Determinare la sequenza del DNA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Determinare la sequenza del DNA"


1 Corso di Laurea in Chimica e Tecnologie Farmaceu9che a.a Università di Catania Determinare la sequenza del DNA Sequenziamento Sanger, NGS e Bioinforma9ca Stefano Forte

2 Sequenziare significa determinare la successione dei monomeri che costituiscono un polimero biologico PROTEINE (sequenza di Aminoacidi) DNA (sequenza di nucleotidi) DNA Genomico cdna Sequenziamento

3 Principi del sequenziamento del DNA Molte tecniche di biologia molecolare si basano sulla possibilità di replicare molecole di DNA in vitro: - Molecola stampo - Nucleotidi trifosfato - DNA polimerasi - Primers - Appropriato buffer di reazione

4 Metodo di Sanger

5 Metodo di Sanger

6 Sequenziamento automatico Stesso principio del metodo di Sanger Il primer o i ddntp sono marcati con un marcatore fuorescente Lettura tramite laser della molecola appena questa esce dal gel Utilizzo di una sola corsia Se si marca il primer? Se si marcano i ddntp Gel di poliacrillamide o capillare Dato di sequenza acquisito automaticamente e trasferito al computer

7 Interpretazione automatica del dato elettroferogramma

8 Allungare la sequenza Con i metodi automatici è possibile ottenere sequenze oltre il migliaio di basi Con l allungamento della sequenza diminuisce la risoluzione e l intensità del segnale Aumento probabilità che una struttura secondaria termini la sintesi L affidabilità diminuisce allontanandosi dal primer

9 Walking

10 Sequenziamento shotgun Per sequenziare un frammento lungo la migliore stratgia è quella di dividerlo in framenti più piccoli. Il DNA può essere frammentato e clonato in una librerie M13 o in plasmidi. La libreria deve contenere frammenti parzialmente sovrapposti Dalla libreria si prelevano cloni a caso e si sequenziano

11 Sequenziamento shotgun

12 Diminuzione della produttività Una accurata determinazione del 90% della sequenza può essere ottenuta molto rapidamente Per ottenere un ulteriore 9% sarà necessario un tempo paragonabile a quello utilizzato per ottenere il 90% Una quantità simile di lavoro sarà necessaria per ottenere un ulteriore 0,9%

13 Le piahaforme di NGS Tra le piahaforme disponibili descriviamo: Tecnologia 454 (pirosequenziamento) PiaHaforma Solexa/Illumina PiaHaforma Ion Torrent Sistema SOLid

14 Il pirosequenziamento Il pirosequenziamento si basa sulla possibilità di rilevare la luminescenza emessa dalla luciferasi che viene attivata (per produzione di ATP) da una reazione accoppiata alla sintesi del DNA. - Il primer si lega allo stampo e viene incubato con: DNA polimerasi, ATP solforilasi, luciferasi e luciferina, apirasi, dntp, adenosin 5 fosfosolfato (APS) -nucleotidi trifosfato complementare alla prima base dello stampo viene incorporato dalla polimerasi. Viene rilasciato pirofosfato (PPi) -In presenza di APS, la solforilasi converte stechiometricamente il PPi ad ATP. La luciferasi utilizza l'atp per produrre (tramite la conversione della luciferina ad ossiluciferina) luce.

15 Il pirosequenziamento Il pirosequenziamento può essere automatizzato grazie all utilizzo di una tecnologia con micropozzetti. Un pozzetto ha il volume inferiore a 100 pl In un vetrino 6x6 cm possono essere contenuti più di un milione di pozzetti. Il pirosequenziamento può determinare sequenze più corte rispetto al metodo di Sanger ma è possibile parallelizzare il processo per ottenere globalmente sequenze molto più lunghe

16 PiaHaforma illumina - Produzione di frammen9 con protrusione di A - Ligazione di adahatori - Ligazione sulla superficie di una cella a flusso - Amplificazione a ponte - Denaturazione e generazione di cluster clonali - Aggiunta dei 4 nucleo9di con fluoroforo e gruppo bloccante - Lavaggio - Rilevazione della fluorescenza - Sbloccaggio

17 Ion Torrent

18 Sistema SOLid


20 Confronto fra Biosequenze I polimeri biologici a più alto ocntenuto di informazione sono gli acidi nucleici e le proteine. Le unità informa9ve di base sono rispexvamente le 4 basi azotate ed i 20 aminocidi. Perché è possibile confrontare biosequenze? Quali sono gli obie9vi di un confronto di sequenze? Filogenesi molecolare; Evoluzione dei singoli genomi (confronto tra banche da9); CaraHerizzazione di proteine con funzione sconosciuta (ed iden9ficazione di domini funzionali). Possibilità di iden9ficare mutazioni responsabili di un feno9po

21 Confronto fra biosequenze (2) La filogenesi classica è basata sull osservazione di caraheris9che morfologiche e fisologiche. La filogenesi molecolare è basata sulla tendenza a divergere che hanno sequenze nucleo9diche o aminoacidiche originatesi da un progenitore comune. Consente di costruire alberi filogene9ci che illustrino le distanze ed i rappor9 evolu9vi tra le molecole analizzate.

