Metodi di ionizzazione

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Metodi di ionizzazione"

Transcript

1 Metodi di ionizzazione IL PROCESSO DI IONIZZAZIONE avviene solitamente all interno della sorgente dello spettrometro di massa e può essere realizzato mediante varie tecniche. Dal tipo di processo di ionizzazione dipendono: il numero dei frammenti la natura dei frammenti l abbondanza dei frammenti

2 Metodi di ionizzazione - classificazione Sulla base dell energia energia coinvolta: Alcune tecniche di ionizzazione operano ad alta energia e portano ad una frammentazione spinta, altre operano a bassa energia producendo un numero inferiore di ioni: Tecniche hard: Estesa frammentazione Tecniche Soft informazione PM

3 - TECNICHE HARD Metodi di ionizzazione Ionizzazione elettronica (EI( - Electron Ionisation) - TECNICHE SOFT Ionizzazione chimica (CI( - Chemical Ionisation) Bombardamento con atomi veloci (FAB( - Fast Atom Bombardment) Ionizzazione laser assistita da matrice (MALDI( - Matrix Assisted Laser Desorption Ionisation) Ionizzazione per elettronebulizzazione (ESI - Electrospray Ionisation)

4 Metodi di ionizzazione - classificazione In base al metodo di volatilizzazione che precede la ionizzazione del campione: Ionizzazione per vaporizzazione Ionizzazione per desorbimento Ionizzazione per nebulizzazione - Molecole piccole - Termicamente stabili - volatili - Molecole grandi - Termicamente poco stabili - non volatili Metodi di scelta per:

5 Metodi di ionizzazione Ionizzazione elettronica (EI( - Electron Ionisation) Ionizzazione chimica (CI( - Chemical Ionisation) Bombardamento con atomi veloci (FAB( - Fast Atom Bombardment) Ionizzazione laser assistita da matrice (MALDI( - Matrix Assisted Laser Desorption Ionisation) Ionizzazione per elettronebulizzazione (ESI - ElectroSpray Ionisation)

6 IONIZZAZIONE ELETTRONICA (EI)* Campioni solidi o liquidi volatili e non termolabili possono essere introdotti nella camera di ionizzazione per ionizzazione elettronica attraverso: Introduzione diretta Introduzione indiretta (GC, HPLC) Sorgente a IONIZZAZIONE ELETTRONICA *Il termine impatto elettronico è poco usato

7 Ionizzazione elettronica (EI) Nella sorgente le molecole neutre del campione (M),( in fase gassosa,, interagiscono con un fascio di elettroni generato da un filamento incandescente (Renio o Tugsteno) ) ed accelerato attraverso un potenziale regolabile dall operatore. L energia del fascio è normalmente fissata a 70 ev. Filamento M M M e - Molecole neutre vaporizzate +70 ev

8 Ionizzazione elettronica (EI) Tale interazione determina l'espulsione di un elettrone dalla molecola. Il catione radicalico M +. che si forma è detto ione molecolare. e - + M M e - catione radicalico Es.. Il normal decano + e - 2e- C 10 H 22 C 10 H M +. L energia fornita dall interazione con gli elettroni con la molecola causa la ionizzazione (rimozione di 1 elettrone) ed una frammentazione più o meno estesa delle molecole.

9 Ionizzazione-frammentazione Lo ione M +., dotato di alta energia, può FRAMMENTARSI e generare: molecole e/o radicali NEUTRI (che lo strumento non rileva) cationi e/o radicali cationi (IONI( frammento) Perdita di specie neutre - CH. 3 -e - C 10 H 22 Ionizzazione C 10 H M m/z C 2 H 5. Frammentazione dello ione molecolare C 9 H + 19 m/z 127 C 8 H + 17 m/z 113

10 Ionizzazione-frammentazione Le particelle neutre,, come CH 3., C 2 H 5., sono allontanate dalla pompa da vuoto; le particelle cariche,, come C 10 H +. 22, C 9 H 19+, C 8 H 17+,... sono accelerate e convogliate all analizzatore. Nello spettro appaiono in corrispondenza del loro rapporto massa/carica. m/z 113, 127, 142 C 8 H + 17 C 9 H + 19 C 10 H m/z

11 Sorgente a ionizzazione elettronica (EI) Filamento Ingresso del campione All analizzatore Fascio di elettroni Elettrodi di focalizzazione degli ioni e - + M M e - oltre a ioni monocarichi si possono formare anche ioni con più cariche.

12 Sorgente a ionizzazione elettronica (EI)

13 Caratteristiche (EI) E la modalità più classica, tuttora molto utilizzata. E una ionizzazione hard : si possono avere frammentazioni estese che lasciano poco o nulla dello ione molecolare. Il campione deve essere in stato di vapore. Adatto per composti piccoli (< 800 Da), volatili, termicamente stabili. Interfaccia con GC (separazione di miscele di analiti).

