Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O.

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O."

Transcript

1 Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O. Ospedali Galliera XVIII Congresso Nazionale Associazione Gulliver Monza 08 marzo 2014

2 X Y NSD1 DNA basi azotate G A G C A T G A C Sequenza normale G A G C G T G A C Sequenziamento diretto Sequenza Mutata

3 XY PROTEINA amminoacidi DNA basi azotate TRASCRIZIONE mrna TRADUZIONE GENOTIPO FENOTIPO

4 Gene NSD1 Nuclear receptor SET Domain containing protein-1, NSD1 : 23 esoni mrna : 8088 bp Proteina : 2696 aa NSD1 espresso in : cervello fetale muscolo scheletrico rene, milza, timo, leucociti di sangue periferico polmone Trasmissione ereditaria: Autosomica Dominante, penetranza 100% Casi Sporadici, (casi familiari rarissimi) Rischio di ricorrenza < 1% Mosaicismo germinale mai descritto

5 Gene NSD1 Nuclear receptor SET Domain containing protein-1, 9 Domini funzionali della Proteina conferiscono la funzione di: Metiltranferasi istonica (H3-K36 e H4-K20) [domini SET e SAC] Legame con Recettori Nucleari ormonali [domini NID +L NID -L ] Mantenimento / rimodellamento cromatina [domini PHD e C5HCH ] Interazioni proteina-proteine [dominio PWWP ] Modificazioni EPIgenetiche Metilazione/acetilazione istonica, rimodellamento cromatina (condensazione/decondensazione) Controllano espressione genica dei diversi tipi cellulari, senza alterare la sequenza del DNA Attivando o silenziando geni, stabilendo dove e quando devono essere espressi

6 Proteina NSD1 co-attivatore NSD1 protein Proteina NSD1 Modifica metilazione DNA / istoni e rimodella la cromatina, Regolatore bifunzionale trascrizione: agisce come co-attivatore o co-repressore interagendo con NR ormonali NSD1 ha un ruolo cruciale sull espressione genica durante lo sviluppo embrionale Patogenesi Alterazione della regolazione dell espressione di geni correlati allo sviluppo es. Perdita della funzione di corepressore su geni promotori della crescita >> iperaccrescimento.

7 Gene NSD1 e sindrome di Sotos

8 Gene NSD1 e sindrome di Sotos Europei e Americani mutazioni intrageniche 80 85% 5q35 microdelezioni 10 15% Giapponesi mutazioni intrageniche 50 % 5q35 microdelezioni 50 % No Hot spot di mutazioni Mutazioni troncanti > lungo tutto il gene Mutazioni missense > dom. funzionali (3 ) Inversione polimorf. NAHR Alu repeats 1.9 Mb deletion Sensibilità diagnostica : 70-93% Sotos classici

9 Casistica personale NID -L - NID +L PWWP -I PHD -I -PHD -IV PWWP -II SAC SET PHD -V Exon Smal Insertion / Deletion Tot. 156 mutazioni ~ 90 % Mutazioni 40 Nonsense 9 Splice-site 44 Missense (1 Del/ins >> missense) 17 delezioni ~ 10 % Delezioni 6 Exonic deletion (MLPA) 11 5q35 microdeletion (FISH/MLPA)

10 Summary Casistica personale Categoria Mutazione Mutazioni Intrageniche N. Mutazioni N. Pazienti Frameshift (4 ricorrenti) Nonsense (9 ricorrenti) Missense (3 ric. + 1 familiare) Splice site 9 13 (1 ric. + 2 familiari) Delezioni parziali intrageniche 6 6 5q35 microdelezioni Totale Incerto valore patogenetico (7 ereditate, 6 n/a) (8 missense 2 del, 1 delins, 1 IVS) Probabilmente non patogenetiche (ereditate)

11 Summary Casistica personale Categoria Mutazione N. Mutazioni Nuove mutazioni Genitori analizzati Mutazioni Intrageniche Frameshift /50 Nonsense /16 Missense /16 1 fam Splice site 9 7 1/7 2 fam Delezioni parziali intrageniche 6 5 5q35 microdelezioni Totale /173 (64%)

