Macromolecole Biologiche. I domini (I)

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Macromolecole Biologiche. I domini (I)"

Transcript

1 I domini (I)

2 I domini I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I domini sono definiti come una catena polipeptidica o parte di essa che si ripiega indipendentemente in una struttura stabile. I domini sono unità funzionali e spesso a domini diversi di una proteina sono associate funzioni diverse.

3 I domini Le proteine possono essere costituite da un singolo dominio o da molti (anche diverse dozzine).

4 I domini I domini sono costituiti da diverse combinazioni di elementi di struttura secondaria e di motivi. Le α eliche e i filamenti β costituenti i motivi sono adiacenti uno all altro nella struttura tridimensionale e connessi da regioni di loop; a loro volta, i motivi adiacenti o formati da regioni consecutive della catena polipeptidica sono vicini nella struttura tridimensionale. Il numero di combinazioni dei motivi a formare i domini è limitato e alcune combinazioni sono strutturalmente favorite rispetto ad altre. Spesso, domini simili ricorrono in proteine diverse che hanno funzioni diverse e sequenza aminoacidica completamente diversa.

5 I domini Michael Levitt and Cyrus Chothia, sulla base di semplici considerazioni sulla connessione dei motivi, hanno classificato i domini in 3 gruppi principali, a seconda delle strutture secondarie e dei motivi coinvolti nella loro formazione: - domini α - domini β - domini α/β - altro

6 Domini α: Coiled coil α eliche Il modo più semplice di associazione compatta di α eliche è quello di impaccarsi a coppie. Nel 1953 Francis Crick mostrò che le interazioni fra le catene laterali degli aminoacidi sono massime se le 2 α eliche non sono bastoncini diritti, ma si avvolgono una con l altra a formare un arrangiamento chiamato coiled coil, una sorta di avvolgimento intrecciato. I coiled coil sono la base di alcune proteine fibrose, quali l α cheratina e la miosina, e di proteine che legano DNA o RNA.

7 Domini α: Coiled coil α eliche Nella superelica sinistrorsa costituita da 2 α eliche destrorse, il numero di aminoacidi per giro in ciascuna elica viene ridotto da 3.6 a 3.5 (portando ad una leggera distorsione della geometria delle α eliche), in modo tale che le interazioni delle catene laterali fra le 2 eliche si ripetano ogni 7 aminoacidi, cioè esattamente ogni 2 giri di elica. Ciò si riflette nella sequenza delle catene polipeptidiche che formano la superelica coiled coil, che si ripetono con un periodo di 7 aminoacidi. I 7 aminoacidi (eptapeptide) vengono indicati con le lettere a-g.

8 Domini α: Coiled coil α eliche L aminoacido d è idrofobico (Leu o Ile): quando 2 eliche formano la struttura coiled coil le catene laterali dei relativi aminoacidi d si impaccano insieme ogni 2 giri delle α eliche. L aminoacido a è idrofobico e anch esso si impacca con il corrispondente dell altra elica. Gli aminoacidi a e d formano il core idrofobico della superelica coiled coil.

9 Domini α: Coiled coil α eliche Gli aminoacidi e e g, spazialmente adiacenti alla zona idrofobica definita da a e d, sono carichi (Glu, Asp, Arg, Lys) e le loro catene laterali formano interazioni fra le 2 α eliche (ponti salini), definendo così la relativa orientazione e allineamento delle 2 catene polipeptidiche.

10 Domini α: Coiled coil α eliche Le 2 α eliche che formano la superelica coiled coil si impaccano in modo tale che le catene laterali di un elica cadano nelle zone vuote tra le catene laterali dell altra elica e viceversa. L inclinazione relativa degli assi delle due α eliche è di 18. Ciascun aminoacido di un elica è circondato da 4 aminoacidi appartenenti all elica opposta.

11 Domini α: α helical bundle L α helical bundle è costituito da 4 α eliche disposte in modo tale che i loro assi siano reciprocamente quasi paralleli. Le catene laterali idrofobiche degli aminoacidi di ciascuna α elica sono orientate verso l interno dell α helical bundle, mentre le catene laterali idrofiliche degli aminoacidi sono rivolte verso l esterno. Le catene laterali idrofobiche rivolte verso l interno dell α helical bundle sono così strettamente impaccate che non c è spazio per molecole d acqua.

