FACOLTA MEDICINA E ODONTOIATRIA. Laurea triennale in. Tecniche di Laboratorio Biomedico. Traslocazioni cromosomiche e infertilità di coppia

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "FACOLTA MEDICINA E ODONTOIATRIA. Laurea triennale in. Tecniche di Laboratorio Biomedico. Traslocazioni cromosomiche e infertilità di coppia"


1 FACOLTA MEDICINA E ODONTOIATRIA Laurea triennale in Tecniche di Laboratorio Biomedico Traslocazioni cromosomiche e infertilità di coppia Relatore Liana Marcucci Laureanda Antonella Di Stefano Matricola Anno Accademico 2010/2011 Antonella Di Stefano 0

2 INDICE 1 INTRODUZIONE Traslocazioni cromosomiche Meccanismi di origine Classificazione delle traslocazioni PARTE SPERIMENTALE Materiali e metodi Studi citogenetici Analisi FISH Analisi PCR Analisi di alberi genealogici familiari RISULTATI CONCLUSIONI BIBLIOGRAFIA. 44 Antonella Di Stefano 1

3 1 INTRODUZIONE 1.1 Traslocazioni cromosomiche Le traslocazioni cromosomiche sono tra le più comuni anomalie genetiche. Queste alterazioni si riscontrano a seguito dell analisi del cariotipo e da ricerche statistiche si è visto che sono presenti nello 0,2% dei neonati, nello 0,6% delle coppie infertili e fino al 9,2% nei pazienti con aborti ricorrenti. I portatori di traslocazioni bilanciate hanno un rischio maggiore di concepire embrioni con anomalie cromosomiche (Pappalardo, 2010) Meccanismi di origine Le traslocazioni sono riarrangiamenti cromosomici che si originano da eventi di rottura a doppio filamento del DNA cromosomico. Eventi di rottura insorgono fisiologicamente durante la duplicazione del DNA ad opera delle Topoisomerasi. Le DNA topoisomerasi sono enzimi di importanza cruciale per il mantenimento dell integrità genomica e per la regolazione delle strutture topologiche del DNA. Tutte le DNA topoisomerasi presentano due caratteristiche fondamentali: la prima è la capacità di rompere e, poi, risaldare lo scheletro fosfodiesterico del DNA in due successive reazioni di transesterificazione; la seconda caratteristica delle DNA topoisomerasi è che, una volta formatosi l intermedio DNA proteina, l enzima permette alle estremità dei filamenti spezzati di essere separate, aprendo così un Antonella Di Stefano 2

4 passaggio per un altro segmento di DNA a doppio o a singolo filamento. Questo passaggio di un segmento di DNA attraverso la rottura di un altro segmento provoca un cambiamento topologico del DNA, come ad esempio una variazione del numero di legame, oppure la decatenazione di due anelli di DNA catenati. Dalla scoperta della prima DNA topoisomerasi I in E. coli nel 1971 questi enzimi sono stati trovati in tutte le cellule eucariote e procariote. Sulla base della capacità di tagliare un singolo o un doppio filamento di DNA, questi enzimi sono classificati, rispettivamente, in DNA topoisomerasi di tipo I e II (Baker et al., 2009). Un secondo evento fisiologico che determina rottura del DNA, si verifica nella gametogenesi durante la profase I meiotica, mediante il processo di crossing-over, un importante meccanismo di ricombinazione del materiale genetico che permette una maggiore varietà nei prodotti della riproduzione sessuata (Klug et al., 2007). Durante il crossing-over non si ha né perdita né acquisizione di materiale genetico, perché esso determina scambi reciproci. Inoltre, le caratteristiche chimico-fisiche del DNA rendono questa molecola stabile e dinamica e suscettibile di diversi tipi di risposta a insulti ambientali. La sequenza nucleotidica può, infatti, modificarsi per gli errori prodotti spontaneamente dalla DNA-polimerasi, per la rottura spontanea di regioni cromosomiche fragili o per l effetto di agenti chimici e fisici genotossici. Fisiologicamente, le cellule hanno sviluppato differenti meccanismi di riparazione del DNA che garantiscono una relativa stabilità Antonella Di Stefano 3

5 del genoma attraverso l intervento di guardiani del genoma come la proteina ATM. Alcuni meccanismi di riparazione riparano correttamente (error free) e non lasciano tracce della mutazione indotta. Tuttavia se il danno è consistente e prolungato, intervengono meccanismi meno accurati di riparazione che sono invece error prone, inclini quindi all errore, come ad esempio i Sister Chromatid Exchange (SCE), visualizzazione citogenetica di crossing-over somatici Classificazione delle traslocazioni Le traslocazioni possono essere classificate in: 1. traslocazioni germinali; 2. traslocazioni somatiche. Traslocazioni germinali Sono traslocazioni ereditarie presenti a livello degli ovociti e degli spermatozoi; Sono causa di un aumentato rischio riproduttivo, sia per abortività ricorrente, sia per la possibilità di avere figli nati vivi con uno sbilanciamento cromosomico e quindi con una sindrome cromosomica. Se ne possono distinguere diversi tipi. - Traslocazione reciproca bilanciata: l incidenza di queste traslocazioni è di 1 su 625 nati (Traversa et al., 2010) e sono dovute ad uno scambio di regioni tra cromosomi non omologhi. Queste fanno seguito ad una rottura singola di due cromosomi e possono comportare variazioni nella lunghezza dei cromosomi che restano, però, sempre monocentrici. Solo di rado nella traslocazione possono essere coinvolti anche più cromosomi Antonella Di Stefano 4

6 (traslocazioni complesse o jumping translocations ). Le traslocazioni reciproche, quando bilanciate e familiari, non comportano anomalie del fenotipo (Ventruto et al, 2001). Per definizione, una traslocazione reciproca bilanciata conserva integra la quantità di materiale cromosomico normale. I punti di rottura che si trovano nella cromatina non informativa consentono lo sviluppo embrionale. Se, invece, il punto di rottura colpisce geni normalmente espressi, la cui informazione è essenziale per le varie fasi dello sviluppo, l embrione potrebbe essere eliminato con aborto spontaneo. Per quanto riguarda i portatori maschili di una traslocazione bilanciata, la possibilità di generare spermatozoi con anomalie cromosomiche varia dal 20 all 80%, secondo il tipo di traslocazione, i cromosomi coinvolti e la posizione dei punti di rottura. - Traslocazioni reciproche bilanciate de novo : insorgono nella gametogenesi di uno dei due genitori, che risultano quindi avere cariotipo normale. Le cause che portano allo sviluppo di una mutazione de novo possono essere diverse, ma comuni sono quelle indotte da mutageni fisici quali le radiazioni. Il rischio di anomalie nel fenotipo è più elevato rispetto Antonella Di Stefano 5

