Applicazioni biotecnologiche in systems biology

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Applicazioni biotecnologiche in systems biology"

Transcript

1 Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013

2 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013

3 NGS: Next Generation Sequencing MacLean et al., 2009

4 Sequenziamento del genoma Genoma: intera sequenza nucleotidica di un organismo Sequenziamento: determinazione di una sequenza nucleotidica Le tecniche di sequenziamento Generazione 0 Sequenziamento chimico Generazione 1 Dye-terminator Generazione 2 NGS con pre-amplificazione Generazione 3 NGS su singola molecola NGS: Next Generation Sequencing

5 Le tecniche di sequenziamento Generazione 0 Sequenziamento chimico Generazione 1 Dye-terminator Generazione 2 NGS con pre-amplificazione Generazione 3 NGS su singola molecola Generazione 4???

6 Tutte le tecniche di sequenziamento portano alla produzione di molte sequenze corte ( bp) Il genoma batterico più corto è circa 1Mb (500 volte la reads più lunga) Un gene batterico è lungo in media 300 bp Necessario unire insieme le varie reads per ottenere un genoma Trimming, Assembling, Scaffolding

7 Controllo qualità Il trimmaggio delle reads

8 Qualità e Probabilità BASES A C T G ERROR 1% 0.1% 0.01% 0.001% QUALITY Base scartata Qualità generalmente accettata

9 Identificativo sequenza (ID) Il formato FASTA Sequenza (DNA, RNA o proteina) Formato file per immagazzinare sequenze biologiche Uno dei formati più semplici (contiene solo la sequenza e il suo nome ) Un file può contenere più di una sequenza Quando si incontra il carattere > all inizio di una riga parte una nuova sequenza

10 Identificativo sequenza (ID) E la qualità? Sequenza (DNA, RNA o proteina) Non c è modo di conoscere il valore di qualità delle singole basi Formato non adatto ai dati di sequenziamento grezzi Il formato FASTA viene usato per sequenze finite, la cui qualità è stata controllata

11 Il formato TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc

12 Il formato TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = 100

13 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

14 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

15 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

16 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità Esempio di codifica della qualità: b = 98 e = 101 g = 103 i = 105 h = 104 c = 99 a = 97 d = TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

17 Codifica della TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Precede l id univoco della sequenza «+» Separa la sequenza nucleotidica dalla qualità La qualità deve essere codificata con un unico carattere come la sequenza, In modo da evitare interpretazioni ambigue (e risparmiare TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC

18 Codifica della La qualità viene codificata usando i caratteri ASCII (lettere, numeri e simboli) Esiste una tabella per convertire ogni carattere ad un determinato valore di qualità Ogni produttore di macchinari di sequenziamento utilizza una propria tabella

19 Codifica della qualità Le varie ditte produttrici di macchine per il sequenziamento NGS, non hanno (ancora?) concordato uno standard comune di qualità Di fatto, ogni tipologia di reads deve essere trattata utilizzando parametri di conversione propri dello strumento che l ha generata SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS......XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

20 Controllo qualità Basi di scarsa qualità Analisi della qualità delle reads tramite il programma FastQC

21 Controllo qualità Basi di scarsa qualità

22 Trimming Eliminazione delle basi a bassa qualità Eliminazione totale delle reads troppo corte dopo la rimozione delle basi a bassa qualità

23 Esempio: Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C A Dr. Giovanni Bacci

24 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C A Q A - Cutoff > 0? NO La base viene rimossa e si ripete il test con la base precedente

25 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C Q C - Cutoff > 0? SI NO La base viene mantenuta e la finestra allargata La base viene rimossa e si ripete il test con la base precedente

26 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C (Q C Cutoff) + (Q C Cutoff) > 0? SI NO La base viene mantenuta e la finestra allargata Le basi vengono rimosse e si ripete il test con la base precedente

27 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A C C (Q C Cutoff) + (Q C Cutoff) > 0? SI NO La base viene mantenuta e la finestra allargata Le basi vengono rimosse e si ripete il test con la base precedente

28 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A (Q A - Cutoff) > 0? SI NO La base viene mantenuta e la finestra allargata La base viene rimossa e si ripete il test con la base precedente