12 Domini α: α helical bundle L α helical bundle è un tipo di dominio che ricorre in svariate proteine (mioemeritrina, citocromo c' e b 562, ferritina, proteina del capside del virus del mosaico del tabacco). In questi casi le α eliche sequenzialmente vicine sono sempre antiparallele.

13 Domini α: α helical bundle L α helical bundle si può anche formare con arrangiamenti topologici delle α eliche diversi, come nel caso dell ormone umano della crescita. In questo caso, l α helical bundle è formato da 2 coppie di eliche parallele che sono disposte in modo antiparallelo nell α helical bundle. L impaccamento antiparallelo delle α eliche conferisce loro maggiore stabilità in quanto i macrodipoli associati a ciascuna α elica si annullano a vicenda.

14 Domini α: α helical bundle Le α eliche che costituiscono l α helical bundle si impaccano con la modalità cresta-solco. Le creste e i solchi sono costituiti dalle catene laterali di aminoacidi separati da 3-4 residui (fig. c e b rispettivamente). La geometria dei solchi e delle creste di un α elica dipende dalla geometria dell elica ma anche dalla sua sequenza aminoacidica.

15 Domini α: α helical bundle Nel caso dell α helical bundle, le creste formate dagli aminoacidi ogni 3 residui vanno a corrispondere con i solchi formati dagli aminoacidi ogni 4 residui. Le creste della prima α elica sono inclinate di circa 45 rispetto alla direzione dell asse dell elica, mentre le creste della seconda α elica sono inclinate di circa 25 rispetto all asse dell elica. Quando le 2 eliche si impaccano, dopo che un elica viene ruotata di 180, si otterrà la massima corrispondenza fra le creste e i solchi delle 2 eliche in seguito ad un inclinazione di circa 20 (45-25 ) fra le 2 eliche.

16 Domini α: Globin fold Un altro impaccamento tipico delle α eliche è quello osservato nel globin fold, caratteristico di emoglobine, mioglobine e ficocianine. Il globin fold è costituito da 8 α eliche, indicate con le lettere A-H, collegate da loop piuttosto corti, in modo da disporsi a formare la tasca del sito attivo, che in mioglobina e emoglobina, ospita il gruppo eme. La lunghezza delle α eliche varia considerevolmente: da 7 aminoacidi per l elica C a 28 aminoacidi per l elica H. Le α eliche sono disposte in direzioni diverse, in modo tale che α eliche adiacenti in sequenza non lo sono nella struttura, con l eccezione delle eliche G e H (sandwich 3/3, BEF/AGH).

17 Domini α: Globin fold Nel caso del globin fold, le creste formate dagli aminoacidi ogni 4 residui vanno a corrispondere con i solchi formati dagli aminoacidi ogni 4 residui. Le creste di entrambe le α eliche sono inclinate di circa 25 rispetto alla direzione dell asse delle eliche. Quando le 2 eliche si impaccano, dopo che un elica viene ruotata di 180, si otterrà la massima corrispondenza fra le creste e i solchi delle 2 eliche in seguito ad un inclinazione di circa 50 ( ) fra le 2 eliche.

I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini.

I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I domini sono definiti come una catena polipeptidica

Dettagli

formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita i da unoo più domini.

formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita i da unoo più domini. Idomini(I) I domini I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita i da unoo più domini. I domini sono definiti come parte

Dettagli

Macromolecole Biologiche. I domini (II)

Macromolecole Biologiche. I domini (II) I domini (II) Domini β Nonostante l elevato numero di possibili disposizioni di filamenti β (a costituire foglietti β antiparalleli) connessi da tratti di loop, i domini β più frequentemente osservati

Dettagli

Domini nelle Proteine

Domini nelle Proteine Struttura secondaria, Motivi e Domini nelle Proteine Proprietà generali Le forme ioniche degli aminoacidi, senza considerare alcuna ionizzazione delle catene laterali. Proprietà generali Tutti gli aminoacidi

Dettagli

Macromolecole Biologiche. Chimica Biologica A.A. 2010-2011. Struttura Terziaria

Macromolecole Biologiche. Chimica Biologica A.A. 2010-2011. Struttura Terziaria Macromolecole Biologiche Chimica Biologica A.A. 2010-2011 Struttura Terziaria Domini e struttura terziaria Struttura terziaria L arrangiamento spaziale degli amminoacidi di una singola catena polipeptidica

Dettagli

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti Le Biomolecole I parte Lezioni d'autore di Giorgio Benedetti LE BIOMOLECOLE Le biomolecole, presenti in tutti gli esseri viventi, sono molecole composte principalmente da carbonio, idrogeno, azoto e ossigeno.

