TUTTI UGUALI, TUTTI DIVERSI Caccia al gene

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "TUTTI UGUALI, TUTTI DIVERSI Caccia al gene"

Transcript

1 Centro Università di Milano-Scuola per la diffusione delle bioscienze e delle biotecnologie TUTTI UGUALI, TUTTI DIVERSI Caccia al gene 1

2 Tutti uguali, tutti diversi Caccia al gene Lo scopo di questa attività pratica è di capire come attraverso l uso di banche dati bioinformatiche sia possibile, partendo da una sequenza parziale di DNA umano, identificare il gene a cui appartiene la sonda nucleotidica, identificare le differenze tra la sequenza data e quella normale, ottenere informazioni dettagliate sulla proteina codificata dal gene e sui tessuti in cui la proteina è espressa, mettere in relazione le alterazioni del gene con malattie. Ti verrà data una sequenza parziale di DNA (sonda) e con quella dovrai pescare il gene corrispondente. Sarà come trovare un ago in un pagliaio!! Obiettivi dell attività: 1. identificare un gene a partire da una sequenza (sonda) sconosciuta; 2. identificare la regione del cromosoma dove si trova il gene; 3. identificare una mutazione in una data sequenza di DNA; definire la struttura esone-introne del gene ed ottenere la sequenza completa del cdna; 4. identificare le caratteristiche principali della proteina codificata dal gene normale 5. trovare le conseguenze della mutazione a livello della proteina; identificare le principali caratteristiche del cdna elaborando uno schema con la posizione del codone di inizio, di stop e del segnale di poliadenilazione; tradurre la molecola di cdna nella corrispondente proteina; 6. ottenere informazioni sulla struttura in 3D della proteina; 7. capire come correlare la mutazione in un gene ad una malattia. 2

3 Scenario I test predittivi vengono proposti a individui asintomatici che hanno, nella loro famiglia, casi di malattie genetiche. Nella storia che viene proposta per l attività di bioinformatica, una donna con casi di cancro al seno in famiglia (vedi l albero genealogico della famiglia del probando) chiede di sottoporsi ad un test per evidenziare se è portatrice di geni di predisposizione alla malattia (in questo caso il tumore al seno). Anne, una giovane donna di 23 anni, si reca al suo primo appuntamento con il suo nuovo ginecologo; il dottore nota dal racconto di Anne che nella sua famiglia ci sono stati numerosi casi di cancro. La sua nonna paterna morì a 40 anni di cancro al seno; due delle quattro zie paterne sono morte prima dei 50 anni per cancro alle ovaie e ad una terza zia paterna di 39 anni è stato recentemente diagnosticato il cancro al seno. Il ginecologo pensa che nella famiglia di Anne possa essere presente una mutazione in uno dei due geni che controllano la predisposizione allo sviluppo del cancro al seno e/o all ovaio (BRCA1 or BRCA2). Durante la visita il ginecologo individua un nodulo sospetto nel seno destro di Anne e ne predispone una biopsia. Oltre all esame istologico, il ginecologo suggerisce ad Anne il test del DNA ma la informa che i risultati potranno essere informativi solo se si può fare il test anche sui famigliari, per individuare esattamente la mutazione tipica della sua famiglia. Anne contatta subito sua zia malata scoprendo che si è già sottoposta al test genetico da cui è risultata portarice di una rara mutazione nel gene BRCA2. Per fare diagnosi di malattie genetiche viene utilizzata dai laboratori una tecnica particolare: la RT- PCR (reverse transcription polymerase chain reaction). L RT-PCR è una tecnica che amplifica un frammento di acido ribonucleico (RNA). La molecola di RNA è dapprima trascritta nel DNA complementare (o cdna) attraverso l uso dell enzima trascrittasi inversa (RT), e in seguito amplificata utilizzando la reazione a catena della polimerasi. L RT-PCR usa come stampo una molecola di RNA ed è quindi molto utile per l analisi dell espressione genica in un tessuto. Sul campione della biopsia di Anne viene eseguita la RT-PCR e il prodotto della reazione viene sequenziato: si scopre che la mutazione nel gene di Anne è la stessa riscontrata nel DNA della zia. Userai una sequenza parziale di cdna di Anne come sonda per identificare la mutazione presente 3

4 in questa famiglia e per verificare la presenza della mutazione nel DNA di Anne. 4

5 Obiettivi 1 e 2: Identificare il gene a cui appartiene la sequenza (sonda) e la sua posizione sul cromosoma. Per raggiungere l obiettivo della prima parte dell attività devi usare il software BLAT (BLAST- Like Alignment Tool), un algoritmo ottimizzato per confrontare sequenze di cdna (prive di introni) con intere sequenze genomiche (che contengono introni). Vai al sito: Incolla nel box vuoto la sequenza nucleotidica TGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCA GCAGACCCAGCTTACCTTGAG TTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAAC AGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAA ATCTGAAAGAGCTAAC ATACAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCG GTTTCAGATGAAATTTTATTTCAGA TTTACCAGCCACGGGAGCCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGA per trovare la sua localizzazione nel genoma umano (controlla che sia selezionata la scelta human tra i genomi disponibili e clicca su submit. Bisogna attendere alcuni secondi per avere i risultati della ricerca del software BLAT. Scegli il primo risultato che mostri il migliore allineamento definito con un numero detto score: più alto è lo score migliore è l allineamento. Scoprirai che la tua sequenza (definita dal software query) è composta da 350 nucleotidi e si trova nel cromosoma 13. Se desideri maggiori dettagli sulla struttura esoni-introni della regione genomica in esame, clicca su details (userai questa funzione anche in seguito); ora però clicca su browser per trovare la regione cromosomica che contiene la sequenza che ci interessa. Nella schermata che si apre osserva che l ideogramma del cromosoma ha un tratto rosso nella posizione dove si trova la sequenza che 5

