Applicazioni biotecnologiche in systems biology

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Applicazioni biotecnologiche in systems biology"

Transcript

1 Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013

2 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013

3 NGS: Next Generation Sequencing MacLean et al., 2009

4 Sequenziamento del genoma Genoma: intera sequenza nucleotidica di un organismo Sequenziamento: determinazione di una sequenza nucleotidica Le tecniche di sequenziamento Generazione 0 Sequenziamento chimico Generazione 1 Dye-terminator Generazione 2 NGS con pre-amplificazione Generazione 3 NGS su singola molecola NGS: Next Generation Sequencing

5 Le tecniche di sequenziamento Generazione 0 Sequenziamento chimico Generazione 1 Dye-terminator Generazione 2 NGS con pre-amplificazione Generazione 3 NGS su singola molecola Generazione 4???

6 Tutte le tecniche di sequenziamento portano alla produzione di molte sequenze corte ( bp) Il genoma batterico più corto è circa 1Mb (500 volte la reads più lunga) Un gene batterico è lungo in media 300 bp Necessario unire insieme le varie reads per ottenere un genoma Trimming, Assembling, Scaffolding

7 Controllo qualità Il trimmaggio delle reads

8 Qualità e Probabilità BASES A C T G ERROR 1% 0.1% 0.01% 0.001% QUALITY Base scartata Qualità generalmente accettata

9 Identificativo sequenza (ID) Il formato FASTA Sequenza (DNA, RNA o proteina) Formato file per immagazzinare sequenze biologiche Uno dei formati più semplici (contiene solo la sequenza e il suo nome ) Un file può contenere più di una sequenza Quando si incontra il carattere > all inizio di una riga parte una nuova sequenza

10 Identificativo sequenza (ID) E la qualità? Sequenza (DNA, RNA o proteina) Non c è modo di conoscere il valore di qualità delle singole basi Formato non adatto ai dati di sequenziamento grezzi Il formato FASTA viene usato per sequenze finite, la cui qualità è stata controllata

11 Il formato TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc

12 Il formato TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = 100

13 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

14 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

15 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

16 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

17 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità La qualità deve essere codificata con un unico carattere come la sequenza, In modo da evitare interpretazioni ambigue (e risparmiare TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

18 Codifica della La qualità viene codificata usando i caratteri ASCII (lettere, numeri e simboli) Esiste una tabella per convertire ogni carattere ad un determinato valore di qualità Ogni produttore di macchinari di sequenziamento utilizza una propria tabella

19 Codifica della qualità Le varie ditte produttrici di macchine per il sequenziamento NGS, non hanno (ancora?) concordato uno standard comune di qualità Di fatto, ogni tipologia di reads deve essere trattata utilizzando parametri di conversione propri dello strumento che l ha generata SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS......XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

20 Controllo qualità Basi di scarsa qualità Analisi della qualità delle reads tramite il programma FastQC

21 Controllo qualità Basi di scarsa qualità

22 Trimming Eliminazione delle basi a bassa qualità Eliminazione totale delle reads troppo corte dopo la rimozione delle basi a bassa qualità

23 Esempio: Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C A Dr. Giovanni Bacci

24 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C A Q A - Cutoff > 0? NO La base viene rimossa e si ripete il test con la base precedente

25 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C Q C - Cutoff > 0? SI NO La base viene mantenuta e la finestra allargata La base viene rimossa e si ripete il test con la base precedente

26 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C (Q C Cutoff) + (Q C Cutoff) > 0? SI NO La base viene mantenuta e la finestra allargata Le basi vengono rimosse e si ripete il test con la base precedente

27 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C (Q C Cutoff) + (Q C Cutoff) > 0? SI NO La base viene mantenuta e la finestra allargata Le basi vengono rimosse e si ripete il test con la base precedente

28 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A (Q A - Cutoff) > 0? SI NO La base viene mantenuta e la finestra allargata La base viene rimossa e si ripete il test con la base precedente

29 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A min max Σ min n=max(q n - Cutoff) > 0? SI NO La base viene mantenuta e la finestra allargata Le basi vengono rimosse e si ripete il test con la base precedente

30 Streaming-Trim algorithm Eliminazione delle basi a bassa qualità Eliminazione totale delle reads troppo corte dopo la rimozione delle basi a bassa qualità

31 Assemblaggio

32 Assemblaggio Assemblaggio: processo con il quale le singole reads vengono allineate e unite fra loro a formare una sequenza di lunghezza maggiore Nel migliore dei casi si ottiene la sequenza completa (senza gap) del genoma di interesse Nella maggior parte dei casi si ottengono una serie di sequenze di varia lunghezza chiamate contigs

33 Profondità del sequenziamento Read singola Genoma completo Il campione genomico viene frammentato (casualmente) ed amplificato Dato l alto numero di frammenti letti dal sequenziamento, statisticamente ogni parte del genoma viene letta più volte La profondità (o coverage) indica quante volte in media ogni base è stata letta durante il sequenziamento

34 1X 2X 3X 4X La profondità minima accettata è circa 30X (ogni base è stata letta almeno 30 volte) Le tecnologie NGS producono una quantità maggiore di reads: profondità > 100X

35 Assemblaggio L assemblaggio delle reads prevede la codifica delle reads (e delle relazioni reciproche) in un grafo (o network)

36 Assemblaggio Introduzione ai network

37 Introduzione ai grafi E possibile visitare tutti i quartieri attraversando i ponti esattamente una volta e tornando al punto di partenza? Concetto introdotto da Eulero nel 1735 Ogni quartiere è rappresentato da un nodo (o vertice), mentre ogni ponte è rappresentato da un arco

38 Introduzione ai grafi C A D Nodi: A, B, C, D Archi: (A,C) (A,C) (A,B) (A,B) (A,D) (C,D) (B,D) B

39 Introduzione ai grafi Grafo indiretto: Gli archi non hanno direzione Possono essere percorsi in entrambi i versi Grafo diretto (digrafo): Gli archi possiedono una direzione Archi orientati Un grafo indiretto può essere trasformato in un grafo diretto: ogni arco viene trasformato in due archi con direzioni opposte e medesimi vertici

40 Introduzione ai grafi Quartiere 1 Quartiere 4 100m 70m 60m 50m 50m Quartiere 3 100m 70m Quartiere 2 I nodi e gli archi possono possedere degli attributi, che ne definiscono delle proprietà Esempio: Nodi (nomi dei quartieri della città) Archi (lunghezza dei ponti)