29 Streaming-Trim algorithm A C T G A C C A G C T A G C T T G G A A C G T A G G C A G T T A A min max Σ min n=max(q n - Cutoff) > 0? SI NO La base viene mantenuta e la finestra allargata Le basi vengono rimosse e si ripete il test con la base precedente

30 Streaming-Trim algorithm Eliminazione delle basi a bassa qualità Eliminazione totale delle reads troppo corte dopo la rimozione delle basi a bassa qualità

31 Assemblaggio

32 Assemblaggio Assemblaggio: processo con il quale le singole reads vengono allineate e unite fra loro a formare una sequenza di lunghezza maggiore Nel migliore dei casi si ottiene la sequenza completa (senza gap) del genoma di interesse Nella maggior parte dei casi si ottengono una serie di sequenze di varia lunghezza chiamate contigs

33 Profondità del sequenziamento Read singola Genoma completo Il campione genomico viene frammentato (casualmente) ed amplificato Dato l alto numero di frammenti letti dal sequenziamento, statisticamente ogni parte del genoma viene letta più volte La profondità (o coverage) indica quante volte in media ogni base è stata letta durante il sequenziamento

34 1X 2X 3X 4X La profondità minima accettata è circa 30X (ogni base è stata letta almeno 30 volte) Le tecnologie NGS producono una quantità maggiore di reads: profondità > 100X

35 Assemblaggio L assemblaggio delle reads prevede la codifica delle reads (e delle relazioni reciproche) in un grafo (o network)

36 Assemblaggio Introduzione ai network

37 Introduzione ai grafi E possibile visitare tutti i quartieri attraversando i ponti esattamente una volta e tornando al punto di partenza? Concetto introdotto da Eulero nel 1735 Ogni quartiere è rappresentato da un nodo (o vertice), mentre ogni ponte è rappresentato da un arco

38 Introduzione ai grafi C A D Nodi: A, B, C, D Archi: (A,C) (A,C) (A,B) (A,B) (A,D) (C,D) (B,D) B

39 Introduzione ai grafi Grafo indiretto: Gli archi non hanno direzione Possono essere percorsi in entrambi i versi Grafo diretto (digrafo): Gli archi possiedono una direzione Archi orientati Un grafo indiretto può essere trasformato in un grafo diretto: ogni arco viene trasformato in due archi con direzioni opposte e medesimi vertici

40 Introduzione ai grafi Quartiere 1 Quartiere 4 100m 70m 60m 50m 50m Quartiere 3 100m 70m Quartiere 2 I nodi e gli archi possono possedere degli attributi, che ne definiscono delle proprietà Esempio: Nodi (nomi dei quartieri della città) Archi (lunghezza dei ponti)

41 Introduzione ai grafi Grado: 3 Grado: 5 Grado: 3 Grado: 3 Grado: Numero di archi incidenti su un vertice Indica il grado di connessione di un singolo vertice o dell intero grafo Grafo k-regolare: tutti i vertici hanno medesimo grado Nei network biologici il grado ha implicazioni importanti

42 Esempio: social network I vertici rappresentano le persone (attributi: nome, sesso, età) Gli archi rappresentano relazioni (ad es. amicizia) (attributi: numero di interazioni) Vertici ad alto grado rappresentano persone con molte amicizie

43 Introduzione ai grafi V3 V4 V0 V2 Vn V1 V5 Percorso: Serie di vertici V0 Vn e di archi (V0, V1) (Vn-1, Vn) Un cammino prevede che i due vertici agli estremi del percorso siano diversi

44 Introduzione ai grafi V2 V1 V3 V0 Vn V4 Ciclo: Percorso i cui vertici agli estremi coincidono

45 Introduzione ai grafi V2 V1 V3 V0 Vn V4 E possibile visitare tutti i quartieri attraversando i ponti esattamente una volta e tornando al punto di partenza? Ciclo: Percorso i cui vertici agli estremi coincidono

46 Assemblaggio Metodo Sanger e grafo de Bruijn

47 Assemblaggio Genome length: 10bp // Reads length: 7bp L assemblaggio delle reads prevede la codifica delle reads (e delle relazioni reciproche) in un grafo (o network) Per chiudere il genoma è necessario individuare un ciclo all interno del grafo

