TUTTI UGUALI, TUTTI DIVERSI Caccia al gene

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "TUTTI UGUALI, TUTTI DIVERSI Caccia al gene"

Transcript

1 Centro Università di Milano-Scuola per la diffusione delle bioscienze e delle biotecnologie TUTTI UGUALI, TUTTI DIVERSI Caccia al gene 1

2 Tutti uguali, tutti diversi Caccia al gene Lo scopo di questa attività pratica è di capire come attraverso l uso di banche dati bioinformatiche sia possibile, partendo da una sequenza parziale di DNA umano, identificare il gene a cui appartiene la sonda nucleotidica, identificare le differenze tra la sequenza data e quella normale, ottenere informazioni dettagliate sulla proteina codificata dal gene e sui tessuti in cui la proteina è espressa, mettere in relazione le alterazioni del gene con malattie. Ti verrà data una sequenza parziale di DNA (sonda) e con quella dovrai pescare il gene corrispondente. Sarà come trovare un ago in un pagliaio!! Obiettivi dell attività: 1. identificare un gene a partire da una sequenza (sonda) sconosciuta; 2. identificare la regione del cromosoma dove si trova il gene; 3. identificare una mutazione in una data sequenza di DNA; definire la struttura esone-introne del gene ed ottenere la sequenza completa del cdna; 4. identificare le caratteristiche principali della proteina codificata dal gene normale 5. trovare le conseguenze della mutazione a livello della proteina; identificare le principali caratteristiche del cdna elaborando uno schema con la posizione del codone di inizio, di stop e del segnale di poliadenilazione; tradurre la molecola di cdna nella corrispondente proteina; 6. ottenere informazioni sulla struttura in 3D della proteina; 7. capire come correlare la mutazione in un gene ad una malattia. 2

3 Scenario I test predittivi vengono proposti a individui asintomatici che hanno, nella loro famiglia, casi di malattie genetiche. Nella storia che viene proposta per l attività di bioinformatica, una donna con casi di cancro al seno in famiglia (vedi l albero genealogico della famiglia del probando) chiede di sottoporsi ad un test per evidenziare se è portatrice di geni di predisposizione alla malattia (in questo caso il tumore al seno). Anne, una giovane donna di 23 anni, si reca al suo primo appuntamento con il suo nuovo ginecologo; il dottore nota dal racconto di Anne che nella sua famiglia ci sono stati numerosi casi di cancro. La sua nonna paterna morì a 40 anni di cancro al seno; due delle quattro zie paterne sono morte prima dei 50 anni per cancro alle ovaie e ad una terza zia paterna di 39 anni è stato recentemente diagnosticato il cancro al seno. Il ginecologo pensa che nella famiglia di Anne possa essere presente una mutazione in uno dei due geni che controllano la predisposizione allo sviluppo del cancro al seno e/o all ovaio (BRCA1 or BRCA2). Durante la visita il ginecologo individua un nodulo sospetto nel seno destro di Anne e ne predispone una biopsia. Oltre all esame istologico, il ginecologo suggerisce ad Anne il test del DNA ma la informa che i risultati potranno essere informativi solo se si può fare il test anche sui famigliari, per individuare esattamente la mutazione tipica della sua famiglia. Anne contatta subito sua zia malata scoprendo che si è già sottoposta al test genetico da cui è risultata portarice di una rara mutazione nel gene BRCA2. Per fare diagnosi di malattie genetiche viene utilizzata dai laboratori una tecnica particolare: la RT- PCR (reverse transcription polymerase chain reaction). L RT-PCR è una tecnica che amplifica un frammento di acido ribonucleico (RNA). La molecola di RNA è dapprima trascritta nel DNA complementare (o cdna) attraverso l uso dell enzima trascrittasi inversa (RT), e in seguito amplificata utilizzando la reazione a catena della polimerasi. L RT-PCR usa come stampo una molecola di RNA ed è quindi molto utile per l analisi dell espressione genica in un tessuto. Sul campione della biopsia di Anne viene eseguita la RT-PCR e il prodotto della reazione viene sequenziato: si scopre che la mutazione nel gene di Anne è la stessa riscontrata nel DNA della zia. Userai una sequenza parziale di cdna di Anne come sonda per identificare la mutazione presente 3

4 in questa famiglia e per verificare la presenza della mutazione nel DNA di Anne. 4

5 Obiettivi 1 e 2: Identificare il gene a cui appartiene la sequenza (sonda) e la sua posizione sul cromosoma. Per raggiungere l obiettivo della prima parte dell attività devi usare il software BLAT (BLAST- Like Alignment Tool), un algoritmo ottimizzato per confrontare sequenze di cdna (prive di introni) con intere sequenze genomiche (che contengono introni). Vai al sito: Incolla nel box vuoto la sequenza nucleotidica TGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCA GCAGACCCAGCTTACCTTGAG TTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAAC AGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAA ATCTGAAAGAGCTAAC ATACAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCG GTTTCAGATGAAATTTTATTTCAGA TTTACCAGCCACGGGAGCCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGA per trovare la sua localizzazione nel genoma umano (controlla che sia selezionata la scelta human tra i genomi disponibili e clicca su submit. Bisogna attendere alcuni secondi per avere i risultati della ricerca del software BLAT. Scegli il primo risultato che mostri il migliore allineamento definito con un numero detto score: più alto è lo score migliore è l allineamento. Scoprirai che la tua sequenza (definita dal software query) è composta da 350 nucleotidi e si trova nel cromosoma 13. Se desideri maggiori dettagli sulla struttura esoni-introni della regione genomica in esame, clicca su details (userai questa funzione anche in seguito); ora però clicca su browser per trovare la regione cromosomica che contiene la sequenza che ci interessa. Nella schermata che si apre osserva che l ideogramma del cromosoma ha un tratto rosso nella posizione dove si trova la sequenza che 5

6 stiamo studiando. Nella finestra sottostante ritrovi la sequenza (your seq) al di sotto della quale c è la sequenza genomica (known genes) che si allinea nel miglior modo possibile; per capire bene le informazioni contenute in questa finestra bisogna rinfrescare le conoscenze sulla struttura del gene. I geni rappresentano solo l 1% del genoma umano e gli scienziati stanno ancora studiando per capire la composizione e la funzione del restante 99%. Negli eucarioti i geni sono affiancati da lunghe sequenze non codificanti il cui significato risulta ancora abbastanza oscuro (queste sequenze sono anche dette DNA spazzatura); quando viene localizzato un gene si nota che è suddiviso in piccole parti dette esoni, che sono le parti codificanti proteine o molecole di RNA e che gli esoni sono separati da lunghi tratti non codificanti detti introni. Nella finestra di BLAT gli esoni sono rappresentati da blocchetti neri o rossi, mentre gli introni sono raffigurati come linee sottili. domanda1) Prendi nota della posizione della sonda che stai studiando sul cromosoma 13 e della lunghezza della regione. Il gene al quale appartiene la tua sonda è quello che mostra il migliore allineamento, indicato sotto a your seq :come ci attendevamo, è BRCA2. Obiettivo 3 Identificare la mutazione presente nel DNA di Anne e nella sua famiglia Confronta la struttura della tua sequenza (your seq) con la struttura del gene normale sottostante. 6