41 Introduzione ai grafi Grado: 3 Grado: 5 Grado: 3 Grado: 3 Grado: Numero di archi incidenti su un vertice Indica il grado di connessione di un singolo vertice o dell intero grafo Grafo k-regolare: tutti i vertici hanno medesimo grado Nei network biologici il grado ha implicazioni importanti

42 Esempio: social network I vertici rappresentano le persone (attributi: nome, sesso, età) Gli archi rappresentano relazioni (ad es. amicizia) (attributi: numero di interazioni) Vertici ad alto grado rappresentano persone con molte amicizie

43 Introduzione ai grafi V3 V4 V0 V2 Vn V1 V5 Percorso: Serie di vertici V0 Vn e di archi (V0, V1) (Vn-1, Vn) Un cammino prevede che i due vertici agli estremi del percorso siano diversi

44 Introduzione ai grafi V2 V1 V3 V0 Vn V4 Ciclo: Percorso i cui vertici agli estremi coincidono

45 Introduzione ai grafi V2 V1 V3 V0 Vn V4 E possibile visitare tutti i quartieri attraversando i ponti esattamente una volta e tornando al punto di partenza? Ciclo: Percorso i cui vertici agli estremi coincidono

46 Assemblaggio Metodo Sanger e grafo de Bruijn

47 Assemblaggio Genome length: 10bp // Reads length: 7bp L assemblaggio delle reads prevede la codifica delle reads (e delle relazioni reciproche) in un grafo (o network) Per chiudere il genoma è necessario individuare un ciclo all interno del grafo

48 Assemblaggio Metodo Sanger Le reads vengono divise in frammenti più piccoli lunghi k (k-mers) I vertici rappresentano i k-mers Gli archi rappresentano gli allineamenti fra i k- mers L assemblaggio avviene cercando all interno del grafo un ciclo hamiltoniano Un ciclo in cui ogni vertice viene visitato al massimo una volta

49 Assemblaggio Metodo Sanger

50 Assemblaggio Metodo Sanger Metodo usato nei sequenziamenti Sanger Metodo computazionalmente costoso Tutti gli allineamenti fra i k-mers devono essere calcolati per costruire il grafo 10 6 reads = allineamenti 10 9 reads = allineamenti La ricerca del ciclo hamiltoniano è un algoritmo che richiede molto tempo Impossibile usare questo approccio per l NGS

51 Assemblaggio Metodo de Bruijn Le reads vengono divise in frammenti più piccoli lunghi k (k-mers) Gli archi rappresentano i k-mers I vertici rappresentano i prefissi e suffissi dei k-mers lunghi k-1 L assemblaggio avviene cercando all interno del grafo un ciclo euleriano Un ciclo in cui ogni arco viene visitato al massimo una volta

52 Assemblaggio Metodo de Bruijn

53 Assemblaggio Metodo de Bruijn Metodo meno costoso Il tempo di calcolo è circa proporzionale al numero di reads Non è necessario allineare fra loro i k- mers Tutti i moderni programmi di assemblaggio (assemblatori) sfruttano questo grafo Abyss, velvet, ray, SOAPdenovo,

54 Assemblaggio - Problemi Errori nel sequenziamento portano alla formazione di bolle nel grafo Difficile determinare quale ramo della bolla rappresenta l assemblaggio corretto

55 Assemblaggio - Problemi Sequenze duplicate portano a leggere più volte lo stesso k-mer Necessario aggiungere tanti archi quante sono le ripetizioni Stimare il numero di duplicazioni è difficile Le sequenze ripetute sono molto comuni nei genomi (es. trasposasi nei batteri)

56 Assemblaggio - Problemi Cromosomi multipli e cromosomi lineari Il genoma di interesse può contenere cromosomi multipli Bisogna trovare un ciclo euleriano per ogni cromosoma Difficile conoscere in anticipo il numero di cromosomi (o plasmidi) presenti in un genoma Scelta del miglior numero k I vari problemi di assemblaggio fanno sì che si ottengano contig (o contigui) K più grandi significano un minor numero di bolle e quindi contig più lunghi Maggior costo computazionale Inclusione di errori nella sequenza

57 Reads Contigs Genome Assemblaggio

58 Assemblaggio Controllo qualità

59 Assemblaggio Controllo qualità Parametri di controllo di un assemblaggio Numero di contig (basso è meglio) Lunghezza media dei contig (alta è meglio) Valore N50: lunghezza del contig oltre il quale se si usano contig di lunghezza maggiore si stanno considerando il 50% delle basi dell assemblaggio (alto è meglio) N80, N90, N70, ecc ecc Se il genoma chiuso è disponibile (o comunque un genoma molto vicino): Numero di misassemblies: Porzioni di contig invertiti o traslocati

60 Assemblaggio Controllo qualità

61 Assemblaggio Dal FASTQ al FASTA

62 Conservazione dati NGS Sanger sequencing Bassa quantità di dati prodotti Ridotto spazio per la conservazione sia delle reads che dei contig/genomi Genoma batterico in formato FASTA: 1Mb ogni milione di basi Un genoma di E.coli = 4/5 Mb Un genoma batterico in formato FASTQ: La dimensione dipende dal numero di reads Il formato FASTQ contiene almeno il doppio di informazioni rispetto al FASTA Per ogni base ho il valore della qualità

63 Conservazione dati TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Esempio di sequenziamento NGS: Dimensione genoma (FASTA): 7Mb Reads in formato FASTQ: 2.4 GB

64 Scaffolding Dai contig ai supercontig

65 Scaffolding Reads Contigs Genome Se il genoma chiuso è disponibile (o comunque un genoma molto vicino): Possiamo stimare la posizione relativa dei contig ottenuti tramite un allineamento contro il genoma chiuso più vicino L avvento delle tecniche NGS ha fatto sì che ad oggi siano disponibili 2303 genomi batterici completi E molto probabile che per ogni nuovo sequenziamento sia disponibile un genome di riferimento vicino

66 Example: the CONTIGuator algorithm Allineamento al genoma di riferimento: BLAST Applicazione di una serie di cut-offs: Lunghezza minima di allineamento Contig coverage (%): per essere considerato mappato il contig deve avere una percentuale minima della sua lunghezza presente nell allineamento I contig mappati in più punti (trasposasi, IS) sono scartati

67 Example: the CONTIGuator algorithm Reference Contig // Scaffold Estrazione dell ordinamento relativo dei contigs: generazione di uno scaffold I buchi nello scaffold possono essere riempiti progettando delle reazioni di PCR fra i contig

68 Example: the CONTIGuator algorithm

69 Annotation From sequences to genes

70

71 Where are the genes?

72 Annotation or Gene calling

73

74 (Common) start codons: ATG, GTG, TTG Assuming that all the codons are equiprobable 5% of the codons are stop codons (3/64) ~ every 60bp we should encounter a stop codon BUT The average bacterial gene size is ~ 300bp Naive annotation method: Find all the DNA region starting with a start codon and long more than 60bp Open Reading Frames (ORFs)

75 Forward Reverse Problems: Each one of the 6 frames has to be considered Which frame should be considered in case of multiple ORFs?

