se non troppo simili. Le regioni che tendono a restare simili sono quelle più importan9 per l axvità della proteina

23 Allineamento di sequenze Per poter procedere al confronto tra sequenze nucleo9diche o tra sequenze proteiche è necessario che queste sequenze vengano allineate. Questo è un esempio di allineamento mul9plo di 5 brevi sequenze aminoacidiche.

24 Allineamento di stringhe Cominciamo con l affrontare il problema più generale dell allineamento di una coppia di stringhe. Date due stringhe acbcdb e cadbd, in che modo possiamo stabilire quanto sono simili? La similarità scaturisce dall allineamento oxmale delle due stringhe. Ecco un possibile allineamento: a c - - b c d b - c a d b - d - Il carahere speciale - rappresenta l inserimento di uno spazio, che sta a significare una cancellazione nella sequenza o, equivalentemente, un inserzione nell altra sequenza (Operazioni di INDEL).

25 Similarità e distanza a c - c b c d b - c a d b - d - Per valutare il grado di correlazione tra stringhe possiamo calcolare la similarità o la distanza. Alta similarità - > bassa distanza, Bassa similarità - > elevata distanza.

26 Distanza di Edi9ng E possibile calcolare la distanza tra due stringhe u9lizzando, per esempio, la distanza di edi9ng. La distanza di edi9ng è definita come il minimo numero di operazioni da eseguire (inserimen9, cancellazioni, sos9tuzioni) per trasformare una stringa in un altra. a - c c t g a a g c t t - a In questo caso per trasformare la prima stringa nella seconda dobbiamo inserire una g, sos9tuire una c con una t e cancellare una g. La distanza di edi9ng tra le due stringhe è dunque 3.

27 La scoring func9on: similarità a c - c b c d b a c a d b - d - n In generale è possibile valutare il grado di similarità o la distanza tra due stringhe, assegnando un punteggio (score) all allineamento u9lizzando un opportuna scoring func6on. n Per esempio, se assegniamo un punteggio di +2 per ogni match esaho e un punteggio di - 1 per ogni mismatch o indel, la similarità tra le due sequenze secondo l allineamento considerato sarà: S = ( 1) = 4

28 La scoring func9on: distanza a c - c b c d b a c a d b - d - Se assegniamo uno score pari a 0 nel caso di matches, pari ad 1 in caso di sos9tuzione di caraheri e pari a 2 in caso di allineamento con uno spazio, la distanza tra le due stringhe preceden9 secondo l allineamento considerato è: d = = 7

29 Matrici di Sos9tuzione Un par9colare allinemento è casulae o biologicamnete significa9vo? E possibile quen9ficare la sua significa9vità biologica? Abbiamo visto che la scoring func9on associa un valore numerico ad ogni coppia di caraheri. Le matrici di sos9tuzione associano un valore numerico ad ogni possibile coppia di aminoacidi, tenendo conto delle similarità chimiche tra di essi. Tali matrici possono quindi essere u9lizzate come scoring func9ons per l allineamento di proteine.

30 Similarità chimica tra aminoacidi

31 Matrici PAM Le matrici PAM (Percent Accepted Muta9ons) furono sviluppate esaminando le mutazioni all interno di superfamiglie di sequenze aminoacidiche strehamente correlate tra loro. Si notò che le sos9tuzioni che occorrevano tra sequenze strehamente correlate non erano casuali. Si concluse che alcune sos9tuzioni di aminoacidi occorrono più facilmente di altre, probabilmente a causa del faho che tali sos9tuzioni non alterano significa9vamente la struhura e la funzione di una proteina. Ciò significa che proteine omologhe non devono necessariamente avere gli stessi aminoacidi in ogni posizione.

32 Unità e matrici PAM Usiamo le unità PAM per misurare la distanza tra sequenze aminoacidiche. Due sequenze S1 ed S2 distano 1 unità PAM se S1 può essere trasformata in S2 con una media di 1 mutazione puntuale ogni 100 aminoacidi. In una sequenza la stessa posizione può mutare più volte e tornare quindi al carahere originario; dunque due sequenze che distano 1 PAM possono differire di meno dell 1%.

33 Matrici PAM Esistono diversi 9pi di matrici PAM. Ognuna di esse è u9lizzata per confrontare due sequenze che distano un certo numero di unità PAM l una dall altra. Ad es. la PAM120 può essere u9lizzata per confrontare sequenze che distano 120 unità PAM. La entry (i,j) della matrice PAM120 con9ene lo score assegnato alla coppia di aminoacidi (Ai,Aj); tale score è proporzionale alla frequenza con cui ci si aspeha che Ai sos9tuisca Aj in due sequenze che distano 120 unità PAM.