12 Summary Casistica personale Categoria Mutazione Mutazioni Intrageniche N. Mutazioni N. Pazienti Frameshift (4 ricorrenti) Nonsense (9 ricorrenti) Missense (3 ric. + 1 familiare) Splice site 9 13 (1 ric. + 2 familiari) Delezioni parziali intrageniche 6 6 5q35 microdelezioni detection rate Totale / 1060 ~19 %

13 Detection rate - sensibilità diagnostica/clinica di un test genetico Influenzata da: Sensibilità analitica del metodo/i usati: DHPLC, sequenziamento diretto (NGS (?)), FISH, MLPA Criteri clinici usati per selezionare i pazienti da sottoporre al test genetico Eterogeneità genetica (?) NSD1 sembra essere l unico gene causativo della Sindrome NFIX > Sotos-like EZH2 > s. Weaver

14 Mutation detection rate Methods: DHPLC + Direct sequencing + FISH Methods: Direct sequencing + MLPA 435 patients >> 25 % detection rate 161 patients >> 33 % detection rate.in this context, patients with a much broader phenotypic range are referred for testing, and the mutation detection rate in a clinical laboratory setting may be expected to be lower than that reported in patients with a confirmed clinical diagnosis. This finding indicates that the patient cohort undergoing testing is much broader and not necessarily defined by the classic clinical characteristics of Sotos syndrome. The clinicians referring patient samples to our laboratory most likely will not have seen a large cohort of patients with Sotos syndrome. This lack of experience, as well as variability in dysmorphology training, may well explain the lack of specificity of the Sotos facial gestalt.... In our study 92% in the cohort of clinically diagnosed patients and 30% in the cohort of routine diagnostic patients reflects the challenges in diagnosing the Sotos syndrome and use of the test in differential diagnostics. Many clinicians meet patients with the Sotos syndrome only occasionally, and in these situations, Diagnostic testing is particularly necessary. For an experienced clinician, the correlation between clinical diagnosis and the presence of mutations in the NSD1 gene is close to 100%, but the experienced clinicians may not have the need to have their clinical diagnosis confirmed with mutation testing, causing a bias in the mutation detection percentage in the diagnostic cohort.

15

16 Gene NSD1 : protocollo diagnostico Screening mediante DHPLC (21 esoni - 37 frammenti) Cromatogramma normale MLPA Delezione Cromatogramma alterato Normale Sequenziamento diretto frammento DNA genomico (ex5-23 no DHPLC) Polimorfismo conferma con QF-PCR acgh mrna Mutazione Variante nuova Incerto valore patog. Analisi genitori REFERTO

17 A 15 B C

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

Biobanca Genetica per Malattie Rare Scheletriche

Biobanca Genetica per Malattie Rare Scheletriche Biobanca Genetica per Malattie Rare Scheletriche Luca Sangiorgi S.S.D. di Genetica Medica e Malattie Rare Ortopediche, Istituto Ortopedico Rizzoli Bologna SSD di Genetica Medica IOR Roma, 25 settembre

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery

Dettagli

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali Milano Marittima 05/06/2010 Dr. Francesco Pigliapoco Lab. Citogenetica A.O.U.-Salesi- Ancona Le sindromi DiGeorge

Dettagli

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Verso la terapia personalizzata

Verso la terapia personalizzata Verso la terapia personalizzata M.G.Tibiletti Genetista Ospedale di Circolo-Università dell Insubria Varese Soroptimist Club Varese Varese 20 aprile 2013 Test genetici DIAGNOSTICI PRESINTOMATICI PREDITTIVI,

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

NOVITA NELL INQUADRAMENTO GENETICO

NOVITA NELL INQUADRAMENTO GENETICO NOVITA NELL INQUADRAMENTO GENETICO Dott.ssa Angela Michelucci U.O. Laboratorio di Genetica Medica AOUP Definizione della Discinesia Ciliare Primaria (DCP) Gruppo di condizioni patologiche congenite, eterogenee

Dettagli

Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza

Dettagli

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di GENETICA MEDICA Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di Perugia Centro Riferimento Regionale

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune

Dettagli

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling

Dettagli

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene eseguita su cellule

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013 La sindrome di Lynch Cancro colonrettale ereditario non poliposico o HNPCC G. A. Pablo Cirrone 1 Caratteristiche generali I HNPCC (Hereditary Non-Polyposis Colonrectal Cancer) è caratterizzato dalla comparsa,

