Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "TUTTI UGUALI, TUTTI DIVERSI Caccia al gene"


1 Centro Università di Milano-Scuola per la diffusione delle bioscienze e delle biotecnologie TUTTI UGUALI, TUTTI DIVERSI Caccia al gene 1

2 Tutti uguali, tutti diversi Caccia al gene Lo scopo di questa attività pratica è di capire come attraverso l uso di banche dati bioinformatiche sia possibile, partendo da una sequenza parziale di DNA umano, identificare il gene a cui appartiene la sonda nucleotidica, identificare le differenze tra la sequenza data e quella normale, ottenere informazioni dettagliate sulla proteina codificata dal gene e sui tessuti in cui la proteina è espressa, mettere in relazione le alterazioni del gene con malattie. Ti verrà data una sequenza parziale di DNA (sonda) e con quella dovrai pescare il gene corrispondente. Sarà come trovare un ago in un pagliaio!! Obiettivi dell attività: 1. identificare un gene a partire da una sequenza (sonda) sconosciuta; 2. identificare la regione del cromosoma dove si trova il gene; 3. identificare una mutazione in una data sequenza di DNA; definire la struttura esone-introne del gene ed ottenere la sequenza completa del cdna; 4. identificare le caratteristiche principali della proteina codificata dal gene normale 5. trovare le conseguenze della mutazione a livello della proteina; identificare le principali caratteristiche del cdna elaborando uno schema con la posizione del codone di inizio, di stop e del segnale di poliadenilazione; tradurre la molecola di cdna nella corrispondente proteina; 6. ottenere informazioni sulla struttura in 3D della proteina; 7. capire come correlare la mutazione in un gene ad una malattia. 2

3 Scenario I test predittivi vengono proposti a individui asintomatici che hanno, nella loro famiglia, casi di malattie genetiche. Nella storia che viene proposta per l attività di bioinformatica, una donna con casi di cancro al seno in famiglia (vedi l albero genealogico della famiglia del probando) chiede di sottoporsi ad un test per evidenziare se è portatrice di geni di predisposizione alla malattia (in questo caso il tumore al seno). Anne, una giovane donna di 23 anni, si reca al suo primo appuntamento con il suo nuovo ginecologo; il dottore nota dal racconto di Anne che nella sua famiglia ci sono stati numerosi casi di cancro. La sua nonna paterna morì a 40 anni di cancro al seno; due delle quattro zie paterne sono morte prima dei 50 anni per cancro alle ovaie e ad una terza zia paterna di 39 anni è stato recentemente diagnosticato il cancro al seno. Il ginecologo pensa che nella famiglia di Anne possa essere presente una mutazione in uno dei due geni che controllano la predisposizione allo sviluppo del cancro al seno e/o all ovaio (BRCA1 or BRCA2). Durante la visita il ginecologo individua un nodulo sospetto nel seno destro di Anne e ne predispone una biopsia. Oltre all esame istologico, il ginecologo suggerisce ad Anne il test del DNA ma la informa che i risultati potranno essere informativi solo se si può fare il test anche sui famigliari, per individuare esattamente la mutazione tipica della sua famiglia. Anne contatta subito sua zia malata scoprendo che si è già sottoposta al test genetico da cui è risultata portarice di una rara mutazione nel gene BRCA2. Per fare diagnosi di malattie genetiche viene utilizzata dai laboratori una tecnica particolare: la RT- PCR (reverse transcription polymerase chain reaction). L RT-PCR è una tecnica che amplifica un frammento di acido ribonucleico (RNA). La molecola di RNA è dapprima trascritta nel DNA complementare (o cdna) attraverso l uso dell enzima trascrittasi inversa (RT), e in seguito amplificata utilizzando la reazione a catena della polimerasi. L RT-PCR usa come stampo una molecola di RNA ed è quindi molto utile per l analisi dell espressione genica in un tessuto. Sul campione della biopsia di Anne viene eseguita la RT-PCR e il prodotto della reazione viene sequenziato: si scopre che la mutazione nel gene di Anne è la stessa riscontrata nel DNA della zia. Userai una sequenza parziale di cdna di Anne come sonda per identificare la mutazione presente 3

4 in questa famiglia e per verificare la presenza della mutazione nel DNA di Anne. 4

5 Obiettivi 1 e 2: Identificare il gene a cui appartiene la sequenza (sonda) e la sua posizione sul cromosoma. Per raggiungere l obiettivo della prima parte dell attività devi usare il software BLAT (BLAST- Like Alignment Tool), un algoritmo ottimizzato per confrontare sequenze di cdna (prive di introni) con intere sequenze genomiche (che contengono introni). Vai al sito: Incolla nel box vuoto la sequenza nucleotidica TGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCA GCAGACCCAGCTTACCTTGAG TTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAAC AGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAA ATCTGAAAGAGCTAAC ATACAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCG GTTTCAGATGAAATTTTATTTCAGA TTTACCAGCCACGGGAGCCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGA per trovare la sua localizzazione nel genoma umano (controlla che sia selezionata la scelta human tra i genomi disponibili e clicca su submit. Bisogna attendere alcuni secondi per avere i risultati della ricerca del software BLAT. Scegli il primo risultato che mostri il migliore allineamento definito con un numero detto score: più alto è lo score migliore è l allineamento. Scoprirai che la tua sequenza (definita dal software query) è composta da 350 nucleotidi e si trova nel cromosoma 13. Se desideri maggiori dettagli sulla struttura esoni-introni della regione genomica in esame, clicca su details (userai questa funzione anche in seguito); ora però clicca su browser per trovare la regione cromosomica che contiene la sequenza che ci interessa. Nella schermata che si apre osserva che l ideogramma del cromosoma ha un tratto rosso nella posizione dove si trova la sequenza che 5

6 stiamo studiando. Nella finestra sottostante ritrovi la sequenza (your seq) al di sotto della quale c è la sequenza genomica (known genes) che si allinea nel miglior modo possibile; per capire bene le informazioni contenute in questa finestra bisogna rinfrescare le conoscenze sulla struttura del gene. I geni rappresentano solo l 1% del genoma umano e gli scienziati stanno ancora studiando per capire la composizione e la funzione del restante 99%. Negli eucarioti i geni sono affiancati da lunghe sequenze non codificanti il cui significato risulta ancora abbastanza oscuro (queste sequenze sono anche dette DNA spazzatura); quando viene localizzato un gene si nota che è suddiviso in piccole parti dette esoni, che sono le parti codificanti proteine o molecole di RNA e che gli esoni sono separati da lunghi tratti non codificanti detti introni. Nella finestra di BLAT gli esoni sono rappresentati da blocchetti neri o rossi, mentre gli introni sono raffigurati come linee sottili. domanda1) Prendi nota della posizione della sonda che stai studiando sul cromosoma 13 e della lunghezza della regione. Il gene al quale appartiene la tua sonda è quello che mostra il migliore allineamento, indicato sotto a your seq :come ci attendevamo, è BRCA2. Obiettivo 3 Identificare la mutazione presente nel DNA di Anne e nella sua famiglia Confronta la struttura della tua sequenza (your seq) con la struttura del gene normale sottostante. 6