6 stiamo studiando. Nella finestra sottostante ritrovi la sequenza (your seq) al di sotto della quale c è la sequenza genomica (known genes) che si allinea nel miglior modo possibile; per capire bene le informazioni contenute in questa finestra bisogna rinfrescare le conoscenze sulla struttura del gene. I geni rappresentano solo l 1% del genoma umano e gli scienziati stanno ancora studiando per capire la composizione e la funzione del restante 99%. Negli eucarioti i geni sono affiancati da lunghe sequenze non codificanti il cui significato risulta ancora abbastanza oscuro (queste sequenze sono anche dette DNA spazzatura); quando viene localizzato un gene si nota che è suddiviso in piccole parti dette esoni, che sono le parti codificanti proteine o molecole di RNA e che gli esoni sono separati da lunghi tratti non codificanti detti introni. Nella finestra di BLAT gli esoni sono rappresentati da blocchetti neri o rossi, mentre gli introni sono raffigurati come linee sottili. domanda1) Prendi nota della posizione della sonda che stai studiando sul cromosoma 13 e della lunghezza della regione. Il gene al quale appartiene la tua sonda è quello che mostra il migliore allineamento, indicato sotto a your seq :come ci attendevamo, è BRCA2. Obiettivo 3 Identificare la mutazione presente nel DNA di Anne e nella sua famiglia Confronta la struttura della tua sequenza (your seq) con la struttura del gene normale sottostante. 6

7 domanda2) Quanti esoni sono visibili in questa parte di gene? Quanti esoni ci sono nella tua sequenza? Ci sono differenze tra la struttura esoni-introni della tua sequenza e la struttura della sequenza del gene normale? Cosa possiamo dire sulla mutazione genica di Anne? In questa pagina ci sono altre informazioni; sulla sinistra ci sono dei blocchetti grigi e blu: l interfaccia del browser ti permette di personalizzare ed arricchire la tua ricerca visualizzando informazioni diverse, aggiungendone o nascondendone altre. Infatti cliccando sui blocchetti verticali si accede ad altre pagine e si possono cambiare anche i parametri della ricerca. Osserva attentamente la barra verticale relativa alla conservazione della sequenza (Vertebrate Alignment and Conservation). Nota che le regioni maggiormente conservate corrispondono agli esoni (i rettangoli colorati pieni nella sezione RefSeq genes ) e che queste regioni si conservano anche in specie di vertebrati lontane evolutivamente dall uomo, come in opossum, pollo o rana. Un discreto livello di conservazione si osserva anche in alcune regioni introniche (conservazione delle sequenze non-codificanti) ma ancora non ne è chiaro il ruolo anche se si può supporre che siano zone coinvolte nella regolazione dell espressione genica. La penultima barra mostra gli SNPs (single nucleotide polymorphisms) e l ultima, Repeat masker, mostra le sequenze ripetute. Ora dobbiamo trovare quale è l esone che manca nella mutazione della famiglia di Anne. Per ottenere questa informazione bisogna trovare la struttura esone-introne completa del gene normale BRCA2. Per fare questo hai bisogno della sequenza codificante completa (CDS) e, con questa, cominciare una nuova ricerca BLAT. Vai alla pagina per trovare il codice identificativo del gene BRCA2. Seleziona Nucleotide nel campo search posizionato in alto a sinistra nella home page e digita BRCA2 homo sapiens nel campo for. Clicca poi su Go. Nell elenco che apparirà, trova BRCA2 Homo sapiens breast cancer 2, early onset (BRCA2), mrna. Prendi nota del numero di accesso identificativo NM_ (NM significa mrna naturale). Clicca su NM_ e si aprirà un tipico file di GenBank. Questa pagina è difficile da interpretare ma alcune informazioni sono chiare; prima di tutto ci sono le Reference, 7

8 cliccando sulle quali si possono trovare le citazioni alle pubblicazioni in letteratura scientifica che riguardano la nostra sequenza. Per leggere un abstract dell articolo che descrive il gene, clicca sul link PubMed presente in ogni Reference. Scendendo nella pagina puoi trovare informazioni più dettagliate sulla mutazione genica. Alla fine della pagina, nella sezione Features, troverai la sequenza di cdna (CDS). Questa è la sequenza utile per la ricerca in BLAT. Non si può copiare la sequenza CDS così come si trova nella pagina ma bisogna ottenere un file utile per la ricerca del gene correlato nelle banche dati. Per fare ciò bisogna risalire all inzio della pagina e di fianco al bottone Display cliccare per far scendere un menù a tendina e selezionare FASTA. Salva su un file di testo con il nome cdnafasta.doc la sequenza di basi che apparirà sullo schermo. Tornando in banca dati alla pagina con le caratteristiche di NM_000059, trova il numero identificativo della proteina prodotta dal gene (NP_000050), la sua sequenza di amminoacidi, copiala e salvala in un nuovo file di testo dal nome BRCA2 protein.doc. Prendi nota del numero di amminoacidi che costituiscono la proteina normale. Adesso che hai la sequenza codificante completa (cdna) del gene BRCA2 puoi cercarne la sequenza genomica usando il software BLAT. Come ricorderai, questo software ti permette di confrontare sequenze di cdna con sequenze genomiche complete e di identificarne la struttura in esoni ed introni. Ritorna alla pagina ed incolla la sequenza di cdna nella finestra di BLAT. Clicca submit e quando comparirà la nuova pagina clicca su details alla sinistra del primo record in elenco (score , nucleotides, 100% identity). Nella pagina che si apre troverai la tua sequenza di cdna, la sequenza di DNA genomico nella quale sono evidenziati in blu scuro e con le lettere maiuscole gli esoni, in nero e con le lettere minuscole gli introni e in azzurro i siti di splicing. Clicca sui links, nella colonna di sinistra, per navigare nella sequenza. Cliccando sui vari blocchi, ti appare ad inizio pagina l esone corrispondente nella sequenza genomica; noterai che ci sono 27 esoni nel gene BRCA2. Il tuo compito ora è di identificare quale è l esone che manca nel gene mutato di BRCA2. 8