7 a quello determinato dalle traslocazioni reciproche bilanciate (circa il 10%) e solitamente vengono scoperte casualmente in individui con insuccessi riproduttivi, in adolescenti con anomalie dello sviluppo sessuale o durante le analisi cromosomiche prenatali; in quest ultimo caso, non essendo possibile una conferma a livello fenotipico, è difficile stabilire se queste traslocazioni siano realmente bilanciate. - Traslocazioni sbilanciate robertsoniane: si verificano quando due cromosomi acrocentrici si uniscono a livello dei centromeri; il risultato è un singolo cromosoma anomalo che contiene entrambi bracci lunghi dei due cromosomi originali, con conseguente perdita dei bracci corti e spesso di un centromero, per cui le cellule dei portatori bilanciati risultano aneuploidi (45 cromosomi). Poiché sui bracci corti di tutti i dieci cromosomi acrocentrici sono localizzati i geni per l RNA ribosomiale, la perdita di due bracci corti non comporta effetti fenotipici. L incidenza di queste traslocazioni è di 1/900 nati (Traversa et al., 2010). Il 5% di tutti i casi di Sindrome di Down è originato da una traslocazione robertsoniana, la maggior parte delle volte tra i cromosomi 14 e 21. I portatori di questa traslocazione sono aneuploidi con apparenti 45 cromosomi dei quali uno è Antonella Di Stefano 6

8 costituito dai due bracci lunghi dei cromosomi 14 e 21 e risultano fenotipicamente normali (Berend et al, 2003). Traslocazioni somatiche e cancro Sono traslocazioni sporadiche poiché insorgono in una cellula somatica. In relazione ai punti di rottura questa cellula può guadagnare un vantaggio replicativo che, con successivi eventi di mutazione, la trasforma in una cellula tumorale. In particolari situazioni, spesso in presenza di concomitanti fattori ambientali mutageni che creano una situazione di stress per la cellula, la frequenza di induzione del danno e la sua gravità risultano superiori rispetto alla capacità dei sistemi di riparazione della cellula. Si ha, quindi, un danno irreversibile nella cellula e di conseguenza una proliferazione sregolata. Il meccanismo di attivazione per traslocazione cromosomica è particolarmente frequente nelle neoplasie del sistema ematopoietico e nei sarcomi. La caratteristica costante delle traslocazioni cromosomiche studiate finora è rappresentata dall alterazione nella struttura o nella regolazione di un protooncogene. Due sono i meccanismi di base attraverso cui una traslocazione può agire. Da un lato, la traslocazione può allontanare il protooncogene dalle sue normali strutture regolatorie e posizionarlo sotto nuovi elementi di controllo. Come conseguenza, il protooncogene può essere espresso in tessuti nei quali normalmente è silenziato o, nel caso sia espresso già nel tessuto normale da cui il tumore deriva, può essere sottratto ai fini meccanismi di controllo che lo regolano in condizioni fisiologiche. Antonella Di Stefano 7

9 Un secondo meccanismo attraverso cui una traslocazione può agire è rappresentato dalla formazione di un trascritto di fusione, derivante dall'unione di due geni localizzati nei due punti di rottura dei cromosomi coinvolti nella traslocazione. T (9; 22) Tutti i casi di leucemia mieloide cronica propriamente detta presentano una caratteristica anomalia citogenetica, il cromosoma Philadelphia, derivante dalla traslocazione t (9; 22). Questa traslocazione sposta l oncogene ABL, che normalmente mappa in 9q34 e codifica per una tirosinchinasi citoplasmatica, sul cromosoma 22q11, dove si localizza il gene BCR. Di conseguenza si forma un trascritto di fusione che codifica per un mrna ibrido BCR/ABL e per una proteina chimerica chiamata p210. La conseguenza funzionale della traslocazione BCR/ABL è la localizzazione citoplasmatica e l attivazione costitutiva del dominio tirosinchinasico di ABL. Bersaglio della fosforilazione da parte di BCR/ABL sono numerose proteine coinvolte nella proliferazione, differenziazione, sopravvivenza, adesione e riparazione del DNA nelle cellule staminali emopoietiche. Antonella Di Stefano 8

10 Se una regione di un cromosoma viene rilocalizzata o riarrangiata in seguito a traslocazione, la normale espressione dei geni contenuti in quella regione cromosomica può essere modificata (effetto posizione). Questo è particolarmente vero se il gene viene a essere posizionato all interno o vicino a certe regioni del cromosoma che sono compattate e inerti da un punto di vista trascrizionale quale è l eterocromatina. Nonostante i molti danni, le traslocazioni, come tutte le mutazioni, svolgono un ruolo importante nell'evoluzione: ad esempio, scimpanzé, gorilla e oranghi hanno tutti 48 cromosomi, mentre l'uomo ne possiede 46. Il secondo cromosoma umano, che è grosso e metacentrico, presenta bande G sovrapponibili a quelle osservate su due differenti cromosomi acrocentrici dei primati. Questo fatto, potrebbe essere il sintomo che in un antenato dell'uomo si sia verificata una fusione centrica, che diede origine ad un grosso cromosoma metacentrico. Inoltre, altri riarrangiamenti cromosomici hanno portato all evoluzione dei geni delle catene α e β dell emoglobina umana e all evoluzione del cromosoma Y a partire da una coppia di omologhi. Tuttavia l insorgenza di una mutazione cromosomica in una cellula, germinale o somatica, potrebbe causare mutazioni geniche o anomalie durante la meiosi. Quindi, data la diversità e la frequenza di questi riarrangiamenti cromosomici, è consigliabile, soprattutto in presenza di anomalie cromosomiche familiari e in caso di problemi di fertilità eseguire l analisi del cariotipo seguito, se necessario, da altre analisi specifiche. Antonella Di Stefano 9

11 2 PARTE SPERIMENTALE Studio di: Traslocazioni bilanciate autosoma/autosoma; Traslocazioni sbilanciate robertsoniane; Traslocazioni reciproche bilanciate de novo ; Traslocazioni cromosoma sessuale/autosoma. L analisi è stata effettuata mediante l utilizzo di alberi genealogici familiari, cariotipo standard, FISH e PCR. 2.1 MATERIALI E METODI Studi citogenetici Allestimento delle colture di linfociti periferici e dei preparati cromosomici I linfociti del sangue venoso periferico eparinizzato (0,5 ml) proveniente dai pazienti analizzati, sono coltivati in terreno RPMI con aggiunta del 20% di siero fetale, antibiotici (penicillina, streptomicina) e 0,1 ml di fitoemoagglutinina M. Per ogni paziente sono allestite tre colture indipendenti; le colture sono incubate per 72 ore a 37 C; a due di esse, 6 ore prima della fine della coltura, viene aggiunto 1cc di 5- Bromodessosiuridina (BudR), un analogo della Timina, al fine di ottenere preparati sui quali eseguire le colorazioni differenziali per il bandeggio cromosomico R. La terza coltura è mantenuta in terreno standard e verrà Antonella Di Stefano 10