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3

Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Grazia Cantelmi, AIF SUN Napoli Prof.ssa L.Perrone, Dipartimento della donna, del bambino, di chirurgia generale e specialistica

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Gene Mutations and Disease

Gene Mutations and Disease Gene Mutations and Disease Mutazioni somatiche: Nuove mutazioni che insorgono casualmente nelle cellule somatiche o nella linea germinale di singoli individui. Le mutazioni germinali possono essere trasmesse

Dettagli

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Brian J O Roak1, Pelagia Deriziotis2, Choli Lee1, Laura Vives1, Jerrod J Schwartz1, Santhosh Girirajan1, Emre

Dettagli

Il differenziamento cellulare

Il differenziamento cellulare Liceo Classico M. Pagano Campobasso Docente: prof.ssa Patrizia PARADISO Allieve (cl. II sez. B e C): BARONE Silvia Antonella DI FABIO Angelica DI MARZO Isabella IANIRO Laura LAUDATI Federica PETRILLO Rosanna

Dettagli

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi Patogenesi Terapia Diagnosi Dalla Genomica alla Medicina Molecolare Chimica Biochimica Biologia Biologia Molecolare Decodificazione Genoma Umano Post-Genomica Medicina Molecolare La CELLULA Nasce Si sviluppa

Dettagli

Il Counselling. Padova, 21 marzo 2016. Dr.ssa Stefania ZOVATO Istituto Oncologico Veneto (IOV) IRCCS Padova SSD Unità per i Tumori Ereditari

Il Counselling. Padova, 21 marzo 2016. Dr.ssa Stefania ZOVATO Istituto Oncologico Veneto (IOV) IRCCS Padova SSD Unità per i Tumori Ereditari Il Counselling Padova, 21 marzo 2016 Dr.ssa Stefania ZOVATO Istituto Oncologico Veneto (IOV) IRCCS Padova SSD Unità per i Tumori Ereditari Punti chiave del counselling Significato Scopo e limiti A chi

Dettagli

Patologie da mutazioni dinamiche

Patologie da mutazioni dinamiche Patologie da mutazioni dinamiche Mutazioni dinamiche mutazioni progressive, nei tessuti e nelle generazioni, di ripetizioni instabili Alleli normali Pre-mutazioni Mutazioni Le alterazioni fenotipiche (patologia)

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

"Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple VIII Incontro-Convegno A.C.A.R 2006-2016: DIECI ANNI DI A.C.A.R. Montecatini Terme (PT), 16 Aprile 2016 A.C.A.R "Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Dettagli

La consulenza alla paziente che richiede l analisi del DNA fetale

La consulenza alla paziente che richiede l analisi del DNA fetale La consulenza alla paziente che richiede l analisi del DNA fetale Bertinoro, 19 Ottobre 2013 Eva Pompilii eva_pompilii@yahoo.it Limiti attuali del Non invasive Prenatal Testing/ Non Invasive Prenatal

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

DAI TEST GENETICI AL RISCHIO DI MALATTIA

DAI TEST GENETICI AL RISCHIO DI MALATTIA DAI TEST GENETICI AL RISCHIO DI MALATTIA Conosciamo il nostro Genoma Varese, 20 aprile 2013 Elisabetta Lenzini LE TAPPE DELLA 1953 Watson and Crick Struttura del DNA 1956 Tijo e Levan Cariotipo 46 cr 1959

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

IL LABORATORIO DI GENETICA MOLECOLARE: TEST GENETICI PER LE SINDROMI DI EHLERS-DANLOS

IL LABORATORIO DI GENETICA MOLECOLARE: TEST GENETICI PER LE SINDROMI DI EHLERS-DANLOS IL LABORATORIO DI GENETICA MOLECOLARE: TEST GENETICI PER LE SINDROMI DI EHLERS-DANLOS Marco Ritelli Sezione di Biologia e Genetica, Laboratorio di Citogenetica e Genetica Molecolare, Dipartimento di Scienze