34 A 2 R -2 6 N D Matrice PAM 120 C Q E G H I L K M F P S T W Y V A R N D C Q E G H I L K M F P S T W Y V

35 Matrici BLOSUM Le matrici BLOSUM sono matrici di sos9tuzione di aminoacidi simili alle PAM. Mentre la matrici PAM si basano su allineamen9 globali tra sequenze, le BLOSUM si basano su allineamen9 di blocchi di segmen9 di sequenze strehamente correlate. I segmen9 appartenen9 a ciascun blocco vengono suddivisi in clusters in base alla percentuale di similarità. Ogni cluster sarà considerato come un unica sequenza. Ad es. nella costruzione della matrice BLOSUM62 ogni cluster sarà cos9tuito da sequenze che hanno iden9tà superiore al 62%. Anche in questo caso la entry (i,j) della matrice è proporzionale alla frequenza di sos9tuzione dell aminoacido Ai con l aminoacido Aj.

36 Gaps Abbiamo visto che due sequenze biologiche possono differire tra loro non solo per sos9tuzione di un residuo con un altro ma anche per inserzione o delezione di residui. E quindi spesso necessario introdurre degli spazi - in una o in entrambe le sequenze da allineare, anche al fine di portare le sequenze alla stessa lunghezza. Una sequenza di spazi con9gui si definisce gap. Ovviamente è necessario determinare un criterio per l inserimento di tali gap. L inserimento di un gap abbassa lo score dell allineamento; in questo modo, essendo il nostro scopo quello di massimizzare lo score dell allineamento, verranno inseri9 gaps solo quando ciò è strehamente necessario.

37 Gap Penal9es La maggior parte degli algoritmi di allineamento usano delle gap penal6es diverse per l apertura di un nuovo gap e per l estensione di un gap già esistente. Il GOP (Gap Opening Penalty) è la penalità da pagare ogni qual volta viene inserito un gap. Il GEP (Gap Extension Penalty) è la penalità da pagare ogni qual volta viene esteso un gap già esistente. Solitamente GOP>GEP, cioè aprire un nuovo gap è più costoso che estenderne uno esistente; in questo modo si tende ad avere inserzioni e delezioni di parecchi residui per volta piuhosto che inserzioni o delezioni sparse.

38 Gap Penal9es Esempio di apertura di un gap: a c t c a a t c a t c a - t c a t c Esempio di estensione di un gap già esistente: a c t c a a - - t t c c a a t t c

39 Algoritmi per il l allineamento Pairwise Come trovare l allinemento oxmale? Il metodo più ovvio per determinare l allineamento oxmale tra due sequenze consiste nel costruire tux i possibili allineamen9 e valutare quello con lo score più alto: APPROCCIO IMPRATICABILE Allineare sequenze di appena 20 caraheri (lunghezza inusuale per una biosequenza, che solitamente è formata da un numero molto maggiore di caraheri) richiederebbe un tempo sicuramente inaccehabile.

40 Allineamento mediante Programmazione Dinamica Date due stringhe S e T, con S =n e T =m, il nostro obiexvo è il calcolo dell allineamento oxmale di S e T. Gli algoritmi di programmazione dinamica vengono u9lizza9 nella risoluzione di problemi di oxmizzazione; nel nostro caso ci interessa massimizzare lo score dell allineamento. Un algoritmo di programmazione dinamica trova la soluzione migliore spezzando il problema originale in sohoproblemi più semplici da risolvere. La soluzione di ogni sohoproblema si basa sulle soluzioni dei sohoproblemi già risol9.

41 Allineamento globale e locale L algoritmo di allineamento che abbiamo considerato, produce l allineamento globale di due sequenze, ovvero allinea due sequenze su tuha la loro lunghezza. Una variante dell algoritmo di Needleman- Wunsch consente di eseguire l allineamento locale di due sequenze; Questo è u9le quando abbiamo a che fare con sequenze che non presentano un alta similarità su tuha la loro lunghezza ma che contengono comunque regioni ad alta similarità (Vedi BLAST). L algoritmo di local alignment res9tuisce gli n allineamen9 di sohosequenze di S e T di massimo score.

