Regolazione dell espressione genica in eucarioti

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Regolazione dell espressione genica in eucarioti"

Transcript

1 Regolazione dell espressione genica in eucarioti

2 -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale

3 Alcuni elementi per la regolazione genica negli eucarioti: Promotori: fattori di trascrizione e repressori Enhancer Stabilita dell RNA Splicing alternativo Risposta ormonale Rimodulazione della cromatina Metilazione del DNA

4 tabilita dell RNA: più è stabile e più cicli di traduzione effettua Assicurata dal CAP5 e dalla polya La lunghezza del polya può determinare la stabilità dell mrna (mrna per gli istoni non hanno il polya ed hanno una breve emivita)

5 La struttura della regione 3 UTR non tradotta influenza la stabilita dell mrna (sequenze AUUUA ripetute nella 3 UTR determinano breve emivita dell mrna) Se si trasferisce la sequenza AUUUA ad un mrna stabile, questo diventa instabile

6

7 SPLICING ALTERNATIVO determinazione del sesso in Drosophila: gene Sex-lethal Esone incluso Proteina non funzionale Proteina funzionale per lo Esone rimosso

8

9

10 espressione genica indotta da un ormone è mediata da specifiche sequenze sul DNA, chiamate elementi HRE (elementi di risposta all ormone) Risposta ormonale Ormone steroideo Ormone peptidico

11 ENHANCER

12 Enhancer: vi si legano fattori di trascrizione speciali, che a loro volta interagiscono con i fattori di trascrizione posti sul promotore e con la RNA polimerasi -agiscono a distanze molto ampie -agiscono in entrambi gli orientamenti -effetti indipendenti dalla posizione (a monte o a valle del gene)

13 L enhancer UAS di lievito Attivazione dei geni del metabolismo del galattosio al10 GAL4, fattore di trascrizione che si lega all enhancer UAS (Upstream activating sequence)

14 Gal4 zincfinger è espressa costituti vamente

15 Struttura Gal4 AD DBD

16 DBD TWO-HYBRID SYSTEM COME DETERMINARE L INTERAZIONE TRA 2 PROTEINE E BASATO SULLA COSTRUZIONE DI 2 TIPI DI IBRIDI: 1-DBD-BYTE 2-AD-PREY BYTE (PROTEINA NOTA) AD PREY (PROTEINA

17

18 PROTEINA NOTA PROTEINA INTERAGENTE

19 La cellula in cui c e interazione tra le 2 proteine sopravvive su terreno in cui l aminoacido che viene espresso o esprime il marcatore LacZ

20 Saccaromyces Cerevisiae Attivazione del reporter essenziale x la sopravviven za della cellula

21 L attivazione di un gene richiede cambiamenti nello stato della cromatina per avere accesso al DNA Geni attivi eucromatina Geni inattivi eterocromatina Alcuni attivatori trascrizionali modificano gli istoni acetilandoli Alcuni repressori trascrizionali li deacetilano

22 Una volta stabiliti, i cambiamenti cromatinici possono persistere attraverso le divisioni cellulari, creando uno stato epigenetico Eredita della condizione di inattivazione

23 2 tipi di condizioni in cui si trova un promotore eucariotico Se si legano prima gli istoni al promotore la trascrizione è bloccata; se si legano prima i fattori di trascrizione la trascrizione è attiva Stato inattivo del promotore Stato attivo

24 Transcription factors or nucleosomes may form stable structures that cannot be changed merely by changing the equilibrium with free components. Chromatin remodeling

25 Il complesso SWI/SNF permette il rimodellamento della struttura cromatinica e lo slittamento dei nucleosomi lungo il DNA rendendolo accessibile da parte della RNA polimerasi II e dei fattori di trascrizione

26 I cambiamenti cromatinici possono compromettere la funzionalità del promotore, di un intero gene, o di un intero cromosoma I cambiamenti nella struttura della cromatina iniziano attraverso la modificazione degli istoni, nella coda N-terminale, soprattutto degli istoni H3 e H4.