Dettagli

Dipartimento Di Scienze Della Vita STRUTTURA DELLE PROTEINE

Dipartimento Di Scienze Della Vita STRUTTURA DELLE PROTEINE Dipartimento Di Scienze Della Vita STRUTTURA DELLE PROTEINE LE PROTEINE possono assumere 4 LIVELLI DI ORGANIZZAZIONE STRUTTURA PRIMARIA SEQUENZA degli amminoacidi STRUTTURA SECONDARIA Ripiegamento locale

Dettagli

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale:

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: N 2 Il nome ordinario degli amminoacidi prevale su quello della nomenclatura IUPA. Si possono avere α-amminoacidi,

Dettagli

Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette

Dettagli

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,

Dettagli

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente Gli amminoacidi naturali sono α-amminoacidi : il gruppo amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente formula generale: gruppo funzionale carbossilico

Dettagli

Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 7 La struttura delle proteine Concetti chiave: La struttura terziaria di una proteina descrive il ripiegamentodei suoi elementi

Dettagli

Relazione struttura-funzione

Relazione struttura-funzione Biotecnologie applicate alla progettazione e sviluppo di molecole biologicamente attive A.A. 2010-2011 Modulo di Biologia Strutturale Relazione struttura-funzione Marco Nardini Dipartimento di Scienze

Dettagli

La funzione delle proteine dipende dalla loro struttura tridimensionale

La funzione delle proteine dipende dalla loro struttura tridimensionale La funzione delle proteine dipende dalla loro struttura tridimensionale La struttura dipende dal ripiegamento di particolari sequenze aminoacidiche La sequenza aminoacidica della catena polipeptidica è

Dettagli

PROTEINE. Amminoacidi

PROTEINE. Amminoacidi PROTEINE Le proteine sono le macromolecole alla base delle attività cellulari. Sono oltre diecimila per cellula, dove svolgono differenti funzioni: Sono ad esempio: enzimi: aumentano la velocità delle

Dettagli

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica.

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. Concanavalina A Emoglobina subunità Trioso fosfato isomerasi Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. 1 La conformazione è

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine

Dettagli

aa 2013-14 Proteine Struttura delle Proteine α Amminoacidi

aa 2013-14 Proteine Struttura delle Proteine α Amminoacidi Proteine Biopolimeri degli α-amino acidi. Amino acidi sono uniti attraverso il legame peptidico. Alcune funzioni: Struttura (collagene, cheratina ecc.) Enzimi (maltasi, deidrogenasi ecc) Trasporto (albumine,

Dettagli

Struttura delle proteine

Struttura delle proteine Struttura delle proteine Nelle proteine vi sono quattro livelli di organizzazione strutturale Struttura Primaria: sequenza di aminoacidi legati tra loro da legami peptidici Tutte le proteine esistenti

Dettagli

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata

2011 - G. Licini, Università di Padova. La riproduzione a fini commerciali è vietata Ammino acidi Composto che contiene una funziome acida e amminica. Usualmente però con amminoacidi si intendono gli alfa- amminoacidi. Tra questi composti ve ne sono 20 che vengono definiti geneticamente

Dettagli

Trasduzione del Segnale da Recettori di Superfice

Trasduzione del Segnale da Recettori di Superfice Trasduzione del Segnale da Recettori di Superfice MEMBRANA 1. Legame recettore-ligando 2. oligomerizzazione 3. Attivazione TYR-K -Dominio citosolico dei RTK -Reclutamento TYR-K (src, jak, fak, abl) 4.

