Macromolecole Biologiche. I domini (I)

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Macromolecole Biologiche. I domini (I)"

Transcript

1 I domini (I)

2 I domini I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I domini sono definiti come una catena polipeptidica o parte di essa che si ripiega indipendentemente in una struttura stabile. I domini sono unità funzionali e spesso a domini diversi di una proteina sono associate funzioni diverse.

3 I domini Le proteine possono essere costituite da un singolo dominio o da molti (anche diverse dozzine).

4 I domini I domini sono costituiti da diverse combinazioni di elementi di struttura secondaria e di motivi. Le α eliche e i filamenti β costituenti i motivi sono adiacenti uno all altro nella struttura tridimensionale e connessi da regioni di loop; a loro volta, i motivi adiacenti o formati da regioni consecutive della catena polipeptidica sono vicini nella struttura tridimensionale. Il numero di combinazioni dei motivi a formare i domini è limitato e alcune combinazioni sono strutturalmente favorite rispetto ad altre. Spesso, domini simili ricorrono in proteine diverse che hanno funzioni diverse e sequenza aminoacidica completamente diversa.

5 I domini Michael Levitt and Cyrus Chothia, sulla base di semplici considerazioni sulla connessione dei motivi, hanno classificato i domini in 3 gruppi principali, a seconda delle strutture secondarie e dei motivi coinvolti nella loro formazione: - domini α - domini β - domini α/β - altro

6 Domini α: Coiled coil α eliche Il modo più semplice di associazione compatta di α eliche è quello di impaccarsi a coppie. Nel 1953 Francis Crick mostrò che le interazioni fra le catene laterali degli aminoacidi sono massime se le 2 α eliche non sono bastoncini diritti, ma si avvolgono una con l altra a formare un arrangiamento chiamato coiled coil, una sorta di avvolgimento intrecciato. I coiled coil sono la base di alcune proteine fibrose, quali l α cheratina e la miosina, e di proteine che legano DNA o RNA.

7 Domini α: Coiled coil α eliche Nella superelica sinistrorsa costituita da 2 α eliche destrorse, il numero di aminoacidi per giro in ciascuna elica viene ridotto da 3.6 a 3.5 (portando ad una leggera distorsione della geometria delle α eliche), in modo tale che le interazioni delle catene laterali fra le 2 eliche si ripetano ogni 7 aminoacidi, cioè esattamente ogni 2 giri di elica. Ciò si riflette nella sequenza delle catene polipeptidiche che formano la superelica coiled coil, che si ripetono con un periodo di 7 aminoacidi. I 7 aminoacidi (eptapeptide) vengono indicati con le lettere a-g.

8 Domini α: Coiled coil α eliche L aminoacido d è idrofobico (Leu o Ile): quando 2 eliche formano la struttura coiled coil le catene laterali dei relativi aminoacidi d si impaccano insieme ogni 2 giri delle α eliche. L aminoacido a è idrofobico e anch esso si impacca con il corrispondente dell altra elica. Gli aminoacidi a e d formano il core idrofobico della superelica coiled coil.

9 Domini α: Coiled coil α eliche Gli aminoacidi e e g, spazialmente adiacenti alla zona idrofobica definita da a e d, sono carichi (Glu, Asp, Arg, Lys) e le loro catene laterali formano interazioni fra le 2 α eliche (ponti salini), definendo così la relativa orientazione e allineamento delle 2 catene polipeptidiche.

10 Domini α: Coiled coil α eliche Le 2 α eliche che formano la superelica coiled coil si impaccano in modo tale che le catene laterali di un elica cadano nelle zone vuote tra le catene laterali dell altra elica e viceversa. L inclinazione relativa degli assi delle due α eliche è di 18. Ciascun aminoacido di un elica è circondato da 4 aminoacidi appartenenti all elica opposta.

11 Domini α: α helical bundle L α helical bundle è costituito da 4 α eliche disposte in modo tale che i loro assi siano reciprocamente quasi paralleli. Le catene laterali idrofobiche degli aminoacidi di ciascuna α elica sono orientate verso l interno dell α helical bundle, mentre le catene laterali idrofiliche degli aminoacidi sono rivolte verso l esterno. Le catene laterali idrofobiche rivolte verso l interno dell α helical bundle sono così strettamente impaccate che non c è spazio per molecole d acqua.