7 domanda2) Quanti esoni sono visibili in questa parte di gene? Quanti esoni ci sono nella tua sequenza? Ci sono differenze tra la struttura esoni-introni della tua sequenza e la struttura della sequenza del gene normale? Cosa possiamo dire sulla mutazione genica di Anne? In questa pagina ci sono altre informazioni; sulla sinistra ci sono dei blocchetti grigi e blu: l interfaccia del browser ti permette di personalizzare ed arricchire la tua ricerca visualizzando informazioni diverse, aggiungendone o nascondendone altre. Infatti cliccando sui blocchetti verticali si accede ad altre pagine e si possono cambiare anche i parametri della ricerca. Osserva attentamente la barra verticale relativa alla conservazione della sequenza (Vertebrate Alignment and Conservation). Nota che le regioni maggiormente conservate corrispondono agli esoni (i rettangoli colorati pieni nella sezione RefSeq genes ) e che queste regioni si conservano anche in specie di vertebrati lontane evolutivamente dall uomo, come in opossum, pollo o rana. Un discreto livello di conservazione si osserva anche in alcune regioni introniche (conservazione delle sequenze non-codificanti) ma ancora non ne è chiaro il ruolo anche se si può supporre che siano zone coinvolte nella regolazione dell espressione genica. La penultima barra mostra gli SNPs (single nucleotide polymorphisms) e l ultima, Repeat masker, mostra le sequenze ripetute. Ora dobbiamo trovare quale è l esone che manca nella mutazione della famiglia di Anne. Per ottenere questa informazione bisogna trovare la struttura esone-introne completa del gene normale BRCA2. Per fare questo hai bisogno della sequenza codificante completa (CDS) e, con questa, cominciare una nuova ricerca BLAT. Vai alla pagina per trovare il codice identificativo del gene BRCA2. Seleziona Nucleotide nel campo search posizionato in alto a sinistra nella home page e digita BRCA2 homo sapiens nel campo for. Clicca poi su Go. Nell elenco che apparirà, trova BRCA2 Homo sapiens breast cancer 2, early onset (BRCA2), mrna. Prendi nota del numero di accesso identificativo NM_ (NM significa mrna naturale). Clicca su NM_ e si aprirà un tipico file di GenBank. Questa pagina è difficile da interpretare ma alcune informazioni sono chiare; prima di tutto ci sono le Reference, 7

8 cliccando sulle quali si possono trovare le citazioni alle pubblicazioni in letteratura scientifica che riguardano la nostra sequenza. Per leggere un abstract dell articolo che descrive il gene, clicca sul link PubMed presente in ogni Reference. Scendendo nella pagina puoi trovare informazioni più dettagliate sulla mutazione genica. Alla fine della pagina, nella sezione Features, troverai la sequenza di cdna (CDS). Questa è la sequenza utile per la ricerca in BLAT. Non si può copiare la sequenza CDS così come si trova nella pagina ma bisogna ottenere un file utile per la ricerca del gene correlato nelle banche dati. Per fare ciò bisogna risalire all inzio della pagina e di fianco al bottone Display cliccare per far scendere un menù a tendina e selezionare FASTA. Salva su un file di testo con il nome cdnafasta.doc la sequenza di basi che apparirà sullo schermo. Tornando in banca dati alla pagina con le caratteristiche di NM_000059, trova il numero identificativo della proteina prodotta dal gene (NP_000050), la sua sequenza di amminoacidi, copiala e salvala in un nuovo file di testo dal nome BRCA2 protein.doc. Prendi nota del numero di amminoacidi che costituiscono la proteina normale. Adesso che hai la sequenza codificante completa (cdna) del gene BRCA2 puoi cercarne la sequenza genomica usando il software BLAT. Come ricorderai, questo software ti permette di confrontare sequenze di cdna con sequenze genomiche complete e di identificarne la struttura in esoni ed introni. Ritorna alla pagina ed incolla la sequenza di cdna nella finestra di BLAT. Clicca submit e quando comparirà la nuova pagina clicca su details alla sinistra del primo record in elenco (score , nucleotides, 100% identity). Nella pagina che si apre troverai la tua sequenza di cdna, la sequenza di DNA genomico nella quale sono evidenziati in blu scuro e con le lettere maiuscole gli esoni, in nero e con le lettere minuscole gli introni e in azzurro i siti di splicing. Clicca sui links, nella colonna di sinistra, per navigare nella sequenza. Cliccando sui vari blocchi, ti appare ad inizio pagina l esone corrispondente nella sequenza genomica; noterai che ci sono 27 esoni nel gene BRCA2. Il tuo compito ora è di identificare quale è l esone che manca nel gene mutato di BRCA2. 8

9 Nella sequenza genomica ricerca i residui nucleotidici che corrispondono alla posizione della tua sonda sul cromosoma 13 (ricorda: chr13:31,848,838-31,852,238), semplicemente cliccando uno di seguito all altro i vari blocchi di sinistra e leggendo i numeri dei nucleotidi dell esone che apparirà in alto nella pagina. domanda3) sei in grado di rispondere alla domanda: qual è l esone che manca nel gene mutato BRCA2? La perdita dell esone è dovuta a una mutazione di un sito di splicing (sostituzione di G con A) nell introne 21, che porta alla perdita completa dell esone 22 (Wagner TM et al 1999, PMID: ). Copia la sequenza dell esone mancante e salvala in un file di testo dal nome missing exon.doc. Obiettivo 4 Costruire una scheda contenente tutte le informazioni sulle funzioni della proteina codificata dal gene BRCA2 normale. Apri l homepage di Swiss Prot all indirizzo Swiss Prot è un database di sequenze proteiche molto ricco e completo che contiene un livello molto elevato di annotazioni quali: la descrizione delle funzioni delle proteine, i domini strutturali, le modificazioni posttrascrizionali, le varianti ecc. Swiss Prot ha livelli minimi di ridondanza e alti livelli di integrazione con altri database bioinformatici. In alto nella pagina che 9

10 si apre, digita nel campo search la tua QUERY (richiesta): BRCA2 human, e clicca su GO; nella pagina seguente, nella lista di risultati che appaiono, cerca human BRCA2 protein (prendi nota del codice identificativo P51587). Clicca su BRCA2_HUMAN. La nuova pagina contiene informazioni raggruppate in categorie quali: [Entry info], [Name and origin], [References], [Comments], [Cross-references], [Keywords], [Features], [Sequence], [Tools]. Osserva tutta la pagina per raccogliere tutte le informazioni disponibili sulla proteina in esame. Nella sezione [Comments] troverai le informazioni sulle funzioni della proteina e in che tessuti è localizzata. Nella sezione [Cross-references], ci sono i links ad altri database per avere più informazioni su BRCA2. Per esempio la sequenza del gene che codifica per la proteina è disponibile su EMBL Genbank, i domini proteici su SMR, la struttura in 3D in PDB, Prosite, InterPro e Pfam, le malattie associate ad alterazioni del gene o della proteina in OMIM. Prendi nota del numero identificativo in PDB (1NOW), SMR (P51587) e OMIM (ci sono molti records tutti preceduti dalla sigla MIM). Obiettivo 5 Trovare le conseguenze della mutazione a livello della proteina. Puoi fare delle predizioni sulle conseguenze della perdita dell esone 22 nel gene BRCA2 sulla struttura e sulla funzione della proteina? Per rispondere a questa domanda devi ricostruire la molecola di mrna (o di cdna) priva dell esone 22 e poi tradurla nella corrispondente sequenza di amminoacidi. Apri il file della sequenza normale di cdna (cdnafasta.doc); apri anche il file della sequenza dell esone 22 (salvata come file missingexon.doc ). Cerca la sequenza dell esone 22 nella sequenza di cdna (ricordati che il cdna è solo una sequenza di esoni) e cancellala. La funzione di Word Cerca potrà aiutarti a trovare l esone 22 nel cdna ma devi prestare molta attenzione a cancellare solo l esone 22. Salva il risultato del tuo lavoro come file cdna22del.doc ( vedi allegato) 10