Dettagli

Ogni globina ha una tasca in cui lega un gruppo EME, quindi l Hb può legare e trasportare 4 molecole di O 2

Ogni globina ha una tasca in cui lega un gruppo EME, quindi l Hb può legare e trasportare 4 molecole di O 2 Emoglobina (Hb): tetramero (le globine si associano formando due copie di dimeri αβ (α 1 β 1 e α 2 β 2 ) che si associano a formare un tetramero attraverso interazioni idrofobiche, legami H e ponti salini

Dettagli

Le proteine. Polimeri composto da 20 diversi aminoacidi

Le proteine. Polimeri composto da 20 diversi aminoacidi Le proteine Polimeri composto da 20 diversi aminoacidi (D. Voet, J.G. Voet, Biochemistry, 3 ed., John Wiley & Sons, 2004) PROTEINE come ATTUATORI nella cellula Trasporto elettronico Trasporto di ioni e

Dettagli

Capitolo 17. Risposte alle domande interne al capitolo. 17.1 (p. 501) a. glicina. b. prolina. c. treonina. d. aspartato

Capitolo 17. Risposte alle domande interne al capitolo. 17.1 (p. 501) a. glicina. b. prolina. c. treonina. d. aspartato apitolo 17 Risposte alle domande interne al capitolo 17.1 (p. 501) a. glicina b. prolina c. treonina d. aspartato e. 17.2 (p. 501) a. La glicina è un aminoacido idrofobico. b. La prolina è un aminoacido

Dettagli

Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa

Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa Gli amminoacidi Le proteine rappresentano gli elementi strutturali e funzionali più importanti nei sistemi viventi. Qualsiasi processo vitale dipende da questa classe di molecole: p. es. la catalisi delle

Dettagli

AMINOACIDI - 1 AMINOACIDI - 2

AMINOACIDI - 1 AMINOACIDI - 2 AMINOAIDI - 1 Proteine (gr. pròtos = primo) 50-80% peso secco cellulare GENE POTEINA EFFETTO proteine calore idrolisi acida o alcalina α-aminoacidi proteasi Struttura generale degli α-aminoacidi primari

Dettagli

Rappresentazione dei Dati Biologici

Rappresentazione dei Dati Biologici Rappresentazione dei Dati Biologici CORSO DI BIOINFORMATICA C.d.L. Ingegneria Informatica e Biomedica Outline Proteine ed Amminoacidi Rappresentazione di Amminoacidi Rappresentazione delle strutture Proteiche

Dettagli

BIOMOLECOLE STRUTTURA E FUNZIONE

BIOMOLECOLE STRUTTURA E FUNZIONE BIOMOLECOLE STRUTTURA E FUNZIONE Lo studio delle relazioni tra struttura e funzione nelle biomolecole è uno degli aspetti più importanti per la comprensione del funzionamento dei processi biologici La

Dettagli

dominio strutturale dominio modulo

dominio strutturale dominio modulo Riepilogo 2^lezione DOMINI Si definisce dominio strutturale (o dominio o modulo) di una proteina: un'unità globulare o fibrosa formata da catene polipeptidiche ripiegate in più regioni compatte le quali

Dettagli

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino Strutture molecolari della cellula: Bio-macromolecole Prof. C. Guarino INTRO Ogni cellula vivente racchiude una pluralità di molecole diverse L acqua è l elemento dominante, nelle cellule vegetali e nei

Dettagli

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4 Indice Prefazione XIII Protein Data Bank: una nota degli autori XIV Nota all edizione italiana XV Ringraziamenti XVI CAPITOLO 1 Dalla sequenza alla struttura 1.0 Visione d insieme: funzione e architettura

Dettagli

La biochimica è anche definita la chimica del C :

La biochimica è anche definita la chimica del C : Tutte le cellule viventi sono composte da macromolecole simili, costituite dalle stesse piccole molecole di base. La grande diversità è data dalle diverse combinazioni di 4 principali elementi C H O N

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

AMMINOACIDI E PROTEINE

AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE Vengono chiamate amminoacidi quelle molecole organiche in cui sono contemporaneamente presenti sia un gruppo acido carbossilico -COO che un gruppo amminico -N2. Una molecola appartenente

Dettagli

Continua. Peptidasi H 2 O

Continua. Peptidasi H 2 O Continua Peptidasi H 2 O Classificazione delle peptidasi 1. Meccanismo catalitico 2. Tipo di reazione catalizzata 3. Struttura molecolare e omologia 1. Meccanismo catalitico (mostrato per la chimotripsina)

Dettagli

la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui

la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui Durante la traduzione l informazione di ripiegamento codificata nella sequenza aminoacidica diventa disponibile in maniera vettoriale la struttura tridimensionale può essere ottenuta solo per Un intero