76 Problems: Many start codons can be found inside an ORF Which one is the right one?

77 Other proof of the presence of an ORF: A ribosomal binding site (RBS) In case of an operon it may not be present Problems: Microbial genomes are dense Small intergenic regions ORFs can overlap each other

78 We assumed that all the codons are equiprobable BUT In bacterial genomes we have: different codon usages variable GC content * different intergenic distances ** Each genome has a particular codon frequency * High GC means lower stop codon frequency ** related to the species lifestyle

79 Eukaryotes are even more complicated: Lower gene frequency (more junk DNA) Presence of exons and introns

80 Annotation methods: Experimental: Through proteomics and transcriptomics Expensive and time-consuming Some genes may not be expressed in vitro Extrinsic: Similarity-based methods BLAST is often used Alignments using transcriptomics data and similar genomes Intrinsic: Ab initio methods: based only on the sequence Mostly statistical methods, based on ORF length, RBS, intergenic distances Dynamic programming, HMM Methods validated with manually curated gene predictions

81 Ab-initio methods: Dynamic programming Computational approach Used to solve complex problems The overall problem is divided in smaller (and simpler) pieces The results of the smaller pieces are stored for quick lookup Used also in alignments

82 Ab-initio methods: Dynamic programming In gene annotation: Used to find the best gene models The overall problem is to find all the genes The smaller problem is the prediction of single genes Each gene model is related to its neighborhoods with a score The sequence of genes with the best score is the most probable

83 Ab-initio methods: Hidden Markov Models Statistical approach A series of states with transitions having different probabilities Used to model sequences of connected objects/events In gene annotation: General features of annotated genomes can be used to build an HMM to be used in the annotation Features like ORFs length, stat codon preference, intergenic distance, Species specific HMMs

84 Ab-initio methods Glimmer (HMM, used at TIGR) Prodigal (Prokaryotic Dynamic Programming Genefinding Algorithm) GeneMarkHMM (HMM, used for Haemophilus influenzae) EasyGene (HMM, with species specific HMMs) Med (Sequence entropy estimations) Most of the gene predictions are similar despite of the approach The biggest differences are on the start codon position Errors in gene annotation can be propagated to other new genomes Combination of various methods can be used for manual curation

85 Prodigal: dynamic programming score

86 Prodigal: other parameters Many corrections have to be made to maximize the predictions

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Indicizzazione terza parte e modello booleano

Indicizzazione terza parte e modello booleano Reperimento dell informazione (IR) - aa 2014-2015 Indicizzazione terza parte e modello booleano Gruppo di ricerca su Sistemi di Gestione delle Informazioni (IMS) Dipartimento di Ingegneria dell Informazione

Dettagli

Gi-Gi Art. 859 - User's Guide Istruzioni d'uso

Gi-Gi Art. 859 - User's Guide Istruzioni d'uso doc.4.12-06/03 Gi-Gi Art. 859 - User's Guide Istruzioni d'uso A belaying plate that can be used in many different conditions Una piastrina d'assicurazione che può essere utilizzata in condizioni diverse.

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Lezione 12: La visione robotica

Lezione 12: La visione robotica Robotica Robot Industriali e di Servizio Lezione 12: La visione robotica L'acquisizione dell'immagine L acquisizione dell immagine Sensori a tubo elettronico (Image-Orthicon, Plumbicon, Vidicon, ecc.)

Dettagli

Sistemi Operativi. Interfaccia del File System FILE SYSTEM : INTERFACCIA. Concetto di File. Metodi di Accesso. Struttura delle Directory

Sistemi Operativi. Interfaccia del File System FILE SYSTEM : INTERFACCIA. Concetto di File. Metodi di Accesso. Struttura delle Directory FILE SYSTEM : INTERFACCIA 8.1 Interfaccia del File System Concetto di File Metodi di Accesso Struttura delle Directory Montaggio del File System Condivisione di File Protezione 8.2 Concetto di File File

Dettagli

Minimizzazione di Reti Logiche Combinatorie Multi-livello

Minimizzazione di Reti Logiche Combinatorie Multi-livello Minimizzazione di Reti Logiche Combinatorie Multi-livello Maurizio Palesi Maurizio Palesi 1 Introduzione Obiettivo della sintesi logica: ottimizzazione delle cifre di merito area e prestazioni Prestazioni:

Dettagli

Zeroshell come client OpenVPN

Zeroshell come client OpenVPN Zeroshell come client OpenVPN (di un server OpenVpn Linux) Le funzionalità di stabilire connessioni VPN di Zeroshell vede come scenario solito Zeroshell sia come client sia come server e per scelta architetturale,

Dettagli

DDS elettronica srl si riserva il diritto di apportare modifiche senza preavviso /we reserves the right to make changes without notice

DDS elettronica srl si riserva il diritto di apportare modifiche senza preavviso /we reserves the right to make changes without notice Maccarone Maccarone Maccarone integra 10 LED POWER TOP alta efficienza, in tecnologia FULL COLOR che permette di raggiungere colori e sfumature ad alta definizione. Ogni singolo led full color di Maccarone

Dettagli

Mod. VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES

Mod. VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES Mod VS/AM VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES VALVOLE DI SFIORO E SICUREZZA RELIEF VALVES AND SAFETY DEVICES Mod VS/AM 65 1 2 VS/AM 65 STANDARD VS/AM 65 CON RACCORDI VS/AM 65

Dettagli

e-spare Parts User Manual Peg Perego Service Site Peg Perego [Dicembre 2011]

e-spare Parts User Manual Peg Perego Service Site Peg Perego [Dicembre 2011] Peg Perego Service Site Peg Perego [Dicembre 2011] 2 Esegui il login: ecco la nuova Home page per il portale servizi. Log in: welcome to the new Peg Perego Service site. Scegli il servizio selezionando

Dettagli

group HIGH CURRENT MULTIPLEX NODE

group HIGH CURRENT MULTIPLEX NODE HIGH CURRENT MULTIPLEX NODE edizione/edition 04-2010 HIGH CURRENT MULTIPLEX NODE DESCRIZIONE GENERALE GENERAL DESCRIPTION L'unità di controllo COBO è una centralina elettronica Multiplex Slave ; la sua

Dettagli

The Directed Closure Process in Hybrid Social-Information Networks

The Directed Closure Process in Hybrid Social-Information Networks The Directed Closure Process in Hybrid Social-Information Networks with an Analysis of Link Formation on Twitter Dario Nardi Seminario Sistemi Complessi 15 Aprile 2014 Dario Nardi (CAS) 15/4/14 1 / 20

Dettagli

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM ALLEGATO 2 FULL PROJECT FORM FORM 1 FORM 1 General information about the project PROJECT SCIENTIFIC COORDINATOR TITLE OF THE PROJECT (max 90 characters) TOTAL BUDGET OF THE PROJECT FUNDING REQUIRED TO

Dettagli

Il test valuta la capacità di pensare?