27 Tipi di modificazione degli istoni

28 Tutti gli istoni possono essere acetilati: l acetilazione è incrementata nei geni trascrizionalmente attivi e la cromatina acetilata è più sensibile alla DNA-asi I

29 L acetilazione è un fenomeno reversibile Enzimi HAT (acetiltransferasi) Enzimi HDAC (deacetiltransferasi)

30 ODULAZIONE DELLA CROMATINA La struttura dei nucleosomi influenza la trascrizione Il dna più trascritto è più facilmente attaccato dalle nucleasi Acetilazione attivazione Acetilazione degli istoni da parte di HAT Apertura della cromatina accessibile alla trascrizione

31 La metilazione è associata ad inattivita trascrizionale La metilazione avviene sugli istoni (lisina 9 dell istone H3) ad opera di metiltransferasi Avviene sul DNA a livello delle isole CpG sia di promotori sia di sequenze geniche codificanti, ad opera di metilasi

32 METILAZIONE DEGLI ISTONI BLOCCO DELLA TRASCRIZIONE AD OPERA DELLE METIL- TRASFERASI (DNMT)

33 L attivazione del promotore richiede il legame di diversi fattori

34 La formazione di eterocromatina on è rigorosamente definita dalla sequenza Quando un gene è trasferito, per traslocazione, trasfezione o integrazione, in una posizione adiacente all eterocromatina, può diventare inattivo, eterocromatinizzandosi Effetto epigenetico o variegazione per effetto da posizione

35 -L inattivazione si diffonde dall eterocromatina alle regioni adiacenti per una distanza variabile -In genere l inattivazione di un gene avviene durante le prime fasi dello sviluppo embrionale e successivamente il gene è ereditato come tale dalle cellule discendenti Fasi dell eterocromatinizzazione: -nucleazione (inizia in sequenze specifiche) -propagazione imprecisa lungo il cromosoma

36 Le proteine leganti la cromatina hanno domini comuni Cromo-domini HP1, hanno come target l eterocromatina Bromo-domini Presente in una varietà di proteine che interagiscono con la cromatina aperta, in particolare con le istone acetilasi e fattori di trascrizione

37 La proteina HP1 H3 deacetilato metilato legato ad HP1

38 Inattivazione del cromosoma X emminile:compensazione da dosaggio Si riattiva durante l oogenesi Inattivazione random di un X, ereditata dalle cellule discendenti Aumenta I 2 X degli l espressione ermafroditi dell X maschile esprimono in cromosomi modo ridotto politenici iperattivi

39 Il cromosoma X Elementi LINE Sequenze Alu ricche di GC Sequenze ripetute invertite e LTR Ricco di geni sesso-specifici, come geni espressi nel muscolo, nel cervello, e geni della prima spermatogenesi

40 Inattivazione dell X nei mammiferi -Il centro dell inattivazione di uno dei 2 cromosomi X è il locus XIC o centro dell inattivazione dell X -Se questo locus viene inserito in un autosoma, questo viene inattivato -Xic è un locus cis-agente da cui parte l eterocromatinizzazione che si estende su tutto il cromosoma in entrambe le direzioni -Di tutto il cromosoma X inattivo c è il gene Xist (X inactive specific transcript) che è attivo solo nel cromosoma inattivo

41 -Xist codifica un trascritto privo di schemi di lettura, quindi un RNA che non produce proteina (ncrna) -L Rna di Xist si trova solo sul cromosoma inattivo -Studi condotti sulle cellule di topo, hanno dimostrato che Xist e prodotto precocemente da entrambi i cromosomi, ma essendo l RNA molto instabile, viene facilmente degradato,e solo sul cromosoma in cui viene stabilizzato, va a ricoprire il cromosoma poi inattivato -Il cromosoma inattivo e visibile durante l interfase come corpuscolo scuro associato alla membrana nucleare, detto Corpo di Barr - Il cromosoma X inattivo si replica piu lentamente degli altri a causa della sua cromatina molto condensata, ricca di istoni H3 e H4 ipoacetilati