12 Domini α: α helical bundle L α helical bundle è un tipo di dominio che ricorre in svariate proteine (mioemeritrina, citocromo c' e b 562, ferritina, proteina del capside del virus del mosaico del tabacco). In questi casi le α eliche sequenzialmente vicine sono sempre antiparallele.

13 Domini α: α helical bundle L α helical bundle si può anche formare con arrangiamenti topologici delle α eliche diversi, come nel caso dell ormone umano della crescita. In questo caso, l α helical bundle è formato da 2 coppie di eliche parallele che sono disposte in modo antiparallelo nell α helical bundle. L impaccamento antiparallelo delle α eliche conferisce loro maggiore stabilità in quanto i macrodipoli associati a ciascuna α elica si annullano a vicenda.

14 Domini α: α helical bundle Le α eliche che costituiscono l α helical bundle si impaccano con la modalità cresta-solco. Le creste e i solchi sono costituiti dalle catene laterali di aminoacidi separati da 3-4 residui (fig. c e b rispettivamente). La geometria dei solchi e delle creste di un α elica dipende dalla geometria dell elica ma anche dalla sua sequenza aminoacidica.

15 Domini α: α helical bundle Nel caso dell α helical bundle, le creste formate dagli aminoacidi ogni 3 residui vanno a corrispondere con i solchi formati dagli aminoacidi ogni 4 residui. Le creste della prima α elica sono inclinate di circa 45 rispetto alla direzione dell asse dell elica, mentre le creste della seconda α elica sono inclinate di circa 25 rispetto all asse dell elica. Quando le 2 eliche si impaccano, dopo che un elica viene ruotata di 180, si otterrà la massima corrispondenza fra le creste e i solchi delle 2 eliche in seguito ad un inclinazione di circa 20 (45-25 ) fra le 2 eliche.

16 Domini α: Globin fold Un altro impaccamento tipico delle α eliche è quello osservato nel globin fold, caratteristico di emoglobine, mioglobine e ficocianine. Il globin fold è costituito da 8 α eliche, indicate con le lettere A-H, collegate da loop piuttosto corti, in modo da disporsi a formare la tasca del sito attivo, che in mioglobina e emoglobina, ospita il gruppo eme. La lunghezza delle α eliche varia considerevolmente: da 7 aminoacidi per l elica C a 28 aminoacidi per l elica H. Le α eliche sono disposte in direzioni diverse, in modo tale che α eliche adiacenti in sequenza non lo sono nella struttura, con l eccezione delle eliche G e H (sandwich 3/3, BEF/AGH).

17 Domini α: Globin fold Nel caso del globin fold, le creste formate dagli aminoacidi ogni 4 residui vanno a corrispondere con i solchi formati dagli aminoacidi ogni 4 residui. Le creste di entrambe le α eliche sono inclinate di circa 25 rispetto alla direzione dell asse delle eliche. Quando le 2 eliche si impaccano, dopo che un elica viene ruotata di 180, si otterrà la massima corrispondenza fra le creste e i solchi delle 2 eliche in seguito ad un inclinazione di circa 50 ( ) fra le 2 eliche.

I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini.

I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I domini sono definiti come una catena polipeptidica

Dettagli

formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita i da unoo più domini.

formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita i da unoo più domini. Idomini(I) I domini I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita i da unoo più domini. I domini sono definiti come parte

Dettagli

Macromolecole Biologiche. I domini (III)

Macromolecole Biologiche. I domini (III) I domini (III) Domini α/β La cross over connection è l unità costitutiva su cui si basa la topologia di 3 tipi di domini α/β osservati nelle proteine: - α/β barrel - motivi ricchi di Leu (fold a ferro

Dettagli

Macromolecole Biologiche. I domini (II)

Macromolecole Biologiche. I domini (II) I domini (II) Domini β Nonostante l elevato numero di possibili disposizioni di filamenti β (a costituire foglietti β antiparalleli) connessi da tratti di loop, i domini β più frequentemente osservati

Dettagli

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti Le Biomolecole I parte Lezioni d'autore di Giorgio Benedetti LE BIOMOLECOLE Le biomolecole, presenti in tutti gli esseri viventi, sono molecole composte principalmente da carbonio, idrogeno, azoto e ossigeno.