Il test valuta la capacità di pensare? Il test valuta la capacità di pensare? Per favore compili il seguente questionario senza farsi aiutare da altri. Cognome e Nome Data di Nascita / / Quanti anni scolastici ha frequentato? Maschio Femmina

Dettagli

Teoria della misurazione e misurabilità di grandezze non fisiche

Teoria della misurazione e misurabilità di grandezze non fisiche Teoria della misurazione e misurabilità di grandezze non fisiche Versione 12.6.05 Teoria della misurazione e misurabilità di grandezze non fisiche 1 Il contesto del discorso (dalla lezione introduttiva)

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Esame di Ricerca Operativa del 18/12/12. Esercizio 1. Completare la seguente tabella considerando il problema di programmazione lineare:

Esame di Ricerca Operativa del 18/12/12. Esercizio 1. Completare la seguente tabella considerando il problema di programmazione lineare: Esame di Ricerca Operativa del 8// (Cognome) (Nome) (Corso di laurea) Esercizio. Completare la seguente tabella considerando il problema di programmazione lineare: max x x x x x x x + x x x + x 8 x Base

Dettagli

Ricerca non informata in uno spazio di stati

Ricerca non informata in uno spazio di stati Università di Bergamo Facoltà di Ingegneria Intelligenza Artificiale Paolo Salvaneschi A5_2 V2.4 Ricerca non informata in uno spazio di stati Il contenuto del documento è liberamente utilizzabile dagli

Dettagli

24V DC ±10% 0.5... 1 W. Fluido Fluid. 15 Nl/min

24V DC ±10% 0.5... 1 W. Fluido Fluid. 15 Nl/min elettropiloti 0 mm 0 mm solenoids Elettropilota Solenoid valve 0 mm 00.44.0 ACCESSORI - ACCESSORIES 07.049.0 Connettore per elettropilota 0 mm con cavetto rosso/nero, lunghezza 400 mm - connector for 0

Dettagli

Informazioni su questo libro

Informazioni su questo libro Informazioni su questo libro Si tratta della copia digitale di un libro che per generazioni è stato conservata negli scaffali di una biblioteca prima di essere digitalizzato da Google nell ambito del progetto

Dettagli

Reti di Telecomunicazione Lezione 7

Reti di Telecomunicazione Lezione 7 Reti di Telecomunicazione Lezione 7 Marco Benini Corso di Laurea in Informatica marco.benini@uninsubria.it Il protocollo Programma della lezione file transfer protocol descrizione architetturale descrizione

Dettagli

Guida ai Parametri di negoziazione dei mercati regolamentati organizzati e gestiti da Borsa Italiana

Guida ai Parametri di negoziazione dei mercati regolamentati organizzati e gestiti da Borsa Italiana Guida ai Parametri di negoziazione dei mercati regolamentati organizzati e gestiti da Borsa Italiana Versione 04 1/28 INTRODUZIONE La Guida ai Parametri contiene la disciplina relativa ai limiti di variazione

Dettagli

tmt 15 Rimozione ecologica di metalli pesanti da acque reflue

tmt 15 Rimozione ecologica di metalli pesanti da acque reflue tmt 15 Rimozione ecologica di metalli pesanti da acque reflue Rimozione ecologica di metalli pesanti da acque reflue Il problema: metalli pesanti nelle acque reflue In numerosi settori ed applicazioni

Dettagli

Esame di Ricerca Operativa del 20/12/13. Esercizio 1. Completare la seguente tabella considerando il problema di programmazione lineare:

Esame di Ricerca Operativa del 20/12/13. Esercizio 1. Completare la seguente tabella considerando il problema di programmazione lineare: Esame di Ricerca Operativa del 0// (Cognome) (Nome) (Corso di laurea) Esercizio. Completare la seguente tabella considerando il problema di programmazione lineare: max x x x + x x +x x x x x x x 0 x x

Dettagli

2 Formulazione dello shortest path come problema di flusso

2 Formulazione dello shortest path come problema di flusso Strumenti della Teoria dei Giochi per l Informatica A.A. 2009/10 Lecture 20: 28 Maggio 2010 Cycle Monotonicity Docente: Vincenzo Auletta Note redatte da: Annibale Panichella Abstract In questa lezione

Dettagli

MODBUS-RTU per. Specifiche protocollo di comunicazione MODBUS-RTU per controllo in rete dispositivi serie. Expert NANO 2ZN

MODBUS-RTU per. Specifiche protocollo di comunicazione MODBUS-RTU per controllo in rete dispositivi serie. Expert NANO 2ZN per Expert NANO 2ZN Specifiche protocollo di comunicazione MODBUS-RTU per controllo in rete dispositivi serie Expert NANO 2ZN Nome documento: MODBUS-RTU_NANO_2ZN_01-12_ITA Software installato: NANO_2ZN.hex

Dettagli

Lavorazione artigianale Italiana Handmade in Italy. da noi ogni sapone è unico. Authentically Made in Italy Florence

Lavorazione artigianale Italiana Handmade in Italy. da noi ogni sapone è unico. Authentically Made in Italy Florence Lavorazione artigianale Italiana Handmade in Italy da noi ogni sapone è unico alveare soap gori 1919 soap factory lavorazione artigianale italiana Handmade in Italy I nostri saponi sono il frutto di un

Dettagli

5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak

5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak Tipo: Type: 5 cabine (1 main deck+ 4 lower deck) 5 cabins (1 main deck+ 4 lower deck) Legno: essenza di rovere naturale Rigatino Wood: striped oak Tessuti: Dedar Fanfara, Paola Lenti Fabrics: Dedar Fanfara,

Dettagli

Alberi binari. Ilaria Castelli castelli@dii.unisi.it A.A. 2009/2010. Università degli Studi di Siena Dipartimento di Ingegneria dell Informazione

Alberi binari. Ilaria Castelli castelli@dii.unisi.it A.A. 2009/2010. Università degli Studi di Siena Dipartimento di Ingegneria dell Informazione Alberi binari Ilaria Castelli castelli@dii.unisi.it Università degli Studi di Siena Dipartimento di Ingegneria dell Informazione A.A. 2009/2010 I. Castelli Alberi binari, A.A. 2009/2010 1/20 Alberi binari

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Rappresentazione dei numeri in un calcolatore

Rappresentazione dei numeri in un calcolatore Corso di Calcolatori Elettronici I A.A. 2010-2011 Rappresentazione dei numeri in un calcolatore Lezione 2 Università degli Studi di Napoli Federico II Facoltà di Ingegneria Rappresentazione dei numeri

Dettagli

IL PROBLEMA DELLO SHORTEST SPANNING TREE

IL PROBLEMA DELLO SHORTEST SPANNING TREE IL PROBLEMA DELLO SHORTEST SPANNING TREE n. 1 - Formulazione del problema Consideriamo il seguente problema: Abbiamo un certo numero di città a cui deve essere fornito un servizio, quale può essere l energia

Dettagli

MODULO DI ISCRIZIONE - ENROLMENT FORM

MODULO DI ISCRIZIONE - ENROLMENT FORM Under the Patronage of Comune di Portofino Regione Liguria 1ST INTERNATIONAL OPERA SINGING COMPETITION OF PORTOFINO from 27th to 31st July 2015 MODULO DI ISCRIZIONE - ENROLMENT FORM Direzione artistica

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

1. SIMPLE PRESENT. Il Simple Present viene anche detto presente abituale in quanto l azione viene compiuta abitualmente.

1. SIMPLE PRESENT. Il Simple Present viene anche detto presente abituale in quanto l azione viene compiuta abitualmente. 1. SIMPLE PRESENT 1. Quando si usa? Il Simple Present viene anche detto presente abituale in quanto l azione viene compiuta abitualmente. Quanto abitualmente? Questo ci viene spesso detto dalla presenza

Dettagli

Massimo Paolucci (paolucci@dist.unige.it) DIST Università di Genova. Metodi per supportare le decisioni relative alla gestione di progetti

Massimo Paolucci (paolucci@dist.unige.it) DIST Università di Genova. Metodi per supportare le decisioni relative alla gestione di progetti Project Management Massimo Paolucci (paolucci@dist.unige.it) DIST Università di Genova Project Management 2 Metodi per supportare le decisioni relative alla gestione di progetti esempi sono progetti nell

Dettagli

Castello di San Donato in Perano Matrimoni nel Chianti Weddings in Chianti

Castello di San Donato in Perano Matrimoni nel Chianti Weddings in Chianti Castello di San Donato in Perano Matrimoni nel Chianti Weddings in Chianti Sede di Rappresentanza: Castello di San Donato in Perano 53013 Gaiole in Chianti (Si) Tel. 0577-744121 Fax 0577-745024 www.castellosandonato.it

Dettagli

Come si prepara una presentazione

Come si prepara una presentazione Analisi Critica della Letteratura Scientifica 1 Come si prepara una presentazione Perché? 2 Esperienza: Si vedono spesso presentazioni di scarsa qualità Evidenza: Un lavoro ottimo, presentato in modo pessimo,

Dettagli

Principali prove meccaniche su materiali polimerici

Principali prove meccaniche su materiali polimerici modulo: Proprietà viscoelastiche e proprietà meccaniche dei polimeri Principali prove meccaniche su materiali polimerici R. Pantani Scheda tecnica di un materiale polimerico Standard per prove meccaniche

Dettagli

UN BUON VIAGGIO INIZIA PRIMA DI PARTIRE 3 SERVIZI ALITALIA. SEMPRE DI PIÙ, PER TE.

UN BUON VIAGGIO INIZIA PRIMA DI PARTIRE 3 SERVIZI ALITALIA. SEMPRE DI PIÙ, PER TE. UN BUON VIAGGIO INIZIA PRIMA DI PARTIR 3 RVIZI ALITALIA. MPR DI PIÙ, PR T. FAT TRACK. DDICATO A CHI NON AMA PRDR TMPO. La pazienza è una grande virtù. Ma è anche vero che ogni minuto è prezioso. Per questo

Dettagli

Routing (instradamento) in Internet. Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi:

Routing (instradamento) in Internet. Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi: Routing (instradamento) in Internet Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi: Stub AS: istituzione piccola Multihomed AS: grande istituzione (nessun ( transito Transit AS: provider

Dettagli

Seconda Prova di Ricerca Operativa. Cognome Nome Numero Matricola A 1/12 A 2/12

Seconda Prova di Ricerca Operativa. Cognome Nome Numero Matricola A 1/12 A 2/12 A / A / Seconda Prova di Ricerca Operativa Cognome Nome Numero Matricola Nota: LA RISOLUZIONE CORRETTA DEGLI ESERCIZI CONTRADDISTINTI DA UN ASTERISCO È CONDIZIONE NECESSARIA PER IL RAGGIUNGIMENTO DELLA

Dettagli

La valutazione degli effetti dei Programmi: il progetto PQM e altre indagini sui dati acquisiti

La valutazione degli effetti dei Programmi: il progetto PQM e altre indagini sui dati acquisiti Seminario Valutazione PON Roma, 29 marzo 2012 La valutazione degli effetti dei Programmi: il progetto PQM e altre indagini sui dati acquisiti Elena Meroni - Università di Padova e INVALSI Daniele Vidoni

Dettagli

T H O R A F L Y. Sistemi di drenaggio toracico Thoracic drainage systems. Catalogo 2009 - Catalogue 2009 GRUPPO C GROUP C

T H O R A F L Y. Sistemi di drenaggio toracico Thoracic drainage systems. Catalogo 2009 - Catalogue 2009 GRUPPO C GROUP C T H O R A F L Y Sistemi di drenaggio toracico Thoracic drainage systems Catalogo 2009 - Catalogue 2009 GRUPPO C GROUP C SOMMARIO GRUPPO C (SUMMARY C GROUP) 1/C II SISTEMI DI DRENAGGIO TORACICO COMPLETI

Dettagli

Introduzione agli algoritmi e alla programmazione in VisualBasic.Net

Introduzione agli algoritmi e alla programmazione in VisualBasic.Net Lezione 1 Introduzione agli algoritmi e alla programmazione in VisualBasic.Net Definizione di utente e di programmatore L utente è qualsiasi persona che usa il computer anche se non è in grado di programmarlo

Dettagli

L identificazione e la denominazione delle sostanze chimiche in ambito REACH

L identificazione e la denominazione delle sostanze chimiche in ambito REACH I DETERGENTI: COME CONIUGARE PRESTAZIONI ELEVATE E RISPETTO PER L AMBIENTE L identificazione e la denominazione delle sostanze chimiche in ambito REACH Resana, 5 ottobre 2007 FEDERICA CECCARELLI Ist. Sup.

Dettagli

Quando A e B coincidono una coppia ordinata é determinata anche dalla loro posizione.

Quando A e B coincidono una coppia ordinata é determinata anche dalla loro posizione. Grafi ed Alberi Pag. /26 Grafi ed Alberi In questo capitolo richiameremo i principali concetti di due ADT che ricorreranno puntualmente nel corso della nostra trattazione: i grafi e gli alberi. Naturale

Dettagli

Il vostro sogno diventa realtà... Your dream comes true... Close to Volterra,portions for sale of "typical tuscan"

Il vostro sogno diventa realtà... Your dream comes true... Close to Volterra,portions for sale of typical tuscan Il vostro sogno diventa realtà... Vicinanze di Volterra vendita di porzione di fabbricato "tipico Toscano" realizzate da recupero di casolare in bellissima posizione panoramica. Your dream comes true...

Dettagli

Smobilizzo pro-soluto di Lettere di Credito Import

Smobilizzo pro-soluto di Lettere di Credito Import definizione L operazione presuppone l emissione di una lettera di credito IMPORT in favore dell esportatore estero, con termine di pagamento differito (es. 180 gg dalla data di spedizione con documenti

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

CALDO SGUARDO GRECO PDF

CALDO SGUARDO GRECO PDF CALDO SGUARDO GRECO PDF ==> Download: CALDO SGUARDO GRECO PDF CALDO SGUARDO GRECO PDF - Are you searching for Caldo Sguardo Greco Books? Now, you will be happy that at this time Caldo Sguardo Greco PDF

Dettagli

Modello OSI e architettura TCP/IP

Modello OSI e architettura TCP/IP Modello OSI e architettura TCP/IP Differenza tra modello e architettura - Modello: è puramente teorico, definisce relazioni e caratteristiche dei livelli ma non i protocolli effettivi - Architettura: è

Dettagli

C è solo un acca tra pi e phi ing. Rosario Turco, prof. Maria Colonnese

C è solo un acca tra pi e phi ing. Rosario Turco, prof. Maria Colonnese C è solo un acca tra pi e phi ing. Rosario Turco, prof. Maria Colonnese Introduzione Nell articolo vengono mostrate vari possibili legami tra la costante di Archimede (pi greco) e la sezione aurea (phi).

Dettagli

Efficacia dei probio-ci nelle mala1e diges-ve

Efficacia dei probio-ci nelle mala1e diges-ve Efficacia dei probio-ci nelle mala1e diges-ve Le aree di incertezza nelle Cure Primarie: Quali sono le evidenze di efficacia dei probio-ci nelle patologie del tra9o gastrointes-nale? Edoardo Benede*o 1907

Dettagli

Elementi di Statistica

Elementi di Statistica Elementi di Statistica Contenuti Contenuti di Statistica nel corso di Data Base Elementi di statistica descrittiva: media, moda, mediana, indici di dispersione Introduzione alle variabili casuali e alle

Dettagli

Catalogo Trattamento dell Aria - Collezione 2009

Catalogo Trattamento dell Aria - Collezione 2009 Catalogo Trattamento dell Aria - Collezione 2009 SECCOTECH & S 8 SeccoTech & Secco Tecnologia al servizio della deumidificazione Technology at dehumidification's service Potenti ed armoniosi Seccotech

Dettagli

Correnti e circuiti a corrente continua. La corrente elettrica

Correnti e circuiti a corrente continua. La corrente elettrica Correnti e circuiti a corrente continua La corrente elettrica Corrente elettrica: carica che fluisce attraverso la sezione di un conduttore in una unità di tempo Q t Q lim t 0 t ntensità di corrente media

Dettagli

Test di comunicazione tra due LOGO! 0BA7: Master - Master

Test di comunicazione tra due LOGO! 0BA7: Master - Master Industry Test di comunicazione tra due LOGO! 0BA7: Master - Master Dispositivi utilizzati: - 2 LOGO! 0BA7 (6ED1 052-1MD00-0AB7) - Scalance X-208 LOGO! 0BA7 Client IP: 192.168.0.1 LOGO! 0BA7 Server IP:

Dettagli

Virtualizzazione con Microsoft Tecnologie e Licensing

Virtualizzazione con Microsoft Tecnologie e Licensing Microsoft Virtualizzazione con Microsoft Tecnologie e Licensing Profile Redirezione dei documenti Offline files Server Presentation Management Desktop Windows Vista Enterprise Centralized Desktop Application

Dettagli

Analisi di massima: L utente dovrà inserire un numero limite, e tramite vari calcoli verrà stampato a video la sequenza.

Analisi di massima: L utente dovrà inserire un numero limite, e tramite vari calcoli verrà stampato a video la sequenza. Relazione tecnica Fibonacci ANDENA GIANMARCO Traccia: Creare un algoritmo che permetta, dato un valore intero e positivo, di stabilire la sequenza utilizzando la regola di fibonacci dei numeri fino al

Dettagli

RAPPRESENTAZIONE BINARIA DEI NUMERI. Andrea Bobbio Anno Accademico 1996-1997

RAPPRESENTAZIONE BINARIA DEI NUMERI. Andrea Bobbio Anno Accademico 1996-1997 1 RAPPRESENTAZIONE BINARIA DEI NUMERI Andrea Bobbio Anno Accademico 1996-1997 Numeri Binari 2 Sistemi di Numerazione Il valore di un numero può essere espresso con diverse rappresentazioni. non posizionali:

Dettagli

ALLEGATO N. 2 STANDARD TECNICI DELL ARCHIVIO UNICO INFORMATICO

ALLEGATO N. 2 STANDARD TECNICI DELL ARCHIVIO UNICO INFORMATICO ALLEGATO N. 2 STANDARD TECNICI DELL ARCHIVIO UNICO INFORMATICO 1 INDICE 1) ASPETTI GENERALI 2) CONTENUTO DELL ARCHIVIO UNICO INFORMATICO 2.1) OPERAZIONI 2.2) RAPPORTI 2.3) LEGAMI TRA SOGGETTI 3) CRITERI

Dettagli

Parte 2. Determinante e matrice inversa

Parte 2. Determinante e matrice inversa Parte. Determinante e matrice inversa A. Savo Appunti del Corso di Geometria 013-14 Indice delle sezioni 1 Determinante di una matrice, 1 Teorema di Cramer (caso particolare), 3 3 Determinante di una matrice

Dettagli

Un ripasso di aritmetica: Conversione dalla base 10 alla base 16

Un ripasso di aritmetica: Conversione dalla base 10 alla base 16 Un ripasso di aritmetica: Conversione dalla base 1 alla base 16 Dato un numero N rappresentato in base dieci, la sua rappresentazione in base sedici sarà del tipo: c m c m-1... c 1 c (le c i sono cifre

Dettagli

/*dichiarazioni*/ // le frasi sono contenute in stringhe, cioè array di char char f1[max]; int i, giusto,len;

/*dichiarazioni*/ // le frasi sono contenute in stringhe, cioè array di char char f1[max]; int i, giusto,len; /* Date in ingresso una frase, dire se una è palindroma */ #include #define MAX 100 int main() /*dichiarazioni*/ // le frasi sono contenute in stringhe, cioè array di char char f1[max]; int i,

Dettagli

Acustica con una Bic e uno smartphone

Acustica con una Bic e uno smartphone 1 Acustica con una Bic e uno smartphone L. Galante #, 1, A. M. Lombardi*, 2 # LSS G. Bruno, Torino, Italy. * ITCS Primo Levi, Bollate (MI), Italy. Abstract. A smartphone, with its integrated sensors and

Dettagli

Principal Component Analysis

Principal Component Analysis Principal Component Analysis Alessandro Rezzani Abstract L articolo descrive una delle tecniche di riduzione della dimensionalità del data set: il metodo dell analisi delle componenti principali (Principal

Dettagli

Pila.h versione 6. class Pila { private: int marker; int * contenuto; public:

Pila.h versione 6. class Pila { private: int marker; int * contenuto; public: 1 Pila.h versione 6 struct Pila { private: int size; int defaultgrowthsize; int marker; int * contenuto; void cresci(int increment); public: Pila(int initialsize) ; Pila(); ~Pila() ; void copy(pila * to)

Dettagli

il materiale e Le forme evocano direttamente il corpo celeste, lo riproducono in ogni venatura. Proprio come avere una piccola luna tutta per sé.

il materiale e Le forme evocano direttamente il corpo celeste, lo riproducono in ogni venatura. Proprio come avere una piccola luna tutta per sé. il materiale e Le forme evocano direttamente il corpo celeste, lo riproducono in ogni venatura. Proprio come avere una piccola luna tutta per sé. COLLECTION luna material and shapes evoke the celestial

Dettagli

Appunti sull uso di matlab - I

Appunti sull uso di matlab - I Appunti sull uso di matlab - I. Inizializazione di vettori.. Inizializazione di matrici.. Usare gli indici per richiamare gli elementi di un vettore o una matrice.. Richiedere le dimensioni di una matrice

Dettagli

Cos'é Code::Blocks? Come Creare un progetto Come eseguire un programma Risoluzione problemi istallazione Code::Blocks Che cos è il Debug e come si usa

Cos'é Code::Blocks? Come Creare un progetto Come eseguire un programma Risoluzione problemi istallazione Code::Blocks Che cos è il Debug e come si usa di Ilaria Lorenzo e Alessandra Palma Cos'é Code::Blocks? Come Creare un progetto Come eseguire un programma Risoluzione problemi istallazione Code::Blocks Che cos è il Debug e come si usa Code::Blocks

Dettagli

PROBABILITA, VALORE ATTESO E VARIANZA DELLE QUANTITÁ ALEATORIE E LORO RELAZIONE CON I DATI OSSERVATI

PROBABILITA, VALORE ATTESO E VARIANZA DELLE QUANTITÁ ALEATORIE E LORO RELAZIONE CON I DATI OSSERVATI statistica, Università Cattaneo-Liuc, AA 006-007, lezione del 08.05.07 IDICE (lezione 08.05.07 PROBABILITA, VALORE ATTESO E VARIAZA DELLE QUATITÁ ALEATORIE E LORO RELAZIOE CO I DATI OSSERVATI 3.1 Valore

Dettagli

INSTALLAZIONE E UTILIZZO DEL COMPILATORE Code::Blocks 8.02

INSTALLAZIONE E UTILIZZO DEL COMPILATORE Code::Blocks 8.02 INSTALLAZIONE E UTILIZZO DEL COMPILATORE Code::Blocks 8.02 Download Si può scaricare gratuitamente la versione per il proprio sistema operativo (Windows, MacOS, Linux) dal sito: http://www.codeblocks.org

Dettagli

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.

Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx. Qual è l errore più comune tra i Trader sul Forex e come possiamo evitarlo? David Rodriguez, Quantitative Strategist drodriguez@dailyfx.com Avvertenza di Rischio: Il Margin Trading su forex e/o CFD comporta

Dettagli

Lezione 20: Strutture di controllo di robot. avanzati

Lezione 20: Strutture di controllo di robot. avanzati Robotica Mobile Lezione 20: Strutture di controllo di robot Come costruire un architettura BARCS L architettura BARCS Behavioural Architecture Robot Control System Strategie Strategie Obiettivi Obiettivi

Dettagli

Ricerca Operativa Branch-and-Bound per problemi di Programmazione Lineare Intera

Ricerca Operativa Branch-and-Bound per problemi di Programmazione Lineare Intera Ricerca Operativa Branch-and-Bound per problemi di Programmazione Lineare Intera L. De Giovanni AVVERTENZA: le note presentate di seguito non hanno alcuna pretesa di completezza, né hanno lo scopo di sostituirsi

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07.