42 l locus XIST da solo non basta, ma servono elementi ch percepiscono il numero dei cromosomi X e della scelta del cromosoma da inattivare L elemento della conta sembra essere ocalizzato a valle di Xist (3 ) L elemento della scelta sembra risiedere nel locus XIC E veramente random la scelta dell X da inattivare? embra che nei marsupiali e nei tessuti extraembrional di topo l inattivazione dell X e imprinted (o paterno o materno), Importante un elemento a valle di Xist, che modifica il rapporto 50:50 dell inattivazione

43 Geni che sfuggono all inattivazione dell X Sono geni che hanno dei loro omologhi nel cromosoma Y Il loro escape dipende dalla sequenza genica e non dalla loro posizione I geni che sfuggono all inattivazione dell X hanno una regione 5 meno ricca di CpG I geni attivi nell X inattivo sono circondati da INSULATORS

44 Insulator Sequenza di DNA agente in cis, che previene il passaggio di effetti attivanti o inattivanti

45 Le isole CpG -Lo 0.7% del genoma umano contiene doppietti CpG -Il 2-7% delle citosine del DNA dei mammiferi sono metilate -La maggior parte dei gruppi metile si trovano nelle isole CpG - La metilazione avviene ad opera di Metilasi e demetilasi del DNA

46 La metilazione ha vari tipi di targets CpG di promotori, che sono metilati quando il gene e inattivo o demetilati nel gene attivo CpG di DNA satellite, che, metilato, stabilizza il DNA centromerico

47 Le metilazioni del DNA sono responsabili di: -IMPRINTING -patologie -espressione tessuto-specifica -Differenziamento cellulare -Vecchiaia -Carcinogenesi (ipometilazione di promotori di oncogeni o ipermetilazione di promotori di oncosoppressori riprogrammazione dello stato cromatinico) -Inattivazione dell X

48

49 IMPRINTING Alleli materni o paterni sono ereditati metilati o no differente comportamento tra gli alleli ereditati da ogni genitore Se l allele paterno attivo porta una mutazione l embrione presenta il fenotipo malato Se l embrione e femmina il gene viene metilato nei gameti durante la gametogenesi Se l embrione e maschio il gene materno deve essere demetilato

50 L IMPRINTING e regolato dallo stato di metilazione di una sequenza cis-agente vicina al gene, chiamata DMD o ICR (imprinting control region); la sua delezione rimuove l imprinting Geni con opposto imprinting regolati dallo stesso ICR, che funziona da insulator

51 IL REPRESSORE Kox1 che porta il dominio KRAB Proteine che contengono domini zinc-finger e Domini di repressione trascrizionale Kruppel-associated boxes Domini di legame al DNA

52 Domini di repressione trascrizionale attivi sulle RNA polimerasi I,II e II Come funziona la repressione trascrizionale operata da Krab? Condensazione reversibile della cromatina

53 Sistemi ibridi TetR-KRAB per accendere e spegnere l espressione genica eucariotica Repressore TetR che blocca l espressione dell operone Tet La tetraciclina stacca il repressore da TetO e attiva l operone TetO TetA TetR Proteina di efflusso della tetraciclina Proteina repressore

54 Proteina di fusione KRAB-TetR Geni eucariotici inducibili e reprimibili basati sul repressore procariotico TetR-TetO Repressore KRAB KRAB ttr Repressore della tetraciclina tetr

55 QUALI SONO LE MUTAZIONI GENICHE RILEVANTI NELLO SVILUPPO E MANTENIMENTO DEL TUMORE? STUDIO DELLA GENESI DEL MELANOMA DIPENDENTE DALL ESPRESSIONE DI H-Ras V12G IN TOPI INK4a -/-, QUINDI PRIVI DELL ATTIVITA DI SOPPRESSIONE DEL TUMORE

56 ANIMALE TRANSGENICO tutte le cellule nucleate contengono il transgene MICROINIEZIONE NEI PRONUCLEI

57 ANIMALI CHIMERICI e le CELLULE STAMINALI EMBRIONALI

58 a b Progenie con cellule germinali portatrici del transgene Eredita mendeliana del transgene Cellule germinali aploidi