7 domanda2) Quanti esoni sono visibili in questa parte di gene? Quanti esoni ci sono nella tua sequenza? Ci sono differenze tra la struttura esoni-introni della tua sequenza e la struttura della sequenza del gene normale? Cosa possiamo dire sulla mutazione genica di Anne? In questa pagina ci sono altre informazioni; sulla sinistra ci sono dei blocchetti grigi e blu: l interfaccia del browser ti permette di personalizzare ed arricchire la tua ricerca visualizzando informazioni diverse, aggiungendone o nascondendone altre. Infatti cliccando sui blocchetti verticali si accede ad altre pagine e si possono cambiare anche i parametri della ricerca. Osserva attentamente la barra verticale relativa alla conservazione della sequenza (Vertebrate Alignment and Conservation). Nota che le regioni maggiormente conservate corrispondono agli esoni (i rettangoli colorati pieni nella sezione RefSeq genes ) e che queste regioni si conservano anche in specie di vertebrati lontane evolutivamente dall uomo, come in opossum, pollo o rana. Un discreto livello di conservazione si osserva anche in alcune regioni introniche (conservazione delle sequenze non-codificanti) ma ancora non ne è chiaro il ruolo anche se si può supporre che siano zone coinvolte nella regolazione dell espressione genica. La penultima barra mostra gli SNPs (single nucleotide polymorphisms) e l ultima, Repeat masker, mostra le sequenze ripetute. Ora dobbiamo trovare quale è l esone che manca nella mutazione della famiglia di Anne. Per ottenere questa informazione bisogna trovare la struttura esone-introne completa del gene normale BRCA2. Per fare questo hai bisogno della sequenza codificante completa (CDS) e, con questa, cominciare una nuova ricerca BLAT. Vai alla pagina per trovare il codice identificativo del gene BRCA2. Seleziona Nucleotide nel campo search posizionato in alto a sinistra nella home page e digita BRCA2 homo sapiens nel campo for. Clicca poi su Go. Nell elenco che apparirà, trova BRCA2 Homo sapiens breast cancer 2, early onset (BRCA2), mrna. Prendi nota del numero di accesso identificativo NM_ (NM significa mrna naturale). Clicca su NM_ e si aprirà un tipico file di GenBank. Questa pagina è difficile da interpretare ma alcune informazioni sono chiare; prima di tutto ci sono le Reference, 7

8 cliccando sulle quali si possono trovare le citazioni alle pubblicazioni in letteratura scientifica che riguardano la nostra sequenza. Per leggere un abstract dell articolo che descrive il gene, clicca sul link PubMed presente in ogni Reference. Scendendo nella pagina puoi trovare informazioni più dettagliate sulla mutazione genica. Alla fine della pagina, nella sezione Features, troverai la sequenza di cdna (CDS). Questa è la sequenza utile per la ricerca in BLAT. Non si può copiare la sequenza CDS così come si trova nella pagina ma bisogna ottenere un file utile per la ricerca del gene correlato nelle banche dati. Per fare ciò bisogna risalire all inzio della pagina e di fianco al bottone Display cliccare per far scendere un menù a tendina e selezionare FASTA. Salva su un file di testo con il nome cdnafasta.doc la sequenza di basi che apparirà sullo schermo. Tornando in banca dati alla pagina con le caratteristiche di NM_000059, trova il numero identificativo della proteina prodotta dal gene (NP_000050), la sua sequenza di amminoacidi, copiala e salvala in un nuovo file di testo dal nome BRCA2 protein.doc. Prendi nota del numero di amminoacidi che costituiscono la proteina normale. Adesso che hai la sequenza codificante completa (cdna) del gene BRCA2 puoi cercarne la sequenza genomica usando il software BLAT. Come ricorderai, questo software ti permette di confrontare sequenze di cdna con sequenze genomiche complete e di identificarne la struttura in esoni ed introni. Ritorna alla pagina ed incolla la sequenza di cdna nella finestra di BLAT. Clicca submit e quando comparirà la nuova pagina clicca su details alla sinistra del primo record in elenco (score , nucleotides, 100% identity). Nella pagina che si apre troverai la tua sequenza di cdna, la sequenza di DNA genomico nella quale sono evidenziati in blu scuro e con le lettere maiuscole gli esoni, in nero e con le lettere minuscole gli introni e in azzurro i siti di splicing. Clicca sui links, nella colonna di sinistra, per navigare nella sequenza. Cliccando sui vari blocchi, ti appare ad inizio pagina l esone corrispondente nella sequenza genomica; noterai che ci sono 27 esoni nel gene BRCA2. Il tuo compito ora è di identificare quale è l esone che manca nel gene mutato di BRCA2. 8

9 Nella sequenza genomica ricerca i residui nucleotidici che corrispondono alla posizione della tua sonda sul cromosoma 13 (ricorda: chr13:31,848,838-31,852,238), semplicemente cliccando uno di seguito all altro i vari blocchi di sinistra e leggendo i numeri dei nucleotidi dell esone che apparirà in alto nella pagina. domanda3) sei in grado di rispondere alla domanda: qual è l esone che manca nel gene mutato BRCA2? La perdita dell esone è dovuta a una mutazione di un sito di splicing (sostituzione di G con A) nell introne 21, che porta alla perdita completa dell esone 22 (Wagner TM et al 1999, PMID: ). Copia la sequenza dell esone mancante e salvala in un file di testo dal nome missing exon.doc. Obiettivo 4 Costruire una scheda contenente tutte le informazioni sulle funzioni della proteina codificata dal gene BRCA2 normale. Apri l homepage di Swiss Prot all indirizzo Swiss Prot è un database di sequenze proteiche molto ricco e completo che contiene un livello molto elevato di annotazioni quali: la descrizione delle funzioni delle proteine, i domini strutturali, le modificazioni posttrascrizionali, le varianti ecc. Swiss Prot ha livelli minimi di ridondanza e alti livelli di integrazione con altri database bioinformatici. In alto nella pagina che 9

10 si apre, digita nel campo search la tua QUERY (richiesta): BRCA2 human, e clicca su GO; nella pagina seguente, nella lista di risultati che appaiono, cerca human BRCA2 protein (prendi nota del codice identificativo P51587). Clicca su BRCA2_HUMAN. La nuova pagina contiene informazioni raggruppate in categorie quali: [Entry info], [Name and origin], [References], [Comments], [Cross-references], [Keywords], [Features], [Sequence], [Tools]. Osserva tutta la pagina per raccogliere tutte le informazioni disponibili sulla proteina in esame. Nella sezione [Comments] troverai le informazioni sulle funzioni della proteina e in che tessuti è localizzata. Nella sezione [Cross-references], ci sono i links ad altri database per avere più informazioni su BRCA2. Per esempio la sequenza del gene che codifica per la proteina è disponibile su EMBL Genbank, i domini proteici su SMR, la struttura in 3D in PDB, Prosite, InterPro e Pfam, le malattie associate ad alterazioni del gene o della proteina in OMIM. Prendi nota del numero identificativo in PDB (1NOW), SMR (P51587) e OMIM (ci sono molti records tutti preceduti dalla sigla MIM). Obiettivo 5 Trovare le conseguenze della mutazione a livello della proteina. Puoi fare delle predizioni sulle conseguenze della perdita dell esone 22 nel gene BRCA2 sulla struttura e sulla funzione della proteina? Per rispondere a questa domanda devi ricostruire la molecola di mrna (o di cdna) priva dell esone 22 e poi tradurla nella corrispondente sequenza di amminoacidi. Apri il file della sequenza normale di cdna (cdnafasta.doc); apri anche il file della sequenza dell esone 22 (salvata come file missingexon.doc ). Cerca la sequenza dell esone 22 nella sequenza di cdna (ricordati che il cdna è solo una sequenza di esoni) e cancellala. La funzione di Word Cerca potrà aiutarti a trovare l esone 22 nel cdna ma devi prestare molta attenzione a cancellare solo l esone 22. Salva il risultato del tuo lavoro come file cdna22del.doc ( vedi allegato) 10