12 utilizzata per l allestimento di preparati con bandeggio differenziale G. Nelle ultime 2 ore viene aggiunta a tutte le colture la Colchicina, un alcaloide che svolge azione antimitotica, compromettendo la stabilità dei dimeri di tubulina dei microfilamenti del citoscheletro organizzati in fibre del fuso. Al termine della coltura, le cellule sono centrifugate a 2000 rpm per 6 minuti, viene aspirato il sopranatante e successivamente viene aggiunta una soluzione ipotonica (KCl 0,67 M) per indurre la lisi dei globuli rossi. A questo punto si incuba per 2 minuti in termostato (37 C), si centrifuga nuovamente e si aspira il sovranatante fino al pellet. Le cellule vengono lavate e fissate per due volte con una soluzione fresca di metanolo/acido acetico (3:1), centrifugate e conservate a +4 C overnight per consentire al fissativo di raggiungere tutta la cromatina e per rendere rigida, e quindi fragile, la membrana cellulare dei linfociti. I preparati cromosomici vengono quindi allestiti secondo la procedura standard e colorati. Per la ricostruzione del cariotipo vengono analizzate almeno 30 metafasi con una risoluzione media di almeno 400 bande. L eventuale presenza di mosaicismi viene valutata su un numero minimo di 100 metafasi. Tecniche di colorazione I preparati sono stati colorati sia con la metodica di colorazione classica con Giemsa (70cc di acqua di fonte e 2,5cc di Giemsa, per 10 minuti) sia con le seguenti tecniche di colorazione differenziale: BANDEGGIO RBG: si utilizzano 140cc di tampone Sorensen a ph 6,7 ottenuto unendo 70cc di soluzione A (500cc di H₂o distillata e 4,54 g di Antonella Di Stefano 11

13 KH₂PO₄) e 70cc di soluzione B (500cc di H₂o distillata e 5,93 g di Na₂HPO₄). A 66,5 cc della soluzione tampone si aggiungono 3,5cc di soluzione Hoechst (5mg/100cc di H₂o distillata). I vetrini vengono immersi in questa soluzione per 30 a temperatura ambiente e al buio. Si effettua il lavaggio dei vetrini in H₂o distillata e si procede al montaggio con coprioggetto in 2-3 gocce di tampone Sorensen. La fotolisi della cromatina viene ottenuta mediante esposizione a raggi UV per 30 minuti o alla luce solare per 2 ore. Terminata l esposizione, i preparati sono denaturati per 1 40 a 82 C e colorati con soluzione Giemsa per 6. Questo tipo di bandeggio colora selettivamente le regioni di DNA early-replicating, consentendo inoltre la ricerca del cromosoma X inattivato. BANDEGGIO CBG: i preparati vengono immersi per 10 minuti in alcool etilico 95%, poi trasferiti in una soluzione satura di idrossido di Bario Ba(OH)₂ a ph 13,2 per 8 minuti a temperatura ambiente. Dopo essere stati sciacquati in H₂o distillata, vengono denaturati per un ora a 62 C in una soluzione salina SSC 2X e in seguito colorati per 3 con soluzione Giemsa al 5%. Questo tipo di bandeggio colora selettivamente l eterocromatina costitutiva (centromeri, costrizioni secondarie dei cromosomi 1, 9, 16 e regione eterocromatica del braccio lungo del cromosoma Y). Antonella Di Stefano 12

14 2.1.2 Analisi FISH L ibridazione in situ con fluorocromi è stata eseguita secondo le indicazioni date dalle ditte fornitrici. I cromosomi, fissati su vetrino, vengono denaturati a 73 C in formammide a ph 7 e diluita in SSC 2X fino ad una concentrazione finale di 12,6 M. Il tempo di denaturazione è di 2-5 minuti a seconda del periodo di invecchiamento del preparato. L ibridazione con sonde specifiche denaturate a 95 C per 5 è protratta per tutta la notte in camera umida a 37 C. Al fine di rimuovere sonde di DNA non legate o legate in modo non specifico, vengono eseguiti, al buio, lavaggi stringenti: 2 in SSC 0,4 a 73 C e 1 in SSC 2X a temperatura ambiente. I cromosomi sono controcolorati con DAPI (concentrazione finale 0,25 ng/ml) e osservati al microscopio a fluorescenza (Zeiss) con filtri FITC TRIC. Le sonde molecolari utilizzate sono: Sonde per le regioni subtelomeriche del cromosoma 1 (sonda Chromoprobe Multiprobe T-System Cytocell); Sonde per le regioni pseudoautosomiche (PAR1, PAR2) comuni ai cromosomi X e Y (sonda Chromoprobe Multiprobe T-System Cytocell); Sonda per SRY (Vysis LSI SRY/CEP X); Sonda locus DNA specifica per la regione Xp21.2/p21.3 (sonda cosmidica QUINT Essential); Sonda painting per il cromosoma X (sonda COATASOME). Antonella Di Stefano 13

15 2.1.3 Analisi PCR La PCR è stata eseguita su DNA estratto da leucociti periferici ottenuti da campioni di sangue con metodi standard. Sono state utilizzate sequenze specifiche per le regioni AZFa, AZFb, e AZFc: Regione AZFa: primers sy85 e USP9Y Regione AZFb: primers sy117 e sy142 Regione AZFc: primers sy158 e sy254 Sequenze specifiche per SRY, ZFX/ZFY sono state usate come controllo interno positivo. Estratti di DNA genomico da parte di uomini e donne fertili sono stati utilizzati per il controllo esterno. PAZIENTI Presso il Servizio di Citogenetica del Policlinico Umberto I di Roma sono stati effettuati accertamenti citogenetici mediante cariotipo su soggetti che presentavano problemi di infertilità o che dichiaravano la presenza di anomalie cromosomiche ereditarie in famiglia. Antonella Di Stefano 14

16 2.1.4 Analisi di alberi genealogici familiari Traslocazioni bilanciate autosoma/autosoma I cromosomi coinvolti negli esempi di famiglie riportate sono: 4, 7, 8, 10, 11, 14, 19, 20 Antonella Di Stefano 15

17 Famiglia 1: t (7;14) (q21;23) II-6 probando In questa famiglia è mostrata la trasmissione ereditaria della traslocazione in 3 generazioni. Nella III generazione (3-9) è significativa la formazione preferenziale di gameti sbilanciati evidenziati dai numerosi aborti spontanei presenti in minor numero anche nella II generazione. Antonella Di Stefano 16