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica

I gruppi R differenziano i 20 amminoacidi standard. Tratto da D. Voet, G. Voet e C.W. Pratt Fondamenti di biochimica Gli aminoacidi NOMENCLATURA Aminoacido Abbr. tre lettere Abbr. una lettera Aminoacido Abbr. tre lettere Abbr. una lettera Alanina ALA A Lisina LYS K Arginina ARG R Metionina MET M Asparagina ASN N Fenilalanina

Dettagli

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE Nell ultima fase della sintesi proteica la catena polipeptidica neosintetizzata assume spontaneamente la sua conformazione nativa (massimo numero di legami

Dettagli

Le proteine. Le proteine sono macromolecole che presentano differenze funzionali e strutturali

Le proteine. Le proteine sono macromolecole che presentano differenze funzionali e strutturali Le proteine Le proteine sono macromolecole che presentano differenze funzionali e strutturali LE PROTEINE HANNO FUNZIONI BIOLOGICHE DIVERSE enzimi proteine di trasporto proteine strutturali proteine di

Dettagli

Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili.

Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. La sensibilita delle vie di trasduzione dipende da 3 fattori: -l affinita

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Sperimenta il BioLab

Sperimenta il BioLab Sperimenta il BioLab Attività di Bioinformatica Le proteine in 3D Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 LE PROTEINE IN 3D Obiettivo dell'attività è

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

- CINETICA ENZIMATICA

- CINETICA ENZIMATICA - CINETICA ENZIMATICA ENZIMI: - CATALIZZATORI aumenta la V di una reazione chimica senza subire trasformazioni durante l intero processo - PROTEINE gli enzimi sono proteine di struttura 3 o talora 4 -

Dettagli

Predizione della struttura terziaria

Predizione della struttura terziaria Predizione della struttura terziaria Metodi di predizione La predizione della struttura tridimensionale è di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi

Dettagli

I Composti Organici. Le Biomolecole

I Composti Organici. Le Biomolecole I Composti Organici I composti organici sono molecole tutte contenenti carbonio. Essi comprendono. 1. composti di interesse energetico che sono gli Idrocarburi ( i derivati del petrolio), 2. composti a

Dettagli

Università di Roma Tor Vergata - Corso di Laurea in Scienze Biologiche - Immunologia Molecolare - dott. Claudio PIOLI - a.a.

Università di Roma Tor Vergata - Corso di Laurea in Scienze Biologiche - Immunologia Molecolare - dott. Claudio PIOLI - a.a. Anticorpi generalità Riconoscimento antigene Anticorpi Molecole MHC Recettore per l Ag dei linfociti T (TCR) Anticorpi riconoscono diversi tipi di strutture antigeniche macromolecole proteine, lipidi,

Dettagli

Macchine semplici. Vantaggi maggiori si ottengono col verricello differenziale (punto 5.5.) e col paranco differenziale (punto 5.6).

Macchine semplici. Vantaggi maggiori si ottengono col verricello differenziale (punto 5.5.) e col paranco differenziale (punto 5.6). Macchine semplici Premessa Lo studio delle macchine semplici si può considerare come una fase propedeutica allo studio delle macchine composte, poiché il comportamento di molti degli organi che compongono

Dettagli

CAP. 3 Molecole organiche degli organismi: carboidrati, lipidi, amminoacidi, proteine, acidi nucleici.

CAP. 3 Molecole organiche degli organismi: carboidrati, lipidi, amminoacidi, proteine, acidi nucleici. CAP. 3 Molecole organiche degli organismi: carboidrati, lipidi, amminoacidi, proteine, acidi nucleici. 3.1 Molecole organiche degli organismi 3.1.1 I carboidrati CARBOIDRATI: comprendono zuccheri semplici

Dettagli

Aminoacidi e proteine

Aminoacidi e proteine Prof. Giorgio Sartor Aminoacidi e proteine Copyright 2001-2012 by Giorgio Sartor. Versione 1.7.1 mar 2012 All rights reserved. Le cellule V.1.7.1 gsartor 2001-2012 Aminoacidi e proteine -2- Aminoacidi

Dettagli

Lezione 2. Sommario. Bioinformatica. Lezione 2: AMMINOACIDI E POLIPEPTIDI Aminoacidi e proteine. Mauro Ceccanti e Alberto Paoluzzi

Lezione 2. Sommario. Bioinformatica. Lezione 2: AMMINOACIDI E POLIPEPTIDI Aminoacidi e proteine. Mauro Ceccanti e Alberto Paoluzzi Lezione 2 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 2: AMMINOACIDI E POLIPEPTIDI Aminoacidi e proteine Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università

Dettagli

La diagnosi genetica della talassemia. Dott.ssa L.Pagano. Unità Operativa Microcitemia Dipartimento di Onco-Ematologia A.O.R.N. A.