22 Similarità e Omologia Similarità: somiglianza nella composizione di due sequenze biologiche Omologia: relazione filogene9ca tra due sequenze. Spesso 2 sequenze omologhe hanno un elevato grado di omologia, ma possono divergere per mutazione ed evoluzione: possono restare omologhe anche se non troppo simili. Le regioni che tendono a restare simili sono quelle più importan9 per l axvità della proteina

23 Allineamento di sequenze Per poter procedere al confronto tra sequenze nucleo9diche o tra sequenze proteiche è necessario che queste sequenze vengano allineate. Questo è un esempio di allineamento mul9plo di 5 brevi sequenze aminoacidiche.

24 Allineamento di stringhe Cominciamo con l affrontare il problema più generale dell allineamento di una coppia di stringhe. Date due stringhe acbcdb e cadbd, in che modo possiamo stabilire quanto sono simili? La similarità scaturisce dall allineamento oxmale delle due stringhe. Ecco un possibile allineamento: a c - - b c d b - c a d b - d - Il carahere speciale - rappresenta l inserimento di uno spazio, che sta a significare una cancellazione nella sequenza o, equivalentemente, un inserzione nell altra sequenza (Operazioni di INDEL).

25 Similarità e distanza a c - c b c d b - c a d b - d - Per valutare il grado di correlazione tra stringhe possiamo calcolare la similarità o la distanza. Alta similarità - > bassa distanza, Bassa similarità - > elevata distanza.

26 Distanza di Edi9ng E possibile calcolare la distanza tra due stringhe u9lizzando, per esempio, la distanza di edi9ng. La distanza di edi9ng è definita come il minimo numero di operazioni da eseguire (inserimen9, cancellazioni, sos9tuzioni) per trasformare una stringa in un altra. a - c c t g a a g c t t - a In questo caso per trasformare la prima stringa nella seconda dobbiamo inserire una g, sos9tuire una c con una t e cancellare una g. La distanza di edi9ng tra le due stringhe è dunque 3.

27 La scoring func9on: similarità a c - c b c d b a c a d b - d - n In generale è possibile valutare il grado di similarità o la distanza tra due stringhe, assegnando un punteggio (score) all allineamento u9lizzando un opportuna scoring func6on. n Per esempio, se assegniamo un punteggio di +2 per ogni match esaho e un punteggio di - 1 per ogni mismatch o indel, la similarità tra le due sequenze secondo l allineamento considerato sarà: S = ( 1) = 4

28 La scoring func9on: distanza a c - c b c d b a c a d b - d - Se assegniamo uno score pari a 0 nel caso di matches, pari ad 1 in caso di sos9tuzione di caraheri e pari a 2 in caso di allineamento con uno spazio, la distanza tra le due stringhe preceden9 secondo l allineamento considerato è: d = = 7

29 Matrici di Sos9tuzione Un par9colare allinemento è casulae o biologicamnete significa9vo? E possibile quen9ficare la sua significa9vità biologica? Abbiamo visto che la scoring func9on associa un valore numerico ad ogni coppia di caraheri. Le matrici di sos9tuzione associano un valore numerico ad ogni possibile coppia di aminoacidi, tenendo conto delle similarità chimiche tra di essi. Tali matrici possono quindi essere u9lizzate come scoring func9ons per l allineamento di proteine.

30 Similarità chimica tra aminoacidi

31 Matrici PAM Le matrici PAM (Percent Accepted Muta9ons) furono sviluppate esaminando le mutazioni all interno di superfamiglie di sequenze aminoacidiche strehamente correlate tra loro. Si notò che le sos9tuzioni che occorrevano tra sequenze strehamente correlate non erano casuali. Si concluse che alcune sos9tuzioni di aminoacidi occorrono più facilmente di altre, probabilmente a causa del faho che tali sos9tuzioni non alterano significa9vamente la struhura e la funzione di una proteina. Ciò significa che proteine omologhe non devono necessariamente avere gli stessi aminoacidi in ogni posizione.

32 Unità e matrici PAM Usiamo le unità PAM per misurare la distanza tra sequenze aminoacidiche. Due sequenze S1 ed S2 distano 1 unità PAM se S1 può essere trasformata in S2 con una media di 1 mutazione puntuale ogni 100 aminoacidi. In una sequenza la stessa posizione può mutare più volte e tornare quindi al carahere originario; dunque due sequenze che distano 1 PAM possono differire di meno dell 1%.