18 Famiglia 2: t (7;10) (q11.21;p15) III-3 probando Probabile trasmissione ereditaria in 4 generazioni. Traslocazione bilanciata asintomatica in portatori e rilevata solo in analisi prenatale nel feto della IV generazione. I punti di rottura presenti in questa traslocazione e i cromosomi derivativi rendono difficoltoso l appaiamento in meiosi, sostenendo l ipotesi che molti zigoti siano abortiti precocemente. Antonella Di Stefano 17

19 Famiglia 3: t (4;11) (q21;q23) III-3 probando Traslocazione che coinvolge il cromosoma 4, relativamente con bassa densità genica, e il cromosoma 11 contenente loci sottoposti ad imprinting con loro coinvolgimento nelle prime fasi dello sviluppo embrionale: questo tipo di traslocazione appare compatibile con la trasmissione alla progenie solo se sono le donne portatrici. Gli individui III- 5 e III-6 non si sono sottoposti ad accertamento del cariotipo, ma è ragionevole supporre che non siano portatori di traslocazione, non avendo dichiarato alcun problema riproduttivo. Antonella Di Stefano 18

20 Famiglia 4: t (11;20) (q23;q13) III-1 probando Traslocazione trasmessa in 3 generazioni. Il coinvolgimento dei cromosomi 11 e 20 determina, come è evidente nella terza generazione, la formazione di un numero significativamente alto di gameti sbilanciati prodotti dalla portatrice II-2 e risultanti in numerosi aborti spontanei. La proporzione attesa di produrre gameti normali e bilanciati è dimostrata dalla nascita di individuo bilanciato (III-1) e da soggetto che non presenta la traslocazione (III-5). Antonella Di Stefano 19

21 Famiglia 5: t (8;19) (q23;p13) III-2 probando La traslocazione coinvolge il cromosoma 8, con relativa bassa densità genica, e il cromosoma 19, denso di geni attivamente espressi. In questo caso si ipotizza un evidente effetto epigenetico di questa traslocazione che sembra non aver creato problemi riproduttivi nella madre della probanda (II-2), mentre è causa di sterilità nella figlia, costretta infatti a ricorrere a protocolli di fecondazione medicalmente assistita. Antonella Di Stefano 20

22 Traslocazioni sbilanciate robertsoniane Famiglia 6: der (14;21) (q10;q10) II-2 probando Esempio di famiglia con traslocazione sbilanciata robertsoniana 14, 21 che interferisce gravemente con gli aspetti epigenetici della spermatogenesi. Il soggetto II-2 presenta dispermia. Antonella Di Stefano 21

23 Traslocazioni de novo Traslocazioni insorte de novo nella gametogenesi di uno dei due genitori. Famiglia 7: t (2;3) (p24;p22) II-3 probando Traslocazione tra i bracci corti dei cromosomi più grandi e più ricchi in geni del genoma. Anomalia cromosomica che comporta infertilità nel maschio per interferenza con gli aspetti epigenetici della spermatogenesi. Antonella Di Stefano 22

24 Famiglia 8: t (5;19) (q10;q10) II-1 probando Traslocazione de novo nella probanda con genitori normali. Per questa traslocazione il rischio di aborti è stimato essere del 50%, in quanto i previsti gameti sbilanciati non sono compatibili con lo sviluppo fetale. Per III-1 è stata eseguita l analisi del cariotipo fetale con diagnosi di cariotipo normale. Antonella Di Stefano 23

25 Traslocazioni cromosoma sessuale/autosoma Le traslocazioni cromosoma sessuale/autosoma compromettono la fertilità in misura maggiore rispetto alle traslocazioni autosoma/autosoma. Infatti, tutti i maschi portatori di una traslocazione X/autosoma e l 80% dei maschi con una traslocazione Y/autosoma presentano azoospermia. Il restante 20% dei maschi portatori di traslocazioni Y/autosomi ha un numero ridotto di gameti e una frazione variabile di questi, ha un corredo cromosomico sbilanciato. Le traslocazioni Y/autosoma sono riarrangiamenti strutturali con un incidenza di circa 1/2000 nella popolazione generale e costituiscono un gruppo eterogeneo in quanto possono coinvolgere molti degli autosomi e differenti regioni del cromosoma sessuale. Antonella Di Stefano 24

26 TRASLOCAZIONE X/16 Famiglia nella quale il probando è un maschio portatore di una traslocazione t (X;16) (p21; p12) e con quadro clinico comprendente ipogonadismo ipogonadotropo, genitali ambigui e ritardo di sviluppo sessuale. La madre e la sorella del probando sono portatrici della stessa traslocazione ma il loro fenotipo è normale. Il confronto dei fenotipi del probando e delle due donne portatrici della stessa traslocazione suggerisce l esistenza di una regione cromosomica, localizzata sul cromosoma X, che è espressa differentemente nei due sessi e che è sotto controllo epigenetico. Figura 1: Cariotipo parziale dei cromosomi coinvolti nella traslocazione con colorazione differenziale RBG; le frecce sugli ideogrammi dei cromosomi strutturalmente normali indicano i punti di rottura. Antonella Di Stefano 25

27 Figura 2: t (X;16) (p21;p12) III-2 probando II-3 e III-3 sono portatrici della traslocazione, ma con fenotipo normale. Non è stato possibile eseguire l analisi del cariotipo a I-1 e I-2. Antonella Di Stefano 26

28 A B Antonella Di Stefano 27

29 C Analisi mediante FISH su cromosomi metafasici A-B: ibridazione con sonda cosmidica QUINT Essential DNA specifica per la regione Xp21.2-p21.3; C: ibridazione con sonda painting COATASOME per il cromosoma X; In B e C le frecce indicano il cromosoma X strutturalmente normale. Antonella Di Stefano 28

30 I risultati ottenuti mediante analisi FISH: confermano i punti di rottura individuati mediante l analisi standard del cariotipo e permettono di escludere la presenza di altri riarrangiamenti cromosomici oltre alla traslocazione (A, B); dimostrano che la regione Xp21.2-p21.3 riconosciuta dalla sonda specifica è interamente traslocata sul braccio corto del cromosoma 16, indicando che i punti di rottura sono rispettivamente sul cromosoma X nella regione p21.1-p11.4 e sul cromosoma 16 nella regione p12; evidenziano nelle metafasi femminili (B) segnali della sonda di intensità analoga sul cromosoma X strutturalmente normale e su quello riarrangiato, suggerendo che la quantità di materiale genetico non sia modificata, e nelle metafasi maschili (A) un unico segnale sul braccio corto del cromosoma 16 di origine materna; dimostrano che l intera regione Xpter p21.2, critica per il differenziamento sessuale, e in particolare la regione DSS, non è coinvolta dai punti di rottura della traslocazione. Antonella Di Stefano 29