11 Ora bisogna usare un nuovo software per tradurre la sequenza di cdna mutata, cdna22del.doc (contenente la delezione) in sequenza di amminoacidi; vai al sito: Incolla la sequenza mutata nella finestra bianca e clicca translate DNA. Otterrai una immagine su fondo nero che è il risultato della traduzione della sequenza nelle 6 possibili cornici di lettura (3 per ogni elica di DNA): in verde sono rappresentati i possibili codoni di inizio e in viola i codoni di stop. Identifica la cornice di lettura detta anche Open Reading Frame o ORF più lunga, senza interruzioni date dai codoni di stop. Nel nostro caso la ORF più lunga è forward frame 3. Ora clicca su Text Output per visualizzare la sequenza e la sua traduzione in amminoacidi. Scegli la forward frame 3. Puoi facilmente personalizzare l interfaccia del software scegliendo di visualizzare la sequenza amminoacidica con il codice a una o a tre lettere, con o senza la sequenza di DNA appaiata. Scegli one letter code e amino acids and DNA. Copia il contenuto della finestra in un nuovo file di Word e salvalo come mutated protein.doc ); usa come font courier new or courier, dimensione 8, nero; è necessario utilizzare questo font per gli allineamenti di sequenza perché mantiene fissi e costanti gli spazi tra i caratteri. Localizzazione delle caratteristiche principali del cdna Ora puoi localizzare le principali caratteristiche del cdna/mrna, per esempio: 5 UTR (5 UnTranslated Region) start codon (inizio della traduzione, ATG (AUG) il codone della metionina) CDS (CoDing Sequence): la sequenza tradotta in proteina stop codon (fine della traduzione, TAA (UAA)/ TAG (UAG) / TGA (UGA) 3 UTR (3 UnTranslated Region) 11

12 sito polya (sito di poliadenilazione) costituito dalla sequenza consenso AATAAA generalmente localizzata bp (max bp) a monte dell inizio della coda di polya. Nota che talvolta questo sito può essere leggermente differente dalla sequenza consenso (per esempio ATTAAA). Identifica tutti gli elementi sopra elencati ed evidenziali con il colore verde e giallo. Iniziando dall estremità 5 della molecola, trova il codone d inizio cioè il primo ATG, che corrisponde alla prima metionina (M), non seguita a breve distanza da alcun codone di stop. Una volta identificato il codone di inizio puoi cancellare la sequenza di amminoacidi che lo precede che è la regione 5 UTR, non tradotta dai ribosomi in proteina. domanda 5 Quanto è lunga la proteina mutata? Confrontala con la lunghezza della proteina normale che hai annotato precedentemente. Obiettivo 6 domanda 6 Quali sono i domini principali della proteina BRCA2 normale? Quali domini mancano nella proteina mutata? Vai alla pagina Pfam raccoglie una collezione di allineamenti multipli di sequenze riguardanti i domini proteici e le famiglie più comuni. Per ogni famiglia in Pfam puoi trovare la struttura del dominio e della proteina nel suo 12

13 complesso. Inserisci il codice identificativo di Swiss Prot per la proteina BRCA2, P51587 nella finestra per la ricerca che si trova sotto Jump to alla voce enter ID/acc. Nella nuova pagina, si trova la lista dei domini conservati identificati all interno della proteina, con i residui amminoacidici corrispondenti. Cliccando sui singoli domini, si ottiene la rappresentazione grafica e la descrizione. Cerca la regione di circa 500 amminoacidi che mancano nella proteina mutata di Anne: si trovano nella parte finale della proteina ed esattamente appartengono al dominio Pfam-A_BRCA2_OB3 (aa ). Clicca ora sul link OB3 per conoscere le funzioni di questo dominio e riassumile qui sotto. Strutture 3D disponibili della proteina BRCA2 Vai alla home page di NCBI e cerca, nel database PROTEIN, BRCA2 Human e scegli la proteina P Alla sua destra clicca sul link Conserved domains. Nella pagina che si apre osserva la sequenza della proteina nella sua interezza e cliccando sull ultimo rettangolino rosso nella riga Specific hits comparirà una finestra che illustra le 13

14 caratteristiche del dominio OB3, clicca sul bottone Structure (nella barra orizzontale azzurra in cima alla pagina); nella pagina seguente inserisci BRCA2 human nella search box. Scegli 1IYJ (la sola struttura in 3D che contiene il dominio che ci interessa). 1IYJ è un frammento della proteina BRCA2 (817 residui) ingegnerizzato in un vettore, espresso in una linea cellulare, purificato e cristallizzato. Clicca su Structure view in Cn3D. Si scaricherà un file con estensione.cgi che potrà essere aperto solo con il programma chiamato 'Cn3D' (è possibile scaricare il programma di modellazione 3D gratuitamente dal sito dell NCBI). In una finestra a fondo nero viene mostrata la struttura in 3D di 1IYJD. Se non si visualizza la sequenza amminoacidica di 1IYJ, apri la finestra sequence viewer dal Menu Window in cima alla pagina. Questo programma 3D è interattivo: spostandosi col mouse su un punto qualsiasi della figura e tenendo premuto il tasto sinistro si può ruotare a piacere l immagine. Sono possibili diverse opzioni: - andando su Style _ Rendering Shortcuts si sceglie il tipo di modellizzazione (a sfere e bastoncini, a tubi, etc). Selezionando worms si ha una struttura vermiforme facilmente interpretabile. - andando su Style _ Coloring Shortcuts si sceglie il criterio di colorazione: Secondary Structure evidenzia con colori diversi le strutture ad alfa elica o a foglietto ripiegato; Molecule associa a ciascuna catena polipeptidica un colore diverso; Hydrophobicity evidenzia le zone idrofile e idrofobiche, Charge le cariche, etc. - Con Style _ Favorites _ Add/Replace si può salvare con nome l immagine tra i favoriti (comparirà nella tendina in basso). - Con Style _ Edit Global Style si ha una visione complessiva delle impostazioni ed è possibile modificarle: in Settings si modifica il tipo di modellizzazione, i colori di catene e sfondo, si decide se visualizzare o meno molecole estranee (esempio ioni zinco, fenolo, etc), gli oggetti che evidenziano la struttura secondaria, i ponti disolfuro. Per prendere familiarità, selezionare e deselezionare queste voci, osservando le variazioni nell immagine. In Labels è possibile visualizzare i nomi degli aminoacidi (alla voce Spacing si sceglie se scrivere un nome ogni uno, due, tre,... aminoacidi). In Details si modificano le dimensioni del tipo di modellizzazione scelta (ad esempio il diametro della struttura vermiforme ). - Alla voce Show/Hide _ Pick Structures... si decide se visualizzare tutte le catene, oppure solo alcune. Può essere utile per identificare quali sono le catene A e B di ciascun monomero. - Con View _ Animation _ Spin si fa partire la rotazione automatica del modello. 14

15 Scegli dal Menu Style Rendering shortcuts e Worms in modo da visualizzare la struttura secondaria con cilindri per le alfa eliche e frecce per i beta foglietti. Per vedere dove è posizionato un amminoacido devi cliccare il medesimo in una delle sequenze e la sua posizione apparirà scritta sul fondo della finestra (tra parentesi compare anche la posizione dell amminoacido nella proteina totale). Cliccando e trascinando il mouse su di una serie di residui amminoacidici nella sequenza cristallizzata (1IYJD) una barra gialla compare sulla struttura 3D nel punto in corrispondenza della posizione dei residui all interno della struttura. In effetti bisognerebbe allineare la proteina normale con la sua forma mutata. Purtroppo non sono ancora state realizzate le strutture 3D di molte proteine e neanche della varie forme mutanti della stessa proteina. Così bisogna riconoscere la mutazione (nel nostro caso la delezione dell esone 22) dalla posizione degli aa mancanti e prevedere quali interferenze strutturali potrebbero esserci nella proteina mutata. Questo metodo, non certamente ottimale, sarà migliorato dalla disponibilità di algoritmi più accurati per predire le strutture che eviteranno di dover determinare la struttura 3D sperimentalmente, lasciando al laboratorio solo la fase finale della validazione farmacologica. Obiettivo 7 Malattie associate con l alterazione del gene BRCA2. Visita il database OMIM per conoscere le malattie associate con le alterazioni di questo gene. Vai all indirizzo e clicca su OMIM nella barra in alto blu. Si aprirà il nuovo database nel quale dobbiamo cercare BRCA2. 15