Dettagli

La genetica della Sindrome di Prader-Willi

La genetica della Sindrome di Prader-Willi La genetica della Sindrome di Prader-Willi Dott.ssa Milan Gabriella Laboratorio Endocrino Metabolico DIPARTIMENTO DI SCIENZE MEDICHE E CHIRURGICHE Università degli Studi di Padova Clinica Medica 3 Prader,

Dettagli

Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti

Dettagli

Ruolo della biologia molecolare nel carcinoma ovarico

Ruolo della biologia molecolare nel carcinoma ovarico Carcinoma ovarico avanzato: quali novità per il 2015? Ruolo della biologia molecolare nel carcinoma ovarico Anna Pesci Ospedale SC Don Calabria, Negrar anna.pesci@sacrocuore.it TIPO I TIPO II Basso stadio

Dettagli

FINALITA : evidenziare la. cromosomiche fetali.

FINALITA : evidenziare la. cromosomiche fetali. Il Cariotipo Fetale Molecolare l (array-cgh) Il Cariotipo Fetale e TRADIZIONALE FINALITA : evidenziare la presenza di eventuali anomalie cromosomiche fetali. TECNICA: comporta la coltura delle cellule

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

UTILIZZO OTTIMALE DEI TEST DI II LIVELLO PER TALASSEMIA

UTILIZZO OTTIMALE DEI TEST DI II LIVELLO PER TALASSEMIA UTILIZZO OTTIMALE DEI TEST DI II LIVELLO PER TALASSEMIA Dr.ssa Anna Ravani Laboratorio di Genetica Molecolare Servizio di Genetica Medica Azienda Ospedaliera-Universitaria S.Anna FERRARA EMOGLOBINOPATIE:

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica DSTB - Università degli Studi di Udine P.le Kolbe,1-33100 Udine - ITALIA

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

4 modulo didattico - Modalità di trasmissione delle malattie

4 modulo didattico - Modalità di trasmissione delle malattie 4 modulo didattico - Modalità di trasmissione delle malattie monogeniche. L analisi dell albero genealogico: uno strumento indispensabile della genetica medica I SIMBOLI DELL ALBERO GENEALOGICO L ANEMIA

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio

Dettagli

Unità Operativa di GENETICA MEDICA

Unità Operativa di GENETICA MEDICA Unità Operativa di GENETICA MEDICA Direttore: Prof. Mario Savi LABORATORIO DI GENETICA MOLECOLARE Responsabile Prof. Tauro Neri. Servizi forniti: Definizione genotipica e diagnosi molecolare POSTNATALE

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni L array-cgh: -riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni -ha un potere si risoluzione 100 volte superiore al cariotipo (100 Kb versus 10 Mb) Microarray-based

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie TEST GENETICI INDIRETTI per la diagnosi di patologie genetiche ereditarie Diagnosi molecolare indiretta Quando non è nota la mutazione malattia, la diagnosi molecolare di quella malattia in una data famiglia

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica SEZIONE DI CITOGENETICA E GENETICA MOLECOLARE DIAGNOSI PRENATALE DIAGNOSI MOLECOLARE PRE E POSTNATALE DI MALATTIE GENETICHE DIAGNOSTICA GENETICA DELLA INFERTILITA

Dettagli

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 21/02/2011 Progetto di ricerca: Utilizzo di oligonucleotidi antisenso per correggere l effetto di mutazioni di splicing in pazienti

Dettagli

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Ereditarietà delle PSE e counselling genetico Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Paraparesi

Dettagli

NPTT- NON-INVASIVE PRENATAL TESTING

NPTT- NON-INVASIVE PRENATAL TESTING Dr.ssa Chiara Boschetto NPTT- NON-INVASIVE PRENATAL TESTING Il TEST PRENATALE NON INVASIVO è un test molecolare nato con l obiettivo di determinare l assetto cromosomico del feto da materiale fetale presente

Dettagli

Eredità non mendeliana

Eredità non mendeliana Eredità non mendeliana eredità extranucleare o citoplasmatica effetto materno eredità epigenetica (imprinting) anticipazione Eredità extranucleare eredità materna o paterna geni non nucleari: genomi mitocondriali

Dettagli

Le malattie recessive

Le malattie recessive Le malattie recessive Frequente la perdita di funzione con aplosufficienza Nascono figli affetti in genere da genitori sani spesso consanguinei che sono eterozigoti ed hanno un rischio di avere un figlio

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

La prevenzione: un piano regionale per la Puglia. Perché?