31 TRASLOCAZIONE Y /1 Il soggetto esaminato presenta infertilità con valori di FSH, LH e inibina B normali. Le analisi dello sperma indicano una azoospermia non ostruttiva. Il volume di entrambi i testicoli valutato mediante ultrasonografia, risulta leggermente ridotto. Il paziente ha due fratelli, uno riprodottosi, e tre sorelle di cui due con figli. I parenti del paziente non hanno effettuato l analisi del cariotipo. Antonella Di Stefano 30

32 Figura 3: t (Y;1) (q11.2;p35) II-2 probando Traslocazione de novo che comporta infertilità, insorta nella gametogenesi paterna Antonella Di Stefano 31

33 A B Figura 4: Riarrangiamento cromosomico bilanciato: traslocazione reciproca tra il braccio lungo del cromosoma Y e il braccio corto del cromosoma 1; [t (Y;1) (q11.2;p35)]. A. Metafase con bandeggio RBG. B. Metafase con bandeggio CBG specifico per le regioni di etero cromatina costitutiva. Nei riquadri a destra sono mostrati il cromosoma 1 strutturalmente normale e i cromosomi coinvolti nella traslocazione reciproca. Antonella Di Stefano 32

34 A Figura 5: Analisi FISH di metafasi con traslocazione reciproca bilanciata (Y;1). Freccia gialla: cromosomi strutturalmente normali. Frecce bianche: cromosomi der (Y) e der (1). A. Ibridazione con sonde per le regioni subtelomeriche del cromosoma 1 (segnale verde 1p; segnale rosso 1q). Il cromosoma 1 strutturalmente normale, presenta entrambi i segnali. Il segnale verde sul braccio lungo del cromosoma der (Y), conferma la traslocazione della regione subtelomerica del braccio corto del cromosoma 1. Il segnale rosso, come atteso, si presenta sul braccio lungo del cromosoma der (1). Antonella Di Stefano 33

35 B B. Ibridazione con le sonde per le regioni pseudoautosomiche (PAR1, PAR2) comuni ai cromosomi X e Y (segnale verde PAR1; segnale rosso PAR2). Il cromosoma X strutturalmente normale presenta entrambi i segnali. Der (Y) presenta solamente il segnale verde PAR1. Der (1) presenta il segnale rosso PAR2 sul braccio corto confermando l avvenuta traslocazione dell intera regione YqPAR. Antonella Di Stefano 34

36 Figura 6: Analisi PCR relativa alle regioni AZFa, AZFb e AZFc. L elettroforesi dimostra che i profili del DNA delle tre regioni AZF sono normali, sovrapponibili a quelli dei controlli di popolazione. Antonella Di Stefano 35

37 3 RISULTATI Nei portatori di traslocazioni bilanciate autosoma/autosoma il rischio teorico di avere una progenie sbilanciata è più del 60%; in pratica, i dati statistici ottenuti da analisi su ampi campioni di popolazione correggono il grado di rischio stimandolo in circa il 50%, poiché una percentuale di embrioni sbilanciati va incontro ad aborto in fasi molto precoci della gestazione. Infatti, analisi mediante FISH di spermatozoi di portatori di traslocazione bilanciata, hanno dimostrato che il 50 % dei gameti maschili hanno corredo cromosomico normale o bilanciato in uguale percentuale, e che il restante 50 % di gameti sbilanciati si originano per segregazione adiacente 1. Nella famiglia 1 [ t (7;14) ] e nella famiglia 2 [ t (7;10) ] è coinvolto in entrambi i casi il cromosoma 7, ma nel primo caso questo è traslocato con un acrocentrico e quindi l appaiamento alla meiosi risulta particolarmente instabile. Di conseguenza è possibile una trasmissione ereditaria, ma con significativa presenza di aborti. Differentemente, nella famiglia 2, il cromosoma 7 è traslocato su un altro cromosoma del gruppo C. La trasmissione ereditaria è documentata in quattro generazioni con simile incidenza di aborti e prole normale, probabilmente per una forte selezione nelle precocissime fasi di sviluppo embrionale. Nelle famiglie 3 [ t (4;11) ] e 4 [ t (11;20) ] è invece coinvolto il cromosoma 11 in cui sono localizzati geni critici per lo sviluppo embrionale (es.famiglia β like delle emoglobine) e geni sottoposti ad imprinting (es. protooncogene tumore di Wilms). Antonella Di Stefano 36

38 Nella traslocazione robertsoniana [ t (14;21) ], l appaiamento prende la forma di un trivalente molto instabile con esposti i bracci corti degli acrocentrici; queste regioni NOR, che ospitano i geni per rrna e intervengono nella formazione del nucleolo, determinano spesso, anche in individui con cariotipo normale, disturbi nella spermatogenesi per interferenza con l appaiamento XY. Per le traslocazioni cromosomi sessuali/autosoma qui descritte, aberrazioni cromosomiche che coinvolgono invece il braccio corto del cromosoma X sono state descritte in maschi con diverse anomalie quali la Sindrome di Kallmann, l ipoplasia congenita delle ghiandole surrenali associata a ipogonadismo ipogonadotropo, il ritardo mentale associato a macrorchidismo e la sindrome sex reversal associata a duplicazione della regione DSS. Poiché sia le due donne fenotipicamente normali che il maschio con gravi anomalie dello sviluppo sessuale presentano gli stessi alleli attivi sui cromosomi derivativi della traslocazione, si può ipotizzare che la regione coinvolta nel punto di rottura del cromosoma X o del cromosoma 16 svolga un ruolo differente nei due sessi presumibilmente sotto l azione di fattori epigenetici. Tuttavia dati recenti relativi agli effetti fenotipici di disomie uniparentali materne a carico del cromosoma 16 indicano che i geni di questo cromosoma, sottoposti a imprinting, non svolgono un ruolo specifico nel differenziamento sessuale. Alcuni studi suggeriscono inoltre, che l inattivazione del cromosoma X e l imprinting di geni X-linked siano Antonella Di Stefano 37




La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule


Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni


Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Diagnosi Preimpianto delle alterazioni cromosomiche mediante array-cgh La sottoscritta (partner femmiile).. Data


Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)


Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti


Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB) Screening Preimpianto delle alterazioni cromosomiche numeriche mediante array-cgh La sottoscritta (partner femmile).. Data


5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti



www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati



MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y L infertilità è considerata dall Organizzazione Mondiale della Sanità una patologia. Per infertilità si intende l assenza di concepimento dopo 12/24 mesi di rapporti mirati non protetti. Il fenomeno dell



VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano


il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre più di non conoscere, nell avvedersi di saper sempre meno,


La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.