48 Assemblaggio Metodo Sanger Le reads vengono divise in frammenti più piccoli lunghi k (k-mers) I vertici rappresentano i k-mers Gli archi rappresentano gli allineamenti fra i k- mers L assemblaggio avviene cercando all interno del grafo un ciclo hamiltoniano Un ciclo in cui ogni vertice viene visitato al massimo una volta

49 Assemblaggio Metodo Sanger

50 Assemblaggio Metodo Sanger Metodo usato nei sequenziamenti Sanger Metodo computazionalmente costoso Tutti gli allineamenti fra i k-mers devono essere calcolati per costruire il grafo 10 6 reads = allineamenti 10 9 reads = allineamenti La ricerca del ciclo hamiltoniano è un algoritmo che richiede molto tempo Impossibile usare questo approccio per l NGS

51 Assemblaggio Metodo de Bruijn Le reads vengono divise in frammenti più piccoli lunghi k (k-mers) Gli archi rappresentano i k-mers I vertici rappresentano i prefissi e suffissi dei k-mers lunghi k-1 L assemblaggio avviene cercando all interno del grafo un ciclo euleriano Un ciclo in cui ogni arco viene visitato al massimo una volta

52 Assemblaggio Metodo de Bruijn

53 Assemblaggio Metodo de Bruijn Metodo meno costoso Il tempo di calcolo è circa proporzionale al numero di reads Non è necessario allineare fra loro i k- mers Tutti i moderni programmi di assemblaggio (assemblatori) sfruttano questo grafo Abyss, velvet, ray, SOAPdenovo,

54 Assemblaggio - Problemi Errori nel sequenziamento portano alla formazione di bolle nel grafo Difficile determinare quale ramo della bolla rappresenta l assemblaggio corretto

55 Assemblaggio - Problemi Sequenze duplicate portano a leggere più volte lo stesso k-mer Necessario aggiungere tanti archi quante sono le ripetizioni Stimare il numero di duplicazioni è difficile Le sequenze ripetute sono molto comuni nei genomi (es. trasposasi nei batteri)

56 Assemblaggio - Problemi Cromosomi multipli e cromosomi lineari Il genoma di interesse può contenere cromosomi multipli Bisogna trovare un ciclo euleriano per ogni cromosoma Difficile conoscere in anticipo il numero di cromosomi (o plasmidi) presenti in un genoma Scelta del miglior numero k I vari problemi di assemblaggio fanno sì che si ottengano contig (o contigui) K più grandi significano un minor numero di bolle e quindi contig più lunghi Maggior costo computazionale Inclusione di errori nella sequenza

57 Reads Contigs Genome Assemblaggio

58 Assemblaggio Controllo qualità

59 Assemblaggio Controllo qualità Parametri di controllo di un assemblaggio Numero di contig (basso è meglio) Lunghezza media dei contig (alta è meglio) Valore N50: lunghezza del contig oltre il quale se si usano contig di lunghezza maggiore si stanno considerando il 50% delle basi dell assemblaggio (alto è meglio) N80, N90, N70, ecc ecc Se il genoma chiuso è disponibile (o comunque un genoma molto vicino): Numero di misassemblies: Porzioni di contig invertiti o traslocati

60 Assemblaggio Controllo qualità

61 Assemblaggio Dal FASTQ al FASTA

62 Conservazione dati NGS Sanger sequencing Bassa quantità di dati prodotti Ridotto spazio per la conservazione sia delle reads che dei contig/genomi Genoma batterico in formato FASTA: 1Mb ogni milione di basi Un genoma di E.coli = 4/5 Mb Un genoma batterico in formato FASTQ: La dimensione dipende dal numero di reads Il formato FASTQ contiene almeno il doppio di informazioni rispetto al FASTA Per ogni base ho il valore della qualità

63 Conservazione dati TTACCGCGGCTGCTGGCACGGAGTTAGCCGGGGCTTCTTCTCCGGCTACCGTCATTATC + bbbeeeeegggggiiiiiiiihighiiiiiiiigggeeedeedacccccccacacdddc Esempio di sequenziamento NGS: Dimensione genoma (FASTA): 7Mb Reads in formato FASTQ: 2.4 GB