11 Ora bisogna usare un nuovo software per tradurre la sequenza di cdna mutata, cdna22del.doc (contenente la delezione) in sequenza di amminoacidi; vai al sito: Incolla la sequenza mutata nella finestra bianca e clicca translate DNA. Otterrai una immagine su fondo nero che è il risultato della traduzione della sequenza nelle 6 possibili cornici di lettura (3 per ogni elica di DNA): in verde sono rappresentati i possibili codoni di inizio e in viola i codoni di stop. Identifica la cornice di lettura detta anche Open Reading Frame o ORF più lunga, senza interruzioni date dai codoni di stop. Nel nostro caso la ORF più lunga è forward frame 3. Ora clicca su Text Output per visualizzare la sequenza e la sua traduzione in amminoacidi. Scegli la forward frame 3. Puoi facilmente personalizzare l interfaccia del software scegliendo di visualizzare la sequenza amminoacidica con il codice a una o a tre lettere, con o senza la sequenza di DNA appaiata. Scegli one letter code e amino acids and DNA. Copia il contenuto della finestra in un nuovo file di Word e salvalo come mutated protein.doc ); usa come font courier new or courier, dimensione 8, nero; è necessario utilizzare questo font per gli allineamenti di sequenza perché mantiene fissi e costanti gli spazi tra i caratteri. Localizzazione delle caratteristiche principali del cdna Ora puoi localizzare le principali caratteristiche del cdna/mrna, per esempio: 5 UTR (5 UnTranslated Region) start codon (inizio della traduzione, ATG (AUG) il codone della metionina) CDS (CoDing Sequence): la sequenza tradotta in proteina stop codon (fine della traduzione, TAA (UAA)/ TAG (UAG) / TGA (UGA) 3 UTR (3 UnTranslated Region) 11

12 sito polya (sito di poliadenilazione) costituito dalla sequenza consenso AATAAA generalmente localizzata bp (max bp) a monte dell inizio della coda di polya. Nota che talvolta questo sito può essere leggermente differente dalla sequenza consenso (per esempio ATTAAA). Identifica tutti gli elementi sopra elencati ed evidenziali con il colore verde e giallo. Iniziando dall estremità 5 della molecola, trova il codone d inizio cioè il primo ATG, che corrisponde alla prima metionina (M), non seguita a breve distanza da alcun codone di stop. Una volta identificato il codone di inizio puoi cancellare la sequenza di amminoacidi che lo precede che è la regione 5 UTR, non tradotta dai ribosomi in proteina. domanda 5 Quanto è lunga la proteina mutata? Confrontala con la lunghezza della proteina normale che hai annotato precedentemente. Obiettivo 6 domanda 6 Quali sono i domini principali della proteina BRCA2 normale? Quali domini mancano nella proteina mutata? Vai alla pagina Pfam raccoglie una collezione di allineamenti multipli di sequenze riguardanti i domini proteici e le famiglie più comuni. Per ogni famiglia in Pfam puoi trovare la struttura del dominio e della proteina nel suo 12

13 complesso. Inserisci il codice identificativo di Swiss Prot per la proteina BRCA2, P51587 nella finestra per la ricerca che si trova sotto Jump to alla voce enter ID/acc. Nella nuova pagina, si trova la lista dei domini conservati identificati all interno della proteina, con i residui amminoacidici corrispondenti. Cliccando sui singoli domini, si ottiene la rappresentazione grafica e la descrizione. Cerca la regione di circa 500 amminoacidi che mancano nella proteina mutata di Anne: si trovano nella parte finale della proteina ed esattamente appartengono al dominio Pfam-A_BRCA2_OB3 (aa ). Clicca ora sul link OB3 per conoscere le funzioni di questo dominio e riassumile qui sotto. Strutture 3D disponibili della proteina BRCA2 Vai alla home page di NCBI e cerca, nel database PROTEIN, BRCA2 Human e scegli la proteina P Alla sua destra clicca sul link Conserved domains. Nella pagina che si apre osserva la sequenza della proteina nella sua interezza e cliccando sull ultimo rettangolino rosso nella riga Specific hits comparirà una finestra che illustra le 13

14 caratteristiche del dominio OB3, clicca sul bottone Structure (nella barra orizzontale azzurra in cima alla pagina); nella pagina seguente inserisci BRCA2 human nella search box. Scegli 1IYJ (la sola struttura in 3D che contiene il dominio che ci interessa). 1IYJ è un frammento della proteina BRCA2 (817 residui) ingegnerizzato in un vettore, espresso in una linea cellulare, purificato e cristallizzato. Clicca su Structure view in Cn3D. Si scaricherà un file con estensione.cgi che potrà essere aperto solo con il programma chiamato 'Cn3D' (è possibile scaricare il programma di modellazione 3D gratuitamente dal sito dell NCBI). In una finestra a fondo nero viene mostrata la struttura in 3D di 1IYJD. Se non si visualizza la sequenza amminoacidica di 1IYJ, apri la finestra sequence viewer dal Menu Window in cima alla pagina. Questo programma 3D è interattivo: spostandosi col mouse su un punto qualsiasi della figura e tenendo premuto il tasto sinistro si può ruotare a piacere l immagine. Sono possibili diverse opzioni: - andando su Style _ Rendering Shortcuts si sceglie il tipo di modellizzazione (a sfere e bastoncini, a tubi, etc). Selezionando worms si ha una struttura vermiforme facilmente interpretabile. - andando su Style _ Coloring Shortcuts si sceglie il criterio di colorazione: Secondary Structure evidenzia con colori diversi le strutture ad alfa elica o a foglietto ripiegato; Molecule associa a ciascuna catena polipeptidica un colore diverso; Hydrophobicity evidenzia le zone idrofile e idrofobiche, Charge le cariche, etc. - Con Style _ Favorites _ Add/Replace si può salvare con nome l immagine tra i favoriti (comparirà nella tendina in basso). - Con Style _ Edit Global Style si ha una visione complessiva delle impostazioni ed è possibile modificarle: in Settings si modifica il tipo di modellizzazione, i colori di catene e sfondo, si decide se visualizzare o meno molecole estranee (esempio ioni zinco, fenolo, etc), gli oggetti che evidenziano la struttura secondaria, i ponti disolfuro. Per prendere familiarità, selezionare e deselezionare queste voci, osservando le variazioni nell immagine. In Labels è possibile visualizzare i nomi degli aminoacidi (alla voce Spacing si sceglie se scrivere un nome ogni uno, due, tre,... aminoacidi). In Details si modificano le dimensioni del tipo di modellizzazione scelta (ad esempio il diametro della struttura vermiforme ). - Alla voce Show/Hide _ Pick Structures... si decide se visualizzare tutte le catene, oppure solo alcune. Può essere utile per identificare quali sono le catene A e B di ciascun monomero. - Con View _ Animation _ Spin si fa partire la rotazione automatica del modello. 14