La Citogenetica nella Diagnosi Prenatale

La Citogenetica nella Diagnosi Prenatale La Citogenetica nella Diagnosi Prenatale Per diagnosi prenatale si intende l insieme delle indagini strumentali e di laboratorio finalizzate ad individuare determinate patologie su base : genetica infettiva



DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI Ogni individuo possiede un proprio patrimonio genetico che lo rende unico e diverso da tutti gli altri. Il patrimonio genetico è costituito da



LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.





Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione


Università degli studi di Firenze Dipartimento di Scienze per la Salute della Donna e del Bambino

Università degli studi di Firenze Dipartimento di Scienze per la Salute della Donna e del Bambino Università degli studi di Firenze Dipartimento di Scienze per la Salute della Donna e del Bambino TERAPIA DELLA INFERTILITA MASCHILE E TECNICHE DI PMA: LO STUDIO DELLA FRAMMENTAZIONE DEL DNA SPERMATICO


Struttura Semplice Dipartimentale GENETICA MEDICA - OSPEDALE SAN BASSIANO

Struttura Semplice Dipartimentale GENETICA MEDICA - OSPEDALE SAN BASSIANO Struttura Semplice Dipartimentale GENETICA MEDICA - OSPEDALE SAN BASSIANO PRESENTAZIONE DELLA STRUTTURA La Struttura Semplice Dipartimentale di genetica medica fa parte del Dipartimento di Medicina dei


GENETICA MEDICA. Analisi genetiche per oltre 400 geni testabili vengono inviati a strutture pubbliche esterne, ospedaliere e universitarie.

GENETICA MEDICA. Analisi genetiche per oltre 400 geni testabili vengono inviati a strutture pubbliche esterne, ospedaliere e universitarie. GENETICA MEDICA PRESENTAZIONE DELLA STRUTTURA L ambulatorio di Genetica Medica fa parte del Dipartimento Materno Infantile. Essa collabora ed interagisce strettamente con le Strutture del Dipartimento


Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,


Glossario essenziale a cura di Salvino Leone

Glossario essenziale a cura di Salvino Leone Glossario essenziale a cura di Salvino Leone I molti termini tecnici usati dagli addetti ai lavori in materia di procreazione assistita non sono usuali. Ne proponiamo un elenco che pur non essendo completo



SISTEMA RIPRODUTTIVO TOSSICITA RIPRODUTTIVA TOSSICITA RIPRODUTTIVA disfunzione indotta da sostanze xenobiotiche che colpiscono i processi di gametogenesi dal loro stadio più precoce all impianto del prodotto del concepimento nell endometrio. La


Diagnosi genetica preimpianto- nuovo metodo di screening di 24 cromosomi tramite il metodo Array CGH...2

Diagnosi genetica preimpianto- nuovo metodo di screening di 24 cromosomi tramite il metodo Array CGH...2 Agosto 2012 contenuto 8 Diagnosi genetica preimpianto- nuovo metodo di screening di 24 cromosomi tramite il metodo Array CGH...2 Mantenimento di fertilitá-nuove possibilitá presso il GENNET...3 Isteroscopia


Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi


Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule.

Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule. Il patrimonio genetico, base della vita Il patrimonio genetico (genoma) è l insieme di tutte le informazioni necessarie per costruire ogni embrione, attraverso complessi meccanismi di moltiplicazione delle


Counselling genetico nell infertilità e nella fecondazione assistita

Counselling genetico nell infertilità e nella fecondazione assistita Counselling genetico nell infertilità e nella fecondazione assistita Giuseppe Novelli & Leila Salehi Università degli Studi di Roma "Tor Vergata" L infertilità è definita come l incapacità per una coppia


Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA


Studio dell infertilità maschile: dall esame seminale alle microdelezioni del cromosoma Y

Studio dell infertilità maschile: dall esame seminale alle microdelezioni del cromosoma Y Studio dell infertilità maschile: dall esame seminale alle microdelezioni del cromosoma Y Domenico Saverio MATAROZZO Claretta MARCHI Anatomia Patologica S. Anna - Torino Premessa L esame seminale è il


Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di GENETICA MEDICA Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di Perugia Centro Riferimento Regionale





Informazioni generali sulla diagnosi genetica preimpianto (PGD) a) Diagnosi preimpianto di aneuploidie cromosomiche (PGS) Pagina 2 di 10

Informazioni generali sulla diagnosi genetica preimpianto (PGD) a) Diagnosi preimpianto di aneuploidie cromosomiche (PGS) Pagina 2 di 10 CONSENSO INFORMATO ALL ESECUZIONE DEL TEST GENETICO PER LA DIAGNOSI DI ALTERAZIONI CROMOSOMICHE NUMERICHE E/O STRUTTURALI SBILANCIATE MEDIANTE TECNICA ARRAY-CGH Il sottoscritto (partner maschile) Data


Diagnosi Prenatale I

Diagnosi Prenatale I Diagnosi Prenatale I Lezione 15 Diagnosi prenatale nata nel 1966 (Steele e Breg); richiede l intervento di numerose discipline: ostetricia, ultrasonografia, genetica clinica, diagnosi e consulenza genetica


Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI

Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Introduzione Cromosoma Cellula Nucleo Ormai a tutti è noto il ruolo del


Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento





Cor o t r e t e C os o t s it i uzi uz o i na U f f i f c i io i o S ta t mpa L g e ge e s ulla f e f c e o c ndazione e a ssist s ita

Cor o t r e t e C os o t s it i uzi uz o i na U f f i f c i io i o S ta t mpa L g e ge e s ulla f e f c e o c ndazione e a ssist s ita La diagnosi pre-impianto Claudia Livi Centro DEMETRA Firenze www.centrodemetra.com Corte Costituzionale Ufficio Stampa Legge sulla fecondazione assistita La Corte ha dichiarato l illegittimità costituzionale


La fecondazione artificiale sul piano biologico e medico

La fecondazione artificiale sul piano biologico e medico La fecondazione artificiale sul piano biologico e medico FERTILITA UMANA CAPACITA FISIOLOGICA DI UNA COPPIA, FORMATA DA UN UOMO E DA UNA DONNA, DI CONCEPIRE IN QUESTA FUNZIONE NON SONO COINVOLTI SOLO GLI


Informazioni generali sulla diagnosi genetica preimpianto (PGD) a) Diagnosi preimpianto di aneuploidie cromosomiche (PGS) Pagina 2 di 11

Informazioni generali sulla diagnosi genetica preimpianto (PGD) a) Diagnosi preimpianto di aneuploidie cromosomiche (PGS) Pagina 2 di 11 ATTO DI CONSENSO INFORMATO ALL ESECUZIONE DEL TEST GENETICO SU SINGOLA CELLULA PER LA DIAGNOSI DI ALTERAZIONI CROMOSOMICHE STRUTTURALI SBILANCIATE E/O NUMERICHE Il sottoscritto (partner maschile) Data


Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi Patogenesi Terapia Diagnosi Dalla Genomica alla Medicina Molecolare Chimica Biochimica Biologia Biologia Molecolare Decodificazione Genoma Umano Post-Genomica Medicina Molecolare La CELLULA Nasce Si sviluppa


Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI


Modulo 2 Genetica e genomica: come migliorare il trattamento per l'infertilità

Modulo 2 Genetica e genomica: come migliorare il trattamento per l'infertilità Modulo 2 Genetica e genomica: come migliorare il trattamento per l'infertilità Autore: Dr. Alessio Paffoni, Specialista in Specialista in Genetica Medica, Ospedale Maggiore Policlinico Mangiagalli e Regina


Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare V Scuola di Ingegneria dell Informazione Laurea Magistrale in Ingegneria Informatica II Scuola di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica e Informazione


Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,



DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIFETTI CONGENITI Le anomalie congenite sono condizioni che si instaurano tra il momento del concepimento e la nascita. LA DIAGNOSI PRENATALE insieme di tecniche


The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione


Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi


Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente



X CICLO DI CONFERENZE X CICLO DI CONFERENZE Professione Biologo Biologo della Fecondazione Assistita Giovedì 27 settembre 2012 Alessandro Miceli Promea S.p.A. - Torino alessandro.miceli@promea.net Dipartimento di Biologia Animale


23-NOV-2015 da pag. 16 foglio 1

23-NOV-2015 da pag. 16 foglio 1 Tiratura: n.d. Diffusione 12/2012: 10.694 Lettori Ed. II 2014: 61.000 Quotidiano - Ed. Roma Dir. Resp.: Gian Marco Chiocci da pag. 16 foglio 1 Tiratura 09/2015: 68.268 Diffusione 09/2015: 48.891 Lettori


Infertilità e fattore età

Infertilità e fattore età Infertilità e fattore età F. Iannotti, GB. La Sala Struttura Complessa di Ostetricia Ginecologia Arcispedale S. Maria Nuova Azienda Ospedaliera di Reggio Emilia La fertilità, definita come capacità di


ZytoLight SPEC ALK Dual Color Break Apart Probe

ZytoLight SPEC ALK Dual Color Break Apart Probe ZytoLight SPEC ALK Dual Color Break Apart Probe Z-2124-200 20 (0.2 ml) Z-2124-50 5 (0.05 ml) Per la rilevazione della traslocazione che coinvolge il gene ALK a 2p23 mediante ibridazione in situ fluorescente



GUIDA PER COPPIE DI TALASSEMICI ETEROZIGOTI (A CURA DELLA REGIONE LOMBARDIA) PREFAZIONE GUIDA PER COPPIE DI TALASSEMICI ETEROZIGOTI (A CURA DELLA REGIONE LOMBARDIA) Le informazioni fornite attraverso queste pagine, sono state tratte da un opuscolo pubblicato e curato dal Gruppo di Lavoro


Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di


geni e dintorni piccola guida alle malattie ereditarie

geni e dintorni piccola guida alle malattie ereditarie 2 geni e dintorni piccola guida alle malattie ereditarie A cura Regione Toscana Giunta Regionale Dipartimento del diritto alla salute e delle politiche di solidarietà Uoc Sviluppo delle risorse professionali


Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di


ZytoLight SPEC ALK/EML4 TriCheck Probe

ZytoLight SPEC ALK/EML4 TriCheck Probe ZytoLight SPEC ALK/EML4 TriCheck Probe Z-2117-200 Z-2117-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del riarrangiamento dei geni ALK- EML4 mediante ibridazione in situ fluorescente (FISH).... Dispositivo


La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.


ANOMALIE CROMOSOMICHE UMANE: Patologie derivate da alterazioni del numero o della struttura dei cromosomi SINDROME DI DOWN

ANOMALIE CROMOSOMICHE UMANE: Patologie derivate da alterazioni del numero o della struttura dei cromosomi SINDROME DI DOWN Sinonimi: Trisomia 21 Frequenza : 1/750 nati vivi ANOMALIE CROMOSOMICHE UMANE: Patologie derivate da alterazioni del numero o della struttura dei cromosomi SINDROME DI DOWN La sindrome di Down (detta anche


Consenso Informato per l esecuzione di Diagnosi Genetica Preimpianto e Screening (PGD/PGS) MO.101.OCT.DMI. FIR

Consenso Informato per l esecuzione di Diagnosi Genetica Preimpianto e Screening (PGD/PGS) MO.101.OCT.DMI. FIR pag 1 di 5 Il sottoscritto Luogo e Data di nascita Residente a Via Documento e numero Malattia genetica Mutazione La sottoscritta Luogo e Data di nascita Residente a Via Documento e numero Malattia genetica



GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel


ZytoLight SPEC HER2/CEN 17 Dual Color Probe

ZytoLight SPEC HER2/CEN 17 Dual Color Probe ZytoLight SPEC HER2/CEN 17 Dual Color Probe Z-2015-200 Z-2015-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del gene umano HER2 e degli alfa-satelliti del cromosoma 17 mediante ibridazione in situ fluorescente


LA GENETICA. Dott.ssa Valentina Terio

LA GENETICA. Dott.ssa Valentina Terio LA GENETICA Dott.ssa Valentina Terio LLA GENETCA SCIENZA NATA CIRCA 150 ANNI FA GRAZIE AD UN STUDIOSO AUSTRIACO DI NOME MENDEL Pisello da giardino per la facilità di crescita e la possibilità di una impollinazione


IL GENOMA UMANO. Ogni cromosoma è suddiviso in regioni d informazione dette GENI. L informazione espressa da ciascun gene è detta CARATTERE.