64 Scaffolding Dai contig ai supercontig

65 Scaffolding Reads Contigs Genome Se il genoma chiuso è disponibile (o comunque un genoma molto vicino): Possiamo stimare la posizione relativa dei contig ottenuti tramite un allineamento contro il genoma chiuso più vicino L avvento delle tecniche NGS ha fatto sì che ad oggi siano disponibili 2303 genomi batterici completi E molto probabile che per ogni nuovo sequenziamento sia disponibile un genome di riferimento vicino

66 Example: the CONTIGuator algorithm Allineamento al genoma di riferimento: BLAST Applicazione di una serie di cut-offs: Lunghezza minima di allineamento Contig coverage (%): per essere considerato mappato il contig deve avere una percentuale minima della sua lunghezza presente nell allineamento I contig mappati in più punti (trasposasi, IS) sono scartati

67 Example: the CONTIGuator algorithm Reference Contig // Scaffold Estrazione dell ordinamento relativo dei contigs: generazione di uno scaffold I buchi nello scaffold possono essere riempiti progettando delle reazioni di PCR fra i contig

68 Example: the CONTIGuator algorithm

69 Annotation From sequences to genes

70

71 Where are the genes?

72 Annotation or Gene calling

73

74 (Common) start codons: ATG, GTG, TTG Assuming that all the codons are equiprobable 5% of the codons are stop codons (3/64) ~ every 60bp we should encounter a stop codon BUT The average bacterial gene size is ~ 300bp Naive annotation method: Find all the DNA region starting with a start codon and long more than 60bp Open Reading Frames (ORFs)

75 Forward Reverse Problems: Each one of the 6 frames has to be considered Which frame should be considered in case of multiple ORFs?

76 Problems: Many start codons can be found inside an ORF Which one is the right one?

77 Other proof of the presence of an ORF: A ribosomal binding site (RBS) In case of an operon it may not be present Problems: Microbial genomes are dense Small intergenic regions ORFs can overlap each other

78 We assumed that all the codons are equiprobable BUT In bacterial genomes we have: different codon usages variable GC content * different intergenic distances ** Each genome has a particular codon frequency * High GC means lower stop codon frequency ** related to the species lifestyle

79 Eukaryotes are even more complicated: Lower gene frequency (more junk DNA) Presence of exons and introns

80 Annotation methods: Experimental: Through proteomics and transcriptomics Expensive and time-consuming Some genes may not be expressed in vitro Extrinsic: Similarity-based methods BLAST is often used Alignments using transcriptomics data and similar genomes Intrinsic: Ab initio methods: based only on the sequence Mostly statistical methods, based on ORF length, RBS, intergenic distances Dynamic programming, HMM Methods validated with manually curated gene predictions

81 Ab-initio methods: Dynamic programming Computational approach Used to solve complex problems The overall problem is divided in smaller (and simpler) pieces The results of the smaller pieces are stored for quick lookup Used also in alignments

82 Ab-initio methods: Dynamic programming In gene annotation: Used to find the best gene models The overall problem is to find all the genes The smaller problem is the prediction of single genes Each gene model is related to its neighborhoods with a score The sequence of genes with the best score is the most probable

83 Ab-initio methods: Hidden Markov Models Statistical approach A series of states with transitions having different probabilities Used to model sequences of connected objects/events In gene annotation: General features of annotated genomes can be used to build an HMM to be used in the annotation Features like ORFs length, stat codon preference, intergenic distance, Species specific HMMs

84 Ab-initio methods Glimmer (HMM, used at TIGR) Prodigal (Prokaryotic Dynamic Programming Genefinding Algorithm) GeneMarkHMM (HMM, used for Haemophilus influenzae) EasyGene (HMM, with species specific HMMs) Med (Sequence entropy estimations) Most of the gene predictions are similar despite of the approach The biggest differences are on the start codon position Errors in gene annotation can be propagated to other new genomes Combination of various methods can be used for manual curation