15 Scegli dal Menu Style Rendering shortcuts e Worms in modo da visualizzare la struttura secondaria con cilindri per le alfa eliche e frecce per i beta foglietti. Per vedere dove è posizionato un amminoacido devi cliccare il medesimo in una delle sequenze e la sua posizione apparirà scritta sul fondo della finestra (tra parentesi compare anche la posizione dell amminoacido nella proteina totale). Cliccando e trascinando il mouse su di una serie di residui amminoacidici nella sequenza cristallizzata (1IYJD) una barra gialla compare sulla struttura 3D nel punto in corrispondenza della posizione dei residui all interno della struttura. In effetti bisognerebbe allineare la proteina normale con la sua forma mutata. Purtroppo non sono ancora state realizzate le strutture 3D di molte proteine e neanche della varie forme mutanti della stessa proteina. Così bisogna riconoscere la mutazione (nel nostro caso la delezione dell esone 22) dalla posizione degli aa mancanti e prevedere quali interferenze strutturali potrebbero esserci nella proteina mutata. Questo metodo, non certamente ottimale, sarà migliorato dalla disponibilità di algoritmi più accurati per predire le strutture che eviteranno di dover determinare la struttura 3D sperimentalmente, lasciando al laboratorio solo la fase finale della validazione farmacologica. Obiettivo 7 Malattie associate con l alterazione del gene BRCA2. Visita il database OMIM per conoscere le malattie associate con le alterazioni di questo gene. Vai all indirizzo e clicca su OMIM nella barra in alto blu. Si aprirà il nuovo database nel quale dobbiamo cercare BRCA2. 15

16 Il gene BRCA2 (BReast CAncer 2) con il gene BRCA1 rappresentano i geni più importanti le cui mutazioni causano suscettibilità allo sviluppo del cancro al seno e all ovaio. BRCA2 è stato scoperto e studiato in famiglie islandesi che avevano casi di tumore al seno nel loro albero genealogico. Normalmente i geni BRCA2 e BRCA1 sono geni soppressori dei tumori poiché sono coinvolti nella sintesi di enzimi riparatori dei danni che può subire il DNA; hanno anche altre funzioni complesse che però non sono state completamente chiarite. Solo il 5-10% dei tumori al seno sono forme di tumore ereditario. In questi casi, nel 90% dei pazienti sono presenti mutazioni nei geni BRCA1 o BRCA2. I ricercatori hanno individuato 450 mutazioni solo nel gene BRCA2 e >600 nel gene BRCA1. Le mutazioni in BRCA1 sono responsabili del 50-85% dei casi di cancro al seno ereditari e aumentano del 15-45% il rischio di sviluppare il cancro alle ovaie. Le mutazioni in BRCA2 sono responsabili del 35% del cancro al seno ereditario ma conferiscono un rischio minore (10-20%) di sviluppare tumori alle ovaie. Entrambi i geni sono coinvolti anche nel tumore al seno nel maschio (6%). In tutti i casi ci sono dati che sottolineano un leggero incremento (6-14%) del rischio di sviluppare anche altri tipi di cancro (colon, prostata, pancreas). Nei casi sporadici (non familiari) di cancro al seno le mutazioni in BRCA1 e BRCA2 sono molto rare. La frequenza delle mutazioni nel gene BRCA2 che predispongono al cancro non è ancora stata definita a livello della popolazione generale,; si stima che, nella popolazione globale, la frequenza di soggetti portatori di mutazioni in uno di questi due geni sia fra 1/500 e 1/1000; a causa dell effetto fondatore, nei diversi gruppi etnici singole o poche mutazioni possono essere predominanti. Qui di seguito vengono illustrati due gruppi etnici con specifiche mutazioni in BRCA2 che predispongono al cancro: 1) la mutazione 999del5 di BRCA2 che predispone al cancro è presente nello 0,6% della popolazione generale Islandese, e rispettivamente nel 7.7% delle donne e nel 40% degli uomini affetti da tumore mammario [Thorlacius et al 1996, Thorlacius et al 1997]; 16

17 2) la mutazione 6174delT di BRCA2 presente con una frequenza dell 1% in individui discendenti da Ebrei Ashkenazi [Struewing et al 1995, Oddoux et al 1996, Roa et al 1996, Struewing et al 1997]. Considerando sia il gene BRCA1 Che BRCA2, nella popolazione degli Ebrei Ashkenaziti sono state osservate 3 tipi di mutazioni dovute a effetto fondatore: 187delAG (BRCA1), 5385insC (BRCA1) e 6174delT (BRCA2). Tra gli ebrei Ashkenaziti 1 individuo su 40 presenta una di queste tre mutazioni [Struewing et al 1997] A questo punto hai trovato un ago in un pagliaio!! Non hai solo individuato il gene ma hai fatto un percorso lungo e complicato: partendo da una sequenza sonda hai trovato molte informazioni sul gene BRCA2 e sulla sua proteina! Hai anche acquisito un metodo per farti domande e trovare risposte ad altre questioni riguardanti mutazioni geniche di tuo interesse (o di interesse dei tuoi studenti). Congratulazioni! Una caccia davvero di successo. A cura di: Prof.ssa Giovanna Viale, Dipartimento di Biologia e Genetica per le Scienze Mediche, Università degli Studi di Milano, Cus-Mi-Bio; Prof.ssa Cinzia Grazioli, docente di scienze del liceo scientifico Vittorio Veneto di Milano, distaccata presso il Cus-Mi-Bio 17

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo


Vai al sito: Incolla nel box vuoto la sequenza nucleotidica

Vai al sito:  Incolla nel box vuoto la sequenza nucleotidica Identificare il gene a cui appartiene la sequenza (sonda) e la sua posizione sul cromosoma. Per raggiungere l obiettivo della prima parte dell attività devi usare il software BLAT (BLAST- Like Alignment


Il foglio elettronico

Il foglio elettronico Il foglio elettronico Foglio di calcolo, Spreadsheet in inglese, Permette di elaborare DATI NUMERICI. E una TABELLA che contiene numeri che possono essere elaborati con FUNZIONI matematiche e statistiche.


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


4. Ricerca di sequenze in banche dati e allineamento multiplo

4. Ricerca di sequenze in banche dati e allineamento multiplo 4. Ricerca di sequenze in banche dati e allineamento multiplo Collegatevi al sito www.ncbi.nlm.nih.gov/blast. Apparirà una pagina nella quale le versioni di BLAST disponibili sono organizzate in base al


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta


EasyPrint v4.7. Impaginatore Album. Manuale Utente

EasyPrint v4.7. Impaginatore Album. Manuale Utente EasyPrint v4.7 Impaginatore Album Manuale Utente Lo strumento di impaginazione album consiste in una nuova funzione del software da banco EasyPrint 4 che permette di organizzare le immagini in maniera


Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.