33 Matrici PAM Esistono diversi 9pi di matrici PAM. Ognuna di esse è u9lizzata per confrontare due sequenze che distano un certo numero di unità PAM l una dall altra. Ad es. la PAM120 può essere u9lizzata per confrontare sequenze che distano 120 unità PAM. La entry (i,j) della matrice PAM120 con9ene lo score assegnato alla coppia di aminoacidi (Ai,Aj); tale score è proporzionale alla frequenza con cui ci si aspeha che Ai sos9tuisca Aj in due sequenze che distano 120 unità PAM.

34 A 2 R -2 6 N D Matrice PAM 120 C Q E G H I L K M F P S T W Y V A R N D C Q E G H I L K M F P S T W Y V

35 Matrici BLOSUM Le matrici BLOSUM sono matrici di sos9tuzione di aminoacidi simili alle PAM. Mentre la matrici PAM si basano su allineamen9 globali tra sequenze, le BLOSUM si basano su allineamen9 di blocchi di segmen9 di sequenze strehamente correlate. I segmen9 appartenen9 a ciascun blocco vengono suddivisi in clusters in base alla percentuale di similarità. Ogni cluster sarà considerato come un unica sequenza. Ad es. nella costruzione della matrice BLOSUM62 ogni cluster sarà cos9tuito da sequenze che hanno iden9tà superiore al 62%. Anche in questo caso la entry (i,j) della matrice è proporzionale alla frequenza di sos9tuzione dell aminoacido Ai con l aminoacido Aj.

36 Gaps Abbiamo visto che due sequenze biologiche possono differire tra loro non solo per sos9tuzione di un residuo con un altro ma anche per inserzione o delezione di residui. E quindi spesso necessario introdurre degli spazi - in una o in entrambe le sequenze da allineare, anche al fine di portare le sequenze alla stessa lunghezza. Una sequenza di spazi con9gui si definisce gap. Ovviamente è necessario determinare un criterio per l inserimento di tali gap. L inserimento di un gap abbassa lo score dell allineamento; in questo modo, essendo il nostro scopo quello di massimizzare lo score dell allineamento, verranno inseri9 gaps solo quando ciò è strehamente necessario.

37 Gap Penal9es La maggior parte degli algoritmi di allineamento usano delle gap penal6es diverse per l apertura di un nuovo gap e per l estensione di un gap già esistente. Il GOP (Gap Opening Penalty) è la penalità da pagare ogni qual volta viene inserito un gap. Il GEP (Gap Extension Penalty) è la penalità da pagare ogni qual volta viene esteso un gap già esistente. Solitamente GOP>GEP, cioè aprire un nuovo gap è più costoso che estenderne uno esistente; in questo modo si tende ad avere inserzioni e delezioni di parecchi residui per volta piuhosto che inserzioni o delezioni sparse.

38 Gap Penal9es Esempio di apertura di un gap: a c t c a a t c a t c a - t c a t c Esempio di estensione di un gap già esistente: a c t c a a - - t t c c a a t t c

39 Algoritmi per il l allineamento Pairwise Come trovare l allinemento oxmale? Il metodo più ovvio per determinare l allineamento oxmale tra due sequenze consiste nel costruire tux i possibili allineamen9 e valutare quello con lo score più alto: APPROCCIO IMPRATICABILE Allineare sequenze di appena 20 caraheri (lunghezza inusuale per una biosequenza, che solitamente è formata da un numero molto maggiore di caraheri) richiederebbe un tempo sicuramente inaccehabile.

40 Allineamento mediante Programmazione Dinamica Date due stringhe S e T, con S =n e T =m, il nostro obiexvo è il calcolo dell allineamento oxmale di S e T. Gli algoritmi di programmazione dinamica vengono u9lizza9 nella risoluzione di problemi di oxmizzazione; nel nostro caso ci interessa massimizzare lo score dell allineamento. Un algoritmo di programmazione dinamica trova la soluzione migliore spezzando il problema originale in sohoproblemi più semplici da risolvere. La soluzione di ogni sohoproblema si basa sulle soluzioni dei sohoproblemi già risol9.

41 Allineamento globale e locale L algoritmo di allineamento che abbiamo considerato, produce l allineamento globale di due sequenze, ovvero allinea due sequenze su tuha la loro lunghezza. Una variante dell algoritmo di Needleman- Wunsch consente di eseguire l allineamento locale di due sequenze; Questo è u9le quando abbiamo a che fare con sequenze che non presentano un alta similarità su tuha la loro lunghezza ma che contengono comunque regioni ad alta similarità (Vedi BLAST). L algoritmo di local alignment res9tuisce gli n allineamen9 di sohosequenze di S e T di massimo score.