La prevenzione: un piano regionale per la Puglia. Perché? La prevenzione: un piano regionale per la Puglia. Perché? Rita Fischetto Referente Genetica Clinica U.O.C. Malattie Metaboliche Diabetologia A.O.U. Policlinico-Giovanni XXIII Bari -CRESCITA CONOSCENZE

Dettagli

Diagnosi delle aneuploidie

Diagnosi delle aneuploidie Diagnosi delle aneuploidie DIAGNOSI PRENATALE NON INVASIVA: UNA RIVOLUZIONE La diagnosi prenatale delle malattie monogeniche e delle aneuploidie Bologna, è attualmente 6 Giugno eseguita2014 nel I-II trimestre

Dettagli

NUOVI ASPETTI NELLA GENETICA E NELLA CLINICA IN DIAGNOSI PRENATALE. 4 giugno 2009 - ORE 9.00 Sala Conferenze Via F. Ferrer 25/27- Busto Arsizio (VA)

NUOVI ASPETTI NELLA GENETICA E NELLA CLINICA IN DIAGNOSI PRENATALE. 4 giugno 2009 - ORE 9.00 Sala Conferenze Via F. Ferrer 25/27- Busto Arsizio (VA) NUOVI ASPETTI NELLA GENETICA E NELLA CLINICA IN DIAGNOSI PRENATALE 8.30 registrazione 9.00 introduzione presentazione 9.15 10.00 10.45 11.00 11.45 12.30 13.30 14.15 15.00 15.15 16.00 Dr. DI GIANANTONIO-Nuove

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Test genetici per evidenziare il rischio di trombolfilia Il Fattore V della coagulazione è un cofattore essenziale per l attivazione della protrombina a trombina. La variante G1691A, definita variante

Dettagli

GENETICA DEL TUMORE DEL COLON-RETTO

GENETICA DEL TUMORE DEL COLON-RETTO GENETICA DEL TUMORE DEL COLON-RETTO EPIDEMIOLOGIA In tutto l'occidente, il cancro del colon-retto occupa, per incidenza, il secondo posto tra i tumori maligni, preceduto dal tumore al polmone nell'uomo

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

ANALISI GENETICHE. Biologia molecolare

ANALISI GENETICHE. Biologia molecolare ANALISI GENETICHE Biologia molecolare Via F. Ferrer 25/27-21052 Busto Arsizio (VA) - Italy Tel +39 0331 652911 - Fax +39 0331 652919 - www.tomalab.com TOMA_biologia_molecolare_scheda_CORR03.indd 1 06/04/2012

Dettagli

Argomenti di Medicina Generale, Biologia, Sanità.

Argomenti di Medicina Generale, Biologia, Sanità. UNI-A.T.E.Ne.O. Ivana Torretta Anno Accademico 11 12 Argomenti di Medicina Generale, Biologia, Sanità. 1. L omeopatia funziona davvero! 2. Ho dolori da tutte le parti. La fibromialgia. 3. La sindrome delle

Dettagli

La Citogenetica nella Diagnosi Prenatale

La Citogenetica nella Diagnosi Prenatale La Citogenetica nella Diagnosi Prenatale Per diagnosi prenatale si intende l insieme delle indagini strumentali e di laboratorio finalizzate ad individuare determinate patologie su base : genetica infettiva

Dettagli

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIFETTI CONGENITI Le anomalie congenite sono condizioni che si instaurano tra il momento del concepimento e la nascita. LA DIAGNOSI PRENATALE insieme di tecniche

Dettagli

RIATTIVAZIONE EPIGENETICA DEL GENE FMR1

RIATTIVAZIONE EPIGENETICA DEL GENE FMR1 RIATTIVAZIONE EPIGENETICA DEL GENE FMR1 Pietro Chiurazzi Istituto di Genetica Medica Università Cattolica del Sacro Cuore Sindrome X Fragile (OMIM #300624) La FXS è la causa più comune di ritardo psicomotorio

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Counselling genetico nell infertilità e nella fecondazione assistita