IMPOSTARE UNA MASCHERA CHE SI APRE AUTOMATICAMENTE IMPOSTARE UNA MASCHERA CHE SI APRE AUTOMATICAMENTE Access permette di specificare una maschera che deve essere visualizzata automaticamente all'apertura di un file. Vediamo come creare una maschera di


Microsoft Access - dispensa didattica ECDL Modulo 5 - a cura di Antonino Terranova PAG 1

Microsoft Access - dispensa didattica ECDL Modulo 5 - a cura di Antonino Terranova PAG 1 Microsoft Access - Determinare l input appropriato per il database...2 Determinare l output appropriato per il database...2 Creare un database usando l autocomposizione...2 Creare la struttura di una tabella...4



lo 2 2-1 - PERSONALIZZARE LA FINESTRA DI WORD 2000 Capittol lo 2 Visualizzazione 2-1 - PERSONALIZZARE LA FINESTRA DI WORD 2000 Nel primo capitolo sono state analizzate le diverse componenti della finestra di Word 2000: barra del titolo, barra dei menu,


La pagina di Explorer

La pagina di Explorer G. Pettarin ECDL Modulo 7: Internet 11 A seconda della configurazione dell accesso alla rete, potrebbe apparire una o più finestre per l autenticazione della connessione remota alla rete. In linea generale


Esercitazione n. 8: Funzionalità base di MS Access

Esercitazione n. 8: Funzionalità base di MS Access + Strumenti digitali per la comunicazione A.A 2013/14 Esercitazione n. 8: Funzionalità base di MS Access Scopo: Familiarizzare con le funzionalità principali del DBMS (Database Management System) Microsoft


EasyPrint v4.15. Gadget e calendari. Manuale Utente

EasyPrint v4.15. Gadget e calendari. Manuale Utente EasyPrint v4.15 Gadget e calendari Manuale Utente Lo strumento di impaginazione gadget e calendari consiste in una nuova funzione del software da banco EasyPrint 4 che permette di ordinare in maniera semplice


Come iniziare a usare Google Drive

Come iniziare a usare Google Drive Come iniziare a usare Google Drive Per registrarsi: occorre avere già o aprirsi un account su GMAIL (la posta elettronica di Google) Per aprire un account su gmail https://accounts.google.com/signup?hl=it


Biologi molecolari in classe BIOLOGIA IN EVOLUZIONE. Alters & Alters. Centro Università di Milano - Scuola per la diffusione delle Bioscienze

Biologi molecolari in classe BIOLOGIA IN EVOLUZIONE. Alters & Alters. Centro Università di Milano - Scuola per la diffusione delle Bioscienze Alters & Alters BIOLOGIA IN EVOLUZIONE Comprendere la vita Biologi molecolari in classe a cura di Giovanna Viale e Cinzia Grazioli Centro Università di Milano - Scuola per la diffusione delle Bioscienze


4. Fondamenti per la produttività informatica

4. Fondamenti per la produttività informatica Pagina 36 di 47 4. Fondamenti per la produttività informatica In questo modulo saranno compiuti i primi passi con i software applicativi più diffusi (elaboratore testi, elaboratore presentazioni ed elaboratore


On-line Corsi d Informatica sul web

On-line Corsi d Informatica sul web On-line Corsi d Informatica sul web Corso base di FrontPage Università degli Studi della Repubblica di San Marino Capitolo1 CREARE UN NUOVO SITO INTERNET Aprire Microsoft FrontPage facendo clic su Start/Avvio


[Tutoriale] Realizzare un cruciverba con Excel

[Tutoriale] Realizzare un cruciverba con Excel [Tutoriale] Realizzare un cruciverba con Excel Aperta in Excel una nuova cartella (un nuovo file), salviamo con nome in una precisa nostra cartella. Cominciamo con la Formattazione del foglio di lavoro.


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,


Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


Esercitazione n. 9: Creazione di un database relazionale

Esercitazione n. 9: Creazione di un database relazionale + Strumenti digitali per la comunicazione A.A 2013/14 Esercitazione n. 9: Creazione di un database relazionale Scopo: Scopo di questa esercitazione è la creazione di una base dati relazionale per la gestione


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze


Manuale Utente. Versione 3.0. Giugno 2012 1

Manuale Utente. Versione 3.0. Giugno 2012 1 Manuale Utente Versione 3.0 Giugno 2012 1 Manuale d uso di Parla con un Click Versione 3.0 Indice degli argomenti 1. Immagini Modificare le immagini - Modifiche generali delle immagini - Modifiche specifiche


Guida all'uso del CMS (Content Management System, Sistema di Gestione dei Contenuti)

Guida all'uso del CMS (Content Management System, Sistema di Gestione dei Contenuti) GUIDE Sa.Sol. Desk: Rete Telematica tra le Associazioni di Volontariato della Sardegna Guida all'uso del CMS (Content Management System, Sistema di Gestione dei Contenuti) Argomento Descrizione Gestione


ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor


1. I database. La schermata di avvio di Access

1. I database. La schermata di avvio di Access 7 Microsoft Access 1. I database Con il termine database (o base di dati) si intende una raccolta organizzata di dati, strutturati in maniera tale che, effettuandovi operazioni di vario tipo (inserimento


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


paragrafo. Testo Incorniciato Con bordo completo Testo Incorniciato Con bordo incompleto

paragrafo. Testo Incorniciato Con bordo completo Testo Incorniciato Con bordo incompleto Applicare bordi e sfondi ai paragrafi Word permette di creare un bordo attorno ad un intera pagina o solo attorno a paragrafi selezionati. Il testo risulta incorniciato in un rettangolo completo dei quattro


Caccia al gene della Fibrosi Cistica

Caccia al gene della Fibrosi Cistica Caccia al gene della Fibrosi Cistica Scenario e simulazione di consulenza genetica Siete un genetista medico e lavorate in un consultorio genetico. Si presenta da voi una coppia che richiede consulenza


MODULO 5 Basi di dati (database)

MODULO 5 Basi di dati (database) MODULO 5 Basi di dati (database) I contenuti del modulo: questo modulo riguarda la conoscenza da parte del candidato dei concetti fondamentali sulle basi di dati e la sua capacità di utilizzarli. Il modulo


WORD per WINDOWS95. Un word processor e` come una macchina da scrivere ma. con molte più funzioni. Il testo viene battuto sulla tastiera

WORD per WINDOWS95. Un word processor e` come una macchina da scrivere ma. con molte più funzioni. Il testo viene battuto sulla tastiera WORD per WINDOWS95 1.Introduzione Un word processor e` come una macchina da scrivere ma con molte più funzioni. Il testo viene battuto sulla tastiera ed appare sullo schermo. Per scrivere delle maiuscole


Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI


Lavorare con i Fireworks pop-up menus in Dreamweaver

Lavorare con i Fireworks pop-up menus in Dreamweaver Lavorare con i Fireworks pop-up menus in Dreamweaver Su una pagina Web, un menu pop-up è uno strumento di navigazione che rimane nascosto fino a che l utente non sposta il puntatore del mouse sopra un


SICURF@D: istruzioni per l uso

SICURF@D: istruzioni per l uso : istruzioni per l uso : istruzioni per l uso Indice 1. Premessa 2 2. La registrazione 2 3. L accesso all area per utenti registrati 2 4. La consultazione dei manuali 3 5. L utilizzo degli strumenti di


Dott.ssa Michela Nelli. Dott.ssa Ilaria Giannelli. Dott. Francesco Pennasilico. Aggiornato al 03/06/2013