9 Nella sequenza genomica ricerca i residui nucleotidici che corrispondono alla posizione della tua sonda sul cromosoma 13 (ricorda: chr13:31,848,838-31,852,238), semplicemente cliccando uno di seguito all altro i vari blocchi di sinistra e leggendo i numeri dei nucleotidi dell esone che apparirà in alto nella pagina. domanda3) sei in grado di rispondere alla domanda: qual è l esone che manca nel gene mutato BRCA2? La perdita dell esone è dovuta a una mutazione di un sito di splicing (sostituzione di G con A) nell introne 21, che porta alla perdita completa dell esone 22 (Wagner TM et al 1999, PMID: ). Copia la sequenza dell esone mancante e salvala in un file di testo dal nome missing exon.doc. Obiettivo 4 Costruire una scheda contenente tutte le informazioni sulle funzioni della proteina codificata dal gene BRCA2 normale. Apri l homepage di Swiss Prot all indirizzo Swiss Prot è un database di sequenze proteiche molto ricco e completo che contiene un livello molto elevato di annotazioni quali: la descrizione delle funzioni delle proteine, i domini strutturali, le modificazioni posttrascrizionali, le varianti ecc. Swiss Prot ha livelli minimi di ridondanza e alti livelli di integrazione con altri database bioinformatici. In alto nella pagina che 9

10 si apre, digita nel campo search la tua QUERY (richiesta): BRCA2 human, e clicca su GO; nella pagina seguente, nella lista di risultati che appaiono, cerca human BRCA2 protein (prendi nota del codice identificativo P51587). Clicca su BRCA2_HUMAN. La nuova pagina contiene informazioni raggruppate in categorie quali: [Entry info], [Name and origin], [References], [Comments], [Cross-references], [Keywords], [Features], [Sequence], [Tools]. Osserva tutta la pagina per raccogliere tutte le informazioni disponibili sulla proteina in esame. Nella sezione [Comments] troverai le informazioni sulle funzioni della proteina e in che tessuti è localizzata. Nella sezione [Cross-references], ci sono i links ad altri database per avere più informazioni su BRCA2. Per esempio la sequenza del gene che codifica per la proteina è disponibile su EMBL Genbank, i domini proteici su SMR, la struttura in 3D in PDB, Prosite, InterPro e Pfam, le malattie associate ad alterazioni del gene o della proteina in OMIM. Prendi nota del numero identificativo in PDB (1NOW), SMR (P51587) e OMIM (ci sono molti records tutti preceduti dalla sigla MIM). Obiettivo 5 Trovare le conseguenze della mutazione a livello della proteina. Puoi fare delle predizioni sulle conseguenze della perdita dell esone 22 nel gene BRCA2 sulla struttura e sulla funzione della proteina? Per rispondere a questa domanda devi ricostruire la molecola di mrna (o di cdna) priva dell esone 22 e poi tradurla nella corrispondente sequenza di amminoacidi. Apri il file della sequenza normale di cdna (cdnafasta.doc); apri anche il file della sequenza dell esone 22 (salvata come file missingexon.doc ). Cerca la sequenza dell esone 22 nella sequenza di cdna (ricordati che il cdna è solo una sequenza di esoni) e cancellala. La funzione di Word Cerca potrà aiutarti a trovare l esone 22 nel cdna ma devi prestare molta attenzione a cancellare solo l esone 22. Salva il risultato del tuo lavoro come file cdna22del.doc ( vedi allegato) 10

11 Ora bisogna usare un nuovo software per tradurre la sequenza di cdna mutata, cdna22del.doc (contenente la delezione) in sequenza di amminoacidi; vai al sito: Incolla la sequenza mutata nella finestra bianca e clicca translate DNA. Otterrai una immagine su fondo nero che è il risultato della traduzione della sequenza nelle 6 possibili cornici di lettura (3 per ogni elica di DNA): in verde sono rappresentati i possibili codoni di inizio e in viola i codoni di stop. Identifica la cornice di lettura detta anche Open Reading Frame o ORF più lunga, senza interruzioni date dai codoni di stop. Nel nostro caso la ORF più lunga è forward frame 3. Ora clicca su Text Output per visualizzare la sequenza e la sua traduzione in amminoacidi. Scegli la forward frame 3. Puoi facilmente personalizzare l interfaccia del software scegliendo di visualizzare la sequenza amminoacidica con il codice a una o a tre lettere, con o senza la sequenza di DNA appaiata. Scegli one letter code e amino acids and DNA. Copia il contenuto della finestra in un nuovo file di Word e salvalo come mutated protein.doc ); usa come font courier new or courier, dimensione 8, nero; è necessario utilizzare questo font per gli allineamenti di sequenza perché mantiene fissi e costanti gli spazi tra i caratteri. Localizzazione delle caratteristiche principali del cdna Ora puoi localizzare le principali caratteristiche del cdna/mrna, per esempio: 5 UTR (5 UnTranslated Region) start codon (inizio della traduzione, ATG (AUG) il codone della metionina) CDS (CoDing Sequence): la sequenza tradotta in proteina stop codon (fine della traduzione, TAA (UAA)/ TAG (UAG) / TGA (UGA) 3 UTR (3 UnTranslated Region) 11

12 sito polya (sito di poliadenilazione) costituito dalla sequenza consenso AATAAA generalmente localizzata bp (max bp) a monte dell inizio della coda di polya. Nota che talvolta questo sito può essere leggermente differente dalla sequenza consenso (per esempio ATTAAA). Identifica tutti gli elementi sopra elencati ed evidenziali con il colore verde e giallo. Iniziando dall estremità 5 della molecola, trova il codone d inizio cioè il primo ATG, che corrisponde alla prima metionina (M), non seguita a breve distanza da alcun codone di stop. Una volta identificato il codone di inizio puoi cancellare la sequenza di amminoacidi che lo precede che è la regione 5 UTR, non tradotta dai ribosomi in proteina. domanda 5 Quanto è lunga la proteina mutata? Confrontala con la lunghezza della proteina normale che hai annotato precedentemente. Obiettivo 6 domanda 6 Quali sono i domini principali della proteina BRCA2 normale? Quali domini mancano nella proteina mutata? Vai alla pagina Pfam raccoglie una collezione di allineamenti multipli di sequenze riguardanti i domini proteici e le famiglie più comuni. Per ogni famiglia in Pfam puoi trovare la struttura del dominio e della proteina nel suo 12