59 KRA B ttr TetO P RasV12G RISOMMINISTRAZIONE DI DOXICICLINA

60

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Inattivazione del cromosoma X e eredita X-linked

Inattivazione del cromosoma X e eredita X-linked Inattivazione del cromosoma X e eredita X-linked By NA Lezione 15 1 X inattivo By NA 2 J L inattivazione domande Vengono inattivati tutti i geni della X? No, inizialmente si riteneva che l inattivazione

Dettagli

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Eredità non mendeliana

Eredità non mendeliana Eredità non mendeliana eredità extranucleare o citoplasmatica effetto materno eredità epigenetica (imprinting) anticipazione Eredità extranucleare eredità materna o paterna geni non nucleari: genomi mitocondriali

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica 1 Eucarioti pluricellulari -un singolo organismo, utilizzando un unico genoma, deve produrre centinaia di tipi cellulari differenti e specializzati. -le cellule differenziate

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.!

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! rimodellatori? Svolgimento del DNA nucleosmale a par6re

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Geni e ambiente. Veronica Mariotti

Geni e ambiente. Veronica Mariotti Geni e ambiente nello sviluppo del fenotipo Veronica Mariotti Innato e Appreso XVII secolo- filosofo Jhon Locke : le esperienze hanno un ruolo predominante nella formazione dell individuo XIX secolo -

Dettagli

Che significa animale transgenico o animale Knockout???

Che significa animale transgenico o animale Knockout??? Che significa animale transgenico o animale Knockout??? ORGANISMI TRANSGENICI Gli animali che sono stati ingegnerizzati per inserzione di un gene, delezione di un gene o sostituzione di un gene si chiamano

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel il sesso di un individuo

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici www.fisiokinesiterapia.biz Fattori estrinseci Ambiente Danno genotossico

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Il Two-Hybrid System e le sue applicazioni

Il Two-Hybrid System e le sue applicazioni Il Two-Hybrid System e le sue applicazioni Una breve storia 1985 nel laboratorio di Mark Ptashne fu dimostrata la modularità degli attivatori della trascrizione leganti il DNA. 1988 nel laboratorio di

Dettagli

1 a LEGGE DI MENDEL Legge della Segregazione

1 a LEGGE DI MENDEL Legge della Segregazione IMPRINTING 1 a LEGGE DI MENDEL Legge della Segregazione I due membri di una coppia di alleli, durante la formazione dei gameti segregano in maniera indipendente, cioè in modo che metà dei gameti porti

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

EPIGENETICA (2014) 1. Metilazione del DNA. 2. Organizzazione della cromatina. 3. Imprinting genomico

EPIGENETICA (2014) 1. Metilazione del DNA. 2. Organizzazione della cromatina. 3. Imprinting genomico EPIGENETICA (2014) Il "dogma centrale" della biologia molecolare sostiene che le informazioni ereditarie sono trasmesse attraverso meccanismi genetici. In realtà, lungo le generazioni, una cellula scambia

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

LA GENETICA MENDELIANA NELLA SPECIE UMANA!

LA GENETICA MENDELIANA NELLA SPECIE UMANA! LA GENETICA MENDELIANA NELLA SPECIE UMANA! ALBERI GENEALOGICI ACCOPPIAMENTO PROGENIE in ordine di nascita (da sx a dx) EREDITA AUTOSOMICA DOMINANTE AUTOSOMICA: il locus genico che controlla il carattere

Dettagli

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di

Dettagli

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche La patogenesi di aborti dovuti ad anomalie cromosomiche è dovuta a: A) Ipoplasia placentare; B) Malformazioni

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

MODALITA DI TRASMISSIONE DEI CARATTERI EREDITARI UMANI. Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti

MODALITA DI TRASMISSIONE DEI CARATTERI EREDITARI UMANI. Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti MODALITA DI TRASMISSIONE DEI CARATTERI EREDITARI UMANI Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti A premessa di tale parte bisogna definire i caratteri Famigliare - carattere che

Dettagli

The difference between genetics and epigenetics can probably be compared to the difference between writing and reading a book.