Dettagli

Domini nelle Proteine

Domini nelle Proteine Struttura secondaria, Motivi e Domini nelle Proteine Proprietà generali Le forme ioniche degli aminoacidi, senza considerare alcuna ionizzazione delle catene laterali. Proprietà generali Tutti gli aminoacidi

Dettagli

Macromolecole Biologiche. Chimica Biologica A.A. 2010-2011. Struttura Terziaria

Macromolecole Biologiche. Chimica Biologica A.A. 2010-2011. Struttura Terziaria Macromolecole Biologiche Chimica Biologica A.A. 2010-2011 Struttura Terziaria Domini e struttura terziaria Struttura terziaria L arrangiamento spaziale degli amminoacidi di una singola catena polipeptidica

Dettagli

Dipartimento Di Scienze Della Vita STRUTTURA DELLE PROTEINE

Dipartimento Di Scienze Della Vita STRUTTURA DELLE PROTEINE Dipartimento Di Scienze Della Vita STRUTTURA DELLE PROTEINE LE PROTEINE possono assumere 4 LIVELLI DI ORGANIZZAZIONE STRUTTURA PRIMARIA SEQUENZA degli amminoacidi STRUTTURA SECONDARIA Ripiegamento locale

Dettagli

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale:

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: N 2 Il nome ordinario degli amminoacidi prevale su quello della nomenclatura IUPA. Si possono avere α-amminoacidi,

Dettagli

Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette

Dettagli

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 9

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 9 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 9 Funzioni delle proteine Concetti chiave: La varietà strutturale delle proteine consente loro di svolgere un enorme quantità

Dettagli

STRUTTURA E FUNZIONE DELLE PROTEINE

STRUTTURA E FUNZIONE DELLE PROTEINE STRUTTURA E FUNZIONE DELLE PROTEINE Le PROTEINE sono i biopolimeri maggiormente presenti all interno delle cellule, dal momento che costituiscono dal 40 al 70% del peso secco. Svolgono funzioni biologiche

Dettagli

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente Gli amminoacidi naturali sono α-amminoacidi : il gruppo amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente formula generale: gruppo funzionale carbossilico

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 7 La struttura delle proteine Concetti chiave: La struttura terziaria di una proteina descrive il ripiegamentodei suoi elementi

Dettagli

Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli

Dettagli

La funzione delle proteine dipende dalla loro struttura tridimensionale

La funzione delle proteine dipende dalla loro struttura tridimensionale La funzione delle proteine dipende dalla loro struttura tridimensionale La struttura dipende dal ripiegamento di particolari sequenze aminoacidiche La sequenza aminoacidica della catena polipeptidica è

Dettagli

Chimica Biologica A.A α-elica foglietto β reverse turn

Chimica Biologica A.A α-elica foglietto β reverse turn Chimica Biologica A.A. 2010-2011 α-elica foglietto β reverse turn Str. Secondaria sperimentalmente osservata: Si distinguono fondamentalmente tre tipi di strutture secondarie: α elica foglietto β reverse

Dettagli

Prof. Maria Nicola GADALETA

Prof. Maria Nicola GADALETA Prof. Maria Nicola GADALETA Email: m.n.gadaleta@biologia.uniba.it Facoltà di Scienze Biotecnologiche Corso di Laurea in Biotecnologie Sanitarie e Farmaceutiche Biochimica e Biotecnologie Biochimiche DISPENSA

Dettagli

LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI PROTEINE. sono ACIDI NUCLEICI. molecole complesse = POLIMERI. formate dall'unione di

LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI PROTEINE. sono ACIDI NUCLEICI. molecole complesse = POLIMERI. formate dall'unione di LE BIOMOLECOLE LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI LE BIOMOLECOLE sono LIPIDI PROTEINE ACIDI NUCLEICI molecole complesse = POLIMERI formate dall'unione di molecole semplici = MONOMERI

Dettagli

COMPORTAMENTO ANFOTERO DEGLI AA

COMPORTAMENTO ANFOTERO DEGLI AA Proprietà acido-basiche degli aminoacidi FORMA NON IONICA Non esiste a nessun valore di ph FORMA ZWITTERIONICA È la forma prevalente a ph 7 COMPORTAMENTO ANFOTERO DEGLI AA CARICA NETTA +1 CARICA NETTA

Dettagli

Relazione struttura-funzione

Relazione struttura-funzione Biotecnologie applicate alla progettazione e sviluppo di molecole biologicamente attive A.A. 2010-2011 Modulo di Biologia Strutturale Relazione struttura-funzione Marco Nardini Dipartimento di Scienze

Dettagli

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica.