85 Prodigal: dynamic programming score

86 Prodigal: other parameters Many corrections have to be made to maximize the predictions

Avanzamento dei sistemi di sequenziamento

Avanzamento dei sistemi di sequenziamento Avanzamento dei sistemi di sequenziamento Sistemi di sequenziamento capillare basati su: Lunghezza delle read: 800 basi Poche sequenze prodotte in una singola corsa Second Generation Sequencing (SGS):

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

DNA sequencing. Reading Genomes. Giovanni Bacci

DNA sequencing. Reading Genomes. Giovanni Bacci Reading Genomes Giovanni Bacci Evoluzione del sequenziamento 1977 Frederick Sanger Prima tecnica di sequenziamento 1987 Applyed Biosystems Prima macchina automatica per il sequenziamento del DNA 1998 Phil

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Bioinformatica (modulo bioinf. dei genomi moderni )

Bioinformatica (modulo bioinf. dei genomi moderni ) Bioinformatica (modulo bioinf. dei genomi moderni ) Dr. Marco Fondi Lezione # 5 Corso di Laurea in Scienze Biologiche, AA 2011-2012 giovedì 3 novembre 2011 1 Sequenziamento ed analisi di genomi: la genomica

Dettagli

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq):

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): Il vostro progetto Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): 1. Analisi di qualità 2. Mappatura sul genoma 3. Calcolo dell espressione 4. Test di espressione differenziale 5. Visualizzazione

Dettagli

Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT

Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT Giuditta Franco Corso di Laurea in Bioinformatica - AA 2012/2013 Uno dei più grossi risultati nell informatica degli

Dettagli

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL Alcuni aspetti legati al calcolo bioinformatico su CRESCO Giuseppe Aprea UTMEA-CAL Principali attività bioinformatiche ENEA legate al calcolo Assemblaggio de Novo* Trascrittomica Analisi filogenetica Metagenomica*

Dettagli

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015 Next Generation Sequencers: from the bacterial culture to raw data Valeria Michelacci NGS course, June 2015 COSTS ASSOCIATED WITH DNA SEQUENCING 80-100 $ per Bacterial Genome!! Benefits from NGS Massive

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Banche Dati Secondarie. geni trascritti proteine profili strutture

Banche Dati Secondarie. geni trascritti proteine profili strutture Banche Dati Secondarie geni trascritti proteine profili strutture definizione Banca dati il cui contenuto deriva da una banca dati primaria DB sec DB primario informazione PROSITE SWISS Prot patterns Profiles

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Scuola Primaria FINALE SQ. - 14/15 ESERCIZIO 1

Scuola Primaria FINALE SQ. - 14/15 ESERCIZIO 1 ESERCIZIO 1 Si ricordi che una regola di deduzione è un termine che ha la struttura: regola(,,). Tale termine indica una regola di nome che consente di dedurre

Dettagli

Perché abbiamo deciso di sequenziare il genoma umano

Perché abbiamo deciso di sequenziare il genoma umano L'immagine sopra rappresenta le tappe fondamentali per la scoperta del genoma umano. Una versione più interattiva della mappa è disponibile nel sito del progetto genoma umano, nella sezione dedicata alla

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia

Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Lorenzo Morelli Istituto di Microbiologia Facoltà di Agraria UCSC Piacenza In questa presentazione Peculiarità del genoma dei

Dettagli

Terminologia per gli ipertesti sul web

Terminologia per gli ipertesti sul web Terminologia per gli ipertesti sul web browser: programma applicativo per navigare in rete page (pagina): singolo foglio di un ipertesto home-page: punto di ingresso di un sito web hotspot, hotword: porzione

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Bioinformatica: DNA e Algoritmi

Bioinformatica: DNA e Algoritmi Bioinformatica: DNA e Algoritmi Alberto Policriti Dpt. of Mathematics and Informatics, University of Udine. Applied Genomics Institute Di cosa parleremo In generale Deniamo i termini: DNA & Algoritmi Tecnologie

Dettagli

Prova finale di Ingegneria del software

Prova finale di Ingegneria del software Prova finale di Ingegneria del software Scaglione: Prof. San Pietro Andrea Romanoni: Francesco Visin: andrea.romanoni@polimi.it francesco.visin@polimi.it Italiano 2 Scaglioni di voto Scaglioni di voto