42 Allineamento Mul9plo Fino ad ora abbiamo visto come produrre allineamen9 di coppie di sequenze. Gli algoritmi vis9 hanno complessità quadra9ca (nella lunghezza delle sequenze) in tempo e spazio. La variante di Myers- Miller consente di produrre allineamen9 di coppie di sequenze in tempo quadra9co e spazio lineare. Il problema dell allineamento di n sequenze non è risolubile in tempo polinomiale. Occorre quindi ricorrere ad euris9che ed approssimazioni.

43 Allineamento Progressivo Il metodo più comune per eseguire un allineamento mul9plo è il cosiddeho allineamento progressivo, basato sulla costruzione di una successione di allineamen9 a coppie. Dato un insieme S cos9tuito da n sequenze da allineare, si scelgono due sequenze s1 ed s2 e si allineano; questo allineamento rimane fissato nei passi successivi. Si sceglie quindi una terza sequenza s3 e si allinea al precedente allineamento, e così via. Questo è un approccio euris9co e non garan9sce di trovare l allineamento mul9plo oxmale; tuhavia è efficiente e nella pra9ca dà dei risulta9 ragionevoli.

44 Allineamento Progressivo (2) L euris9ca più importante u9lizzata negli algoritmi di allineamento progressivo prevede che le coppie che presentano un maggior grado di similarità siano allineate per prime. Ciò è gius9ficato dal faho che coppie di sequenze maggiormente somiglian9 hanno maggiore probabilità di essere derivate più recentemente da un antenato comune e quindi il loro allineamento fornisce l informazione più affidabile che è possibile ricavare dalle sequenze. Inoltre le posizioni dei gaps in sequenze maggiormente correlate sono 9picamente più accurate rispeho a quelle rela9ve a sequenze meno simili, per cui i gaps degli allineamen9 iniziali vanno preserva9 durante l allineamento progressivo.

45 ClustalW ClustalW è il tool più popolare per l allineamento mul9plo di biosequenze. Dato un insieme S di n sequenze da allineare, ClustalW allinea tuhe le coppie di sequenze di S separatamente e costruisce una matrice con le distanze tra ogni coppia di sequenze. Seq. A Seq. B Seq. C Seq. D Seq. A 0.00 Seq. B Seq. C Seq. D

46 ClustalW: Albero filogene9co n n Viene quindi costruito un albero guida filogene9co u9lizzando il metodo neighbour- joining. Si sceglie la coppia più vicina: questa andrà a formare il primo sohoalbero: Seq. A Seq. B Seq. C Seq. D Seq. A 0.00 Seq. B Seq. C Seq. D A AB B

47 ClustalW: Albero filogene9co (2) Sostituiamo nella tabella la entry AB alle singole entry A e B e calcoliamo le distanze di AB dalle sequenze rimanenti facendo una semplice media aritmetica: Impossibile visualizzare l'immagine. La memoria del computer potrebbe essere insufficiente per aprire l'immagine oppure l'immagine potrebbe essere danneggiata. Riavviare il computer e aprire di nuovo il file. Se viene visualizzata di nuovo la x rossa, potrebbe essere necessario eliminare l'immagine e inserirla di nuovo. Impossibile visualizzare l'immagine. La memoria del computer potrebbe essere insufficiente per aprire l'immagine oppure l'immagine potrebbe essere danneggiata. Riavviare il computer e aprire di nuovo il file. Se viene visualizzata di nuovo la x rossa, potrebbe essere necessario eliminare l'immagine e inserirla di nuovo. Seq. AB Seq. C Seq. D Seq. AB 0.00 Seq. C 0.375? 0.00 Seq. D 0.175? D( AB, D) = D( A, D) + D( B, D) = = D( AB, C) = D( A, C) + D( B, C) = = Iterando il procedimento si ottiene l albero completo.

48 ClustalW: Albero filogene9co (3) OHerremo un albero i cui rami hanno lunghezza proporzionale alla distanza tra le sequenze : Quest albero verrà u9lizzato per guidare l allineamento progressivo. Nel nostro esempio verranno allineate per prime le sequenze A e B. Successivamente verrà allineata la sequenza D all allineamento AB e infine verrà allineata la sequenza C all allineamento ABD. A B D C

49 Albero filogene9co: un esempio L albero filogene9co in figura è costruito mediante ClustalW a par9re dalle sequenze della proteina mnsod su diversi organismi: il clustering ohenuto rispecchia in maniera abbastanza fedele quella che è la filogenesi classica (cioè basata su da9 geopaleontologici).