42 Allineamento Mul9plo Fino ad ora abbiamo visto come produrre allineamen9 di coppie di sequenze. Gli algoritmi vis9 hanno complessità quadra9ca (nella lunghezza delle sequenze) in tempo e spazio. La variante di Myers- Miller consente di produrre allineamen9 di coppie di sequenze in tempo quadra9co e spazio lineare. Il problema dell allineamento di n sequenze non è risolubile in tempo polinomiale. Occorre quindi ricorrere ad euris9che ed approssimazioni.

43 Allineamento Progressivo Il metodo più comune per eseguire un allineamento mul9plo è il cosiddeho allineamento progressivo, basato sulla costruzione di una successione di allineamen9 a coppie. Dato un insieme S cos9tuito da n sequenze da allineare, si scelgono due sequenze s1 ed s2 e si allineano; questo allineamento rimane fissato nei passi successivi. Si sceglie quindi una terza sequenza s3 e si allinea al precedente allineamento, e così via. Questo è un approccio euris9co e non garan9sce di trovare l allineamento mul9plo oxmale; tuhavia è efficiente e nella pra9ca dà dei risulta9 ragionevoli.

44 Allineamento Progressivo (2) L euris9ca più importante u9lizzata negli algoritmi di allineamento progressivo prevede che le coppie che presentano un maggior grado di similarità siano allineate per prime. Ciò è gius9ficato dal faho che coppie di sequenze maggiormente somiglian9 hanno maggiore probabilità di essere derivate più recentemente da un antenato comune e quindi il loro allineamento fornisce l informazione più affidabile che è possibile ricavare dalle sequenze. Inoltre le posizioni dei gaps in sequenze maggiormente correlate sono 9picamente più accurate rispeho a quelle rela9ve a sequenze meno simili, per cui i gaps degli allineamen9 iniziali vanno preserva9 durante l allineamento progressivo.

45 ClustalW ClustalW è il tool più popolare per l allineamento mul9plo di biosequenze. Dato un insieme S di n sequenze da allineare, ClustalW allinea tuhe le coppie di sequenze di S separatamente e costruisce una matrice con le distanze tra ogni coppia di sequenze. Seq. A Seq. B Seq. C Seq. D Seq. A 0.00 Seq. B Seq. C Seq. D

46 ClustalW: Albero filogene9co n n Viene quindi costruito un albero guida filogene9co u9lizzando il metodo neighbour- joining. Si sceglie la coppia più vicina: questa andrà a formare il primo sohoalbero: Seq. A Seq. B Seq. C Seq. D Seq. A 0.00 Seq. B Seq. C Seq. D A AB B

47 ClustalW: Albero filogene9co (2) Sostituiamo nella tabella la entry AB alle singole entry A e B e calcoliamo le distanze di AB dalle sequenze rimanenti facendo una semplice media aritmetica: Impossibile visualizzare l'immagine. La memoria del computer potrebbe essere insufficiente per aprire l'immagine oppure l'immagine potrebbe essere danneggiata. Riavviare il computer e aprire di nuovo il file. Se viene visualizzata di nuovo la x rossa, potrebbe essere necessario eliminare l'immagine e inserirla di nuovo. Impossibile visualizzare l'immagine. La memoria del computer potrebbe essere insufficiente per aprire l'immagine oppure l'immagine potrebbe essere danneggiata. Riavviare il computer e aprire di nuovo il file. Se viene visualizzata di nuovo la x rossa, potrebbe essere necessario eliminare l'immagine e inserirla di nuovo. Seq. AB Seq. C Seq. D Seq. AB 0.00 Seq. C 0.375? 0.00 Seq. D 0.175? D( AB, D) = D( A, D) + D( B, D) = = D( AB, C) = D( A, C) + D( B, C) = = Iterando il procedimento si ottiene l albero completo.

48 ClustalW: Albero filogene9co (3) OHerremo un albero i cui rami hanno lunghezza proporzionale alla distanza tra le sequenze : Quest albero verrà u9lizzato per guidare l allineamento progressivo. Nel nostro esempio verranno allineate per prime le sequenze A e B. Successivamente verrà allineata la sequenza D all allineamento AB e infine verrà allineata la sequenza C all allineamento ABD. A B D C

49 Albero filogene9co: un esempio L albero filogene9co in figura è costruito mediante ClustalW a par9re dalle sequenze della proteina mnsod su diversi organismi: il clustering ohenuto rispecchia in maniera abbastanza fedele quella che è la filogenesi classica (cioè basata su da9 geopaleontologici).

50 Allineamento con ClustalW n n n La presenza di un simbolo * in fondo ad una colonna indica un match del 100%. Il simbolo : indica un alta similarità (>75%). Il simbolo. indica una media similarità (50%- 75%). Nell allineamento di sequenze nucleo9diche è possibile trovare solo simboli * nel caso di iden9tà della colonna al 100%.