Dettagli

Guida utente User Manual made in Italy Rev0

Guida utente User Manual made in Italy Rev0 Guida utente User Manual Rev0 made in Italy Indice/Index Informazioni generali General Info... 3 Guida Rapida per messa in funzione Start Up procedure... 3 Login Login... 3 Significato dei tasti Botton

Dettagli

Indice. settembre 2008 Il File System 2

Indice. settembre 2008 Il File System 2 Il File System Indice 4. Il File System 5. Vantaggi del FS 6. Protezione 7. Condivisione 8. I file - 1 9. I file - 2 10. Attributi dei file 11. Directory 12. Livelli di astrazione - 1 13. Livelli di astrazione

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Metodologie informa/che per l analisi dei genomi

Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Perchè sono qui? Walter Sanseverino, CEO at !? Informa/cs = Genomics? We have a problem!!! Focus curve

Dettagli

Sezione 1 / Section 1. Elementi d identità: il marchio Elements of identity: the logo

Sezione 1 / Section 1. Elementi d identità: il marchio Elements of identity: the logo Sezione 1 / Section 1 2 Elementi d identità: il marchio Elements of identity: the logo Elements of identity: the logo Indice 2.01 Elementi d identità 2.02 Versioni declinabili 2.03 Versioni A e A1, a colori

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

Come ordinare Geni sintetici Online

Come ordinare Geni sintetici Online Come ordinare Geni sintetici Online I geni sintetici di Eurofins MWG Operon possono essere ordinati online grazie all esclusivo software GENEius. Di seguito una guida dettagliata per effettuare la richiesta

Dettagli

13-03-2013. Introduzione al Semantic Web Linguaggi per la rappresentazione di ontologie. L idea del Semantic Web.

13-03-2013. Introduzione al Semantic Web Linguaggi per la rappresentazione di ontologie. L idea del Semantic Web. Corso di Ontologie e Semantic Web Linguaggi per la rappresentazione di ontologie Prof. Alfio Ferrara, Prof. Stefano Montanelli Definizioni di Semantic Web Rilievi critici Un esempio Tecnologie e linguaggi

Dettagli

Facoltà di Scienze e Tecnologie

Facoltà di Scienze e Tecnologie Corso di Laurea in Informatica Applicata Estratto da: Tesi di laurea di: Matteo Parlani Anno Accademico 2006-2007 Indice 1. Introduzione 2. Cepstrum Analysis 3. Caso di studio 4. Esperimenti 5. Risultati

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Foglio di calcolo. Foglio di calcolo: nomi celle

Foglio di calcolo. Foglio di calcolo: nomi celle Foglio di calcolo L'astrazione offerta da un programma di gestione di fogli di calcolo è quella di una matrice (un foglio a quadretti). Colonne: A, B, C,... Righe: 1, 2, 3,... Ogni cella ha un nome composto

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

Bioinformatica NGS Next Generation Sequencing

Bioinformatica NGS Next Generation Sequencing NGS Next Generation Sequencing NGS Le tecnologie di sequenziamento di DNA rappresentano uno strumento fondamentale per la ricerca nel campo della genetica e della biologia molecolare; Dal 2005, piattaforme

Dettagli

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY) http://www.molecularstation.com/molecular-biology-images/data/502/human-genome-gene.png

Dettagli

Riconoscimento e recupero dell informazione per bioinformatica

Riconoscimento e recupero dell informazione per bioinformatica Riconoscimento e recupero dell informazione per bioinformatica Clustering: similarità Manuele Bicego Corso di Laurea in Bioinformatica Dipartimento di Informatica - Università di Verona Definizioni preliminari

Dettagli

Rappresentazione e Memorizzazione dei Dati

Rappresentazione e Memorizzazione dei Dati Rappresentazione e Memorizzazione dei Dati Giuseppe Nicosia CdL in Matematica (Laurea Triennale) Facoltà di Scienze MM.FF.NN. Università di Catania Bit e loro Memorizzazione Definizioni Algoritmo: una

Dettagli

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010 Percorso nº 3: Clonaggio di segmenti di DNA 11-5-2010 I plasmidi: un mondo da esplorare. Elementi genetici capaci di replicarsi autonomamente

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Estendere Lean e Operational Excellence a tutta la Supply Chain