The difference between genetics and epigenetics can probably be compared to the difference between writing and reading a book. Epigenetica Definita come lo studio dei meccanismi responsabili di cambiamenti ereditabili nelle funzioni del genoma senza alcuna modificazione nella sequenza del DNA The difference between genetics and

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Patologie da mutazioni dinamiche

Patologie da mutazioni dinamiche Patologie da mutazioni dinamiche Mutazioni dinamiche mutazioni progressive, nei tessuti e nelle generazioni, di ripetizioni instabili Alleli normali Pre-mutazioni Mutazioni Le alterazioni fenotipiche (patologia)

Dettagli

IL RUOLO DELLA METILAZIONE DELL ISTONE H3 DURANTE LA FORMAZIONE DELL ETEROCROMATINA FACOLTATIVA

IL RUOLO DELLA METILAZIONE DELL ISTONE H3 DURANTE LA FORMAZIONE DELL ETEROCROMATINA FACOLTATIVA UNIVERSITÀ DEGLI STUDI DELLA TUSCIA DI VITERBO DIPARTIMENTO DI AGROBIOLOGIA ED AGROCHIMICA CORSO DI DOTTORATO DI RICERCA GENETICA E BIOLOGIA CELLULARE - XXI CICLO. TITOLO TESI DI DOTTORATO DI RICERCA:

Dettagli

L eredita legata al sesso

L eredita legata al sesso L eredita legata al sesso La maggior parte delle specie animali e vegetali presenta dimorfismo sessuale Individui maschi Individui femmine Il sesso e determinato da specifici cromosomi sessuali Nell uomo

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3

Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Grazia Cantelmi, AIF SUN Napoli Prof.ssa L.Perrone, Dipartimento della donna, del bambino, di chirurgia generale e specialistica

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

Gene number 19,000 30,000

Gene number 19,000 30,000 Gene number 6000 19,000 13,500 30,000 30,000 MODULI: Nucleotidi (4) Amino acidi (21) Domini proteici/proteine (Domini di interazione proteina-proteina Proteina/DNA o Proteina /RNA Interazione con membrana

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

La rivoluzione epigenetica

La rivoluzione epigenetica La rivoluzione epigenetica Mauro Durante 2011 Perceptions of epigenetics Adrian Bird (2007) Geneticists study the gene; however, for epigeneticists, there is no obvious epigene. Nevertheless, during the

Dettagli

RIATTIVAZIONE EPIGENETICA DEL GENE FMR1

RIATTIVAZIONE EPIGENETICA DEL GENE FMR1 RIATTIVAZIONE EPIGENETICA DEL GENE FMR1 Pietro Chiurazzi Istituto di Genetica Medica Università Cattolica del Sacro Cuore Sindrome X Fragile (OMIM #300624) La FXS è la causa più comune di ritardo psicomotorio

Dettagli

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti NUCLEO Il nucleo è la centrale operativa che controlla i vari processi che si svolgono dentro la cellula. Contiene il materiale genetico DNA e proteine. Quando la cellula è a riposo il DNA è sotto forma

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

TEST Lo Studente Ricercatore edizione 2011

TEST Lo Studente Ricercatore edizione 2011 TEST Lo Studente Ricercatore edizione 2011 1. A chi soffre di colesterolo elevato è sconsigliato mangiare i crostacei, che ne contengono una quantità elevata. Dovrà pertanto eliminare dal suo menù soprattutto

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

UNIVERSITA' DEGLI STUDI DI FERRARA

UNIVERSITA' DEGLI STUDI DI FERRARA UNIVERSITA' DEGLI STUDI DI FERRARA FACOLTA' DI FARMACIA Dipartimento di Biochimica e Biologia Molecolare Corso di Laurea in Chimica e Tecnologia Farmaceutiche EVEROLIMUS: UN POTENTE INDUTTORE DEL DIFFERENZIAMENTO

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI La Fecondazione Processo con cui due cellule sessuali (gameti) si uniscono per formare un nuovo individuo cha ha un genoma

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli