Regolazione dell espressione genica in eucarioti

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Regolazione dell espressione genica in eucarioti"

Transcript

1 Regolazione dell espressione genica in eucarioti

2 -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale

3 Alcuni elementi per la regolazione genica negli eucarioti: Promotori: fattori di trascrizione e repressori Enhancer Stabilita dell RNA Splicing alternativo Risposta ormonale Rimodulazione della cromatina Metilazione del DNA

4 tabilita dell RNA: più è stabile e più cicli di traduzione effettua Assicurata dal CAP5 e dalla polya La lunghezza del polya può determinare la stabilità dell mrna (mrna per gli istoni non hanno il polya ed hanno una breve emivita)

5 La struttura della regione 3 UTR non tradotta influenza la stabilita dell mrna (sequenze AUUUA ripetute nella 3 UTR determinano breve emivita dell mrna) Se si trasferisce la sequenza AUUUA ad un mrna stabile, questo diventa instabile

6

7 SPLICING ALTERNATIVO determinazione del sesso in Drosophila: gene Sex-lethal Esone incluso Proteina non funzionale Proteina funzionale per lo Esone rimosso

8

9

10 espressione genica indotta da un ormone è mediata da specifiche sequenze sul DNA, chiamate elementi HRE (elementi di risposta all ormone) Risposta ormonale Ormone steroideo Ormone peptidico

11 ENHANCER

12 Enhancer: vi si legano fattori di trascrizione speciali, che a loro volta interagiscono con i fattori di trascrizione posti sul promotore e con la RNA polimerasi -agiscono a distanze molto ampie -agiscono in entrambi gli orientamenti -effetti indipendenti dalla posizione (a monte o a valle del gene)

13 L enhancer UAS di lievito Attivazione dei geni del metabolismo del galattosio al10 GAL4, fattore di trascrizione che si lega all enhancer UAS (Upstream activating sequence)

14 Gal4 zincfinger è espressa costituti vamente

15 Struttura Gal4 AD DBD

16 DBD TWO-HYBRID SYSTEM COME DETERMINARE L INTERAZIONE TRA 2 PROTEINE E BASATO SULLA COSTRUZIONE DI 2 TIPI DI IBRIDI: 1-DBD-BYTE 2-AD-PREY BYTE (PROTEINA NOTA) AD PREY (PROTEINA

17

18 PROTEINA NOTA PROTEINA INTERAGENTE

19 La cellula in cui c e interazione tra le 2 proteine sopravvive su terreno in cui l aminoacido che viene espresso o esprime il marcatore LacZ

20 Saccaromyces Cerevisiae Attivazione del reporter essenziale x la sopravviven za della cellula

21 L attivazione di un gene richiede cambiamenti nello stato della cromatina per avere accesso al DNA Geni attivi eucromatina Geni inattivi eterocromatina Alcuni attivatori trascrizionali modificano gli istoni acetilandoli Alcuni repressori trascrizionali li deacetilano

22 Una volta stabiliti, i cambiamenti cromatinici possono persistere attraverso le divisioni cellulari, creando uno stato epigenetico Eredita della condizione di inattivazione

23 2 tipi di condizioni in cui si trova un promotore eucariotico Se si legano prima gli istoni al promotore la trascrizione è bloccata; se si legano prima i fattori di trascrizione la trascrizione è attiva Stato inattivo del promotore Stato attivo

24 Transcription factors or nucleosomes may form stable structures that cannot be changed merely by changing the equilibrium with free components. Chromatin remodeling

25 Il complesso SWI/SNF permette il rimodellamento della struttura cromatinica e lo slittamento dei nucleosomi lungo il DNA rendendolo accessibile da parte della RNA polimerasi II e dei fattori di trascrizione

26 I cambiamenti cromatinici possono compromettere la funzionalità del promotore, di un intero gene, o di un intero cromosoma I cambiamenti nella struttura della cromatina iniziano attraverso la modificazione degli istoni, nella coda N-terminale, soprattutto degli istoni H3 e H4.

27 Tipi di modificazione degli istoni

28 Tutti gli istoni possono essere acetilati: l acetilazione è incrementata nei geni trascrizionalmente attivi e la cromatina acetilata è più sensibile alla DNA-asi I

29 L acetilazione è un fenomeno reversibile Enzimi HAT (acetiltransferasi) Enzimi HDAC (deacetiltransferasi)

30 ODULAZIONE DELLA CROMATINA La struttura dei nucleosomi influenza la trascrizione Il dna più trascritto è più facilmente attaccato dalle nucleasi Acetilazione attivazione Acetilazione degli istoni da parte di HAT Apertura della cromatina accessibile alla trascrizione

31 La metilazione è associata ad inattivita trascrizionale La metilazione avviene sugli istoni (lisina 9 dell istone H3) ad opera di metiltransferasi Avviene sul DNA a livello delle isole CpG sia di promotori sia di sequenze geniche codificanti, ad opera di metilasi

32 METILAZIONE DEGLI ISTONI BLOCCO DELLA TRASCRIZIONE AD OPERA DELLE METIL- TRASFERASI (DNMT)

33 L attivazione del promotore richiede il legame di diversi fattori

34 La formazione di eterocromatina on è rigorosamente definita dalla sequenza Quando un gene è trasferito, per traslocazione, trasfezione o integrazione, in una posizione adiacente all eterocromatina, può diventare inattivo, eterocromatinizzandosi Effetto epigenetico o variegazione per effetto da posizione

35 -L inattivazione si diffonde dall eterocromatina alle regioni adiacenti per una distanza variabile -In genere l inattivazione di un gene avviene durante le prime fasi dello sviluppo embrionale e successivamente il gene è ereditato come tale dalle cellule discendenti Fasi dell eterocromatinizzazione: -nucleazione (inizia in sequenze specifiche) -propagazione imprecisa lungo il cromosoma

36 Le proteine leganti la cromatina hanno domini comuni Cromo-domini HP1, hanno come target l eterocromatina Bromo-domini Presente in una varietà di proteine che interagiscono con la cromatina aperta, in particolare con le istone acetilasi e fattori di trascrizione

37 La proteina HP1 H3 deacetilato metilato legato ad HP1

38 Inattivazione del cromosoma X emminile:compensazione da dosaggio Si riattiva durante l oogenesi Inattivazione random di un X, ereditata dalle cellule discendenti Aumenta I 2 X degli l espressione ermafroditi dell X maschile esprimono in cromosomi modo ridotto politenici iperattivi

39 Il cromosoma X Elementi LINE Sequenze Alu ricche di GC Sequenze ripetute invertite e LTR Ricco di geni sesso-specifici, come geni espressi nel muscolo, nel cervello, e geni della prima spermatogenesi

40 Inattivazione dell X nei mammiferi -Il centro dell inattivazione di uno dei 2 cromosomi X è il locus XIC o centro dell inattivazione dell X -Se questo locus viene inserito in un autosoma, questo viene inattivato -Xic è un locus cis-agente da cui parte l eterocromatinizzazione che si estende su tutto il cromosoma in entrambe le direzioni -Di tutto il cromosoma X inattivo c è il gene Xist (X inactive specific transcript) che è attivo solo nel cromosoma inattivo

41 -Xist codifica un trascritto privo di schemi di lettura, quindi un RNA che non produce proteina (ncrna) -L Rna di Xist si trova solo sul cromosoma inattivo -Studi condotti sulle cellule di topo, hanno dimostrato che Xist e prodotto precocemente da entrambi i cromosomi, ma essendo l RNA molto instabile, viene facilmente degradato,e solo sul cromosoma in cui viene stabilizzato, va a ricoprire il cromosoma poi inattivato -Il cromosoma inattivo e visibile durante l interfase come corpuscolo scuro associato alla membrana nucleare, detto Corpo di Barr - Il cromosoma X inattivo si replica piu lentamente degli altri a causa della sua cromatina molto condensata, ricca di istoni H3 e H4 ipoacetilati

42 l locus XIST da solo non basta, ma servono elementi ch percepiscono il numero dei cromosomi X e della scelta del cromosoma da inattivare L elemento della conta sembra essere ocalizzato a valle di Xist (3 ) L elemento della scelta sembra risiedere nel locus XIC E veramente random la scelta dell X da inattivare? embra che nei marsupiali e nei tessuti extraembrional di topo l inattivazione dell X e imprinted (o paterno o materno), Importante un elemento a valle di Xist, che modifica il rapporto 50:50 dell inattivazione

43 Geni che sfuggono all inattivazione dell X Sono geni che hanno dei loro omologhi nel cromosoma Y Il loro escape dipende dalla sequenza genica e non dalla loro posizione I geni che sfuggono all inattivazione dell X hanno una regione 5 meno ricca di CpG I geni attivi nell X inattivo sono circondati da INSULATORS

44 Insulator Sequenza di DNA agente in cis, che previene il passaggio di effetti attivanti o inattivanti

45 Le isole CpG -Lo 0.7% del genoma umano contiene doppietti CpG -Il 2-7% delle citosine del DNA dei mammiferi sono metilate -La maggior parte dei gruppi metile si trovano nelle isole CpG - La metilazione avviene ad opera di Metilasi e demetilasi del DNA

46 La metilazione ha vari tipi di targets CpG di promotori, che sono metilati quando il gene e inattivo o demetilati nel gene attivo CpG di DNA satellite, che, metilato, stabilizza il DNA centromerico

47 Le metilazioni del DNA sono responsabili di: -IMPRINTING -patologie -espressione tessuto-specifica -Differenziamento cellulare -Vecchiaia -Carcinogenesi (ipometilazione di promotori di oncogeni o ipermetilazione di promotori di oncosoppressori riprogrammazione dello stato cromatinico) -Inattivazione dell X

48

49 IMPRINTING Alleli materni o paterni sono ereditati metilati o no differente comportamento tra gli alleli ereditati da ogni genitore Se l allele paterno attivo porta una mutazione l embrione presenta il fenotipo malato Se l embrione e femmina il gene viene metilato nei gameti durante la gametogenesi Se l embrione e maschio il gene materno deve essere demetilato

50 L IMPRINTING e regolato dallo stato di metilazione di una sequenza cis-agente vicina al gene, chiamata DMD o ICR (imprinting control region); la sua delezione rimuove l imprinting Geni con opposto imprinting regolati dallo stesso ICR, che funziona da insulator

51 IL REPRESSORE Kox1 che porta il dominio KRAB Proteine che contengono domini zinc-finger e Domini di repressione trascrizionale Kruppel-associated boxes Domini di legame al DNA

52 Domini di repressione trascrizionale attivi sulle RNA polimerasi I,II e II Come funziona la repressione trascrizionale operata da Krab? Condensazione reversibile della cromatina

53 Sistemi ibridi TetR-KRAB per accendere e spegnere l espressione genica eucariotica Repressore TetR che blocca l espressione dell operone Tet La tetraciclina stacca il repressore da TetO e attiva l operone TetO TetA TetR Proteina di efflusso della tetraciclina Proteina repressore

54 Proteina di fusione KRAB-TetR Geni eucariotici inducibili e reprimibili basati sul repressore procariotico TetR-TetO Repressore KRAB KRAB ttr Repressore della tetraciclina tetr

55 QUALI SONO LE MUTAZIONI GENICHE RILEVANTI NELLO SVILUPPO E MANTENIMENTO DEL TUMORE? STUDIO DELLA GENESI DEL MELANOMA DIPENDENTE DALL ESPRESSIONE DI H-Ras V12G IN TOPI INK4a -/-, QUINDI PRIVI DELL ATTIVITA DI SOPPRESSIONE DEL TUMORE

56 ANIMALE TRANSGENICO tutte le cellule nucleate contengono il transgene MICROINIEZIONE NEI PRONUCLEI

57 ANIMALI CHIMERICI e le CELLULE STAMINALI EMBRIONALI

58 a b Progenie con cellule germinali portatrici del transgene Eredita mendeliana del transgene Cellule germinali aploidi

59 KRA B ttr TetO P RasV12G RISOMMINISTRAZIONE DI DOXICICLINA

60

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica 1 Eucarioti pluricellulari -un singolo organismo, utilizzando un unico genoma, deve produrre centinaia di tipi cellulari differenti e specializzati. -le cellule differenziate

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.!