13 complesso. Inserisci il codice identificativo di Swiss Prot per la proteina BRCA2, P51587 nella finestra per la ricerca che si trova sotto Jump to alla voce enter ID/acc. Nella nuova pagina, si trova la lista dei domini conservati identificati all interno della proteina, con i residui amminoacidici corrispondenti. Cliccando sui singoli domini, si ottiene la rappresentazione grafica e la descrizione. Cerca la regione di circa 500 amminoacidi che mancano nella proteina mutata di Anne: si trovano nella parte finale della proteina ed esattamente appartengono al dominio Pfam-A_BRCA2_OB3 (aa ). Clicca ora sul link OB3 per conoscere le funzioni di questo dominio e riassumile qui sotto. Strutture 3D disponibili della proteina BRCA2 Vai alla home page di NCBI e cerca, nel database PROTEIN, BRCA2 Human e scegli la proteina P Alla sua destra clicca sul link Conserved domains. Nella pagina che si apre osserva la sequenza della proteina nella sua interezza e cliccando sull ultimo rettangolino rosso nella riga Specific hits comparirà una finestra che illustra le 13

14 caratteristiche del dominio OB3, clicca sul bottone Structure (nella barra orizzontale azzurra in cima alla pagina); nella pagina seguente inserisci BRCA2 human nella search box. Scegli 1IYJ (la sola struttura in 3D che contiene il dominio che ci interessa). 1IYJ è un frammento della proteina BRCA2 (817 residui) ingegnerizzato in un vettore, espresso in una linea cellulare, purificato e cristallizzato. Clicca su Structure view in Cn3D. Si scaricherà un file con estensione.cgi che potrà essere aperto solo con il programma chiamato 'Cn3D' (è possibile scaricare il programma di modellazione 3D gratuitamente dal sito dell NCBI). In una finestra a fondo nero viene mostrata la struttura in 3D di 1IYJD. Se non si visualizza la sequenza amminoacidica di 1IYJ, apri la finestra sequence viewer dal Menu Window in cima alla pagina. Questo programma 3D è interattivo: spostandosi col mouse su un punto qualsiasi della figura e tenendo premuto il tasto sinistro si può ruotare a piacere l immagine. Sono possibili diverse opzioni: - andando su Style _ Rendering Shortcuts si sceglie il tipo di modellizzazione (a sfere e bastoncini, a tubi, etc). Selezionando worms si ha una struttura vermiforme facilmente interpretabile. - andando su Style _ Coloring Shortcuts si sceglie il criterio di colorazione: Secondary Structure evidenzia con colori diversi le strutture ad alfa elica o a foglietto ripiegato; Molecule associa a ciascuna catena polipeptidica un colore diverso; Hydrophobicity evidenzia le zone idrofile e idrofobiche, Charge le cariche, etc. - Con Style _ Favorites _ Add/Replace si può salvare con nome l immagine tra i favoriti (comparirà nella tendina in basso). - Con Style _ Edit Global Style si ha una visione complessiva delle impostazioni ed è possibile modificarle: in Settings si modifica il tipo di modellizzazione, i colori di catene e sfondo, si decide se visualizzare o meno molecole estranee (esempio ioni zinco, fenolo, etc), gli oggetti che evidenziano la struttura secondaria, i ponti disolfuro. Per prendere familiarità, selezionare e deselezionare queste voci, osservando le variazioni nell immagine. In Labels è possibile visualizzare i nomi degli aminoacidi (alla voce Spacing si sceglie se scrivere un nome ogni uno, due, tre,... aminoacidi). In Details si modificano le dimensioni del tipo di modellizzazione scelta (ad esempio il diametro della struttura vermiforme ). - Alla voce Show/Hide _ Pick Structures... si decide se visualizzare tutte le catene, oppure solo alcune. Può essere utile per identificare quali sono le catene A e B di ciascun monomero. - Con View _ Animation _ Spin si fa partire la rotazione automatica del modello. 14

15 Scegli dal Menu Style Rendering shortcuts e Worms in modo da visualizzare la struttura secondaria con cilindri per le alfa eliche e frecce per i beta foglietti. Per vedere dove è posizionato un amminoacido devi cliccare il medesimo in una delle sequenze e la sua posizione apparirà scritta sul fondo della finestra (tra parentesi compare anche la posizione dell amminoacido nella proteina totale). Cliccando e trascinando il mouse su di una serie di residui amminoacidici nella sequenza cristallizzata (1IYJD) una barra gialla compare sulla struttura 3D nel punto in corrispondenza della posizione dei residui all interno della struttura. In effetti bisognerebbe allineare la proteina normale con la sua forma mutata. Purtroppo non sono ancora state realizzate le strutture 3D di molte proteine e neanche della varie forme mutanti della stessa proteina. Così bisogna riconoscere la mutazione (nel nostro caso la delezione dell esone 22) dalla posizione degli aa mancanti e prevedere quali interferenze strutturali potrebbero esserci nella proteina mutata. Questo metodo, non certamente ottimale, sarà migliorato dalla disponibilità di algoritmi più accurati per predire le strutture che eviteranno di dover determinare la struttura 3D sperimentalmente, lasciando al laboratorio solo la fase finale della validazione farmacologica. Obiettivo 7 Malattie associate con l alterazione del gene BRCA2. Visita il database OMIM per conoscere le malattie associate con le alterazioni di questo gene. Vai all indirizzo e clicca su OMIM nella barra in alto blu. Si aprirà il nuovo database nel quale dobbiamo cercare BRCA2. 15