Estendere Lean e Operational Excellence a tutta la Supply Chain Estendere Lean e Operational Excellence a tutta la Supply Chain Prof. Alberto Portioli Staudacher www.lean-excellence.it Dipartimento Ing. Gestionale Politecnico di Milano alberto.portioli@polimi.it Lean

Dettagli

User Guide Guglielmo SmartClient

User Guide Guglielmo SmartClient User Guide Guglielmo SmartClient User Guide - Guglielmo SmartClient Version: 1.0 Guglielmo All rights reserved. All trademarks and logos referenced herein belong to their respective companies. -2- 1. Introduction

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

HARDTOP MINI HARDTOP BUSINESS CARD PAD

HARDTOP MINI HARDTOP BUSINESS CARD PAD HARDTOP Il consolidato incontro qualità/prezzo Stampato in quadricromia offset sotto la superficie in plastica antistatica ruvida con base in gomma sintetica spessore 2 o 4 mm. Formati standard: cm 23

Dettagli

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Università degli Studi di Padova Dipartimento di Ingegneria dell Informazione Corso di Laurea in Ingegneria dell Informazione Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Laureando:

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

Il differenziamento cellulare

Il differenziamento cellulare Liceo Classico M. Pagano Campobasso Docente: prof.ssa Patrizia PARADISO Allieve (cl. II sez. B e C): BARONE Silvia Antonella DI FABIO Angelica DI MARZO Isabella IANIRO Laura LAUDATI Federica PETRILLO Rosanna

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

U Corso di italiano, Lezione Quindici

U Corso di italiano, Lezione Quindici 1 U Corso di italiano, Lezione Quindici U Buongiorno, anche in questa lezione iniziamo con qualche dialogo formale M Good morning, in this lesson as well, let s start with some formal dialogues U Buongiorno,

Dettagli

UNIVERSITÀ DI PISA FACOLTÀ DI INGEGNERIA

UNIVERSITÀ DI PISA FACOLTÀ DI INGEGNERIA UNIVERSITÀ DI PISA FACOLTÀ DI INGEGNERIA CORSO DI LAUREA IN INGEGNERIA DELLE TELECOMUNICAZIONI Tesi di Laurea Analisi statistica di propagazione di campo elettromagnetico in ambiente urbano. Relatori:

Dettagli

3 WORKSHOP DEI LABORATORI DEL CONTROLLO UFFICIALE DI OGM Roma, 23-25 Novembre 2011

3 WORKSHOP DEI LABORATORI DEL CONTROLLO UFFICIALE DI OGM Roma, 23-25 Novembre 2011 Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana 3 WORKSHOP DEI LABORATORI DEL CONTROLLO UFFICIALE DI OGM Roma, 23-25 Novembre 2011 ILARIA CIABATTI Verification of analytical methods

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

DNA Memory. Approfondimento del corso di Bioinformatica. prof.ssa Cocco. Sebastiano Vascon

DNA Memory. Approfondimento del corso di Bioinformatica. prof.ssa Cocco. Sebastiano Vascon DNA Memory Approfondimento del corso di Bioinformatica prof.ssa Cocco DNA Memory (Outline) Nested PCR NPMM (Nested Primer Molecular Memory) Gerarchie di memoria Accesso ai dati Spazio di memoria Vincoli

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Combinazioni serie IL-MIL + MOT

Combinazioni serie IL-MIL + MOT Combinazioni tra riduttori serie IL-MIL e MOT Combined series IL-MIL + MOT reduction units Combinazioni serie IL-MIL + MOT Sono disponibili varie combinazioni tra riduttori a vite senza fine con limitatore

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze Curriculum Vitae SARA GRAZIANO Informazioni personali Cognome Nome Indirizzo Telefono E-mail Cittadinanza Data di nascita Sesso Settore professionale Graziano Sara sara.graziano1985@libero.it Italiana

Dettagli

Ant Colony Optimization (ACO) e Swarm Intelligence

Ant Colony Optimization (ACO) e Swarm Intelligence Università degli Studi di Milano Facoltà di scienze Matematiche, Fisiche e Naturali Ant Colony Optimization (ACO) e Swarm Intelligence Seminario per il corso di Sistemi Intelligenti Prof. N. Alberto BORGHESE

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

FRAMES WINDOW TECHNOLOGY MOTTURA.COM

FRAMES WINDOW TECHNOLOGY MOTTURA.COM FRAMES WINDOW TECHNOLOGY MOTTURA.COM FRAMES UNA GAMMA DEDICATA Rollbox 40 e 60 sono tende a rullo filtranti ed oscuranti specifiche per installazione diretta senza foratura su serramenti in alluminio.