La diagnosi genetica della talassemia. Dott.ssa L.Pagano. Unità Operativa Microcitemia Dipartimento di Onco-Ematologia A.O.R.N. A. Diapositiva 1 La diagnosi genetica della talassemia Dott.ssa L.Pagano Unità Operativa Microcitemia Dipartimento di Onco-Ematologia A.O.R.N. A. Cardarelli Napoli 2 Dicembre 2005 Castel dell Ovo Sala Virgilio

Dettagli

I LIPIDI. - gruppo eterogeneo sia dal punto di vista chimico che funzionale; caratteristica comune è l insolubilità in acqua

I LIPIDI. - gruppo eterogeneo sia dal punto di vista chimico che funzionale; caratteristica comune è l insolubilità in acqua I LIPIDI I LIPIDI - gruppo eterogeneo sia dal punto di vista chimico che funzionale; caratteristica comune è l insolubilità in acqua - ruolo fondamentale di fornitori di energia (circa 9 kcal/grammo),

Dettagli

Struttura e geometria cristallina

Struttura e geometria cristallina Struttura e geometria cristallina Descrizione macroscopica e microscopica Nello studio delle proprietà fisiche della materia è utile distinguere tra descrizione microscopica e descrizione macroscopica

Dettagli

4x4x4=4 3 =64 codoni. 20 aminoacidi

4x4x4=4 3 =64 codoni. 20 aminoacidi 4x4x4=4 3 =64 codoni 20 aminoacidi 1 Le 20 diverse catene laterali (gruppo R) che costituiscono gli aminoacidi si differenziano considerevolmente per dimensioni, volume e per le loro caratteristiche fisico-chimiche,

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

LE PROTEINE. Le proteine sono i biopolimeri piu' abbondanti negli organismi viventi e svolgono funzioni biologiche di fondamentale importanza:

LE PROTEINE. Le proteine sono i biopolimeri piu' abbondanti negli organismi viventi e svolgono funzioni biologiche di fondamentale importanza: LE PRTEINE Le proteine sono i biopolimeri piu' abbondanti negli organismi viventi e svolgono funzioni biologiche di fondamentale importanza: PRTEINE CATALITICHE PRTEINE REGLATRICI PRTEINE DIFESA PRTEINE

Dettagli

La spirale iperbolica: Fu descritta per la prima volta da Pierre Varignon (1654-1722). L equazione, espressa in coordinate polari, è del tipo:

La spirale iperbolica: Fu descritta per la prima volta da Pierre Varignon (1654-1722). L equazione, espressa in coordinate polari, è del tipo: Esistono delle forme geometriche che sono in grado, per complessi fattori psicologici non del tutto chiariti, di comunicarci un senso d equilibrio, di gradimento e di benessere. Tra queste analizzeremo

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Pectinasi. PECTINA composto estratto dalla frutta- MELE E PERE- gelificante. Grado di esterificazione

Pectinasi. PECTINA composto estratto dalla frutta- MELE E PERE- gelificante. Grado di esterificazione Pectinasi Le pectine sono carboidrati complessi che fanno parte della lamella mediana delle cellule vegetali e contribuiscono al mantenimento della struttura dei tessuti vegetali. L unità di base è costituita

Dettagli

Motori passo-passo Caratteristiche, tecniche e circuiti di pilotaggio

Motori passo-passo Caratteristiche, tecniche e circuiti di pilotaggio Motori passo-passo Caratteristiche, tecniche e circuiti di pilotaggio I motori elettrici si possono suddividere in varie categorie (vedi figura 1), che si differenziano a seconda della tensione di alimentazione