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. Concanavalina A Emoglobina subunità Trioso fosfato isomerasi Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. 1 La conformazione è

Dettagli

PROTEINE. Amminoacidi

PROTEINE. Amminoacidi PROTEINE Le proteine sono le macromolecole alla base delle attività cellulari. Sono oltre diecimila per cellula, dove svolgono differenti funzioni: Sono ad esempio: enzimi: aumentano la velocità delle

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

Gli amminoacidi Il legame peptidico Motivi strutturali classificazione, architettura topologia delle strutture tridimensionali di proteine.

Gli amminoacidi Il legame peptidico Motivi strutturali classificazione, architettura topologia delle strutture tridimensionali di proteine. Struttura di proteine Gli amminoacidi Il legame peptidico Motivi strutturali classificazione, architettura topologia delle strutture tridimensionali di proteine. Correlazioni struttura-funzione Gli amminoacidi

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici La seta della tela di ragno è un insieme di macromolecole, dette proteine. Sono le caratteristiche fisico-chimiche di queste

Dettagli

strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 6

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 6 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 6 La struttura secondaria delle proteine Concetti chiave: Il carattere planare di un gruppo peptidico limita la flessibilitàconformazionale

Dettagli

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti Gli attivatori trascrizionali sono delle proteine modulari domini funzionali sovrapposti DIMOSTRAZIONE SPERIMENTALE DI DOMINI FUNZIONALI SEPARATI NEL TF DI LIEVITO GAL 4! Esperimenti di Ptshane. Cellule

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

Trasduzione del Segnale da Recettori di Superfice

Trasduzione del Segnale da Recettori di Superfice Trasduzione del Segnale da Recettori di Superfice MEMBRANA 1. Legame recettore-ligando 2. oligomerizzazione 3. Attivazione TYR-K -Dominio citosolico dei RTK -Reclutamento TYR-K (src, jak, fak, abl) 4.

Dettagli

corta catena (meno di 20 ammino acidi) mancanza di una struttura spaziale organizzata lunga catena di ammino acidi struttura spaziale organizzata

corta catena (meno di 20 ammino acidi) mancanza di una struttura spaziale organizzata lunga catena di ammino acidi struttura spaziale organizzata STRUTTURA DELLE PROTEINE Peptide: corta catena (meno di 20 ammino acidi) mancanza di una struttura spaziale organizzata Polipeptide (proteina): lunga catena di ammino acidi struttura spaziale organizzata

Dettagli

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata Ammino acidi Composto che contiene una funziome acida e amminica. Usualmente però con amminoacidi si intendono gli alfa- amminoacidi. Tra questi composti ve ne sono 20 che vengono definiti geneticamente

Dettagli

Proteine. Struttura tridimensionale Parte II

Proteine. Struttura tridimensionale Parte II Proteine Struttura tridimensionale Parte II (D.L. Nelson, M.M. Cox, Lehninger Principles of Biochemistry, 4th ed., W.H. Freeman & Co., 2005) Plot di Ramachandran Una situazione opposta a quella della glicina

Dettagli

Ogni globina ha una tasca in cui lega un gruppo EME, quindi l Hb può legare e trasportare 4 molecole di O 2

Ogni globina ha una tasca in cui lega un gruppo EME, quindi l Hb può legare e trasportare 4 molecole di O 2 Emoglobina (Hb): tetramero (le globine si associano formando due copie di dimeri αβ (α 1 β 1 e α 2 β 2 ) che si associano a formare un tetramero attraverso interazioni idrofobiche, legami H e ponti salini

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

aa 2013-14 Proteine Struttura delle Proteine α Amminoacidi

aa 2013-14 Proteine Struttura delle Proteine α Amminoacidi Proteine Biopolimeri degli α-amino acidi. Amino acidi sono uniti attraverso il legame peptidico. Alcune funzioni: Struttura (collagene, cheratina ecc.) Enzimi (maltasi, deidrogenasi ecc) Trasporto (albumine,

Dettagli

30/10/2015 LIVELLI DI ORGANIZZAZIONE STRUTTURALE DELLE PROTEINE

30/10/2015 LIVELLI DI ORGANIZZAZIONE STRUTTURALE DELLE PROTEINE LIVELLI DI ORGANIZZAZIONE STRUTTURALE DELLE PROTEINE 1 CARATTERISTICHE DEL LEGAME PEPTIDICO lunghezza intermedia tra un legame singolo e uno doppio ibrido di risonanza per il parziale carattere di doppio