Dott.ssa Michela Nelli. Dott.ssa Ilaria Giannelli. Dott. Francesco Pennasilico. Aggiornato al 03/06/2013 MANUALE SIDIP - Versione per Cancelleria- Dott.ssa Michela Nelli Dott.ssa Ilaria Giannelli Dott. Francesco Pennasilico Aggiornato al 03/06/2013 1 INDICE CAPITOLO 1: Consultazione e stampa dei documenti


FlukeView Forms Documenting Software

FlukeView Forms Documenting Software FlukeView Forms Documenting Software N. 5: Uso di FlukeView Forms con il tester per impianti elettrici Fluke 1653 Introduzione Questa procedura mostra come trasferire i dati dal tester 1653 a FlukeView


Moodle 1.5.3+ Breve Guida per il Docente versione 1.2. A cura di Federico Barattini federicobarattini@gmail.com

Moodle 1.5.3+ Breve Guida per il Docente versione 1.2. A cura di Federico Barattini federicobarattini@gmail.com Moodle 1.5.3+ Breve Guida per il Docente versione 1.2 A cura di Federico Barattini federicobarattini@gmail.com Indice 1.0 Primo accesso in piattaforma...3 1.1 Partecipanti, Login come corsista (per vedere


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di


. A primi passi con microsoft a.ccepss SommarIo: i S 1. aprire e chiudere microsoft access Start (o avvio) l i b tutti i pro- grammi

. A primi passi con microsoft a.ccepss SommarIo: i S 1. aprire e chiudere microsoft access Start (o avvio) l i b tutti i pro- grammi Capitolo Terzo Primi passi con Microsoft Access Sommario: 1. Aprire e chiudere Microsoft Access. - 2. Aprire un database esistente. - 3. La barra multifunzione di Microsoft Access 2007. - 4. Creare e salvare


Personalizza. Page 1 of 33

Personalizza. Page 1 of 33 Personalizza Aprendo la scheda Personalizza, puoi aggiungere, riposizionare e regolare la grandezza del testo, inserire immagini e forme, creare una stampa unione e molto altro. Page 1 of 33 Clicca su


Guida all Utilizzo del Posto Operatore su PC

Guida all Utilizzo del Posto Operatore su PC Guida all Utilizzo del Posto Operatore su PC 1 Introduzione Indice Accesso all applicazione 3 Installazione di Vodafone Applicazione Centralino 3 Utilizzo dell Applicazione Centralino con accessi ad internet


1) il menu: qui trovi tutte le funzioni di comando del sito. 2) i dati sulla campagna corrente: qui puoi cambiare il nome e la descrizione e puoi

1) il menu: qui trovi tutte le funzioni di comando del sito. 2) i dati sulla campagna corrente: qui puoi cambiare il nome e la descrizione e puoi Come si fa? Struttura del messaggio Cominciamo con l illustrare la struttura dello spazio in cui costruire il messaggio. Come vedi in figura la pubblicità è composta da 6 elementi: 1 5 PERSONALE (ES. LOGO)



GUIDA AL PORTALE PARTE 1 GUIDA AL PORTALE PARTE 1 1 L HOME PAGE Al primo ingresso nel portale www.farmaciefvg.it è visualizzata l Home page (letteralmente pagina di casa ma meglio conosciuta come pagina iniziale ) la cui parte


IRIS - Prontuario d'uso

IRIS - Prontuario d'uso CINECA - Università degli Studi di Trento IRIS - Prontuario d'uso [Versione 1.0] [Aprile 2015] Quest'opera è distribuita con Licenza Creative Commons Attribuzione - Non commerciale - Condividi allo stesso


Guida dello studente all'uso di Moodle

Guida dello studente all'uso di Moodle Guida dello studente all'uso di Moodle Indice generale Introduzione...3 Registrazione...3 Iscrizione ad un corso...10 Navigazione nel corso...11 Blocchi...12 Risorse...13 Attività...13 Il tuo profilo...14


GUIDA. VI.BE.MAC. Negozio Online

GUIDA. VI.BE.MAC. Negozio Online GUIDA VI.BE.MAC. Negozio Online Questa guida spiega come utilizzare il negozio on-line con lo scopo di richiedere un offerta per l acquisto di parti di ricambio. INDICE Accedere al NEGOZIO ON-LINE Scelta


www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti



ISTRUZIONI D USO AREA RISERVATA UTENTE Il Portale degli Agenti e dei Mediatori d Affari ISTRUZIONI D USO AREA RISERVATA UTENTE Esserciconta è una iniziativa di: 4 TO BE s.r.l. Viale Risorgimento n. 2, 42121 Reggio Emilia (RE) tel. +39.0522.1606435


Operazioni fondamentali

Operazioni fondamentali Elaborazione testi Le seguenti indicazioni valgono per Word 2007, ma le procedure per Word 2010 sono molto simile. In alcuni casi (per esempio, Pulsante Office /File) ci sono indicazioni entrambe le versioni.





NAVIGARE IN INTERNET (Dal latino inter e dall inglese net = tra la rete )

NAVIGARE IN INTERNET (Dal latino inter e dall inglese net = tra la rete ) NAVIGARE IN INTERNET (Dal latino inter e dall inglese net = tra la rete ) 1.1 SE CONOSCIAMO L'INDIRIZZO - 1. ACCEDERE ALLE PAGINE WEB (Web = rete) APRIRE L' URL (Uniform Resource Locator), cioè l'indirizzo


Foglio di calcolo. Il foglio di calcolo: Excel. Selezione delle celle

Foglio di calcolo. Il foglio di calcolo: Excel. Selezione delle celle Foglio di calcolo Il foglio di calcolo: Excel I dati inseriti in Excel sono organizzati in Cartelle di lavoro a loro volta suddivise in Fogli elettronici. I fogli sono formati da celle disposte per righe


Creare scritte/disegni glitterati con Photoshop e Image Ready.

Creare scritte/disegni glitterati con Photoshop e Image Ready. Creare scritte/disegni glitterati con Photoshop e Image Ready. Come prima devi procurati delle basi glitterate, ossia delle piccole gif animate, composte di solito da 3 immagini separate che riprodotte


Microsoft PowerPoint 2003. Tutorial

Microsoft PowerPoint 2003. Tutorial Facoltà di Lettere e Filosofia Cdl in Scienze dell Educazione A.A. 2010/2011 Informatica (Laboratorio) Microsoft PowerPoint 2003 Tutorial Author Kristian Reale Rev. 2011 by Kristian Reale Liberamente distribuibile


Gestione home page. Intranet -> Ambiente Halley -> Gestione homepage

Gestione home page. Intranet -> Ambiente Halley -> Gestione homepage Gestione home page egovernment L home page del portale Halley egovernment permette all Amministrazione di pubblicare contenuti e informazioni e di organizzarle in blocchi. Questa struttura per argomenti


PhoneSuite Manuale dell utente. Istruzioni preliminari: installazione e primo impiego di Phone Suite

PhoneSuite Manuale dell utente. Istruzioni preliminari: installazione e primo impiego di Phone Suite PhoneSuite Manuale dell utente Istruzioni preliminari: installazione e primo impiego di Phone Suite Il software PhoneSuite può essere utilizzato direttamente da CD o essere installato sul PC. Quando si



GUIDA DOCENTE ALL USO DELLA PIATTAFORMA EXCHANGE E-LEARNING - Lotus Quickr GUIDA DOCENTE ALL USO DELLA PIATTAFORMA EXCHANGE E-LEARNING - Lotus Quickr 1. 0BACCESSO Accesso - Interfaccia e navigazione Cartella personale studente Download allegati Risposta ad un messaggio ricevuto


Presentazione piattaforma Csv

Presentazione piattaforma Csv Presentazione piattaforma Csv Il Csv di Rovigo ha preparato una piattaforma web con l obiettivo di fornire alle associazioni che lo richiedono la possibilità di creare e mantenere in modo semplice un sito


TaleteWeb. Funzionalità Trasversali e configurazioni generali. 1 rev. 0-280814

TaleteWeb. Funzionalità Trasversali e configurazioni generali. 1 rev. 0-280814 TaleteWeb Funzionalità trasversali e configurazioni generali 1 rev. 0-280814 Indice Per accedere ad un applicazione... 3 La home page di un applicazione... 4 Come gestire gli elementi di una maschera...