16 Il gene BRCA2 (BReast CAncer 2) con il gene BRCA1 rappresentano i geni più importanti le cui mutazioni causano suscettibilità allo sviluppo del cancro al seno e all ovaio. BRCA2 è stato scoperto e studiato in famiglie islandesi che avevano casi di tumore al seno nel loro albero genealogico. Normalmente i geni BRCA2 e BRCA1 sono geni soppressori dei tumori poiché sono coinvolti nella sintesi di enzimi riparatori dei danni che può subire il DNA; hanno anche altre funzioni complesse che però non sono state completamente chiarite. Solo il 5-10% dei tumori al seno sono forme di tumore ereditario. In questi casi, nel 90% dei pazienti sono presenti mutazioni nei geni BRCA1 o BRCA2. I ricercatori hanno individuato 450 mutazioni solo nel gene BRCA2 e >600 nel gene BRCA1. Le mutazioni in BRCA1 sono responsabili del 50-85% dei casi di cancro al seno ereditari e aumentano del 15-45% il rischio di sviluppare il cancro alle ovaie. Le mutazioni in BRCA2 sono responsabili del 35% del cancro al seno ereditario ma conferiscono un rischio minore (10-20%) di sviluppare tumori alle ovaie. Entrambi i geni sono coinvolti anche nel tumore al seno nel maschio (6%). In tutti i casi ci sono dati che sottolineano un leggero incremento (6-14%) del rischio di sviluppare anche altri tipi di cancro (colon, prostata, pancreas). Nei casi sporadici (non familiari) di cancro al seno le mutazioni in BRCA1 e BRCA2 sono molto rare. La frequenza delle mutazioni nel gene BRCA2 che predispongono al cancro non è ancora stata definita a livello della popolazione generale,; si stima che, nella popolazione globale, la frequenza di soggetti portatori di mutazioni in uno di questi due geni sia fra 1/500 e 1/1000; a causa dell effetto fondatore, nei diversi gruppi etnici singole o poche mutazioni possono essere predominanti. Qui di seguito vengono illustrati due gruppi etnici con specifiche mutazioni in BRCA2 che predispongono al cancro: 1) la mutazione 999del5 di BRCA2 che predispone al cancro è presente nello 0,6% della popolazione generale Islandese, e rispettivamente nel 7.7% delle donne e nel 40% degli uomini affetti da tumore mammario [Thorlacius et al 1996, Thorlacius et al 1997]; 16

17 2) la mutazione 6174delT di BRCA2 presente con una frequenza dell 1% in individui discendenti da Ebrei Ashkenazi [Struewing et al 1995, Oddoux et al 1996, Roa et al 1996, Struewing et al 1997]. Considerando sia il gene BRCA1 Che BRCA2, nella popolazione degli Ebrei Ashkenaziti sono state osservate 3 tipi di mutazioni dovute a effetto fondatore: 187delAG (BRCA1), 5385insC (BRCA1) e 6174delT (BRCA2). Tra gli ebrei Ashkenaziti 1 individuo su 40 presenta una di queste tre mutazioni [Struewing et al 1997] A questo punto hai trovato un ago in un pagliaio!! Non hai solo individuato il gene ma hai fatto un percorso lungo e complicato: partendo da una sequenza sonda hai trovato molte informazioni sul gene BRCA2 e sulla sua proteina! Hai anche acquisito un metodo per farti domande e trovare risposte ad altre questioni riguardanti mutazioni geniche di tuo interesse (o di interesse dei tuoi studenti). Congratulazioni! Una caccia davvero di successo. A cura di: Prof.ssa Giovanna Viale, Dipartimento di Biologia e Genetica per le Scienze Mediche, Università degli Studi di Milano, Cus-Mi-Bio; Prof.ssa Cinzia Grazioli, docente di scienze del liceo scientifico Vittorio Veneto di Milano, distaccata presso il Cus-Mi-Bio 17

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Biologi molecolari in classe BIOLOGIA IN EVOLUZIONE. Alters & Alters. Centro Università di Milano - Scuola per la diffusione delle Bioscienze

Biologi molecolari in classe BIOLOGIA IN EVOLUZIONE. Alters & Alters. Centro Università di Milano - Scuola per la diffusione delle Bioscienze Alters & Alters BIOLOGIA IN EVOLUZIONE Comprendere la vita Biologi molecolari in classe a cura di Giovanna Viale e Cinzia Grazioli Centro Università di Milano - Scuola per la diffusione delle Bioscienze

Dettagli

Caccia al gene della Fibrosi Cistica

Caccia al gene della Fibrosi Cistica Caccia al gene della Fibrosi Cistica Scenario e simulazione di consulenza genetica Siete un genetista medico e lavorate in un consultorio genetico. Si presenta da voi una coppia che richiede consulenza

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI

Dettagli

4. Ricerca di sequenze in banche dati e allineamento multiplo

4. Ricerca di sequenze in banche dati e allineamento multiplo 4. Ricerca di sequenze in banche dati e allineamento multiplo Collegatevi al sito www.ncbi.nlm.nih.gov/blast. Apparirà una pagina nella quale le versioni di BLAST disponibili sono organizzate in base al

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Sperimenta il BioLab

Sperimenta il BioLab Sperimenta il BioLab Attività di Bioinformatica Le proteine in 3D Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 LE PROTEINE IN 3D Obiettivo dell'attività è

Dettagli

Sommario SELEZIONARE UN OGGETTO UTILIZZANDO LA BARRA DEGLI OGGETTI 10 NAVIGARE ATTRAVERSO I RECORD IN UNA TABELLA, IN UNA QUERY, IN UNA MASCHERA 12

Sommario SELEZIONARE UN OGGETTO UTILIZZANDO LA BARRA DEGLI OGGETTI 10 NAVIGARE ATTRAVERSO I RECORD IN UNA TABELLA, IN UNA QUERY, IN UNA MASCHERA 12 $FFHVV;3 A Sommario cura di Ninni Terranova Marco Alessi DETERMINARE L INPUT APPROPRIATO PER IL DATABASE 3 DETERMINARE L OUTPUT APPROPRIATO PER IL DATABASE 3 CREARE LA STRUTTURA DI UNA TABELLA 3 STABILIRE

Dettagli

MICROSOFT ACCESS. Fabrizio Barani 1

MICROSOFT ACCESS. Fabrizio Barani 1 MICROSOFT ACCESS Premessa ACCESS è un programma di gestione di banche dati, consente la creazione e modifica dei contenitori di informazioni di un database (tabelle), l inserimento di dati anche mediante

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Predizione della struttura terziaria

Predizione della struttura terziaria Predizione della struttura terziaria Metodi di predizione La predizione della struttura tridimensionale è di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi

Dettagli

EasyPrint v4.7. Impaginatore Album. Manuale Utente

EasyPrint v4.7. Impaginatore Album. Manuale Utente EasyPrint v4.7 Impaginatore Album Manuale Utente Lo strumento di impaginazione album consiste in una nuova funzione del software da banco EasyPrint 4 che permette di organizzare le immagini in maniera

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

MODULO 5 Basi di dati (database)

MODULO 5 Basi di dati (database) MODULO 5 Basi di dati (database) I contenuti del modulo: questo modulo riguarda la conoscenza da parte del candidato dei concetti fondamentali sulle basi di dati e la sua capacità di utilizzarli. Il modulo

Dettagli

UTILIZZO DI WORD PROCESSOR

UTILIZZO DI WORD PROCESSOR UTILIZZO DI WORD PROCESSOR (ELABORAZIONE TESTI) Laboratorio Informatico di base A.A. 2013/2014 Dipartimento di Scienze Aziendali e Giuridiche Università della Calabria Dott. Pierluigi Muoio (pierluigi.muoio@unical.it)

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Esercitazione n. 9: Creazione di un database relazionale

Esercitazione n. 9: Creazione di un database relazionale + Strumenti digitali per la comunicazione A.A 2013/14 Esercitazione n. 9: Creazione di un database relazionale Scopo: Scopo di questa esercitazione è la creazione di una base dati relazionale per la gestione

Dettagli

IMPOSTARE UNA MASCHERA CHE SI APRE AUTOMATICAMENTE

IMPOSTARE UNA MASCHERA CHE SI APRE AUTOMATICAMENTE IMPOSTARE UNA MASCHERA CHE SI APRE AUTOMATICAMENTE Access permette di specificare una maschera che deve essere visualizzata automaticamente all'apertura di un file. Vediamo come creare una maschera di

Dettagli

Germano Pettarin E-book per la preparazione all ECDL ECDL Modulo 3 Elaborazione testi Word Argomenti del Syllabus 5.0

Germano Pettarin E-book per la preparazione all ECDL ECDL Modulo 3 Elaborazione testi Word Argomenti del Syllabus 5.0 Germano Pettarin E-book per la preparazione all ECDL ECDL Modulo 3 Elaborazione testi Word Argomenti del Syllabus 5.0 G. Pettarin ECDL Modulo 3: Word 2 Modulo 3 Elaborazione testi Word G. Pettarin ECDL

Dettagli

10. Previsione della struttura tridimensionale di una proteina

10. Previsione della struttura tridimensionale di una proteina 10. Previsione della struttura tridimensionale di una proteina Lo scopo di questa esercitazione è di comprendere la logica alla base della modellizzazione per omologia attraverso la previsione della struttura

Dettagli

Indice III. Indice. Unità 1 Il personal computer, 1. Unità 2 AutoCAD, 9

Indice III. Indice. Unità 1 Il personal computer, 1. Unità 2 AutoCAD, 9 Indice III Indice Unità 1 Il personal computer, 1 1.1 Struttura del personal computer, 2 1.2 Il software, 5 1.3 I dispositivi informatici di stampa, 6 1.4 Il disegno al computer, 7 1.5 La fotografia digitale,

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

Dipartimento di Storia, Società e Studi sull Uomo Università del Salento Ing. Maria Grazia Celentano Mariagrazia.celentano@gmail.

Dipartimento di Storia, Società e Studi sull Uomo Università del Salento Ing. Maria Grazia Celentano Mariagrazia.celentano@gmail. Dipartimento di Storia, Società e Studi sull Uomo Università del Salento Ing. Maria Grazia Celentano Mariagrazia.celentano@gmail.com Indice: La finestra di Word Barra del titolo Barra dei menu Barra degli

Dettagli

MICROSOFT WORD INTRODUZIONE

MICROSOFT WORD INTRODUZIONE 1 MICROSOFT WORD INTRODUZIONE Word è il programma più diffuso per elaborazione di testi, il cui scopo fondamentale è assistere l utente nelle operazioni di digitazione, revisione e formattazione di testi.

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Microsoft Word 2007. La BARRA DI ACCESSO RAPIDO, che contiene alcuni comandi sempre visibili e può essere personalizzata.

Microsoft Word 2007. La BARRA DI ACCESSO RAPIDO, che contiene alcuni comandi sempre visibili e può essere personalizzata. Microsoft Word 2007 Microsoft Office Word è il programma di elaborazione testi di Microsoft all interno del pacchetto Office. Oggi Word ha un enorme diffusione, tanto da diventare l editor di testi più

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Associazione per lo sviluppo delle tecnologie nella didattica HOTPOTATOES. version 6.3. Tutorial a cura di Rosanna Imbrogno Marzo 2011

Associazione per lo sviluppo delle tecnologie nella didattica HOTPOTATOES. version 6.3. Tutorial a cura di Rosanna Imbrogno Marzo 2011 HOTPOTATOES version 6.3 Tutorial a cura di Rosanna Imbrogno Marzo 2011 I contenuti di questo lavoro, salvo diversa indicazione, sono rilasciati sotto una licenza Creative Commons License. Tutti i marchi

Dettagli

4. Fondamenti per la produttività informatica

4. Fondamenti per la produttività informatica Pagina 36 di 47 4. Fondamenti per la produttività informatica In questo modulo saranno compiuti i primi passi con i software applicativi più diffusi (elaboratore testi, elaboratore presentazioni ed elaboratore

Dettagli

strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine

Dettagli

Il mago delle presentazioni: PowerPoint

Il mago delle presentazioni: PowerPoint Informatica 2 livello/2ªb 21-02-2006 10:46 Pagina 48 Il mago delle presentazioni: è un programma di Microsoft che ti permette di creare presentazioni multimediali per mostrare, a chi vuoi, un tuo lavoro,

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Struttura logica di un programma

Struttura logica di un programma Struttura logica di un programma Tutti i programmi per computer prevedono tre operazioni principali: l input di dati (cioè l inserimento delle informazioni da elaborare) il calcolo dei risultati cercati