Dettagli

Rapporto Struttura/Funzione delle Proteine

Rapporto Struttura/Funzione delle Proteine Macromolecole Biologiche Chimica Biologica A.A. 2010-2011 Rapporto Struttura/Funzione delle Proteine Struttura/Funzione delle Proteine Interazioni proteina-ligando come base della funzione di molte proteine

Dettagli

Le proteine. Polimeri composto da 20 diversi aminoacidi

Le proteine. Polimeri composto da 20 diversi aminoacidi Le proteine Polimeri composto da 20 diversi aminoacidi (D. Voet, J.G. Voet, Biochemistry, 3 ed., John Wiley & Sons, 2004) PROTEINE come ATTUATORI nella cellula Trasporto elettronico Trasporto di ioni e

Dettagli

AMINOACIDI - 1 AMINOACIDI - 2

AMINOACIDI - 1 AMINOACIDI - 2 AMINOAIDI - 1 Proteine (gr. pròtos = primo) 50-80% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida o alcalina α-aminoacidi proteasi Struttura generale degli α-aminoacidi primari

Dettagli

Introduzione alla biologia della cellula. Lezione 2 Le biomolecole

Introduzione alla biologia della cellula. Lezione 2 Le biomolecole Introduzione alla biologia della cellula Lezione 2 Le biomolecole Tutte le molecole contenute nelle cellule sono costituite da composti del carbonio Zuccheri Lipidi Proteine Acidi nucleici Polimeri Sono

Dettagli

La struttura delle proteine

La struttura delle proteine La struttura delle proteine Funzioni delle proteine Strutturali Contrattili Trasporto Riserva Ormonali Enzimatiche Protezione Struttura della proteina Struttura secondaria: ripiegamento locale della catena

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa

Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa Gli amminoacidi Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa classe di molecole: p. es. la catalisi delle

Dettagli

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE Nell ultima fase della sintesi proteica la catena polipeptidica neosintetizzata assume spontaneamente la sua conformazione nativa (massimo numero di legami

Dettagli

Struttura delle proteine

Struttura delle proteine Struttura delle proteine Nelle proteine vi sono quattro livelli di organizzazione strutturale Struttura Primaria: sequenza di aminoacidi legati tra loro da legami peptidici Tutte le proteine esistenti

Dettagli

Capitolo 17. Risposte alle domande interne al capitolo. 17.1 (p. 501) a. glicina. b. prolina. c. treonina. d. aspartato

Capitolo 17. Risposte alle domande interne al capitolo. 17.1 (p. 501) a. glicina. b. prolina. c. treonina. d. aspartato apitolo 17 Risposte alle domande interne al capitolo 17.1 (p. 501) a. glicina b. prolina c. treonina d. aspartato e. 17.2 (p. 501) a. La glicina è un aminoacido idrofobico. b. La prolina è un aminoacido

Dettagli

Funzioni delle proteine

Funzioni delle proteine Funzioni delle proteine ENZIMI Proteine di trasporto Proteine di riserva Proteine contrattili o motili Proteine strutturali Proteine di difesa Proteine regolatrici Proteine di trasporto Emoglobina Lipoproteine

Dettagli

Le macromolecole dei tessuti - 1

Le macromolecole dei tessuti - 1 Le macromolecole dei tessuti - 1 Che cosa sono le proteine? Sono macromolecole complesse ad alta informazione Sono costituite da una o più catene polipeptidiche Ogni catena peptidica è composta da centinaia

Dettagli

Rappresentazione dei Dati Biologici

Rappresentazione dei Dati Biologici Rappresentazione dei Dati Biologici CORSO DI BIOINFORMATICA C.d.L. Ingegneria Informatica e Biomedica Outline Proteine ed Amminoacidi Rappresentazione di Amminoacidi Rappresentazione delle strutture Proteiche

Dettagli

AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali):

AMINOACIDI. GENE PROTEINA EFFETTO. calore. idrolisi acida (o alcalina) Struttura generale degli α-aminoacidi primari (standard, normali): AMINOAIDI. Proteine (gr. pròtos = primo) > 50% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida (o alcalina) α-aminoacidi Struttura generale degli α-aminoacidi primari (standard,