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


CREARE MAPPE CONCETTUALI CON POWER POINT PowerPoint della versione 2003 di Office

CREARE MAPPE CONCETTUALI CON POWER POINT PowerPoint della versione 2003 di Office CREARE MAPPE CONCETTUALI CON POWER POINT PowerPoint della versione 2003 di Office INTRODUZIONE Le mappe concettuali sono strumenti utili per lo studio e la comunicazione. Sono disponibili vari software


MICROSOFT ACCESS. Fabrizio Barani 1

MICROSOFT ACCESS. Fabrizio Barani 1 MICROSOFT ACCESS Premessa ACCESS è un programma di gestione di banche dati, consente la creazione e modifica dei contenitori di informazioni di un database (tabelle), l inserimento di dati anche mediante


Capitolo IX Esercitazione n. 9: Creazione di un database relazionale

Capitolo IX Esercitazione n. 9: Creazione di un database relazionale Capitolo IX Esercitazione n. 9: Creazione di un database relazionale Scopo: Scopo di questa esercitazione è la creazione di una base dati relazionale per la gestione della biblioteca universitaria; il


Capitolo 9. Figura 104. Tabella grafico. Si evidenzia l intera tabella A1-D4 e dal menù Inserisci si seleziona Grafico. Si apre la seguente finestra:

Capitolo 9. Figura 104. Tabella grafico. Si evidenzia l intera tabella A1-D4 e dal menù Inserisci si seleziona Grafico. Si apre la seguente finestra: Capitolo 9 I GRAFICI Si apra il Foglio3 e lo si rinomini Grafici. Si crei la tabella seguente: Figura 104. Tabella grafico Si evidenzia l intera tabella A1-D4 e dal menù Inserisci si seleziona Grafico.



REGISTRO DELLE MODIFICHE TITOLO DOCUMENTO: - TIPO DOCUMENTO: Documento di supporto ai servizi Manuale WebMail EMESSO DA: I.T. Telecom S.r.l. DATA EMISSIONE N. ALLEGATI: STATO: 03/11/2010 0 REDATTO: M. Amato VERIFICATO: F. Galetta


ISTITUTO COMPRENSIVO TRILUSSA. Approccio alla LIM. A cura dell ins. Maurizio Ippolito



Database 1 biblioteca universitaria. Testo del quesito

Database 1 biblioteca universitaria. Testo del quesito Database 1 biblioteca universitaria Testo del quesito Una biblioteca universitaria acquista testi didattici su indicazione dei professori e cura il prestito dei testi agli studenti. La biblioteca vuole


Microsoft PowerPoint

Microsoft PowerPoint Microsoft introduzione a E' un programma che si utilizza per creare presentazioni grafiche con estrema semplicità e rapidità. Si possono realizzare presentazioni aziendali diapositive per riunioni di marketing





Germano Pettarin E-book per la preparazione all ECDL ECDL Modulo 3 Elaborazione testi Word Argomenti del Syllabus 5.0

Germano Pettarin E-book per la preparazione all ECDL ECDL Modulo 3 Elaborazione testi Word Argomenti del Syllabus 5.0 Germano Pettarin E-book per la preparazione all ECDL ECDL Modulo 3 Elaborazione testi Word Argomenti del Syllabus 5.0 G. Pettarin ECDL Modulo 3: Word 2 Modulo 3 Elaborazione testi Word G. Pettarin ECDL


Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica


Organizzati la vita con Bulletin Board e ReelTime

Organizzati la vita con Bulletin Board e ReelTime Organizzati la vita con Bulletin Board e ReelTime Presentazione di Toshiba LifeSpace Organizzarsi non è mai stato più semplice LifeSpace è uno strumento semplice ed elegante che ti consentirà di organizzare


Relazioni tra tabelle

Relazioni tra tabelle Relazioni tra tabelle Una delle caratteristiche principali di Access è la possibilità di definire le relazioni fra tabelle in modo molto semplice vista l interfaccia grafica visuale. Le relazioni possono



GUIDA DOCENTE ALL USO DELLA PIATTAFORMA EXCHANGE E-LEARNING - Lotus Quickr GUIDA DOCENTE ALL USO DELLA PIATTAFORMA EXCHANGE E-LEARNING - Lotus Quickr Accesso - Interfaccia e navigazione Cartella personale studente Download allegati Risposta ad un messaggio ricevuto - Invio nuovo


Guida all Utilizzo dell Applicazione Centralino

Guida all Utilizzo dell Applicazione Centralino Guida all Utilizzo dell Applicazione Centralino 1 Introduzione Indice Accesso all applicazione 3 Installazione di Vodafone Applicazione Centralino 3 Utilizzo dell Applicazione Centralino con accessi ad


Guida a Theblog.net. cioè il sito è raggiungibile da due indirizzi, ma i contenuti sono gli stessi.

Guida a Theblog.net. cioè il sito è raggiungibile da due indirizzi, ma i contenuti sono gli stessi. 1 PRIMA PARTE 0) inserisci un commento 1) login 2) scrivi un post 3) (nel post) inserisci un immagine Il blog ha l indirizzo http://newblogpadova.theblog.net ma anche l alias http://049peoplesay.theblog.net



CORSO DI INFORMATICA 1 CORSO DI INFORMATICA 1 All interno del computer ci sono dei dispositivi che permettono di memorizzare i lavori che vengono creati. Questi dispositivi sono l HARD-DISK (o DISCO FISSO) e il LETTORE E MASTERIZZATORE


MODULO 3. Microsoft Excel. TEST ED ESERCIZI SU: http://www.informarsi.net/ecdl/excel/index.php

MODULO 3. Microsoft Excel. TEST ED ESERCIZI SU: http://www.informarsi.net/ecdl/excel/index.php MODULO 3 Microsoft Excel TEST ED ESERCIZI SU: http:///ecdl/excel/index.php Foglio Elettronico - SpreadSheet Un foglio elettronico (in inglese spreadsheet) è un programma applicativo usato per memorizzare


Capitolo 26: schemi di installazione

Capitolo 26: schemi di installazione Capitolo 26: schemi di installazione Avviate MasterChef dall icona presente sul vostro Desktop. Nota: Se state utilizzando una versione dimostrativa, una volta caricato il programma, un messaggio vi comunicherà