Dettagli

eascom MANUALE per UTENTI A cura di eascom 2012 www.eascom.it

eascom MANUALE per UTENTI A cura di eascom 2012 www.eascom.it MANUALE per UTENTI A cura di eascom 2012 www.eascom.it Indice Introduzione... 3 Perchè Wordpress... 3 Pagina di accesso all amministrazione... 3 Bacheca... 4 Home... 4 Aggiornamenti... 5 Articoli... 6

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Come utilizzare il servizio di creazione di siti Internet. Creazione di Site Internet

Come utilizzare il servizio di creazione di siti Internet. Creazione di Site Internet Come utilizzare il servizio di creazione di siti Internet Sommario 1) Come mi connetto al mio conto cliente? 2) Come creare il mio sito Internet? 3) Come amministrare le pagine del mio sito Internet? 4)

Dettagli

Lavorare con i Fireworks pop-up menus in Dreamweaver

Lavorare con i Fireworks pop-up menus in Dreamweaver Lavorare con i Fireworks pop-up menus in Dreamweaver Su una pagina Web, un menu pop-up è uno strumento di navigazione che rimane nascosto fino a che l utente non sposta il puntatore del mouse sopra un

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

L interfaccia. La barra delle applicazioni. MS Windows Barra delle Applicazioni

L interfaccia. La barra delle applicazioni. MS Windows Barra delle Applicazioni Windows XP In questa sezione, si desidero evidenziare le caratteristiche principali di Windows cercando possibilmente di suggerire, per quanto possibile, le strategie migliori per lavorare velocemente

Dettagli

Condividere i documenti

Condividere i documenti Appendice Condividere i documenti Quando si lavora in gruppo su uno stesso documento, spesso succede che ciascun redattore stampi una copia del testo per segnare su di essa, a mano, le proprie annotazioni

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

3. Confronto tra due sequenze

3. Confronto tra due sequenze 3. Confronto tra due sequenze Esercizio 1: uso di DotLet Il programma DotLet è accessibile dal sito http://myhits.isb-sib.ch/cgi-bin/dotlet, dove può essere utilizzato attraverso un interfaccia utente

Dettagli

STRUMENTI DI PRESENTAZIONE POWERPOINT 2003

STRUMENTI DI PRESENTAZIONE POWERPOINT 2003 STRUMENTI DI PRESENTAZIONE POWERPOINT 2003 INDICE 1 Strumenti di Presentazione... 4 2 Concetti generali di PowerPoint... 5 2.1 APRIRE POWERPOINT... 5 2.2 SELEZIONE DEL LAYOUT... 6 2.3 SALVARE LA PRESENTAZIONE...

Dettagli

CORSO DI INFORMATICA 1

CORSO DI INFORMATICA 1 CORSO DI INFORMATICA 1 All interno del computer ci sono dei dispositivi che permettono di memorizzare i lavori che vengono creati. Questi dispositivi sono l HARD-DISK (o DISCO FISSO) e il LETTORE E MASTERIZZATORE

Dettagli

Manuale Utente. Versione 3.0. Giugno 2012 1

Manuale Utente. Versione 3.0. Giugno 2012 1 Manuale Utente Versione 3.0 Giugno 2012 1 Manuale d uso di Parla con un Click Versione 3.0 Indice degli argomenti 1. Immagini Modificare le immagini - Modifiche generali delle immagini - Modifiche specifiche

Dettagli

INDICE L ambiente di lavoro... 2 Interfaccia di Word... 2 Le visualizzazioni... 5 Digitazione e revisione del testo...6 Modalità di selezione del

INDICE L ambiente di lavoro... 2 Interfaccia di Word... 2 Le visualizzazioni... 5 Digitazione e revisione del testo...6 Modalità di selezione del INDICE L ambiente di lavoro... 2 Interfaccia di Word... 2 Le visualizzazioni... 5 Digitazione e revisione del testo...6 Modalità di selezione del testo... 6 Selezione attraverso il mouse... 6 Selezione

Dettagli

MANUALE OPERATORE CMS ASMENET

MANUALE OPERATORE CMS ASMENET MANUALE OPERATORE CMS ASMENET 2.0 Pag. 1 di 46 INDICE Termini e definizioni... pag. 3 Introduzione... pag. 4 Descrizione generale e accesso al back office... pag. 5 1 Gestione della pagina... pag. 6 1.1

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

DIAGRAMMA CARTESIANO

DIAGRAMMA CARTESIANO DIAGRAMMA CARTESIANO Imparerai ora a costruire con excel un diagramma cartesiano. Inizialmente andremo a porre sul grafico un solo punto, lo vedremo cambiare di posizione cambiando i valori nelle celle

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

1. Aprire Microsoft Word

1. Aprire Microsoft Word Guida n 3 Realizzare, impaginare e stampare un documento (volantino) con Microsoft Word 1. Avviare Word e Creare un nuovo documento 2. Digitare un testo 3. Il comando annulla 4. Salvare un documento 5.

Dettagli

paragrafo. Testo Incorniciato Con bordo completo Testo Incorniciato Con bordo incompleto

paragrafo. Testo Incorniciato Con bordo completo Testo Incorniciato Con bordo incompleto Applicare bordi e sfondi ai paragrafi Word permette di creare un bordo attorno ad un intera pagina o solo attorno a paragrafi selezionati. Il testo risulta incorniciato in un rettangolo completo dei quattro

Dettagli

Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette

Dettagli

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

ISLIL. Offline Composer 1.0. Internet Hypertext Composer. Integrated System for Long Distance Intercultural Learning

ISLIL. Offline Composer 1.0. Internet Hypertext Composer. Integrated System for Long Distance Intercultural Learning ISLIL Integrated System for Long Distance Intercultural Learning Offline Composer 1.0 Internet Hypertext Composer Ciao! Sono Scottie, la tua mascotte. Entra con me all'interno di questo manuale e scoprirai