IL GENOMA UMANO. Ogni cromosoma è suddiviso in regioni d informazione dette GENI. L informazione espressa da ciascun gene è detta CARATTERE. IL GENOMA UMANO Ogni cellula contiene nel nucleo una molecola chiamata DNA (acido desossiribonucleico) Tale molecola ha la forma di una lunghissima scala a chiocciola. I gradini che compongono la scala


ZytoLight SPEC ERG Dual Color Break Apart Probe

ZytoLight SPEC ERG Dual Color Break Apart Probe ZytoLight SPEC ERG Dual Color Break Apart Probe IVD Dispositivo medico-diagnostico in vitro Produttore: ZytoVision GmbH Codice: Z-2138-200 (0.2ml).. Per l identificazione della traslocazione che coinvolge



MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della



VADEMECUM PER COPPIE PORTATRICI DI TALASSEMIA VADEMECUM PER COPPIE PORTATRICI DI TALASSEMIA Questo vademecum non ha alcuna pretesa medica, ma intende essere uno strumento informativo di base per le coppie portatrici di talassemia. Invitiamo gli interessati


Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:


La terapia in utero delle malattie genetiche: cellule staminali, terapia genica

La terapia in utero delle malattie genetiche: cellule staminali, terapia genica La terapia in utero delle malattie genetiche: cellule staminali, terapia genica Prof. M.Seri: U.O. Genetica Clin ica Dipartimento per la Salute della Donna, del Bambin o e dell Adolescente Geni e malattie


Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Riparazione del DNA ed insorgenza di tumori Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Danni al DNA e cancro Le cellule tumorali L importanza della stabilità


GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna


Alessandra Ferlini Marcella Neri CONSULENZA GENETICA

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Ad integrazione delle lezioni e del testo di studio Genetica Umana e Medica Neri- Genuardi 3a edizione 2014 Masson (www.mediquiz.it) GENETICA MEDICA



LE TECNICHE DI PROCREAZIONE MEDICALMENTE ASSISTITA LE TECNICHE DI PROCREAZIONE MEDICALMENTE ASSISTITA Dr. Nunzio Minniti Clinica del Mediterraneo (Ragusa) Centro Genesi (Palermo) Arca Service PMA (Livorno) Le tecniche di PMA Perché? Quali? Per forza? Una


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici


You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


Normativa Progetto di legge Gran Bretagna Sì Sì Danimarca Sì sì Norvegia Sì Sì Svezia Sì sì Italia Sì sì Spagna Sì Sì Portogallo Sì sì Francia Sì Sì

Normativa Progetto di legge Gran Bretagna Sì Sì Danimarca Sì sì Norvegia Sì Sì Svezia Sì sì Italia Sì sì Spagna Sì Sì Portogallo Sì sì Francia Sì Sì Parte specifica Parere del Comitato etico provinciale sull uso di cellule staminali embrionali con particolare riferimento alla diagnosi genetica preimpianto (ingl. preimplantation genetic diagnosis =


Tecniche avanzate di PMA

Tecniche avanzate di PMA Procreazione medicalmente assistita e legge 40/04 Tecniche avanzate di PMA FIVET fecondazione in vitro ed embrio-transfer ICSI intra-citoplasmatic sperm injection GIFT gamete intra-fallopian transfer ZIFT


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.



LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni



L INFERTILITA MASCHILE L INFERTILITA MASCHILE Dott. CARMINE DI PALMA Andrologia, Urologia, Chirurgia Andrologica e Urologica, Ecografia Come si definisce l infertilità maschile? L'infertilità maschile corrisponde a una ridotta


RISULTATI DEI TRATTAMENTI PMA. 1985-2012 S.I.S.Me.R - Bologna e Centri Satellite

RISULTATI DEI TRATTAMENTI PMA. 1985-2012 S.I.S.Me.R - Bologna e Centri Satellite 4 RISULTATI DEI TRATTAMENTI PMA 1985-2012 S.I.S.Me.R - Bologna e Centri Satellite 1 2 Premessa In questo fascicolo sono presentati i risultati della attività di PMA svolta dal 1985 al 2012 in Italia dalla


TECNICHE DI II - III LIVELLO. Fecondazione in Vitro e Trasferimento dell embrione (FIVET)

TECNICHE DI II - III LIVELLO. Fecondazione in Vitro e Trasferimento dell embrione (FIVET) TECNICHE DI II - III LIVELLO Fecondazione in Vitro e Trasferimento dell embrione (FIVET) È una tecnica di PMA in cui i gameti (ovocita per la donna e spermatozoo per l uomo) si incontrano all esterno del


Presidio Ospedaliero di Pordenone Sacile Via Montereale 24 - Pordenone NOTA INFORMATIVA PER AMNIOCENTESI

Presidio Ospedaliero di Pordenone Sacile Via Montereale 24 - Pordenone NOTA INFORMATIVA PER AMNIOCENTESI Azienda per l Assistenza Sanitaria n. 5 Friuli Occidentale Via della Vecchia Ceramica, 1 33170 Pordenone C.F. e P.I. 01772890933 PEC aas5.protgen@certsanita.fvg.it Presidio Ospedaliero di Pordenone Sacile


La consulenza alla paziente che richiede l analisi del DNA fetale

La consulenza alla paziente che richiede l analisi del DNA fetale La consulenza alla paziente che richiede l analisi del DNA fetale Bertinoro, 19 Ottobre 2013 Eva Pompilii eva_pompilii@yahoo.it Limiti attuali del Non invasive Prenatal Testing/ Non Invasive Prenatal


Corso di Medicina del Lavoro

Corso di Medicina del Lavoro Corso di Medicina del Lavoro Malattie da cancerogeni, mutageni e genotossici Valutazione del rischio per la riproduzione in ambiente di lavoro 1 of 28 A quali agenti è esposto il lavoratore o la lavoratrice?


LOSSARIO HSP. Riproduzione assistita sec. WHO. Dati statistici

LOSSARIO HSP. Riproduzione assistita sec. WHO. Dati statistici HSP LOSSARIO Riproduzione assistita sec. WHO Dati statistici Vayena E, Rowe PJ, Griggin PD Current Practices and Controversies in Assisted Reproduction. Proceedings of the Meeting Medical, Ethical and


Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi



DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo



NEOPLASIE ED INFERTILITA NEOPLASIE ED INFERTILITA NEOPLASIE E FERTILITA UN TEMA DA AFFRONTARE INSIEME CONOSCERE IL PROPRIO PROBLEMA Ogni anno circa 11000 persone in età riproduttiva si ammalano di tumore. Per queste persone affrontare


Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE

Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE TIPOLOGIA CAMPIONE n. nome TEST GENETICO metodo giorni 1 Acondroplasia



ELENCO DELLE INDAGINI ESEGUIBILI Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE n. nome TEST GENETICO metodo giorni TIPOLOGIA CAMPIONE 1 Acondroplasia


GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una


Fecondazione In Vitro (FIV / ICSI)

Fecondazione In Vitro (FIV / ICSI) Fecondazione In Vitro (FIV / ICSI) In che consiste? La fecondazione in vitro (FIV) è una tecnica di procreazione assistita che consiste nella fecondazione dell ovocita (o gamete femminile) con lo spermatozoo


Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di





A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina


la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo


Her-2 nel carcinoma mammario

Her-2 nel carcinoma mammario Her-2 nel carcinoma mammario Piera Balzarini U.O. Anatomia Patologica Università degli Studi di Brescia Spedali Civili di Brescia Il gene ERBB2 dà origine ad un recettore tirosin-chinasico appartenente


Traslocazioni cromosomiche

Traslocazioni cromosomiche 16 Traslocazioni cromosomiche Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle loro norme