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

PROCESSI DI ADESIONE ED ACCRESCIMENTO DEI TESSUTI: BIOMOLECOLE DI INTERESSE APPLICATIVO

PROCESSI DI ADESIONE ED ACCRESCIMENTO DEI TESSUTI: BIOMOLECOLE DI INTERESSE APPLICATIVO Interazione tra Biomateriali e Tessuti Anno Accademico 2004/2005 PROCESSI DI ADESIONE ED ACCRESCIMENTO DEI TESSUTI: BIOMOLECOLE DI INTERESSE APPLICATIVO Premessa Negli ultimi 20 anni, indagini in campo

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

Spettroscopia UV-visibile (parte 2) Bande di assorbimento. Assorbimento UV-vis da parte di proteine ed acidi nucleici

Spettroscopia UV-visibile (parte 2) Bande di assorbimento. Assorbimento UV-vis da parte di proteine ed acidi nucleici (parte 2) Bande di assorbimento Assorbimento UV-vis da parte di proteine ed acidi nucleici Bande d assorbimento Absorbance 1.0 legge di Lambert-Beer A(l)=e l cb 0.5 0.0 350 400 450 Bande d assorbimento

Dettagli

Legame al GMPciclico COOH

Legame al GMPciclico COOH Moduli strutturali delle proteine Nelle proteine è possibile individuare alcune strutture caratterizzate da omologia, che svolgono particolari funzioni, e che si ritrovano in proteine diverse. Si può parlare

Dettagli

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi.

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi. Sommario La molecola di DNA è deputata a conservare le informazioni genetiche necessarie per lo sviluppo ed il funzionamento degli organismi viventi. Poiché contiene le istruzioni per la costruzione delle

Dettagli

Struttura delle proteine

Struttura delle proteine Struttura delle proteine I II III Copyright 2001-2015 by Giorgio Sartor. All rights reserved. Versione 1.0.2 oct 2015 Struttura quaternaria Èil livello di organizzazione per il quale si formano strutture

Dettagli

Funzioni delle proteine del sangue:

Funzioni delle proteine del sangue: PROTEINE DEL SANGUE Funzioni delle proteine del sangue: 1. Funzioni nutrizionali 2. Regolazione dell equilibrio acido base 3. Ripartizione dell acqua nei vari distretti 4. Funzione di trasporto 5. Coagulazione

Dettagli

Marinella Bosetto Irene Lozzi. Elementi di biochimica agraria

Marinella Bosetto Irene Lozzi. Elementi di biochimica agraria A07 25 Marinella Bosetto Irene Lozzi Elementi di biochimica agraria Copyright MMVI ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 A/B 00173 Roma (06) 93781065

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

Amminoacidi e Proteine

Amminoacidi e Proteine Amminoacidi e Proteine Struttura generale di un α-amminoacido R = catena laterale AMMINOACIDI (AA) CELLULARI Gli amminoacidi presenti nella cellula possono essere il prodotto di idrolisi delle proteine

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Catena di Trasporto degli elettroni

Catena di Trasporto degli elettroni Chimica Biologica A.A. 2010-2011 Catena di Trasporto degli elettroni Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano Respirazione - il catabolismo di tutti i combustibili

Dettagli

UNIVERSITÀ DEGLI STUDI DI PADOVA Facoltà di Ingegneria sede di Vicenza A.A. 2007/08

UNIVERSITÀ DEGLI STUDI DI PADOVA Facoltà di Ingegneria sede di Vicenza A.A. 2007/08 UNIVERSITÀ DEGLI STUDI DI PADOVA Facoltà di Ingegneria sede di Vicenza Corso di Disegno Tecnico Industriale per il Corso di Laurea triennale in Ingegneria Meccanica e in Ingegneria Meccatronica Tolleranze

Dettagli

Livello di organizzazione degli esseri viventi

Livello di organizzazione degli esseri viventi Livello di organizzazione degli esseri viventi _Organismo; _Apparato; _Organo; _Tessuti; _Cellule; _Organelli cellulari; _Molecole. Atomo, elemento, molecola, composto, formula, legame, elettronegativita.

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

L E P R O T E I N E. Le proteine sono macromolecole formate dall'unione di molte unità elementari chiamate amminoacidi (AA).