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! rimodellatori? Svolgimento del DNA nucleosmale a par6re

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Che significa animale transgenico o animale Knockout???

Che significa animale transgenico o animale Knockout??? Che significa animale transgenico o animale Knockout??? ORGANISMI TRANSGENICI Gli animali che sono stati ingegnerizzati per inserzione di un gene, delezione di un gene o sostituzione di un gene si chiamano

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici www.fisiokinesiterapia.biz Fattori estrinseci Ambiente Danno genotossico

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

Il Two-Hybrid System e le sue applicazioni

Il Two-Hybrid System e le sue applicazioni Il Two-Hybrid System e le sue applicazioni Una breve storia 1985 nel laboratorio di Mark Ptashne fu dimostrata la modularità degli attivatori della trascrizione leganti il DNA. 1988 nel laboratorio di

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

IL RUOLO DELLA METILAZIONE DELL ISTONE H3 DURANTE LA FORMAZIONE DELL ETEROCROMATINA FACOLTATIVA

IL RUOLO DELLA METILAZIONE DELL ISTONE H3 DURANTE LA FORMAZIONE DELL ETEROCROMATINA FACOLTATIVA UNIVERSITÀ DEGLI STUDI DELLA TUSCIA DI VITERBO DIPARTIMENTO DI AGROBIOLOGIA ED AGROCHIMICA CORSO DI DOTTORATO DI RICERCA GENETICA E BIOLOGIA CELLULARE - XXI CICLO. TITOLO TESI DI DOTTORATO DI RICERCA:

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

La rivoluzione epigenetica

La rivoluzione epigenetica La rivoluzione epigenetica Mauro Durante 2011 Perceptions of epigenetics Adrian Bird (2007) Geneticists study the gene; however, for epigeneticists, there is no obvious epigene. Nevertheless, during the

Dettagli

Gene number 19,000 30,000

Gene number 19,000 30,000 Gene number 6000 19,000 13,500 30,000 30,000 MODULI: Nucleotidi (4) Amino acidi (21) Domini proteici/proteine (Domini di interazione proteina-proteina Proteina/DNA o Proteina /RNA Interazione con membrana

Dettagli

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti NUCLEO Il nucleo è la centrale operativa che controlla i vari processi che si svolgono dentro la cellula. Contiene il materiale genetico DNA e proteine. Quando la cellula è a riposo il DNA è sotto forma

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Corso di aggiornamento sulle Biotecnologie CusMiBio

Corso di aggiornamento sulle Biotecnologie CusMiBio Corso di aggiornamento sulle Biotecnologie CusMiBio Regolazione dell espressione genica dal DNA alle proteine Prof. Paolo Plevani, Aula 200, 22/09/2014 LEARNING WEEK Qualche novità e/o stimolo sul controllo

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

INAIL Settore Ricerca Certificazione e Verifica, Dipartimento installazioni di produzione ed Insediamenti antropici

INAIL Settore Ricerca Certificazione e Verifica, Dipartimento installazioni di produzione ed Insediamenti antropici Biotecnologie: Ricerca e Produzioni Industriali APPROFONDIMENTO IN TEMA DI EPIGENETICA Immagine grafica di Nicolas Bouvier Corso di formazione per gli studenti del IV e V anno Roma, 14 Marzo 2013 Atti

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna.

Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna. ( RNAi ) RNA Interference Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna. E un meccanismo naturale in piante, funghi, insetti e mammiferi. Cronologia:

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

LA STRUTTURA DELLA CROMATINA E DINAMICA, SI MODIFICA A SECONDA DELLO STATO TRASCRIZIONALE

LA STRUTTURA DELLA CROMATINA E DINAMICA, SI MODIFICA A SECONDA DELLO STATO TRASCRIZIONALE LA STRUTTURA DELLA CROMATINA E DINAMICA, SI MODIFICA A SECONDA DELLO STATO TRASCRIZIONALE La cromatina dei geni che devono espressi viene rilassata per consentire la formazione del complesso di trascrizione.

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

PNEINEWS ALIMENTAZIONE E CANCRO LE DUE FACCE I NUOVI SAPERI DELLA SALUTE. Cibi che promuovono, cibi che proteggono

PNEINEWS ALIMENTAZIONE E CANCRO LE DUE FACCE I NUOVI SAPERI DELLA SALUTE. Cibi che promuovono, cibi che proteggono rivista della società italiana di psico - neuro - endocrino - immunologia diretta da Francesco Bottaccioli PNEINEWS I NUOVI SAPERI DELLA SALUTE ALIMENTAZIONE E CANCRO LE DUE FACCE Cibi che promuovono,

Dettagli

The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

Genomica e modelli animali di malattie umane

Genomica e modelli animali di malattie umane I giovedì della cultura scientifica Etica e sperimentazione animale nella ricerca biomedica Genomica e modelli animali di malattie umane Mariateresa Mancuso BIOTEC-MED Mus Musculus : organismo modello

Dettagli

SINDROMI MIELODISPLASTICHE

SINDROMI MIELODISPLASTICHE SINDROMI MIELODISPLASTICHE MECCANISMI MOLECOLARI R. Piazza MECCANISMI MOLECOLARI Bejar R et al. JCO 2011;29:504-515 NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic

Dettagli

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi Patogenesi Terapia Diagnosi Dalla Genomica alla Medicina Molecolare Chimica Biochimica Biologia Biologia Molecolare Decodificazione Genoma Umano Post-Genomica Medicina Molecolare La CELLULA Nasce Si sviluppa

Dettagli

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Seconda Università di Napoli II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Gruppo di studio La Sbobba A cura di dodo e Ely24e 1) Introduzione alla Genetica Medica Pag. 2

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

EREDITA EPIGENETICA ED IMPRINTING GENOMICO

EREDITA EPIGENETICA ED IMPRINTING GENOMICO Talassemia β + causata da una mutazione di una G con una A in posizione 110 nel primo introne Questo porta alla creazione di un sito accettare di splicing anomalo, poiché la nuova sequenza contiene un

Dettagli

Studies of the number of different mrnas suggest that, at any one time, a typical

Studies of the number of different mrnas suggest that, at any one time, a typical REGOLAZIONE DELLA ESPRESSIONE GENICA Una completa descrizione della sequenza di DNA di un organismo non sarebbe in grado di ricostruire lo stesso organismo più di quanto una lista di vocaboli inglesi non

Dettagli

MALATTIE UMANE LEGATE ALL UPP: IL MORBO DI PARKINSON

MALATTIE UMANE LEGATE ALL UPP: IL MORBO DI PARKINSON MALATTIE UMANE LEGATE ALL UPP: IL MORBO DI PARKINSON La degradazione proteica è uno dei meccanismi essenziali che regolano i livelli di proteine cellulari, coinvolto in processi cellulari cruciali dal

Dettagli

Imprinting. Imprinting

Imprinting. Imprinting Imprinting L'osservazione che Gregorio Mendel fece alla metà del XIX secolo, nel corso dei suoi primi esperimenti sui piselli, sarebbe diventata in seguito un assioma per i genetisti. Mendel si era accorto

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni Perché ci troviamo oggi a parlare delle cellule staminali? Driesch (fine 800) dimostra la totipotenza dei blastomeri dell embrione embrione

Dettagli