16 Il gene BRCA2 (BReast CAncer 2) con il gene BRCA1 rappresentano i geni più importanti le cui mutazioni causano suscettibilità allo sviluppo del cancro al seno e all ovaio. BRCA2 è stato scoperto e studiato in famiglie islandesi che avevano casi di tumore al seno nel loro albero genealogico. Normalmente i geni BRCA2 e BRCA1 sono geni soppressori dei tumori poiché sono coinvolti nella sintesi di enzimi riparatori dei danni che può subire il DNA; hanno anche altre funzioni complesse che però non sono state completamente chiarite. Solo il 5-10% dei tumori al seno sono forme di tumore ereditario. In questi casi, nel 90% dei pazienti sono presenti mutazioni nei geni BRCA1 o BRCA2. I ricercatori hanno individuato 450 mutazioni solo nel gene BRCA2 e >600 nel gene BRCA1. Le mutazioni in BRCA1 sono responsabili del 50-85% dei casi di cancro al seno ereditari e aumentano del 15-45% il rischio di sviluppare il cancro alle ovaie. Le mutazioni in BRCA2 sono responsabili del 35% del cancro al seno ereditario ma conferiscono un rischio minore (10-20%) di sviluppare tumori alle ovaie. Entrambi i geni sono coinvolti anche nel tumore al seno nel maschio (6%). In tutti i casi ci sono dati che sottolineano un leggero incremento (6-14%) del rischio di sviluppare anche altri tipi di cancro (colon, prostata, pancreas). Nei casi sporadici (non familiari) di cancro al seno le mutazioni in BRCA1 e BRCA2 sono molto rare. La frequenza delle mutazioni nel gene BRCA2 che predispongono al cancro non è ancora stata definita a livello della popolazione generale,; si stima che, nella popolazione globale, la frequenza di soggetti portatori di mutazioni in uno di questi due geni sia fra 1/500 e 1/1000; a causa dell effetto fondatore, nei diversi gruppi etnici singole o poche mutazioni possono essere predominanti. Qui di seguito vengono illustrati due gruppi etnici con specifiche mutazioni in BRCA2 che predispongono al cancro: 1) la mutazione 999del5 di BRCA2 che predispone al cancro è presente nello 0,6% della popolazione generale Islandese, e rispettivamente nel 7.7% delle donne e nel 40% degli uomini affetti da tumore mammario [Thorlacius et al 1996, Thorlacius et al 1997]; 16

17 2) la mutazione 6174delT di BRCA2 presente con una frequenza dell 1% in individui discendenti da Ebrei Ashkenazi [Struewing et al 1995, Oddoux et al 1996, Roa et al 1996, Struewing et al 1997]. Considerando sia il gene BRCA1 Che BRCA2, nella popolazione degli Ebrei Ashkenaziti sono state osservate 3 tipi di mutazioni dovute a effetto fondatore: 187delAG (BRCA1), 5385insC (BRCA1) e 6174delT (BRCA2). Tra gli ebrei Ashkenaziti 1 individuo su 40 presenta una di queste tre mutazioni [Struewing et al 1997] A questo punto hai trovato un ago in un pagliaio!! Non hai solo individuato il gene ma hai fatto un percorso lungo e complicato: partendo da una sequenza sonda hai trovato molte informazioni sul gene BRCA2 e sulla sua proteina! Hai anche acquisito un metodo per farti domande e trovare risposte ad altre questioni riguardanti mutazioni geniche di tuo interesse (o di interesse dei tuoi studenti). Congratulazioni! Una caccia davvero di successo. A cura di: Prof.ssa Giovanna Viale, Dipartimento di Biologia e Genetica per le Scienze Mediche, Università degli Studi di Milano, Cus-Mi-Bio; Prof.ssa Cinzia Grazioli, docente di scienze del liceo scientifico Vittorio Veneto di Milano, distaccata presso il Cus-Mi-Bio 17

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

IMPOSTARE UNA MASCHERA CHE SI APRE AUTOMATICAMENTE

IMPOSTARE UNA MASCHERA CHE SI APRE AUTOMATICAMENTE IMPOSTARE UNA MASCHERA CHE SI APRE AUTOMATICAMENTE Access permette di specificare una maschera che deve essere visualizzata automaticamente all'apertura di un file. Vediamo come creare una maschera di

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

guida all'utilizzo del software

guida all'utilizzo del software guida all'utilizzo del software Il software Gestione Lido è un programma molto semplice e veloce che permette a gestori e proprietari di stabilimenti balneari di semplificare la gestione quotidiana dell?attività

Dettagli

INDICE Informazioni Generali... 4. Comprare ebook con Kobo Desktop... 8. Usare la Libreria di Kobo Desktop... 10. Leggere su Kobo Desktop...

INDICE Informazioni Generali... 4. Comprare ebook con Kobo Desktop... 8. Usare la Libreria di Kobo Desktop... 10. Leggere su Kobo Desktop... Kobo Desktop Manuale Utente INDICE Informazioni Generali... 4 Installare Kobo Desktop su Windows... 5 Installare Kobo Desktop su Mac... 6 Comprare ebook con Kobo Desktop... 8 Usare la Libreria di Kobo

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

LA FINESTRA DI OPEN OFFICE CALC

LA FINESTRA DI OPEN OFFICE CALC LA FINESTRA DI OPEN OFFICE CALC Barra di Formattazione Barra Standard Barra del Menu Intestazione di colonna Barra di Calcolo Contenuto della cella attiva Indirizzo della cella attiva Cella attiva Intestazione

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

I Grafici. La creazione di un grafico

I Grafici. La creazione di un grafico I Grafici I grafici servono per illustrare meglio un concetto o per visualizzare una situazione di fatto e pertanto la scelta del tipo di grafico assume notevole importanza. Creare grafici con Excel è

Dettagli

Introduzione ad Access

Introduzione ad Access Introduzione ad Access Luca Bortolussi Dipartimento di Matematica e Informatica Università degli studi di Trieste Access E un programma di gestione di database (DBMS) Access offre: un supporto transazionale

Dettagli

MINI GUIDA SINTETICA per l uso della lavagna interattiva multimediale

MINI GUIDA SINTETICA per l uso della lavagna interattiva multimediale MINI GUIDA SINTETICA per l uso della lavagna interattiva multimediale InterWrite SchoolBoard è un software per lavagna elettronica di facile utilizzo. Può essere adoperata anche da studenti diversamente

Dettagli

GESTIRE LA BIBLIOGRAFIA

GESTIRE LA BIBLIOGRAFIA GESTIRE LA BIBLIOGRAFIA STRUMENTI DI GESTIONE BIBLIOGRAFICA I software di gestione bibliografica permettono di raccogliere, catalogare e organizzare diverse tipologie di materiali, prendere appunti, formattare

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Funzioni di base. Manualino OE6. Outlook Express 6

Funzioni di base. Manualino OE6. Outlook Express 6 Manualino OE6 Microsoft Outlook Express 6 Outlook Express 6 è un programma, incluso nel browser di Microsoft Internet Explorer, che ci permette di inviare e ricevere messaggi di posta elettronica. È gratuito,

Dettagli

I.Stat Guida utente Versione 1.7 Dicembre 2010

I.Stat Guida utente Versione 1.7 Dicembre 2010 I.Stat Guida utente Versione 1.7 Dicembre 2010 1 Sommario INTRODUZIONE 3 I concetti principali di I.Stat 4 Organizzazione dei dati 4 Ricerca 5 GUIDA UTENTE 6 Per iniziare 6 Selezione della lingua 7 Individuazione

Dettagli

Calc è il programma per la gestione di fogli di calcolo della suite OpenOffice.org.