Dettagli

Continua. Peptidasi H 2 O

Continua. Peptidasi H 2 O Continua Peptidasi H 2 O Classificazione delle peptidasi 1. Meccanismo catalitico 2. Tipo di reazione catalizzata 3. Struttura molecolare e omologia 1. Meccanismo catalitico (mostrato per la chimotripsina)

Dettagli

PROTEINE RESPIRATORIE DEI VERTEBRATI EMOGLOBINA E MIOGLOBINA

PROTEINE RESPIRATORIE DEI VERTEBRATI EMOGLOBINA E MIOGLOBINA PROTEINE RESPIRATORIE DEI VERTEBRATI EMOGLOBINA E MIOGLOBINA Svolgono la loro funzione legando reversibilmente l OSSIGENO. Aumentano la solubilità dell ossigeno nel plasma, da 3ml/L a 220 ml/l. La mioglobina

Dettagli

LE PROTEINE -struttura tridimensionale-

LE PROTEINE -struttura tridimensionale- LE PROTEINE -struttura tridimensionale- Struttura generale di una proteina Ceruloplasmina Cosa sono??? Sono biopolimeri con forme ben definite. composti da molteplici amminoacidi, legati con legami peptidici

Dettagli

Struttura delle Proteine

Struttura delle Proteine Biotecnologie applicate alla progettazione e sviluppo di molecole biologicamente attive A.A. 2010-2011 Modulo di Biologia Strutturale Struttura delle Proteine Marco Nardini Dipartimento di Scienze Biomolecolari

Dettagli

Le idee della chimica

Le idee della chimica G. Valitutti A.Tifi A.Gentile Seconda edizione Copyright 2009 Zanichelli editore Capitolo 25 Le basi della biochimica 1. I carboidrati 2. I lipidi 3. Gli amminoacidi, i peptidi e le proteine 4. La struttura

Dettagli

la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui

la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui Durante la traduzione l informazione di ripiegamento codificata nella sequenza aminoacidica diventa disponibile in maniera vettoriale la struttura tridimensionale può essere ottenuta solo per Un intero

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino Strutture molecolari della cellula: Bio-macromolecole Prof. C. Guarino INTRO Ogni cellula vivente racchiude una pluralità di molecole diverse L acqua è l elemento dominante, nelle cellule vegetali e nei

Dettagli

BIOMOLECOLE STRUTTURA E FUNZIONE

BIOMOLECOLE STRUTTURA E FUNZIONE BIOMOLECOLE STRUTTURA E FUNZIONE Lo studio delle relazioni tra struttura e funzione nelle biomolecole è uno degli aspetti più importanti per la comprensione del funzionamento dei processi biologici La

Dettagli

Biologia. Lezione 09/11/2010

Biologia. Lezione 09/11/2010 Biologia Lezione 09/11/2010 Tutte le molecole contenute nelle cellule sono costituite da composti del carbonio Zuccheri Lipidi Proteine Acidi nucleici Polimeri Sono macromolecole formate da unità (MONOMERI)

Dettagli

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4 Indice Prefazione XIII Protein Data Bank: una nota degli autori XIV Nota all edizione italiana XV Ringraziamenti XVI CAPITOLO 1 Dalla sequenza alla struttura 1.0 Visione d insieme: funzione e architettura

Dettagli

LIVELLI DI STRUTTURA DELLE PROTEINE

LIVELLI DI STRUTTURA DELLE PROTEINE FUNZIONI E STRUTTURA DELLE PROTEINE PROF.SSA AUSILIA ELCE Indice 1 INTRODUZIONE -------------------------------------------------------------------------------------------------------------- 3 2 LIVELLI

Dettagli

ACIDI GRASSI INSATURI

ACIDI GRASSI INSATURI LIPIDI ACIDI GRASSI SATURI ACIDI GRASSI INSATURI TRIGLICERIDI TRIGLICERIDI Grassi neutri o lipidi semplici glicerolo + 1 acido grasso monogliceride glicerolo + 2 acidi grassi digliceride glicerolo + 3

Dettagli

PROTEINE. sono COMPOSTI ORGANICI QUATERNARI

PROTEINE. sono COMPOSTI ORGANICI QUATERNARI PROTEINE sono COMPOSTI ORGANICI QUATERNARI Unione di elementi chimici diversi Il composto chimico principale è il C (carbonio) Sono quattro gli elementi chimici principali che formano le proteine : C (carbonio),