Guida passo-passo. Per imparare a usare il tuo TwinSpace

Guida passo-passo. Per imparare a usare il tuo TwinSpace Guida passo-passo Per imparare a usare il tuo TwinSpace Come aggiornare il tuo profilo... Error! Bookmark not defined. Come invitare insegnanti e visitatori al tuo TwinSpace... 4 Come invitare studenti


Introduzione. Alberto Fortunato alberto.fortunato@gmail.com. www.albertofortunato.com Pag. 1 di 137

Introduzione. Alberto Fortunato alberto.fortunato@gmail.com. www.albertofortunato.com Pag. 1 di 137 Introduzione Il software Gestione magazzino è stato realizzato con l intenzione di fornire uno strumento di apprendimento per chi intendesse cominciare ad utilizzare Access 2010 applicando le tecniche


Guida operativa. My Legal Corner. BestSoft SOFTWARE IN SANITÀ

Guida operativa. My Legal Corner. BestSoft SOFTWARE IN SANITÀ Guida operativa My Legal Corner BestSoft SOFTWARE IN SANITÀ Via Bono Cairoli 28/A - 20127 Milano (MI) Help desk: 02 29529140 Num. Verde da fisso: 800 978542 E-mail: info@bestsoft.it Sito Internet: www.bestsoft.it


Uso della posta elettronica 7.6.1 Invio di un messaggio

Uso della posta elettronica 7.6.1 Invio di un messaggio Navigazione Web e comunicazione Uso della posta elettronica 7.6.1 Invio di un messaggio Aprire, chiudere un programma/messaggio selezionare il menu Start / Tutti i programmi / Mozilla Thunderbird


Internet Posta Elettronica

Internet Posta Elettronica Progetto IUVARE Codice progetto CIP: 2007.IT.051.PO.003/II/D/F/9.2.1/0299 Corso Operatore/trice socio assistenziale MODULO "INFORMATICA DI BASE" Docente: Arch. Tommaso Campanile Internet Posta Elettronica


Il foglio elettronico: Excel

Il foglio elettronico: Excel Il foglio elettronico: Excel Laboratorio di Informatica Corso di Laurea triennale in Biologia Dott. Fabio Aiolli (aiolli@math.unipd.it) Dott.ssa Elisa Caniato (ecaniato@gmail.com) Anno accademico 2007-2008



Esame di Informatica CHE COS È UN FOGLIO ELETTRONICO CHE COS È UN FOGLIO ELETTRONICO CHE COS È UN FOGLIO ELETTRONICO. Facoltà di Scienze Motorie Facoltà di Scienze Motorie CHE COS È UN FOGLIO ELETTRONICO Una tabella che contiene parole e numeri che possono essere elaborati applicando formule matematiche e funzioni statistiche. Esame di Informatica


Istituto Comprensivo Selvazzano2. CORSO DI FORMAZIONE a.s.2012-2013 LIM IN CLASSE. LESSON ACTIVITY TOOLKIT Smart Notebook 11 guida

Istituto Comprensivo Selvazzano2. CORSO DI FORMAZIONE a.s.2012-2013 LIM IN CLASSE. LESSON ACTIVITY TOOLKIT Smart Notebook 11 guida Istituto Comprensivo Selvazzano2 CORSO DI FORMAZIONE a.s.2012-2013 LIM IN CLASSE LESSON ACTIVITY TOOLKIT Smart Notebook 11 guida di Semperlotti Loredana Quest 'Opera e distribuita con Licenza Creative


Crea questionari on-line, test e quiz in pochi minuti!

Crea questionari on-line, test e quiz in pochi minuti! Crea questionari on-line, test e quiz in pochi minuti! 1. ACCEDI Utilizzando Microsoft Internet Explorer (è necessario questo browser) vai all indirizzo http://demo.ewebtest.com e inserisci il tuo nome


Dipartimento di Storia, Società e Studi sull Uomo Università del Salento Ing. Maria Grazia Celentano Mariagrazia.celentano@gmail.

Dipartimento di Storia, Società e Studi sull Uomo Università del Salento Ing. Maria Grazia Celentano Mariagrazia.celentano@gmail. Dipartimento di Storia, Società e Studi sull Uomo Università del Salento Ing. Maria Grazia Celentano Mariagrazia.celentano@gmail.com Indice: La finestra di Word Barra del titolo Barra dei menu Barra degli


Società Italiana di Colposcopia e Patologia Cervico Vaginale 2000-2003. Manuale d uso in breve

Società Italiana di Colposcopia e Patologia Cervico Vaginale 2000-2003. Manuale d uso in breve SICPCV Quality Società Italiana di Colposcopia e Patologia Cervico Vaginale 2000-2003 Manuale d uso in breve Indice: Introduzione pag.1 Interfaccia utente pag.2 Gestione assistiti, visite, statistiche


Accedere alle banche dati da casa Il server PROXY di UniTO

Accedere alle banche dati da casa Il server PROXY di UniTO Accedere alle banche dati da casa Il server PROXY di UniTO 1 IL PROXY DI ATENEO Gran parte delle delle banche dati disponibili sono consultabili anche da casa. Per poter garantire il corretto riconoscimento


Veneto Lavoro via Ca' Marcello 67/b, 30172 Venezia-Mestre tel.: 041/2919311 fax: 041/2919312

Veneto Lavoro via Ca' Marcello 67/b, 30172 Venezia-Mestre tel.: 041/2919311 fax: 041/2919312 Veneto Lavoro via Ca' Marcello 67/b, 30172 Venezia-Mestre tel.: 041/2919311 fax: 041/2919312 INDICE 1. INTRODUZIONE... 3 2. PROCEDURA DI INSTALLAZIONE DEL TOOL AROF... 3 2.1 Procedura di installazione


10. Previsione della struttura tridimensionale di una proteina

10. Previsione della struttura tridimensionale di una proteina 10. Previsione della struttura tridimensionale di una proteina Lo scopo di questa esercitazione è di comprendere la logica alla base della modellizzazione per omologia attraverso la previsione della struttura


Voti finali e Scrutini

Voti finali e Scrutini Voti finali e Scrutini Premessa La gestione Scrutini è ora completamente integrata dentro RE. Sono previste diverse funzioni applicative, dall inserimento dei voti proposti alla gestione dello scrutinio


Modulo 3 - Elaborazione Testi 3.6 Preparazione stampa

Modulo 3 - Elaborazione Testi 3.6 Preparazione stampa Università degli Studi dell Aquila Corso ECDL programma START Modulo 3 - Elaborazione Testi 3.6 Preparazione stampa Maria Maddalena Fornari Impostazioni di pagina: orientamento È possibile modificare le


The Free Interactive Whiteboard Software

The Free Interactive Whiteboard Software The Free Interactive Whiteboard Software Per eseguire il Download del Software Digita nella barra di Google l indirizzo Una finestra di dialogo ti chiederà di inserire i tuoi dati personali Scegli il sistema



SCRIVERE TESTI CON WORD SCRIVERE TESTI CON WORD Per scrivere una lettera, un libro, una tesi, o un semplice cartello occorre un programma di elaborazione testo. Queste lezioni fanno riferimento al programma più conosciuto: Microsoft


Word processor funzione Stampa Unione

Word processor funzione Stampa Unione Word processor funzione Stampa Unione La funzione Stampa unione permette di collegare un documento che deve essere inviato ad una serie di indirizzi ad un file che contenga i nominativi dei destinatari.