Calc è il programma per la gestione di fogli di calcolo della suite OpenOffice.org. Calc è il programma per la gestione di fogli di calcolo della suite OpenOffice.org. Nuovo documento Anteprima di stampa Annulla Galleria Apri Controllo ortografico Ripristina Sorgente dati Salva Controllo

Dettagli

Guida rapida all uso di ECM Titanium

Guida rapida all uso di ECM Titanium Guida rapida all uso di ECM Titanium Introduzione Questa guida contiene una spiegazione semplificata del funzionamento del software per Chiputilizzare al meglio il Tuning ECM Titanium ed include tutte

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Guida all uso del portale dello studente

Guida all uso del portale dello studente Guida all uso del portale dello studente www.studente.unicas.it Versione 1.0 del 10/04/2010 Pagina 1 Sommario PREMESSA... 3 PROFILO... 7 AMICI... 9 POSTA... 10 IMPOSTAZIONI... 11 APPUNTI DI STUDIO... 12

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

INFORMATIVA FINANZIARIA

INFORMATIVA FINANZIARIA Capitolo 10 INFORMATIVA FINANZIARIA In questa sezione sono riportate le quotazioni e le informazioni relative ai titoli inseriti nella SELEZIONE PERSONALE attiva.tramite la funzione RICERCA TITOLI è possibile

Dettagli

Appunti sugli Elaboratori di Testo. Introduzione. D. Gubiani. 19 Luglio 2005

Appunti sugli Elaboratori di Testo. Introduzione. D. Gubiani. 19 Luglio 2005 Appunti sugli Elaboratori di Testo D. Gubiani Università degli Studi G.D Annunzio di Chieti-Pescara 19 Luglio 2005 1 Cos è un elaboratore di testo? 2 3 Cos è un elaboratore di testo? Cos è un elaboratore

Dettagli

Equilibrio Termico tra Due Corpi

Equilibrio Termico tra Due Corpi Equilibrio Termico tra Due Corpi www.lepla.eu OBIETTIVO L attività ha l obiettivo di fare acquisire allo sperimentatore la consapevolezza che: 1 il raggiungimento dell'equilibrio termico non è istantaneo

Dettagli

RefWorks Guida all utente Versione 4.0

RefWorks Guida all utente Versione 4.0 Accesso a RefWorks per utenti registrati RefWorks Guida all utente Versione 4.0 Dalla pagina web www.refworks.com/refworks Inserire il proprio username (indirizzo e-mail) e password NB: Agli utenti remoti

Dettagli

Data warehouse.stat Guida utente

Data warehouse.stat Guida utente Data warehouse.stat Guida utente Versione 3.0 Giugno 2013 1 Sommario INTRODUZIONE 3 I concetti principali 4 Organizzazione dei dati 4 Ricerca 5 Il browser 5 GUIDA UTENTE 6 Per iniziare 6 Selezione della

Dettagli

Traduzione di TeamLab in altre lingue

Traduzione di TeamLab in altre lingue Lingue disponibili TeamLab è disponibile nelle seguenti lingue nel mese di gennaio 2012: Traduzioni complete Lingue tradotte parzialmente Inglese Tedesco Francese Spagnolo Russo Lettone Italiano Cinese

Dettagli

INSTALLAZIONE E UTILIZZO DEL COMPILATORE Code::Blocks 8.02

INSTALLAZIONE E UTILIZZO DEL COMPILATORE Code::Blocks 8.02 INSTALLAZIONE E UTILIZZO DEL COMPILATORE Code::Blocks 8.02 Download Si può scaricare gratuitamente la versione per il proprio sistema operativo (Windows, MacOS, Linux) dal sito: http://www.codeblocks.org

Dettagli

Alb@conference GO e Web Tools

Alb@conference GO e Web Tools Alb@conference GO e Web Tools Crea riunioni virtuali sempre più efficaci Strumenti Web di Alb@conference GO Guida Utente Avanzata Alb@conference GO Per partecipare ad un audioconferenza online con Alb@conference

Dettagli

EndNote Web. Quick Reference Card THOMSON SCIENTIFIC

EndNote Web. Quick Reference Card THOMSON SCIENTIFIC THOMSON SCIENTIFIC EndNote Web Quick Reference Card Web è un servizio online ideato per aiutare studenti e ricercatori nel processo di scrittura di un documento di ricerca. ISI Web of Knowledge, EndNote

Dettagli

8. L'USO DEL PROGRAMMA DI POSTA ELETTRONICA INSIEME ALLA GESTIONE PROFESSIONALE DI DOCUMENTI IN FORMATO E-MAIL

8. L'USO DEL PROGRAMMA DI POSTA ELETTRONICA INSIEME ALLA GESTIONE PROFESSIONALE DI DOCUMENTI IN FORMATO E-MAIL This project funded by Leonardo da Vinci has been carried out with the support of the European Community. The content of this project does not necessarily reflect the position of the European Community

Dettagli

Lezione su Informatica di Base

Lezione su Informatica di Base Lezione su Informatica di Base Esplora Risorse, Gestione Cartelle, Alcuni tasti di scelta Rapida Domenico Capano D.C. Viterbo: Lunedì 21 Novembre 2005 Indice Una nota su questa lezione...4 Introduzione:

Dettagli

CATTURARE LO SCHERMO INTERO O LA FINESTRA ATTIVA

CATTURARE LO SCHERMO INTERO O LA FINESTRA ATTIVA CATTURARE LO SCHERMO INTERO O LA FINESTRA ATTIVA Supponiamo di voler eseguire una istantanea del nostro desktop, quella che in gergo si chiama Screenshot (da screen, schermo, e shot, scatto fotografico).

Dettagli

Modulo. Programmiamo in Pascal. Unità didattiche COSA IMPAREREMO...

Modulo. Programmiamo in Pascal. Unità didattiche COSA IMPAREREMO... Modulo A Programmiamo in Pascal Unità didattiche 1. Installiamo il Dev-Pascal 2. Il programma e le variabili 3. Input dei dati 4. Utilizziamo gli operatori matematici e commentiamo il codice COSA IMPAREREMO...

Dettagli

Guida agli strumenti etwinning

Guida agli strumenti etwinning Guida agli strumenti etwinning Registrarsi in etwinning Prima tappa: Dati di chi effettua la registrazione Seconda tappa: Preferenze di gemellaggio Terza tappa: Dati della scuola Quarta tappa: Profilo

Dettagli

Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009

Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009 Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009 Introduzione generale Autenticazione dell operatore https://sebina1.unife.it/sebinatest Al primo accesso ai servizi di Back Office, utilizzando

Dettagli

Breve guida all uso di PubMed

Breve guida all uso di PubMed Breve guida all uso di PubMed http://www4.ncbi.nlm.nih.gov/pubmed/ I. Pagina iniziale A destra di appare una finestra di interrogazione dove è possibile inserire uno o più termini. Al di sotto di questa

Dettagli

Attiva la APP di GoToMeeting. Clicca su ATTIVA APP

Attiva la APP di GoToMeeting. Clicca su ATTIVA APP Questo breve manuale ha lo scopo di mostrare la procedura con la quale interfacciare la piattaforma di web conferencing GoToMeeting e la tua piattaforma E-Learning Docebo. Questo interfacciamento consente

Dettagli

Guida ai Servizi Voce per il Referente. Guida ai Servizi Voce per il Referente

Guida ai Servizi Voce per il Referente. Guida ai Servizi Voce per il Referente Guida ai Servizi Voce per il Referente Guida ai Servizi Voce per il Referente 1 Sommario 1 Introduzione... 3 1.1 Accesso al Self Care Web di Rete Unica... 4 2 Servizi Aziendali... 6 2.1 Centralino - Numero

Dettagli

Energy Studio Manager Manuale Utente USO DEL SOFTWARE

Energy Studio Manager Manuale Utente USO DEL SOFTWARE Energy Studio Manager Manuale Utente USO DEL SOFTWARE 1 ANALYSIS.EXE IL PROGRAMMA: Una volta aperto il programma e visualizzato uno strumento il programma apparirà come nell esempio seguente: Il programma

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

FUNZIONI AVANZATE DI EXCEL

FUNZIONI AVANZATE DI EXCEL FUNZIONI AVANZATE DI EXCEL Inserire una funzione dalla barra dei menu Clicca sulla scheda "Formule" e clicca su "Fx" (Inserisci Funzione). Dalla finestra di dialogo "Inserisci Funzione" clicca sulla categoria

Dettagli

LA POSTA ELETTRONICA

LA POSTA ELETTRONICA LA POSTA ELETTRONICA Nella vita ordinaria ci sono due modi principali di gestire la propria corrispondenza o tramite un fermo posta, creandosi una propria casella postale presso l ufficio P:T., oppure

Dettagli

Le formule possono essere scritte utilizzando un insieme di funzioni predefinite che Excel mette a disposizione, raggruppate per argomento.

Le formule possono essere scritte utilizzando un insieme di funzioni predefinite che Excel mette a disposizione, raggruppate per argomento. Excel: le funzioni Le formule possono essere scritte utilizzando un insieme di funzioni predefinite che Excel mette a disposizione, raggruppate per argomento. DEFINIZIONE: Le funzioni sono dei procedimenti

Dettagli

Ultimo aggiornamento.: 18/02/2006 Pagina 1 di 25

Ultimo aggiornamento.: 18/02/2006 Pagina 1 di 25 Introduzione al programma POWERPOINT Ultimo aggiornamento.: 18/02/2006 Pagina 1 di 25 Introduzione al programma POWERPOINT 1 1 Introduzione al programma 3 2 La prima volta con Powerpoint 3 3 Visualizzazione

Dettagli

Database Manager Guida utente DMAN-IT-01/09/10

Database Manager Guida utente DMAN-IT-01/09/10 Database Manager Guida utente DMAN-IT-01/09/10 Le informazioni contenute in questo manuale di documentazione non sono contrattuali e possono essere modificate senza preavviso. La fornitura del software

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Software Emeris Communication Manager

Software Emeris Communication Manager ecm Software Emeris Communication Manager Manuale operativo Fantini Cosmi S.p.A. Via dell Osio 6 20090 Caleppio di Settala MI Tel 02.956821 - Fax 02.95307006 e-mail: info@fantinicosmi.it http://www.fantinicosmi.it

Dettagli

Legge del Raffreddamento di Newton

Legge del Raffreddamento di Newton Legge del Raffreddamento di Newton www.lepla.eu Obiettivo L'obiettivo di questo esperimento è studiare l'andamento temporale della temperatura di un oggetto che si raffredda e trovare un modello matematico

Dettagli

2009 Elite Computer. All rights reserved

2009 Elite Computer. All rights reserved 1 PREMESSA OrisDent 9001 prevede la possibilità di poter gestire il servizio SMS per l'invio di messaggi sul cellulare dei propri pazienti. Una volta ricevuta comunicazione della propria UserID e Password

Dettagli

Guida all uso. Come ricevere ed inviare Fax ed Sms tramite E-mail in 3 semplici passi.

Guida all uso. Come ricevere ed inviare Fax ed Sms tramite E-mail in 3 semplici passi. Guida all uso Come ricevere ed inviare Fax ed Sms tramite E-mail in 3 semplici passi. Legenda Singolo = Fax o SMS da inviare ad un singolo destinatario Multiplo = Fax o SMS da inviare a tanti destinatari

Dettagli

AUTOMATIZZARE UN'AZIONE COMUNE DI WORD USANDO UNA MACRO

AUTOMATIZZARE UN'AZIONE COMUNE DI WORD USANDO UNA MACRO AUTOMATIZZARE UN'AZIONE COMUNE DI WORD USANDO UNA MACRO Con questa esercitazione guidata imparerai a realizzare una macro. Una macro è costituita da una serie di istruzioni pre-registrate che possono essere

Dettagli

REGEL - Registro Docenti

REGEL - Registro Docenti REGEL - Registro Docenti INFORMAZIONI GENERALI Con il Registro Docenti online vengono compiute dai Docenti tutte le operazioni di registrazione delle attività quotidiane, le medesime che si eseguono sul

Dettagli

Manuale d uso per la raccolta: Monitoraggio del servizio di Maggior Tutela

Manuale d uso per la raccolta: Monitoraggio del servizio di Maggior Tutela Manuale d uso per la raccolta: Monitoraggio del servizio di Maggior Tutela Pagina 1 di 9 Indice generale 1 Accesso alla raccolta... 3 2 Il pannello di controllo della raccolta e attivazione delle maschere...

Dettagli

Manuale d uso Apache OpenMeetings (Manuale Utente + Manuale Amministratore)

Manuale d uso Apache OpenMeetings (Manuale Utente + Manuale Amministratore) Manuale d uso Apache OpenMeetings (Manuale Utente + Manuale Amministratore) Autore: Matteo Veroni Email: matver87@gmail.com Sito web: matteoveroni@altervista.org Fonti consultate: http://openmeetings.apache.org/

Dettagli

GUIDA ALLA CONFIGURAZIONE DELLA POSTA iphone/ipad. (v. 1.0.0 Maggio 2014)

GUIDA ALLA CONFIGURAZIONE DELLA POSTA iphone/ipad. (v. 1.0.0 Maggio 2014) GUIDA ALLA CONFIGURAZIONE DELLA POSTA iphone/ipad (v. 1.0.0 Maggio 2014) Benvenuto alla guida di configurazione della posta elettronica per dispositivi mobili tipo iphone/ipad. Prima di proseguire, assicurati

Dettagli

INTERPUMP GROUP SPA-VIA E. FERMI 25 42040 S.ILARIO (RE) http: //www.interpumpgroup.it

INTERPUMP GROUP SPA-VIA E. FERMI 25 42040 S.ILARIO (RE) http: //www.interpumpgroup.it PROCEDURA E-COMMERCE BUSINESS TO BUSINESS Guida alla Compilazione di un ordine INTERPUMP GROUP SPA-VIA E. FERMI 25 42040 S.ILARIO (RE) http: //www.interpumpgroup.it INDICE 1. Autenticazione del nome utente

Dettagli

MANUALE GESTIONE DELLE UTENZE - PORTALE ARGO (VERS. 2.1.0)

MANUALE GESTIONE DELLE UTENZE - PORTALE ARGO (VERS. 2.1.0) Indice generale PREMESSA... 2 ACCESSO... 2 GESTIONE DELLE UTENZE... 3 DATI DELLA SCUOLA... 6 UTENTI...7 LISTA UTENTI... 8 CREA NUOVO UTENTE...8 ABILITAZIONI UTENTE...9 ORARI D'ACCESSO... 11 DETTAGLIO UTENTE...

Dettagli

Cos è un analisi genetica (test genetico)?