51 ClustalW: Server on line Il server ufficiale di ClustalW si trova sul sito dell EMBL: hhp:// Vi sono comunque mol9 altri server di ClustalW; uno dei più popolari è quello dello Swiss Ins9tute of Bioinforma9cs: hhp:// Questa versione di ClustalW ha un interfaccia semplificata rispeho a quella ufficiale su EMBL.

52 ClustalW: uso locale E anche possibile scaricare la versione locale di ClustalW per ambien9 Windows (DOS) e Linux: sp:// sp:// sp://sp- igbmc.u- hhp://

53 Blast2Seq Blast2Seq è un tool della famiglia BLAST che permehe di eseguire l allineamento di una coppia di sequenze u9lizzando l algoritmo di allineamento locale di BLAST. E importante soholineare la differenza tra questo 9po di approccio e quello mostrato nelle slides preceden9: L allineamento Pairwise Globale di coppie di sequenze mehe in luce l eventuale similarità globale tra le due sequenze. L allineamento Pairwise effehuato da Blast2Seq mehe in luce le eventuali similarità locali tra le due sequenze. Due sequenze possono anche essere molto diverse nella loro interezza ma avere comunque delle regioni molto simili: a par9re da tale similarità è spesso possibile formulare interessan9 ipotesi sulla presenza di determina9 mo9vi e quindi sulla funzione delle molecole analizzate.


SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico


Tecniche di sequenziamento del DNA

Tecniche di sequenziamento del DNA Tecniche di sequenziamento del DNA -Metodo di Maxam e Gilbert (della degradazione chimica del DNA) -Metodo di Sanger (a terminazione di catena) Metodo di Maxam-Gilbert Questo metodo, basato sulla degradazione


Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello


Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare Facoltà di Ingegneria dell Informazione Laurea Specialistica e Magistrale in Ingegneria Informatica Facoltà di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica


Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT


3. Confronto tra due sequenze

3. Confronto tra due sequenze 3. Confronto tra due sequenze Esercizio 1: uso di DotLet Il programma DotLet è accessibile dal sito, dove può essere utilizzato attraverso un interfaccia utente


Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare


PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre


Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana



TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi


La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica


Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore


Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)


Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando



METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda


Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono


Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi


DNA sequencing. Reading Genomes. Giovanni Bacci

DNA sequencing. Reading Genomes. Giovanni Bacci Reading Genomes Giovanni Bacci Evoluzione del sequenziamento 1977 Frederick Sanger Prima tecnica di sequenziamento 1987 Applyed Biosystems Prima macchina automatica per il sequenziamento del DNA 1998 Phil


Sequence Alignment Algorithms

Sequence Alignment Algorithms Sequence Alignment Algorithms Algoritmi per l Allineamento di Sequenze Relatore: Prof. Giancarlo Mauri Correlatore: Prof. Gianluca Della Vedova Tesi di Laurea di: Mauro Baluda Matricola 038208 Part of


La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza


SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno


SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica

SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica Prof. Francesco Michelotti SAPIENZA Università di Roma Facoltà di Ingegneria


Algoritmi di Allineamento

Algoritmi di Allineamento Algoritmi di Allineamento CORSO DI BIOINFORMATICA Corso di Laurea in Biotecnologie Università Magna Graecia Catanzaro Outline Similarità Allineamento Omologia Allineamento di Coppie di Sequenze Allineamento


Perché abbiamo deciso di sequenziare il genoma umano

Perché abbiamo deciso di sequenziare il genoma umano L'immagine sopra rappresenta le tappe fondamentali per la scoperta del genoma umano. Una versione più interattiva della mappa è disponibile nel sito del progetto genoma umano, nella sezione dedicata alla



PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA


Percorsi di matematica per il ripasso e il recupero

Percorsi di matematica per il ripasso e il recupero Giacomo Pagina Giovanna Patri Percorsi di matematica per il ripasso e il recupero 2 per la Scuola secondaria di secondo grado UNITÀ CAMPIONE Edizioni del Quadrifoglio à t i n U 1 Sistemi di primo grado


DNA sequence alignment

DNA sequence alignment DNA sequence alignment - Introduzione: un possibile modello per rappresentare il DNA. Il DNA (Acido desossiribonucleico) è una sostanza presente nei nuclei cellulari, sia vegetali che animali; a questo


Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA Sequenziamento del DNA Preparazione di librerie Library di cdna e di DNA genomico Analisi di librerie Sequenziamento del DNA 1) Metodo di Maxam&Gilbert (taglio chimico): il DNA viene marcato ad un estremità


q xi Modelli probabilis-ci Lanciando un dado abbiamo sei parametri p i >0;

q xi Modelli probabilis-ci Lanciando un dado abbiamo sei parametri p i >0; Modelli probabilis-ci Lanciando un dado abbiamo sei parametri p1 p6 p i >0; 6! i=1 p i =1 Sequenza di dna/proteine x con probabilita q x Probabilita dell intera sequenza n " i!1 q xi Massima verosimiglianza


Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA


PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you


Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni


Allineamento e similarità di sequenze

Allineamento e similarità di sequenze Allineamento e similarità di sequenze Allineamento di Sequenze L allineamento tra due o più sequenza può aiutare a trovare regioni simili per le quali si può supporre svolgano la stessa funzione; La similarità


Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,


Linguaggi di programmazione

Linguaggi di programmazione Linguaggi di programmazione Programmazione L attività con cui si predispone l elaboratore ad eseguire un particolare insieme di azioni su particolari dati, allo scopo di risolvere un problema Dati Input


Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione



DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando


Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare


Banche Dati Secondarie. geni trascritti proteine profili strutture

Banche Dati Secondarie. geni trascritti proteine profili strutture Banche Dati Secondarie geni trascritti proteine profili strutture definizione Banca dati il cui contenuto deriva da una banca dati primaria DB sec DB primario informazione PROSITE SWISS Prot patterns Profiles


ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor


Predizione della struttura terziaria

Predizione della struttura terziaria Predizione della struttura terziaria Metodi di predizione La predizione della struttura tridimensionale è di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi


Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:


Chiamiamo macchina un dispositivo che funzioni accettando in ingresso una qualche forma di energia e producendo in uscita un'altra forma di energia.

Chiamiamo macchina un dispositivo che funzioni accettando in ingresso una qualche forma di energia e producendo in uscita un'altra forma di energia. Lezione 17 - pag.1 Lezione 17: le macchine 17.1. Che cosa è una macchina? Il termine macchina, nell uso comune della lingua italiana, sta diventando sinonimo di automobile, cioè, alla lettera, dispositivo


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e


Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!


Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione


I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici La seta della tela di ragno è un insieme di macromolecole, dette proteine. Sono le caratteristiche fisico-chimiche di queste



HITS & LEADS HIT LEAD HITS & LEADS HIT: struttura (molecola) non ottimizzata selezionata da un processo di selezione (screening) tramite un saggio. Spesso ha una debole affinità per il target ed ha probabilmente un profilo





Sistemi di tracciabilità per un attestato di identità molecolare. FEM 2 - Ambiente S.r.l. Spin-off dell Università degli Studi di Milano-Bicocca

Sistemi di tracciabilità per un attestato di identità molecolare. FEM 2 - Ambiente S.r.l. Spin-off dell Università degli Studi di Milano-Bicocca Sistemi di tracciabilità per un attestato di identità molecolare FEM 2 - Ambiente S.r.l. Spin-off dell Università degli Studi di Milano-Bicocca PROBLEMA L identificazione e il controllo della filiera delle





Progetto di simulazione molecolare per il corso di Complementi di algoritmi A.A. 2005-06

Progetto di simulazione molecolare per il corso di Complementi di algoritmi A.A. 2005-06 Progetto di simulazione molecolare per il corso di Complementi di algoritmi A.A. 2005-06 13 febbraio 2006 1 Descrizione Il progetto si compone delle seguenti fasi: 1. caricamento di soluzioni in formato


Riconoscimento e recupero dell informazione per bioinformatica

Riconoscimento e recupero dell informazione per bioinformatica Riconoscimento e recupero dell informazione per bioinformatica Clustering: similarità Manuele Bicego Corso di Laurea in Bioinformatica Dipartimento di Informatica - Università di Verona Definizioni preliminari



REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità


Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini

Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini Dipartimento di Ingegneria della Informazione Via Diotisalvi, 2 56122 PISA ALGORITMI GENETICI (GA) Sono usati per risolvere problemi di ricerca


Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Il tecnico di laboratorio biomedico: Applicazioni nel laboratorio di anatomia patologica


Il sequenziamento del DNA

Il sequenziamento del DNA Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile


Un ripasso di aritmetica: Rappresentazione binaria - operazioni. riporti

Un ripasso di aritmetica: Rappresentazione binaria - operazioni. riporti Un ripasso di aritmetica: Rappresentazione binaria - operazioni A queste rappresentazioni si possono applicare le operazioni aritmetiche: riporti 1 1 0 + 1 0 = 1 0 0 24 Un ripasso di aritmetica: Rappresentazione


PowerPoint: utilizzare al meglio i grafici speciali per realizzare presentazioni efficaci. Se un disegno vale più di.