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Peptidi, proteine ed e nzim i i 1

Peptidi, proteine ed e nzim i i 1 Peptidi, proteine ed enzimi 1 Gli amminoacidi possono formare catene Due amminoacidi possono unirsi tra loro attraverso il legame ammidico detto legame peptidico, tra il gruppo NH 2 di un amminoacido e

Dettagli

La biochimica è anche definita la chimica del C :

La biochimica è anche definita la chimica del C : Tutte le cellule viventi sono composte da macromolecole simili, costituite dalle stesse piccole molecole di base. La grande diversità è data dalle diverse combinazioni di 4 principali elementi C H O N

Dettagli

Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi

Dettagli

Gli angoli diedri (φ, ψ) della catena polipeptidica in conformazione foglietto β cadono nella. (quadrante in alto a sinistra).

Gli angoli diedri (φ, ψ) della catena polipeptidica in conformazione foglietto β cadono nella. (quadrante in alto a sinistra). Strutture secondarie (b) Foglietto β Nello stesso anno (1951) in cui proposero l α α elica, Pauling e Corey postularono anche l esistenza di un altra struttura secondaria: il foglietto β (β-sheet). Dopo

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Ruote dentate elicoidali e loro controllo con micrometro a piattelli

Ruote dentate elicoidali e loro controllo con micrometro a piattelli Ruote dentate elicoidali e loro controllo con micrometro a piattelli Nella ruota dentata cilindrica a denti elicoidali le linee dei fianchi, essendo delle eliche, sono inclinate di un angolo β rispetto

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

dominio strutturale dominio modulo

dominio strutturale dominio modulo Riepilogo 2^lezione DOMINI Si definisce dominio strutturale (o dominio o modulo) di una proteina: un'unità globulare o fibrosa formata da catene polipeptidiche ripiegate in più regioni compatte le quali

Dettagli

AMMINOACIDI E PROTEINE

AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE Vengono chiamate amminoacidi quelle molecole organiche in cui sono contemporaneamente presenti sia un gruppo acido carbossilico -COO che un gruppo amminico -N2. Una molecola appartenente

Dettagli

Formazione del legame peptidico:

Formazione del legame peptidico: Formazione del legame peptidico: Planare, ha una forza intermedia tra il legame semplice ed il legame doppio. 2^ lezione N R C C O O O + R N R C O C O O N R C C N C C O Ogni piano delle unità peptidiche

Dettagli

CARBOIDRATI C H O ZUCCHERO SACCARIDE GLUCIDE CARBOIDRATO

CARBOIDRATI C H O ZUCCHERO SACCARIDE GLUCIDE CARBOIDRATO CARBOIDRATI ZUCCHERO SACCARIDE GLUCIDE CARBOIDRATO C H O carboidrati C n H 2n O n H C O C O Il glucosio è un monosaccaride con 6 atomi di carbonio GLUCOSIO Forma ciclica Forma lineare a ph 7 circa lo 0,0026%

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

STRUTTURA E FUNZIONE DELLE PROTEINE

STRUTTURA E FUNZIONE DELLE PROTEINE STRUTTURA E FUNZIONE DELLE PROTEINE PROTEINE 50% DEL PESO SECCO DI UNA CELLULA STRUTTURA intelaiatura citoscheletrica strutture cellulari impalcatura di sostegno extracellulare FUNZIONE catalisi enzimatica

Dettagli

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica Gli aminoacidi NOMENCLATURA Aminoacido Abbr. tre lettere Abbr. una lettera Aminoacido Abbr. tre lettere Abbr. una lettera Alanina ALA A Lisina LYS K Arginina ARG R Metionina MET M Asparagina ASN N Fenilalanina

Dettagli

FUNZIONI DELLE PROTEINE

FUNZIONI DELLE PROTEINE FUNZIONI DELLE PROTEINE 1 CATALISI ENZIMATICA 2 TRASPORTO E DEPOSITO 3 MOVIMENTO COORDINATO 4 SUPPORTO MECCANICO 5 PROTEZIONE IMMUNITARIA 6 GENERAZIONE E TRASMISSIONE DELL IMPULSO NERVOSO 7 CONTROLLO DELLA

Dettagli

Predizione della struttura terziaria

Predizione della struttura terziaria Predizione della struttura terziaria Metodi di predizione La predizione della struttura tridimensionale è di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi

Dettagli

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE Nell ultima fase della sintesi proteica la catena polipeptidica neosintetizzata assume spontaneamente la sua conformazione nativa (massimo numero di legami

Dettagli

sono le unità monomeriche che costituiscono le proteine hanno tutti una struttura comune

sono le unità monomeriche che costituiscono le proteine hanno tutti una struttura comune AMINO ACIDI sono le unità monomeriche che costituiscono le proteine sono 20 hanno tutti una struttura comune sono asimmetrici La carica di un amino acido dipende dal ph Classificazione amino acidi Glicina

Dettagli

Vittoria Patti MACROMOLECOLE BIOLOGICHE. 4. proteine

Vittoria Patti MACROMOLECOLE BIOLOGICHE. 4. proteine Vittoria Patti MACROMOLECOLE BIOLOGICHE 4. proteine 1 Funzioni principali delle proteine funzione cosa significa esempi ENZIMATICA STRUTTURALE TRASPORTO MOVIMENTO DIFESA IMMUNITARIA ORMONALE catalizzare

Dettagli

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione

Dettagli

Struttura delle Proteine

Struttura delle Proteine Chimica Biologica A.A. 2010-2011 Struttura delle Proteine Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano Macromolecole Biologiche Struttura Proteine Proteine:

Dettagli

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale.

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale. Homology modelling L omology modeling delle proteine è il tipo di predizione di struttura terziaria più semplice ed affidabile. Viene richiesta soltanto una (o più) sequenze di riferimento su cui modellare

Dettagli

LA CHERATINA. CORSO COSMETOLOGIA- DOTT.SSA B. SCARABELLI (www.cosmesinice.it) PROTEINA: unione di più aminoacidi

LA CHERATINA. CORSO COSMETOLOGIA- DOTT.SSA B. SCARABELLI (www.cosmesinice.it) PROTEINA: unione di più aminoacidi PROTEINA: unione di più aminoacidi LA CHERATINA AMINOACIDO: molecola unità di base; ce ne sono 20 di cui 8 sono essenziali (da introdurre solo con i cibi) La struttura delle proteine vien suddivisa in

Dettagli

i principi alimentari

i principi alimentari i principi alimentari CARBOIDRATI glucidi PROTEINE protidi GRASSI lipidi VITAMINE SALI MINERALI ACQUA 1 carboidrati glucidi o zuccheri sono composti di carbonio, idrogeno e ossigeno Lo zucchero più semplice

Dettagli

Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione

Visualizzazioni 3D. Informatica. Matrice di voxel. Tipi di dato. Dati vettoriali. Tecniche di rappresentazione Informatica Lezione VIII Visualizzazione 3D di proteine Visualizzazioni 3D Rappresentazione di strutture/oggetti tridimensionali Risultato di un esperimento modello teorico dati fisici astrazione 1 Lezione

Dettagli

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi.

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi. Sommario La molecola di DNA è deputata a conservare le informazioni genetiche necessarie per lo sviluppo ed il funzionamento degli organismi viventi. Poiché contiene le istruzioni per la costruzione delle

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Pectinasi. PECTINA composto estratto dalla frutta- MELE E PERE- gelificante. Grado di esterificazione

Pectinasi. PECTINA composto estratto dalla frutta- MELE E PERE- gelificante. Grado di esterificazione Pectinasi Le pectine sono carboidrati complessi che fanno parte della lamella mediana delle cellule vegetali e contribuiscono al mantenimento della struttura dei tessuti vegetali. L unità di base è costituita

Dettagli

- CINETICA ENZIMATICA

- CINETICA ENZIMATICA - CINETICA ENZIMATICA ENZIMI: - CATALIZZATORI aumenta la V di una reazione chimica senza subire trasformazioni durante l intero processo - PROTEINE gli enzimi sono proteine di struttura 3 o talora 4 -

Dettagli

Parametri dell α-elica. residui/giro 3.6. passo dell elica

Parametri dell α-elica. residui/giro 3.6. passo dell elica GRAFICO DI RAMACHANDRAN Parametri dell α-elica residui/giro 3.6 spazio/residuo passo dell elica 1.5 Å 5.4 Å 1 L α-elica può essere destabilizzata da interazioni tra i gruppi R: repulsione/attrazione elettrostatica

Dettagli