L E P R O T E I N E. Le proteine sono macromolecole formate dall'unione di molte unità elementari chiamate amminoacidi (AA). L E P R O T E I N E ASPETTI GENERALI I protidi o proteine sono i costituenti principali delle cellule, sia animali che vegetali; sono sempre presenti negli esseri viventi dei quali entrano a far parte

Dettagli

Studio mediante Microscopia a Forza Atomica (Atomic Force Microscopy AFM) dell interazione tra DNA e molecole organiche di sintesi

Studio mediante Microscopia a Forza Atomica (Atomic Force Microscopy AFM) dell interazione tra DNA e molecole organiche di sintesi Studio mediante Microscopia a Forza Atomica (Atomic Force Microscopy AFM) dell interazione tra DNA e molecole organiche di sintesi La possibilità di osservare direttamente singole molecole dà grandi vantaggi

Dettagli

delegate a conservare e trasmettere l'informazione genetica. Oggi é noto che sono gli acidi

delegate a conservare e trasmettere l'informazione genetica. Oggi é noto che sono gli acidi 8. Le proteine Il termine "proteina" (dal greco προτειος: di primaria importanza) fu coniato nel 1838 dal chimico svedese J. Berzelius 1 quando ancora si riteneva che le proteine fossero le molecole delegate

Dettagli

Trasformazioni Geometriche 1 Roberto Petroni, 2011

Trasformazioni Geometriche 1 Roberto Petroni, 2011 1 Trasformazioni Geometriche 1 Roberto etroni, 2011 Trasformazioni Geometriche sul piano euclideo 1) Introduzione Def: si dice trasformazione geometrica una corrispondenza biunivoca che associa ad ogni

Dettagli

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale.

E il server più utilizzato, permette di tracciare tutte le operazioni che svolge e di impostare alcuni parametri importanti per il risultato finale. Homology modelling L omology modeling delle proteine è il tipo di predizione di struttura terziaria più semplice ed affidabile. Viene richiesta soltanto una (o più) sequenze di riferimento su cui modellare

Dettagli

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione

Dettagli

Citoscheletro Microfilamenti

Citoscheletro Microfilamenti Citoscheletro Microfilamenti Biotecnologie 1 PROPRIETA DEI MICROTUBULI, FILAMENTI INTERMEDI E FILAMENTI DI ACTINA Uni Texas Da G. Karp, BIOLOGIA CELLULARE E MOLECOLARE, 3a ed, CORRETTA Microfilamenti I

Dettagli

Costituzione dei viventi

Costituzione dei viventi Costituzione dei viventi La materia e costituita da elementi chimici in forma pura o in combinazioni dette composti 25 dei 92 elementi naturali sono costituenti essenziali dei viventi 4 (C, O,, N) costituiscono

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Eurocodici Strutturali

Eurocodici Strutturali Eurocodici Strutturali 5 Capitolo Strutture in acciaio Rappresentazione saldature Unificazione viti/bulloni Indicazioni pratiche collegamenti bullonati Rappresentazione bullonature Caratteristiche dimensionali

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

DISEGNO TECNICO INDUSTRIALE

DISEGNO TECNICO INDUSTRIALE DISEGNO TECNICO INDUSTRIALE COSTRUZIONI GEOMETRICHE Anno Accademico 2014-2015 Le Costruzioni Geometriche Nello studio del disegno tecnico, inteso come linguaggio grafico comune fra i tecnici per la progettazione

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

MISCELAZIONE MECCANICA DEL TERRENO PER VIA UMIDA

MISCELAZIONE MECCANICA DEL TERRENO PER VIA UMIDA 1 Via Arni, 30 55032 Castelnuovo di Garfagnana (LU) MISCELAZIONE MECCANICA DEL TERRENO PER VIA UMIDA SMW ( Soil Mixing Wall ) - trielica RELAZIONE TECNICA DESCRITTIVA Emissione : Castelnuovo di Garfagnana,

Dettagli

Distribuzione e composizione dei liquidi corporei

Distribuzione e composizione dei liquidi corporei Distribuzione e composizione dei liquidi corporei Cavità principali del corpo umano Dee Unglaub Silverthorn, Fisiologia umana 2010 Pearson Italia S.p.A Organizzazione generale dell organismo: un visione

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Lo Stato Superficiale dei Pezzi Meccanici

Lo Stato Superficiale dei Pezzi Meccanici Lo Stato Superficiale dei Pezzi Meccanici Superfici Reali e Nominali Ing. Alessandro Carandina Disegno Tecnico Industriale per Ingegneria Meccanica Disegno tecnico Informazioni qualitative (i vari tipi

Dettagli