Dettagli

La pagina di Explorer

La pagina di Explorer G. Pettarin ECDL Modulo 7: Internet 11 A seconda della configurazione dell accesso alla rete, potrebbe apparire una o più finestre per l autenticazione della connessione remota alla rete. In linea generale

Dettagli

COME CREARE IL DATABASE GESTIONE CLIENTI IN ACCESS 2010

COME CREARE IL DATABASE GESTIONE CLIENTI IN ACCESS 2010 ALBERTO FORTUNATO COME CREARE IL DATABASE GESTIONE CLIENTI IN ACCESS 2010 SPIEGAZIONE ED ILLUSTRAZIONE GUIDATA DI TUTTI I PASSAGGI PER LA CREAZIONE DELLE TABELLE, DELLE MASCHERE, DELLE QUERY, DEI REPORT

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

MANUALE UTENTE GESTIONE SITO SVILUPPATO IN TYPO3

MANUALE UTENTE GESTIONE SITO SVILUPPATO IN TYPO3 Pag.1 di 23 MANUALE UTENTE GESTIONE SITO SVILUPPATO IN TYPO3 Pag.2 di 23 INDICE 1. Introduzione... 3 1.1. Premessa documento... 3 1.2. Caratteristiche Typo3... 3 1.3. Backend e Frontend... 3 1.4. Struttura

Dettagli

Strumenti Urbanistici on-line: requisiti e struttura del sito... Informazioni sulla procedura di download e installazione di Map Guide Viewer, sulla

Strumenti Urbanistici on-line: requisiti e struttura del sito... Informazioni sulla procedura di download e installazione di Map Guide Viewer, sulla Strumenti Urbanistici on-line: requisiti e struttura del sito... Informazioni sulla procedura di download e installazione di Map Guide Viewer, sulla struttura del sito e sugli elementi degli ambienti di

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Esercitazione n. 7: Presentazioni

Esercitazione n. 7: Presentazioni + Strumenti digitali per la comunicazione A.A 2013/14 Esercitazione n. 7: Presentazioni Scopo: Creare una presentazione con Microsoft PowerPoint 2010. Scegliere uno sfondo, uno stile per i caratteri, diversi

Dettagli

Excel Guida introduttiva

Excel Guida introduttiva Excel Guida introduttiva Informativa Questa guida nasce con l intento di spiegare in modo chiaro e preciso come usare il software Microsoft Excel. Questa è una guida completa creata dal sito http://pcalmeglio.altervista.org

Dettagli

USARE WORD. - non solo per scrivere - Un corso per chi vuole imparare ad usare Word senza fare fatica

USARE WORD. - non solo per scrivere - Un corso per chi vuole imparare ad usare Word senza fare fatica Pagina 1 di 32 USARE WORD - non solo per scrivere - Un corso per chi vuole imparare ad usare Word senza fare fatica Indice: - La finestra di Word pag. 2 - Barra del titolo pag. 3 - Barra dei menu pag.

Dettagli

USARE WORD - non solo per scrivere -

USARE WORD - non solo per scrivere - GUIDA WORD USARE WORD - non solo per scrivere - corso Word Un corso per chi vuole imparare ad usare Word senza fare fatica Indice: - La finestra di Word pag. 2 - Barra del titolo pag. 3 - Barra dei menu

Dettagli

MODULO DOMANDE INDICE

MODULO DOMANDE INDICE INDICE INDICE... 2 IL PROGRAMMA... 3 LA VIDEATA PRINCIPALE... 4 IL MENU FILE... 7 Esportare i file... 9 LA FINESTRA DELLA RISPOSTA... 11 TUTTI I MODI PER INSERIRE IL TESTO... 11 I Collegamenti... 12 MODELLI

Dettagli

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale.

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale. Homology modelling L omology modeling delle proteine è il tipo di predizione di struttura terziaria più semplice ed affidabile. Viene richiesta soltanto una (o più) sequenze di riferimento su cui modellare

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

HOT POTATOES MANUALE

HOT POTATOES MANUALE HOT POTATOES MANUALE Sommario Cos è Hot Potatoes... 3 Reperibilità... 3 Licenza. 3 Requisiti di sistema.. 3 Lingue utilizzate.. 3 Il quaderno... 4 documentazione. 4 Dove trovare e come scaricare il software.

Dettagli

APPUNTI WORD PER WINDOWS

APPUNTI WORD PER WINDOWS COBASLID Accedemia Ligustica di Belle Arti Laboratorio d informatica a.a 2005/06 prof Spaccini Gianfranco APPUNTI WORD PER WINDOWS 1. COSA È 2. NOZIONI DI BASE 2.1 COME AVVIARE WORD 2.2 LA FINESTRA DI

Dettagli

Laboratorio di Informatica. Facoltà di Economia Università di Foggia. Prof. Crescenzio Gallo

Laboratorio di Informatica. Facoltà di Economia Università di Foggia. Prof. Crescenzio Gallo . Laboratorio di Informatica Facoltà di Economia Università di Foggia Prof. Crescenzio Gallo Word è un programma di elaborazione testi che consente di creare, modificare e formattare documenti in modo

Dettagli

Guida al Caricamento dei Messaggi Personalizzati. Guida al Caricamento dei Messaggi Personalizzati

Guida al Caricamento dei Messaggi Personalizzati. Guida al Caricamento dei Messaggi Personalizzati Guida al Caricamento dei Messaggi Personalizzati Guida al Caricamento dei Messaggi Personalizzati 1 1 Introduzione... 3 2 Accesso al Self Care Web... 4 3 Caricamento dei messaggi principali... 7 3.1 Messaggio

Dettagli

SCRIVERE TESTI CON WORD

SCRIVERE TESTI CON WORD SCRIVERE TESTI CON WORD Per scrivere una lettera, un libro, una tesi, o un semplice cartello occorre un programma di elaborazione testo. Queste lezioni fanno riferimento al programma più conosciuto: Microsoft

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

Guida alla navigazione

Guida alla navigazione 4 Guida alla navigazione Avvio e struttura del software Il programma si installa automaticamente nel pc creando un icona di avvio sul desktop. Il software è utilizzabile con qualsiasi lavagna interattiva

Dettagli