Counselling genetico nell infertilità e nella fecondazione assistita Counselling genetico nell infertilità e nella fecondazione assistita Giuseppe Novelli & Leila Salehi Università degli Studi di Roma "Tor Vergata" L infertilità è definita come l incapacità per una coppia

Dettagli

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione in campo medico e biotecnologico Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione delle sequenze di acido nucleico Elena Comoglio Jacobacci & Partners S.p.A. Brevetti

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Genetica, malattie rare e contesto familiare

Genetica, malattie rare e contesto familiare XXV Anniversario IRCCS E. Medea La salute del bambino tra genetica e neuroscienze Bosisio Parini, 11 dicembre 2010 Genetica, malattie rare e contesto familiare La genetica negli ultimi 25 anni Sequenziamento

Dettagli

Screening dei soggetti a rischio e diagnostica molecolare

Screening dei soggetti a rischio e diagnostica molecolare Screening dei soggetti a rischio e diagnostica molecolare Daniela Furlan U.O. Anatomia Patologica Varese, 3 luglio 2012 Il carcinoma pancreatico Patogenesi Suscettibilità genetica Implicazioni diagnostiche

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

La Consulenza Genetica nella prospettiva della medicina predittiva

La Consulenza Genetica nella prospettiva della medicina predittiva La Consulenza Genetica nella prospettiva della medicina predittiva Dr.ssa Licia Turolla U.O. di Genetica Medica ASL n. 9 del Veneto - Treviso www.ulss.tv.it/genetica medica I test genomici predittivi Treviso,

Dettagli

INFORMAZIONI SUL TEST

INFORMAZIONI SUL TEST QUALITY OF SCIENCE INFORMAZIONI SULLA SOCIETÀ INFORMAZIONI SUL TEST Sequenom Laboratories, una consociata interamente controllata di Sequenom, Inc., è un laboratorio di diagnostica molecolare riconosciuto

Dettagli

codice_toma codice_asl xc_tipomateriale c_descrizione metodoanalisi service unita_misura c_min c_max importo_asl l m m1 g v s BM00787 91301 SgEr ACE PCR+ REVERSE DOT BLOT T 215,11 21 20 20 20 20 20 BM00005

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita

Dettagli

LUCIO LUZZATO. AIRTUM (Associazione Italiana Registri Tumori) Una vita dedicata alla Ricerca, alla Cultura ed al Dialogo tra popoli

LUCIO LUZZATO. AIRTUM (Associazione Italiana Registri Tumori) Una vita dedicata alla Ricerca, alla Cultura ed al Dialogo tra popoli LUCIO LUZZATO Una vita dedicata alla Ricerca, alla Cultura ed al Dialogo tra popoli AIRTUM (Associazione Italiana Registri Tumori) SABAUDIA, 21-23 Aprile 2010 Maurizio Ponz de Leon Dipartimento di Medicina

Dettagli

Sperimenta il BioLab. Da un albero genealogico al DNA e ritorno. Università degli Studi di Milano

Sperimenta il BioLab. Da un albero genealogico al DNA e ritorno. Università degli Studi di Milano Sperimenta il BioLab Da un albero genealogico al DNA e ritorno Università degli Studi di Milano Indice 1. Conoscenze propedeutiche p. 3 1.1 Le mutazioni p. 3 1.2 Mutazioni geniche 1.3 Alcuni concetti base

Dettagli

Diagnosi prenatale invasiva: presente e futuro

Diagnosi prenatale invasiva: presente e futuro Diagnosi prenatale invasiva: presente e futuro Gianluigi Pilu GynePro Medical Group Bologna, Italy www.gynepro.it Sintesi Frequenza delle anomalie cromosomiche I rischi delle diagnosi invasive Diagnosi

Dettagli

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE?

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? SCREENING NEONATALE GENETICO RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? Pietro Chiurazzi Istituto di Genetica Medica Facoltà di Medicina e Chirurgia Università Cattolica Associazione Culturale Giuseppe

Dettagli

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS DIRECT SEQUENCING TTCACTGAGAGTCGC TCCCAATAAAAGTGACTCTCAGCGAGC TTCACTGAGAGTCGG TCCCAATAAAAGTGACTCTCAGCCAGC wt mut wt wt/mut mut The Sanger method 07_01.jpg

Dettagli