PowerPoint: utilizzare al meglio i grafici speciali per realizzare presentazioni efficaci. Se un disegno vale più di. PowerPoint: utilizzare al meglio i grafici speciali per realizzare presentazioni efficaci Vi spieghiamo come utilizzare questi potenti strumenti di comunicazione per presentare analisi particolari o descrivere


Scuola Primaria Conta oggetti o eventi, a voce e a mente, in senso progressivo e regressivo e per salti di due, tre ;

Scuola Primaria Conta oggetti o eventi, a voce e a mente, in senso progressivo e regressivo e per salti di due, tre ; Primo anno Secondo anno Terzo anno Primo anno MATEMATICA Scuola dell Infanzia Scuola Primaria Conta oggetti o eventi, a voce e a mente, in senso progressivo e regressivo e per salti di due, tre ; legge


Evasione. Evasione. Vendite. Magazzini Immagini

Evasione. Evasione. Vendite. Magazzini Immagini Schema di funzionamento del Carico da Ordini Ordine Archivio di Transito Univoco Evasione Codifica Controllo Articoli Generico Evasione Movimenti Documenti Giacenze Testata Scadenze Vendite Dettaglio Ingrosso


Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini

Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini Dipartimento di Ingegneria della Informazione Via Diotisalvi, 2 56122 PISA ALGORITMI GENETICI (GA) Sono usati per risolvere problemi di ricerca



CURRICOLO di MATEMATICA Scuola Primaria CURRICOLO di MATEMATICA Scuola Primaria MATEMATICA CLASSE I Indicatori Competenze Contenuti e processi NUMERI Contare oggetti o eventi con la voce in senso progressivo e regressivo Riconoscere e utilizzare


Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.


Struttura logica di un programma

Struttura logica di un programma Struttura logica di un programma Tutti i programmi per computer prevedono tre operazioni principali: l input di dati (cioè l inserimento delle informazioni da elaborare) il calcolo dei risultati cercati


PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in



LA GESTIONE AGENTI PER LE AZIENDE CHE CRESCONO 1 LA GESTIONE AGENTI Impossibile visualizzare l'immagine. La memoria del computer potrebbe essere insufficiente per aprire l'immagine oppure l'immagine potrebbe essere danneggiata. Riavviare il computer


Teoria dei Giochi non Cooperativi

Teoria dei Giochi non Cooperativi Politecnico di Milano Descrizione del gioco Egoismo Razionalità 1 L insieme dei giocatori 2 La situazione iniziale 3 Le sue possibili evoluzioni 4 I suoi esiti finali I Giochi della teoria Perché studiare



AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita


Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione


3DE Modeling Professional

3DE Modeling Professional 3DE Modeling Professional 3DE Modeling Professional è la parte di 3DE Modeling Suite che si occupa della modellazione 3D automatica di oggetti ed edifici a partire da nuvole di punti ottenute con scanner


Tesi di Laurea di Mauro Baluda matr. 038208

Tesi di Laurea di Mauro Baluda matr. 038208 Università degli Studi di Milano Bicocca Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea in Informatica Algoritmi per l'allineamento di Sequenze Tesi di Laurea di matr. 038208 Relatore:



ANALISI DEI DATI PER IL MARKETING 2014 ANALISI DEI DATI PER IL MARKETING 2014 Marco Riani LA CLASSIFICAZIONE CAP IX, pp.367-457 Problema generale della scienza (Linneo, ) Analisi discriminante Cluster Analysis


Master della filiera cereagricola. Impresa e mercati. Facoltà di Agraria Università di Teramo. Giovanni Di Bartolomeo Stefano Papa

Master della filiera cereagricola. Impresa e mercati. Facoltà di Agraria Università di Teramo. Giovanni Di Bartolomeo Stefano Papa Master della filiera cereagricola Giovanni Di Bartolomeo Stefano Papa Facoltà di Agraria Università di Teramo Impresa e mercati Parte prima L impresa L impresa e il suo problema economico L economia studia


Helena Curtis N. Sue Barnes

Helena Curtis N. Sue Barnes Helena Curtis N. Sue Barnes LA RESPIRAZIONE CELLULARE INDICE Demolizione del glucosio Glicolisi Fermentazione lattica Fermentazione alcolica Respirazione cellulare Ciclo di Krebs Catena di trasporto degli



Disciplina: SCIENZE MATEMATICHE UNITÀ DI APPRENDIMENTO 1 Disciplina: SCIENZE MATEMATICHE UNITÀ DI APPRENDIMENTO 1 OBIETTIVO FORMATIVO Comprendere come gli strumenti matematici siano necessari per operare nella realtà. L alunno si muove con sicurezza nel calcolo


Sistemi Operativi IMPLEMENTAZIONE DEL FILE SYSTEM. D. Talia - UNICAL. Sistemi Operativi 9.1

Sistemi Operativi IMPLEMENTAZIONE DEL FILE SYSTEM. D. Talia - UNICAL. Sistemi Operativi 9.1 IMPLEMENTAZIONE DEL FILE SYSTEM 9.1 Implementazione del File System Struttura del File System Implementazione Implementazione delle Directory Metodi di Allocazione Gestione dello spazio libero Efficienza