14 IONIZZAZIONE CHIMICA (CI) La CI consiste generalmente nel trasferimento di un PROTONE da un gas reagente (GH),, precedentemente ionizzato, alla molecola neutra M da analizzare per formare uno ione molecolare protonato [M+H] +. GH + + M MH + + G Ionizzazione chimica di M La particolarità è che nello spettro vedremo lo ione molecolare con un unità di massa in più M

15 IONIZZAZIONE CHIMICA (CI vs EI) 3,4-dimetossiacetofenone MW = 180 M +. m/z 180 MH + m/z 181 M + 1

16 IONIZZAZIONE CHIMICA (CI) A questo scopo nella n camera di ionizzazione sono presenti: la molecola da analizzare (M)( ) allo stato gassoso un gas reagente (G) in concentrazioni relativamente elevate (1 a 100).

17 Ionizzazione chimica (CI) 1. Il gas reagente è soggetto a ionizzazione elettronica EI. G G +. Ionizzazione EI del gas reagente G 2. Io ione radicalico del gas reagente G +. reagisce con molecole G neutre e forma ioni GH +. G +. Il gas reagente protonato GH + (acido di Brönsted) fungerà da specie ionizzante attraverso una reazione di trasferimento di un protone (reazione ione-molecola neutra) GH + + M GH + Ionizzazione del gas reagente G MH + + G Ionizzazione chimica di M

18 1. Ionizzazione del gas reagente Es. Metano 1. CH 4 + e > CH e > CH 3+ + H. Lo ione molecolare del metano (CH( +. 4 ) generato per ionizzazione elettronica può reagire con l'eccesso di metano neutro: 2. CH CH > CH 5+ + CH. 3 CH CH > C 2 H 5+ + H 2 + H. C 2 H 5+ + CH -----> C 4 3 H H 2 Il catione CH + 5, un acido forte, può quindi protonare con una reazione acido-base praticamente qualsiasi molecola organica (più basica del metano).

19 2. Trasferimento di un protone 3. Il processo di trasferimento di un protone corrisponde ad una reazione, in fase gas, Acido-Base secondo Brønsted nsted-lowrey CH M CH MH + + CH Ionizzazione chimica di M CH 4 M + 1? 3,4-dimetossiacetofenone

20 Formazione di addotti (metano) Oltre a reazioni di trasferimento protonico che portano alla formazione di ioni [M+H] + si possono osservare altri ioni: meno intensi A valori m/z superiori (nel caso del metano: 15, 29, 41..Da.Da)) a quelli dello ione [M+H] + quali.. [M+15 15] + [M+CH 3 ] + [M+29 29] + [M+C 2 H 5 ] + [M+41 41] + [M+C 3 H 5 ] + Tali ioni sono dovuti a formazione di ADDOTTI con la molecola M. M

21 Formazione di addotti (metanolo) Gas reagente metano: CH 5+ 48% C 2 H 5+ 41% C 3 H 5+ 6% CH 5+ + M MH + + CH 4 C 2 H 5+ + M [M+C 2 H 5 ] + + C 2 H 4 MH + M + 1 [M+C 2 H 5 ] + M + 29

22 Formazione di addotti (metanolo) Utili per identificare o confermare lo ione molecolare. MH + [M+C 2 H 5 ] + [M+C 3 H 5 ] + M + 29 M + 41 CI spectrum (by methane) ) of malonamide of pentobarbital PM = 200).

23 Altri gas reagenti impiegati in CI sono: isobutano, ammoniaca, acetonitrile e metanolo. Isobutano: - Altri gas reagenti 1. i-c 4 H 10 + e > i-c 4 H e - 2. i-c 4 H i-c 4 H > i-c 4 H 9+ + C 4 H 9 +H 2 3. (CH 3 ) 3 C + + M i-c 4 H 9 + MH + + (CH 3 ) 3 C=CH 2 M + 1

24 - Altri gas reagenti Ammoniaca: 1. NH 3 + e > > NH e- 2. NH NH > NH 4+ + NH NH M MH + + NH 3 M + 1 Formazione di addotti : [M+NH 4 ] + [M+18] +

25 Affinità protonica (PA) - Scelta del gas reagente Il gas G deve avere affinità protonica MINORE di quella di M altrimenti non è in grado di cedere il protone alla molecola M GH + + M MH M + + G H = PA (G) PA (M) Gas reagente G CH 4 H 2 O CH 3 OH i-c 4 H 10 NH 3 Acido Brønsted CH + 5 H 3 O + CH 3 OH + 2 i-c 4 H 9 + NH + 4 PA

26 Energia trasferita - Scelta del gas reagente L energia trasferita dai vari ioni secondari (metano, isobutano e ammoniaca) diminuisce nell ordine : CH + 5 > i-c 4 H + 9 > NH + 4 Lo ione NH 4+ trasferisce meno energia allo ione MH + che di conseguenza si frammenterà meno.