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

sdforexcontest2009 Tool

sdforexcontest2009 Tool sdforexcontest2009 Tool Guida all istallazione e rimozione. Per scaricare il tool del campionato occorre visitare il sito dell organizzatore http://www.sdstudiodainesi.com e selezionare il link ForexContest

Dettagli

norme BS 88 BS 88 standards fusibili e portafusibili norme bs 88 FuSeS and FuSeHolDeRS

norme BS 88 BS 88 standards fusibili e portafusibili norme bs 88 FuSeS and FuSeHolDeRS fusibili e portafusibili norme bs 88 FuSeS and FuSeHolDeRS BS 88 StanDaRDS norme BS 88 BS 88 standards Fusibili BS 88 extrarapidi - Tensione nominale 240V 158 High speed BS 88 fuses - Rated voltage 240V

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Lezione 4. Il sequenziamento del DNA, Sanger

Lezione 4. Il sequenziamento del DNA, Sanger Lezione 4 Il sequenziamento del DNA, Sanger Schema della lezione Polymerase chain reaction (PCR) Dal prodotto di PCR al sequenziamento di Sanger Lettura dei prodotti di sequenziamento con sequenziatori

Dettagli

Network complessi e modelli. Rossano Gaeta Università degli Studi di Torino

Network complessi e modelli. Rossano Gaeta Università degli Studi di Torino Network complessi e modelli Rossano Gaeta Università degli Studi di Torino Sommario Introduzione Proprietà network complessi Modelli matematici per la rappresentazione Grafi regolari Grafi random Small

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Attuatore a relè Manuale di istruzioni

Attuatore a relè Manuale di istruzioni Attuatore a relè Manuale di istruzioni www.ecodhome.com 1 Sommario 3 Introduzione 4 Descrizione e specifiche prodotto 5 Installazione 6 Funzionamento 6 Garanzia 2 Introduzione SmartDHOME vi ringrazia per

Dettagli

Il sequenziamento del DNA

Il sequenziamento del DNA Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Livello di Rete. Prof. Filippo Lanubile. Obiettivo

Livello di Rete. Prof. Filippo Lanubile. Obiettivo Livello di Rete Circuiti virtuali e datagram La funzione di instradamento Costruzione della tabella di routing Algoritmi di routing adattivi: distance vector routing e link-state routing Routing gerarchico

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Algoritmi e strutture di dati 2

Algoritmi e strutture di dati 2 Algoritmi e strutture di dati 2 Paola Vocca Lezione 2: Tecniche golose (greedy) Lezione1- Divide et impera 1 Progettazione di algoritmi greedy Tecniche di dimostrazione (progettazione) o Greedy algorithms

Dettagli

ELTeach. Ottmizza lia preparazione pedagogica dei docenti all insegnamento dell inglese in inglese

ELTeach. Ottmizza lia preparazione pedagogica dei docenti all insegnamento dell inglese in inglese ELTeach Ottmizza lia preparazione pedagogica dei docenti all insegnamento dell inglese in inglese Porta a risultati quantificabili e genera dati non ricavabili dalle sessioni di formazione faccia a faccia

Dettagli

Definizione di segnale

Definizione di segnale Signal detection Laura Sottosanti Ugo Moretti Definizione di segnale Information that arises from one or multiple sources (including observations and experiments), which suggests a new potentially causal

Dettagli

Principi di Chimica Organica

Principi di Chimica Organica Gianluca Giorgi Università degli Studi di Siena Dipartimento di Biotecnologie, Chimica e Farmacia via Aldo Moro 53100 Siena Tel. 0577-234241 e-mail:gianluca.giorgi@unisi.it Corsi di laurea in Scienze Ambientali

Dettagli