Progetto della classe II C

Progetto della classe II C Progetto della classe II C Preparazione allo svolgimento dell esperienza La II C è preparata all esperienza presso il centro di ricerca E.B.R.I. iniziando un intenso lavoro di approfondimento sulla genetica





Indirizzamento Aperto

Indirizzamento Aperto Indirizzamento Aperto Sommario Metodo di indirizzamento aperto Scansione lineare Scansione quadratica Hashing doppio Metodo di indirizzamento aperto L idea è di memorizzare tutti gli elementi nella tabella


Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi Università degli Studi di Milano Polo Didattico e di Ricerca di Crema Facoltà di Scienze Matematiche, Fisiche e Naturali Corso di Geometria Computazionale Determinazione della struttura di una molecola


La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta


Sequenziamento a minimo costo di commutazione in macchine o celle con costo lineare e posizione home (In generale il metodo di ottimizzazione

Sequenziamento a minimo costo di commutazione in macchine o celle con costo lineare e posizione home (In generale il metodo di ottimizzazione Sequenziamento a minimo costo di commutazione in macchine o celle con costo lineare e posizione home (In generale il metodo di ottimizzazione presentato in questo file trova la seq. a costo minimo per


Appunti sulla Macchina di Turing. Macchina di Turing

Appunti sulla Macchina di Turing. Macchina di Turing Macchina di Turing Una macchina di Turing è costituita dai seguenti elementi (vedi fig. 1): a) una unità di memoria, detta memoria esterna, consistente in un nastro illimitato in entrambi i sensi e suddiviso


Indicando con x i minuti di conversazione effettuati in un mese, con la spesa totale nel mese e con il costo medio al minuto:

Indicando con x i minuti di conversazione effettuati in un mese, con la spesa totale nel mese e con il costo medio al minuto: PROBLEMA 1. Il piano tariffario proposto da un operatore telefonico prevede, per le telefonate all estero, un canone fisso di 10 euro al mese, più 10 centesimi per ogni minuto di conversazione. Indicando



LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni



SCUOLA PRIMARIA Anno Scolastico 2014/2015 CURRICOLO DI MATEMATICA OBIETTIVI DI APPRENDIMENTO AL TERMINE DELLA CLASSE TERZA DELLA SCUOLA PRIMARIA Ministero dell Istruzione, dell Università e della Ricerca Istituto Comprensivo Statale di Calolziocorte Via F. Nullo,6 23801 CALOLZIOCORTE (LC) e.mail: - Tel: 0341/642405/630636


E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale.

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale. Homology modelling L omology modeling delle proteine è il tipo di predizione di struttura terziaria più semplice ed affidabile. Viene richiesta soltanto una (o più) sequenze di riferimento su cui modellare


Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine


Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici



OBIETTIVI SPECIFICI DI APPRENDIMENTO Disciplina:... Anno scolastico: 20.../20... Classe/i :... Docente:... DI APPRENDIMENTO SEZIONE 1 Premesse matematiche Nozioni fondamentali sui sistemi di numerazione Sistemi di numerazione in base diversa


TEMPO X PRODURRE ARTICOLO QUANTITÀ LAVORAZIONE MACCHINA 1 PEZZO Taglio Seghetto 30 minuti. Tornitura Tornio 20 minuti

TEMPO X PRODURRE ARTICOLO QUANTITÀ LAVORAZIONE MACCHINA 1 PEZZO Taglio Seghetto 30 minuti. Tornitura Tornio 20 minuti PIANIFICAZIONE DELLA PRODUZIONE CON ACCESS E PROJECT 2007 In questo articolo esamineremo come una applicazione Access ed una applicazione Project 2007 possono interagire per creare un piano di produzione


Rappresentazione dei numeri in un calcolatore

Rappresentazione dei numeri in un calcolatore Corso di Calcolatori Elettronici I A.A. 2010-2011 Rappresentazione dei numeri in un calcolatore Lezione 2 Università degli Studi di Napoli Federico II Facoltà di Ingegneria Rappresentazione dei numeri


Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,


Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi



FORMARE COMPETENZE CON LA MATEMATICA FORMARE COMPETENZE CON LA MATEMATICA marcata esigenza di promuovere nella formazione scolastica vere e proprie competenze e non solo conoscenze e abilità. Sembrerebbe che il valore educativo della matematica


La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano

La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano SOC di Farmacologia Sperimentale e Clinica VI CONGRESSO NAZIONALE FITeLab Slow Medicine Laboratory: IT s the Future 1-2-3 Ottobre 2015 Ospedale Borgo Roma (Verona) La farmacogeneticanella gestione del