Cos è un analisi genetica (test genetico)? 12 Cos è un analisi genetica (test genetico)? Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra Luglio 2008 Questo lavoro è sponsorizzato dal Consorzio EU-FP6 EuroGentest,

Dettagli

Guida ai Servizi Voce per l Utente. Guida ai ai Servizi Voce per l Utente

Guida ai Servizi Voce per l Utente. Guida ai ai Servizi Voce per l Utente Guida ai Servizi Voce per l Utente Guida ai ai Servizi Voce per l Utente 1 Indice Introduzione... 3 1 Servizi Voce Base... 4 1.1 Gestione delle chiamate... 4 1.2 Gestione del Numero Fisso sul cellulare...

Dettagli

SOGEAS - Manuale operatore

SOGEAS - Manuale operatore SOGEAS - Manuale operatore Accesso La home page del programma si trova all indirizzo: http://www.sogeas.net Per accedere, l operatore dovrà cliccare sulla voce Accedi in alto a destra ed apparirà la seguente

Dettagli

Laboratorio Database. Docente Prof. Giuseppe Landolfi

Laboratorio Database. Docente Prof. Giuseppe Landolfi Laboratorio Database Docente Prof. Giuseppe Landolfi Manuale Laboratorio Database Scritto dal Prof.Giuseppe Landolfi per S.M.S Pietramelara Access 2000 Introduzione Che cos'è un Database Il modo migliore

Dettagli

ACCREDITAMENTO EVENTI

ACCREDITAMENTO EVENTI E.C.M. Educazione Continua in Medicina ACCREDITAMENTO EVENTI Manuale utente Versione 1.5 Maggio 2015 E.C.M. Manuale utente per Indice 2 Indice Revisioni 4 1. Introduzione 5 2. Accesso al sistema 6 2.1

Dettagli

EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi

EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi ENDNOTE WEB EndNote Web è un servizio online per la gestione di bibliografie personalizzate integrabili nella redazione di testi: paper, articoli, saggi EndNote Web consente di: importare informazioni

Dettagli

REP_Guidawlg-SE-061113-TRIO

REP_Guidawlg-SE-061113-TRIO REP_Guidawlg-SE-061113-TRIO Istruzioni per l accesso e il completamento dei corsi TRIO per gli utenti di un Web Learning Group 06 novembre 2013 Servizio A TRIO Versione Destinatari: referenti e utenti

Dettagli

Volume HUMIGRAIN SYSTEM. Manuale d uso

Volume HUMIGRAIN SYSTEM. Manuale d uso Volume 1 HUMIGRAIN SYSTEM Manuale d uso Manuale d uso Fornasier Tiziano & C. S.a.s. Via Mercatelli Maglio, 26 31010 Ponte della Priula (TV) - ITALY tel. +39 0438 445354 fax +39 0438 759210 Sommario Principio

Dettagli

Cross Software ltd Malta Pro.Sy.T Srl. Il gestionale come l'avete sempre sognato... Pag. 1

Cross Software ltd Malta Pro.Sy.T Srl. Il gestionale come l'avete sempre sognato... Pag. 1 Il gestionale come l'avete sempre sognato... Pag. 1 Le funzionalità di X-Cross La sofisticata tecnologia di CrossModel, oltre a permettere di lavorare in Internet come nel proprio ufficio e ad avere una

Dettagli

WINDOWS - Comandi rapidi da tastiera più utilizzati.

WINDOWS - Comandi rapidi da tastiera più utilizzati. WINDOWS - Comandi rapidi da tastiera più utilizzati. La prima colonna indica il tasto da premere singolarmente e poi rilasciare. La seconda e terza colonna rappresenta la combinazione dei i tasti da premere

Dettagli

ThemixInfo Gestione Informazione al Pubblico per Laboratori di analisi e Poliambulatori. Manuale d uso. themix Italia srl

ThemixInfo Gestione Informazione al Pubblico per Laboratori di analisi e Poliambulatori. Manuale d uso. themix Italia srl Gestione Informazione al Pubblico per Laboratori di analisi e Poliambulatori Manuale d uso Versione 08/07/2014 themix Italia srl tel. 06 35420034 fax 06 35420150 email info@themix.it LOGIN All avvio il

Dettagli

Boot Camp Guida all installazione e alla configurazione

Boot Camp Guida all installazione e alla configurazione Boot Camp Guida all installazione e alla configurazione Indice 4 Introduzione 5 Cosa ti occorre 6 Panoramica dell installazione 6 Passo 1: verifica la presenza di aggiornamenti. 6 Passo 2: apri Assistente

Dettagli

PROCEDURA DI INSTALLAZIONE DI MYSQL E VolT per utenti Visual Trader e InteractiveBrokers

PROCEDURA DI INSTALLAZIONE DI MYSQL E VolT per utenti Visual Trader e InteractiveBrokers PROCEDURA DI INSTALLAZIONE DI MYSQL E VolT per utenti Visual Trader e InteractiveBrokers La procedura di installazione è divisa in tre parti : Installazione dell archivio MySql, sul quale vengono salvati

Dettagli

Presentazioni efficaci: come si usa prezi?

Presentazioni efficaci: come si usa prezi? Presentazioni efficaci: come si usa prezi? a cura di Lorenzo Amadei (amadei@iol.it) versione 5 febbraio 2013 Cos è prezi Prezi (http://prezi.com/) è un applicazione online per creare presentazioni. In

Dettagli

Procedura Import tracciato ministeriale

Procedura Import tracciato ministeriale Progetto SINTESI Dominio Provinciale Modulo Applicativo:COB Procedura Import tracciato ministeriale 1 INDICE 1 INTRODUZIONE... 3 2 LETTURA DEL FILE... 4 3 IMPORT DEI FILE... 10 4 VERIFICA DELLE BOZZE E

Dettagli

GUIDA RAPIDA emagister-agora Edizione BASIC

GUIDA RAPIDA emagister-agora Edizione BASIC GUIDA RAPIDA emagister-agora Edizione BASIC Introduzione a emagister-agora Interfaccia di emagister-agora Configurazione dell offerta didattica Richieste d informazioni Gestione delle richieste d informazioni

Dettagli

Università degli Studi Roma Tre. Prenotazione on-line

Università degli Studi Roma Tre. Prenotazione on-line Università degli Studi Roma Tre Prenotazione on-line Istruzioni per effettuare la prenotazione on-line degli appelli presenti sul Portale dello Studente Assistenza... 2 Accedi al Portale dello Studente...

Dettagli

Progetto Istanze On Line

Progetto Istanze On Line 2012 Progetto Istanze On Line MOBILITÀ IN ORGANICO DI DIRITTO PRESENTAZIONE DOMANDE PER LA SCUOLA SEC. DI I GRADO ON-LINE 13 Febbraio 2012 INDICE 1 INTRODUZIONE ALL USO DELLA GUIDA... 3 1.1 SIMBOLI USATI

Dettagli

MANUALE UTENTE DEL SOFTWARE DI GESTIONE DEGLI ART. SDVR040A/SDVR080A/SDVR160A

MANUALE UTENTE DEL SOFTWARE DI GESTIONE DEGLI ART. SDVR040A/SDVR080A/SDVR160A MANUALE UTENTE DEL SOFTWARE DI GESTIONE DEGLI ART. SDVR040A/SDVR080A/SDVR160A Leggere attentamente questo manuale prima dell utilizzo e conservarlo per consultazioni future Via Don Arrigoni, 5 24020 Rovetta

Dettagli

NAVIGAORA HOTSPOT. Manuale utente per la configurazione

NAVIGAORA HOTSPOT. Manuale utente per la configurazione NAVIGAORA HOTSPOT Manuale utente per la configurazione NAVIGAORA Hotspot è l innovativo servizio che offre ai suoi clienti accesso ad Internet gratuito, in modo semplice e veloce, grazie al collegamento