Istruzione N. Versione. Ultima. modifica. Funzione. Data 18/12/2009. Firma. Approvato da: ASSEMBLAGGIO COLLAUDO TRAINING IMBALLO. service 07. Istruzione N 62 Data creazione 18/ 12/2009 Versione N 00 Ultima modifica TIPO ISTRUZIONE ASSEMBLAGGIO COLLAUDO TRAINING MODIFICA TEST FUNZIONALE RIPARAZIONE/SOSTITUZIONE IMBALLO TITOLO DELL ISTRUZIONE

Dettagli

Introduzione ad Access

Introduzione ad Access Introduzione ad Access Luca Bortolussi Dipartimento di Matematica e Informatica Università degli studi di Trieste Access E un programma di gestione di database (DBMS) Access offre: un supporto transazionale

Dettagli

DEFT Zero Guida Rapida

DEFT Zero Guida Rapida DEFT Zero Guida Rapida Indice Indice... 1 Premessa... 1 Modalità di avvio... 1 1) GUI mode, RAM preload... 2 2) GUI mode... 2 3) Text mode... 2 Modalità di mount dei dispositivi... 3 Mount di dispositivi

Dettagli

La corrente elettrica

La corrente elettrica PROGRAMMA OPERATIVO NAZIONALE Fondo Sociale Europeo "Competenze per lo Sviluppo" Obiettivo C-Azione C1: Dall esperienza alla legge: la Fisica in Laboratorio La corrente elettrica Sommario 1) Corrente elettrica

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

LA DIFFERENZA È NECTA

LA DIFFERENZA È NECTA LA DIFFERENZA È NECTA SOLUZIONI BREVETTATE PER UNA BEVANDA PERFETTA Gruppo Caffè Z4000 in versione singolo o doppio espresso Tecnologia Sigma per bevande fresh brew Dispositivo Dual Cup per scegliere il

Dettagli

Come si indica un punto? Un punto si indica (distingue) con una lettera maiuscola dell alfabeto italiano.

Come si indica un punto? Un punto si indica (distingue) con una lettera maiuscola dell alfabeto italiano. Il punto Il punto è un elemento geometrico fondamentale privo di dimensioni ed occupa solo una posizione. Come si indica un punto? Un punto si indica (distingue) con una lettera maiuscola dell alfabeto

Dettagli

+ / operatori di confronto (espressioni logiche/predicati) / + 5 3 9 = > < Pseudo codice. Pseudo codice

+ / operatori di confronto (espressioni logiche/predicati) / + 5 3 9 = > < Pseudo codice. Pseudo codice Pseudo codice Pseudo codice Paolo Bison Fondamenti di Informatica A.A. 2006/07 Università di Padova linguaggio testuale mix di linguaggio naturale ed elementi linguistici con sintassi ben definita e semantica

Dettagli

APPLICATION FORM 1. YOUR MOTIVATION/ LA TUA MOTIVAZIONE

APPLICATION FORM 1. YOUR MOTIVATION/ LA TUA MOTIVAZIONE APPLICATION FORM Thank you for your interest in our project. We would like to understand better your motivation in taking part in this specific project. So please, read carefully the form, answer the questions

Dettagli

CAPITOLO PRIMO IL CONCETTO DI ALGORITMO 1

CAPITOLO PRIMO IL CONCETTO DI ALGORITMO 1 1.1 Che cos è un algoritmo CAPITOLO PRIMO IL CONCETTO DI ALGORITMO 1 Gli algoritmi sono metodi per la soluzione di problemi. Possiamo caratterizzare un problema mediante i dati di cui si dispone all inizio

Dettagli

Oncologici: Iniziative e sostenibilità della Regione. Valeria Fadda Unità di HTA di ESTAV centro, Regione Toscana

Oncologici: Iniziative e sostenibilità della Regione. Valeria Fadda Unità di HTA di ESTAV centro, Regione Toscana Oncologici: Iniziative e sostenibilità della Regione Valeria Fadda Unità di HTA di ESTAV centro, Regione Toscana 2.760.000.000 Euro 14.4% della spesa farmaceutica 32.8% della spesa farmaceutica ospedaliera

Dettagli

BPEL: Business Process Execution Language

BPEL: Business Process Execution Language Ingegneria dei processi aziendali BPEL: Business Process Execution Language Ghilardi Dario 753708 Manenti Andrea 755454 Docente: Prof. Ernesto Damiani BPEL - definizione Business Process Execution Language

Dettagli

Conjugate: prendere ammirare camminare entrare visitare sedersi divertirsi

Conjugate: prendere ammirare camminare entrare visitare sedersi divertirsi The IMPERFECT is used to express an action that took place in the past but whose duration cannot be specified. Its endings are identical in all three conjugations. io tu lui/lei noi voi loro -vo -vi -va

Dettagli

Esercizio 1 Soluzione Esercizio 2 Soluzione

Esercizio 1 Soluzione Esercizio 2 Soluzione Esercizio 1 Si specifichi, mediante una formula del prim ordine un apparato che funziona nel modo seguente: All istante 0 esso emette un segnale s, che può essere uno 0 o un 1. Se, dopo l emissione di

Dettagli

FUNZIONI AVANZATE DI EXCEL

FUNZIONI AVANZATE DI EXCEL FUNZIONI AVANZATE DI EXCEL Inserire una funzione dalla barra dei menu Clicca sulla scheda "Formule" e clicca su "Fx" (Inserisci Funzione). Dalla finestra di dialogo "Inserisci Funzione" clicca sulla categoria

Dettagli

Editoriale VALUTAZIONE PER L E.C.M.: ANALISI DEI QUESTIONARI DI GRADIMENTO

Editoriale VALUTAZIONE PER L E.C.M.: ANALISI DEI QUESTIONARI DI GRADIMENTO Lo Spallanzani (2007) 21: 5-10 C. Beggi e Al. Editoriale VALUTAZIONE PER L E.C.M.: ANALISI DEI QUESTIONARI DI GRADIMENTO IL GRADIMENTO DEI DISCENTI, INDICATORE DI SODDISFAZIONE DELLE ATTIVITÀ FORMATIVE

Dettagli

COMINCIAMO A SENTIRCI UNA FAMIGLIA

COMINCIAMO A SENTIRCI UNA FAMIGLIA COMINCIAMO A SENTIRCI UNA FAMIGLIA IL PRIMO GIORNO CON LA FAMIGLIA OSPITANTE FIRST DAY WITH THE HOST FAMILY Questa serie di domande, a cui gli studenti risponderanno insieme alle loro famiglie, vuole aiutare

Dettagli

INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam.

INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 DHCP Dynamic Host Configuration Protocol Fausto Marcantoni fausto.marcantoni@unicam. Laurea in INFORMATICA INTERNET e RETI di CALCOLATORI A.A. 2014/2015 Capitolo 4 Dynamic Host Configuration Protocol fausto.marcantoni@unicam.it Prima di iniziare... Gli indirizzi IP privati possono essere

Dettagli

User guide Conference phone Konftel 100

User guide Conference phone Konftel 100 User guide Conference phone Konftel 100 Dansk I Deutsch I English I Español I Français I Norsk Suomi I Svenska Conference phones for every situation Sommario Descrizione Connessioni, accessoires, ricambi

Dettagli