50 Allineamento con ClustalW n n n La presenza di un simbolo * in fondo ad una colonna indica un match del 100%. Il simbolo : indica un alta similarità (>75%). Il simbolo. indica una media similarità (50%- 75%). Nell allineamento di sequenze nucleo9diche è possibile trovare solo simboli * nel caso di iden9tà della colonna al 100%.

51 ClustalW: Server on line Il server ufficiale di ClustalW si trova sul sito dell EMBL: hhp://www.ebi.ac.uk/clustalw/index.html Vi sono comunque mol9 altri server di ClustalW; uno dei più popolari è quello dello Swiss Ins9tute of Bioinforma9cs: hhp://www.ch.embnet.org/sosware/clustalw.html Questa versione di ClustalW ha un interfaccia semplificata rispeho a quella ufficiale su EMBL.

52 ClustalW: uso locale E anche possibile scaricare la versione locale di ClustalW per ambien9 Windows (DOS) e Linux: sp://sp.ebi.ac.uk/pub/sosware/dos/clustalw/ sp://sp.ebi.ac.uk/pub/sosware/unix/clustalw/ sp://sp- igbmc.u- strasbg.fr/pub/clustalw/ hhp://www.biolinux.org/clustalw.html

53 Blast2Seq Blast2Seq è un tool della famiglia BLAST che permehe di eseguire l allineamento di una coppia di sequenze u9lizzando l algoritmo di allineamento locale di BLAST. E importante soholineare la differenza tra questo 9po di approccio e quello mostrato nelle slides preceden9: L allineamento Pairwise Globale di coppie di sequenze mehe in luce l eventuale similarità globale tra le due sequenze. L allineamento Pairwise effehuato da Blast2Seq mehe in luce le eventuali similarità locali tra le due sequenze. Due sequenze possono anche essere molto diverse nella loro interezza ma avere comunque delle regioni molto simili: a par9re da tale similarità è spesso possibile formulare interessan9 ipotesi sulla presenza di determina9 mo9vi e quindi sulla funzione delle molecole analizzate.

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare Facoltà di Ingegneria dell Informazione Laurea Specialistica e Magistrale in Ingegneria Informatica Facoltà di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

3. Confronto tra due sequenze

3. Confronto tra due sequenze 3. Confronto tra due sequenze Esercizio 1: uso di DotLet Il programma DotLet è accessibile dal sito http://myhits.isb-sib.ch/cgi-bin/dotlet, dove può essere utilizzato attraverso un interfaccia utente

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Il sequenziamento del DNA

Il sequenziamento del DNA Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Riconoscimento e recupero dell informazione per bioinformatica

Riconoscimento e recupero dell informazione per bioinformatica Riconoscimento e recupero dell informazione per bioinformatica Clustering: similarità Manuele Bicego Corso di Laurea in Bioinformatica Dipartimento di Informatica - Università di Verona Definizioni preliminari

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Android. Android. Sviluppo di applicazioni. Dalvik 19/03/2011. A. Ferrari

Android. Android. Sviluppo di applicazioni. Dalvik 19/03/2011. A. Ferrari Android Android A. Ferrari Android è un sistema opera8vo per disposi8vi mobili. Inizialmente sviluppato da Startup Android Inc. acquisita poi nel 2005 da Google Inc. Il cuore di Android è un kernel Linux.

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

LA GENOMICA SYSTEM BIOLOGY

LA GENOMICA SYSTEM BIOLOGY LA GENOMICA Lo scopo della genomica funzionale è quello di capire la funzione dei geni e delle altre parti del genoma. Molte altre informazioni possono arrivare dalla genomica comparata, che consiste nel

Dettagli

e dei genotipi tossici

e dei genotipi tossici Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle

Dettagli

Metodi per la Ricostruzione Filogenetica. Giuliana Allegrucci riproduzione vietata

Metodi per la Ricostruzione Filogenetica. Giuliana Allegrucci riproduzione vietata Metodi per la Ricostruzione Filogenetica Ricostruire una filogenesi significa trovare la migliore stima delle relazioni evolutive storiche fra entità tassonomiche usando i dati disponibili. I dati di base

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

Predizione della struttura terziaria

Predizione della struttura terziaria Predizione della struttura terziaria Metodi di predizione La predizione della struttura tridimensionale è di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

Tesi di Laurea di Mauro Baluda matr. 038208

Tesi di Laurea di Mauro Baluda matr. 038208 Università degli Studi di Milano Bicocca Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea in Informatica Algoritmi per l'allineamento di Sequenze Tesi di Laurea di matr. 038208 Relatore:

Dettagli

File System. File System. Hard disk. Disco a stato solido. A. Ferrari

File System. File System. Hard disk. Disco a stato solido. A. Ferrari File System File System A. Ferrari Il file system è la parte del Sistema Opera6vo che perme;e la ges6one delle informazioni memorizzate in modo permanente (i file sui vari sistemi di memorizzazione di massa).