Dettagli

MEGA Process. Manuale introduttivo

MEGA Process. Manuale introduttivo MEGA Process Manuale introduttivo MEGA 2009 SP4 1ª edizione (giugno 2010) Le informazioni contenute nel presente documento possono essere modificate senza preavviso e non costituiscono in alcun modo un

Dettagli

Denuncia di Malattia Professionale telematica

Denuncia di Malattia Professionale telematica Denuncia di Malattia Professionale telematica Manuale utente Versione 1.5 COME ACCEDERE ALLA DENUNCIA DI MALATTIA PROFESSIONALE ONLINE... 3 SITO INAIL... 3 LOGIN... 4 UTILIZZA LE TUE APPLICAZIONI... 5

Dettagli

Università degli Studi Roma Tre. Prove di Ammissione / Valutazione della Preparazione Iniziale

Università degli Studi Roma Tre. Prove di Ammissione / Valutazione della Preparazione Iniziale Università degli Studi Roma Tre Prove di Ammissione / Valutazione della Preparazione Iniziale Istruzioni per l individuazione della propria Prematricola e della posizione in graduatoria Introduzione...

Dettagli

Gestore Comunicazioni Obbligatorie. Progetto SINTESI. Comunicazioni Obbligatorie. Modulo Applicativo COB. - Versione Giugno 2013 -

Gestore Comunicazioni Obbligatorie. Progetto SINTESI. Comunicazioni Obbligatorie. Modulo Applicativo COB. - Versione Giugno 2013 - Progetto SINTESI Comunicazioni Obbligatorie Modulo Applicativo COB - Versione Giugno 2013-1 Versione Giugno 2013 INDICE 1 Introduzione 3 1.1 Generalità 3 1.2 Descrizione e struttura del manuale 3 1.3 Requisiti

Dettagli

Manuale di installazione e d uso

Manuale di installazione e d uso Manuale di installazione e d uso 1 Indice Installazione del POS pag. 2 Funzionalità di Base - POS Sagem - Accesso Operatore pag. 2 - Leggere una Card/braccialetto Cliente con il lettore di prossimità TeliumPass

Dettagli

Test per portatori sani

Test per portatori sani 16 Test per portatori sani Tutti i nomi originali in questo opuscolo sono stati cambiati per proteggere l'identità degli intervistati. Queste informazioni sono state elaborate dal Genetic Interest Group.

Dettagli

GUIDA ALL UTILIZZO DELL ECM 8

GUIDA ALL UTILIZZO DELL ECM 8 GUIDA ALL UTILIZZO DELL ECM 8 GUIDA ALL UTILIZZO DELL ECM 8 1) Introduzione Pg 3 2) L area amministratore Pg 3 2.1) ECM Pg 4 2.1.1) Sezione Struttura Pg 5 2.1.2) Sezione Documento Pg 7 2.1.3) Sezione Pubblicazione

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati

Dettagli

Boot Camp Guida di installazione e configurazione

Boot Camp Guida di installazione e configurazione Boot Camp Guida di installazione e configurazione Indice 3 Introduzione 4 Panoramica dell'installazione 4 Passo 1: Verificare la presenza di aggiornamenti 4 Passo 2: Per preparare il Mac per Windows 4

Dettagli

Guida pratica di base

Guida pratica di base Adolfo Catelli Guida pratica di base Windows XP Professional Dicembre 2008 Sommario Accedere a Windows XP 4 Avviare Windows XP 4 Uscire da Windows XP 5 L interfaccia utente di Windows XP 6 Il desktop di

Dettagli

Importazione dati da Excel

Importazione dati da Excel Nota Salvatempo Spesometro 4.3 19 MARZO 2015 Importazione dati da Excel In previsione della prossima scadenza dell'invio del Modello Polivalente (Spesometro scadenza aprile 2015), è stata implementata

Dettagli

UNIVERSITA DEGLI STUDI DI TORINO WORD

UNIVERSITA DEGLI STUDI DI TORINO WORD WORD SOMMARIO 1. Muoversi nel testo... 1 2. Taglia, copia e incolla... 2 3. Aprire, salvare e chiudere... 3 4. Trovare e sostituire... 4 5. Visualizzare in modi diversi... 6 6. Formattare e incolonnare...

Dettagli

Guida Studenti per i servizi online: compilazione dei questionari per la valutazione della didattica Iscrizione agli appelli

Guida Studenti per i servizi online: compilazione dei questionari per la valutazione della didattica Iscrizione agli appelli Guida Studenti per i servizi online: compilazione dei questionari per la valutazione della didattica Iscrizione agli appelli v 4.0 1. Requisiti software Lo studente deve essere dotato di connessione internet

Dettagli

Percorsi di matematica per il ripasso e il recupero

Percorsi di matematica per il ripasso e il recupero Giacomo Pagina Giovanna Patri Percorsi di matematica per il ripasso e il recupero 1 per la Scuola secondaria di secondo grado UNITÀ CMPIONE Edizioni del Quadrifoglio à t i n U 1 Insiemi La teoria degli

Dettagli

Manuale del Trader. Benvenuti nel fantastico mondo del trading binario!

Manuale del Trader. Benvenuti nel fantastico mondo del trading binario! Manuale del Trader Benvenuti nel fantastico mondo del trading binario! Questo manuale spiega esattamente cosa sono le opzioni binarie, come investire e familiarizzare con il nostro sito web. Se avete delle

Dettagli

Form Designer Guida utente DOC-FD-UG-IT-01/01/12

Form Designer Guida utente DOC-FD-UG-IT-01/01/12 Form Designer Guida utente DOC-FD-UG-IT-01/01/12 Le informazioni contenute in questo manuale di documentazione non sono contrattuali e possono essere modificate senza preavviso. La fornitura del software

Dettagli

Istruzioni per l importazione del certificato per Internet Explorer

Istruzioni per l importazione del certificato per Internet Explorer Istruzioni per l importazione del certificato per Internet Explorer 1. Prima emissione certificato 1 2. Rilascio nuovo certificato 10 3. Rimozione certificato 13 1. Prima emissione certificato Dal sito

Dettagli

Guida all utilizzo del Portaltermico per i privati che installano un sistema di riscaldamento a biomassa

Guida all utilizzo del Portaltermico per i privati che installano un sistema di riscaldamento a biomassa Guida all utilizzo del Portaltermico per i privati che installano un sistema di riscaldamento a biomassa (intervento 2.B - art. 4, comma 2, lettera b) D.M. 28 dicembre 2012 Agosto 2013 AIEL Annalisa Paniz

Dettagli

1x1 qs-stat. Pacchetto Software per la Soluzione di Problemi Statistici nel Controllo Qualità. Versione: 1 / Marzo 2010 Doc. n.

1x1 qs-stat. Pacchetto Software per la Soluzione di Problemi Statistici nel Controllo Qualità. Versione: 1 / Marzo 2010 Doc. n. 1x1 qs-stat Pacchetto Software per la Soluzione di Problemi Statistici nel Controllo Qualità Versione: 1 / Marzo 2010 Doc. n.: PD-0012 Copyright 2010 Q-DAS GmbH & Co. KG Eisleber Str. 2 D - 69469 Weinheim

Dettagli

Utilizzare Swisscom TV

Utilizzare Swisscom TV Swisscom (Svizzera) SA Contact Center CH-3050 Bern www.swisscom.ch 125474 12/2010 Utilizzare Swisscom TV Panoramica delle funzioni più importanti Indice Funzioni importanti quadro generale 3 Funzione PiP

Dettagli