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Rappresentazione dei Dati Biologici

Rappresentazione dei Dati Biologici Rappresentazione dei Dati Biologici CORSO DI BIOINFORMATICA C.d.L. Ingegneria Informatica e Biomedica Outline Proteine ed Amminoacidi Rappresentazione di Amminoacidi Rappresentazione delle strutture Proteiche

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale.

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale. Homology modelling L omology modeling delle proteine è il tipo di predizione di struttura terziaria più semplice ed affidabile. Viene richiesta soltanto una (o più) sequenze di riferimento su cui modellare

Dettagli

Allineamento di sequenze di DNA e proteine: possibilità, limiti ed interpretazione

Allineamento di sequenze di DNA e proteine: possibilità, limiti ed interpretazione ATTENZIONE: lo sfondo giallo NON riguarda parti più importanti ma evidenzia solo parti di testo (frasi, paragrafi) aggiornate (correzioni, miglioramento dello stile, o aggiunta di note o esempi per chiarire

Dettagli

DNA sequencing. Reading Genomes. Giovanni Bacci

DNA sequencing. Reading Genomes. Giovanni Bacci Reading Genomes Giovanni Bacci Evoluzione del sequenziamento 1977 Frederick Sanger Prima tecnica di sequenziamento 1987 Applyed Biosystems Prima macchina automatica per il sequenziamento del DNA 1998 Phil

Dettagli

Elettroforesi degli acidi nucleici

Elettroforesi degli acidi nucleici Elettroforesi degli acidi nucleici Una volta che i frammenti del DNA o del RNA da analizzare sono stati amplificati con la reazione PCR è necessario separarli ed identificarli. A tale scopo si utilizza

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

HITS & LEADS HIT LEAD

HITS & LEADS HIT LEAD HITS & LEADS HIT: struttura (molecola) non ottimizzata selezionata da un processo di selezione (screening) tramite un saggio. Spesso ha una debole affinità per il target ed ha probabilmente un profilo

Dettagli

Analisi qualitativa con Agilent BioAnalyzer. cdna, RNA Totale e Messaggero e small RNA

Analisi qualitativa con Agilent BioAnalyzer. cdna, RNA Totale e Messaggero e small RNA Il Servizio di Biologia Molecolare si è di recente dotato di uno strumento per l analisi qualitativa e quantitativa degli acidi nucleici Agilent Bioanalyzer 2100 e ha implementato tale tecnologia nell

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

Microarray. (in parte da Wikipedia)

Microarray. (in parte da Wikipedia) Microarray (in parte da Wikipedia) Un DNA microarray (comunemente conosciuto come gene chip, DNA chip, o biochip) è costituito da una collezione di microscopiche sonde di DNA attaccate ad una superficie

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Introduzione. è uguale a 0, spostamento di dati da una parte della memoria del calcolatore ad un altra.

Introduzione. è uguale a 0, spostamento di dati da una parte della memoria del calcolatore ad un altra. Appunti di Calcolatori Elettronici Modello di macchina multilivello Introduzione... 1 Linguaggi, livelli e macchine virtuali... 3 La struttura a livelli delle macchine odierne... 4 Evoluzione delle macchine

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette

Dettagli

Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

PowerPoint: utilizzare al meglio i grafici speciali per realizzare presentazioni efficaci. Se un disegno vale più di.

PowerPoint: utilizzare al meglio i grafici speciali per realizzare presentazioni efficaci. Se un disegno vale più di. PowerPoint: utilizzare al meglio i grafici speciali per realizzare presentazioni efficaci Vi spieghiamo come utilizzare questi potenti strumenti di comunicazione per presentare analisi particolari o descrivere

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

FORMARE COMPETENZE CON LA MATEMATICA

FORMARE COMPETENZE CON LA MATEMATICA FORMARE COMPETENZE CON LA MATEMATICA marcata esigenza di promuovere nella formazione scolastica vere e proprie competenze e non solo conoscenze e abilità. Sembrerebbe che il valore educativo della matematica

Dettagli

Sequence Alignment Algorithms

Sequence Alignment Algorithms Sequence Alignment Algorithms Algoritmi per l Allineamento di Sequenze Relatore: Prof. Giancarlo Mauri Correlatore: Prof. Gianluca Della Vedova Tesi di Laurea di: Mauro Baluda Matricola 038208 Part of

Dettagli

Next-generation sequencing : dalla ricerca di base alla diagnostica*

Next-generation sequencing : dalla ricerca di base alla diagnostica* Next-generation sequencing : dalla ricerca di base alla diagnostica* Karl V. Voelkerding 1,2, Shale A. Dames 1, Jacob D. Durtschi 1 1ARUP Institute for Experimental and Clinical Pathology, Salt Lake City,

Dettagli

Spettroscopia UV-visibile (parte 2) Bande di assorbimento. Assorbimento UV-vis da parte di proteine ed acidi nucleici

Spettroscopia UV-visibile (parte 2) Bande di assorbimento. Assorbimento UV-vis da parte di proteine ed acidi nucleici (parte 2) Bande di assorbimento Assorbimento UV-vis da parte di proteine ed acidi nucleici Bande d assorbimento Absorbance 1.0 legge di Lambert-Beer A(l)=e l cb 0.5 0.0 350 400 450 Bande d assorbimento

Dettagli

Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli

Dettagli

Biosensori 3: Biosensori a DNA e Bio- Gene Chip

Biosensori 3: Biosensori a DNA e Bio- Gene Chip Biosensori 3: Biosensori a DNA e Bio- Gene Chip mazzei@di.unipi.it (materiale parzialmente tratto da: http://nestor.med.unibo.it/shared_files/seminari/sartini_21-10-2004.ppt) Biosensori ad affinità basati

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale:

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: N 2 Il nome ordinario degli amminoacidi prevale su quello della nomenclatura IUPA. Si possono avere α-amminoacidi,

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Università degli Studi di Padova Dipartimento di Ingegneria dell Informazione Corso di Laurea in Ingegneria dell Informazione Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Laureando:

Dettagli

Sistemi Operativi. ugoerr+so@dia.unisa.it 12 LEZIONE REALIZZAZIONE DEL FILE SYSTEM CORSO DI LAUREA TRIENNALE IN INFORMATICA. Sistemi Operativi 2007/08

Sistemi Operativi. ugoerr+so@dia.unisa.it 12 LEZIONE REALIZZAZIONE DEL FILE SYSTEM CORSO DI LAUREA TRIENNALE IN INFORMATICA. Sistemi Operativi 2007/08 Sistemi Operativi Docente: Ugo Erra ugoerr+so@dia.unisa.it 12 LEZIONE REALIZZAZIONE DEL FILE SYSTEM CORSO DI LAUREA TRIENNALE IN INFORMATICA UNIVERSITA DEGLI STUDI DELLA BASILICATA Sommario della lezione

Dettagli

Biodiversità Molecolare: aspetti di base e nuove tecnologie

Biodiversità Molecolare: aspetti di base e nuove tecnologie Biodiversità Molecolare: aspetti di base e nuove tecnologie Graziano PESOLE Università di Bari & IBBE-CNR, Bari, Italy Seminari sulla Biodiversità Bari, 18 Febbraio 2011 La Biodiversità Per biodiversità

Dettagli

Tecniche per il sequenziamento degli acidi nucleici

Tecniche per il sequenziamento degli acidi nucleici Tecniche per il sequenziamento degli acidi nucleici Nel 1965 viene determinata la prima sequenza completa di un Acido Nucleico: il trna dell alanina di lievito (78 nucleotidi) 1971: prima mappa di restrizione

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 3 Biotecnologie avanzate 3 L evoluzione delle biotecnologie Le biotecnologie hanno conosciuto un evoluzione continua, grazie anche agli avanzamenti tecnologici. Infatti

Dettagli

Lezione IX-X martedì 25-X-2011

Lezione IX-X martedì 25-X-2011 Lezione IX-X martedì 25-X-2011 corso di genomica laurea magistrale Biotecnologia Industriale aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 non ci sarà lezione martedì 1 e giovedì 3 Novembre

Dettagli

strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine

Dettagli