27 - Scelta del gas reagente. CH + 5 > i-c 4 H + 9 > NH + 4 Figure 1. CI spectrum (by methane) Malonamide of pentobarbital PM = 200 MH + = 201 Figure 2. CI spectrum (by ammonia) MH + = 201 MINORE FRAMMENTAZIONE

28 - Scelta del gas reagente. CH + 5 > i-c 4 H + 9 > NH + 4 Metilbenzofenone PM = 196

29 - Scelta del gas reagente Dall esame degli spettri registrati con diversi reagenti si arriva alla conclusione che, oltre all informazione sul peso molecolare,, si possono anche ottenere informazioni sulla frammentazione, mediante una oculata scelta del gas reagente.

30 Caratteristiche (CI) E una ionizzazione soft soft. Questa tecnica di ionizzazione genera uno ione molecolare MH + con un bassissimo eccesso di energia (< a 5 ev), e le reazioni di frammentazione sono quindi poco importanti. Ione molecolare sempre presente: informazione PM Minore frammentazione: scarse informazioni sulla struttura

31 EI versus CI EFEDRINA Spettro di Massa per Ionizzazione Elettronica MW= 165 M +.

32 EI versus CI EFEDRINA Spettro di Massa per Ionizzazione Chimica MW= 165 [M+H]+ E una tecnica di ionizzazione ad energia più bassa e consente di rilevare lo ione molecolare.

33 Caratteristiche (CI) Il campione deve essere in stato di vapore Adatto per composti piccoli (< 800 Da), volatili, termicamente stabili. Interfaccia con sistemi cromatografici (HPLC).

34 Ionizzazione per Desorbimento: FAB e MALDI E un processo attraverso il quale una molecola è sia evaporata da una superficie (substrato) che ionizzata. Il campione viene desorbito e ionizzato mediante un processo che sfrutta il bombardamento del substrato contenente il campione, con atomi ad alta energia o fotoni, o frammenti di fissione nucleare. L impatto deposita energia sul campione tramite la matrice e porta al trasferimento delle molecole in fase gassosa e alla ionizzazione

35 Ionizzazione per bombardamento di ioni con atomi veloci - FAB - Fast Atom Bombardment Il campione è miscelato ad una MATRICE LIQUIDA (Glicerolo, Tioglicerolo, Nitrobenzil alcol, dietilammina). La miscela (analita( analita-matrice) ) posta su una sonda opportuna, viene introdotta nella camera della sorgente viene bombardata da un fascio di atomi neutri che si muovono ad alta velocità (atomi neutri pesanti come xenon, argon con un energia cinetica di kev ). Soluzione dell analita in glicerina Sonda

36 Ionizzazione per bombardamento di ioni con atomi veloci (FAB) L impatto degli atomi contro la miscela crea fenomeno di superficie cioè gli atomi impattano sulle superfici e proiettano via molecole di analita. Visione pittorica del bombardamento con atomi veloci sulla superficie della soluzione (dispersione) di glicerina con produzione di ioni positivi e negativi dell analita come pure di specie neutre (N) e ioni di glicerina (G)

37 Ionizzazione per bombardamento di ioni con atomi veloci (FAB) In particolare, si verifica un elevato innalzamento della temperatura, per un breve periodo, troppo breve per causare la rottura dei legami chimici, ma sufficientemente alto da permettere la ionizzazione per protonazione dei composti da analizzare.

38 Ionizzazione per bombardamento di ioni con atomi veloci (FAB) L introduzione di questa tecnica nei primi anni 80 ha rivoluzionato la spettrometria di massa, aprendola alla biologia e alla medicina. In questo tipo di ionizzazione il vantaggio rispetto alle precedenti è costituito dal fatto che il campione non deve essere trasformato in gas o vapore. Questa tecnica può essere quindi applicata anche a molecole grandi poco volatili: peptidi,, piccole proteine, altri biopolimeri (fino a 5000). Ionizzazione soft. Con questa tecnica in genere si evitano ulteriori frammentazioni della molecola in esame, problema presente sia nella ionizzazione chimica che elettronica. Quantità minima circa 20 picomoli

39 MALDI - Matrix Assisted Laser Desorption Ionisation La tecnica MALDI è stata introdotta da Karas e Hillkamp nel 1988 per la ionizzazione di peptidi e di proteine. Successivamente questa tecnica è stata in grado di analizzare altri tipi di biomolecole come oligosaccaridi glicolipidi, nucleotidi e polimeri sintetici. Il campione è cristallizzato con MATRICI CRISTALLINE capaci di assorbire la radiazione UV del laser, (Es.( nicotinic acid or dihydroxybenzoic acid).

40 MALDI - Matrix Assisted Laser Desorption Ionisation Un impulso di raggio laser colpisce la MATRICE CRISTALLINA.. Il laser che emette radiazione UV, ha funzione di aiutare a introdurre energia ergia nel sistema molecolare per promuovere la ionizzazione impedendo contemporaneamente una degradazione termica del campione. - Matrice cristallina (anzichè liquida). - Fascio di fotoni (anziché di atomi). -The final molar ratio sample/matrix matrix is about or around 1/ Ioni prodotti sono spesso solo a singola carica

41 MALDI - Matrix Assisted Laser Desorption Ionisation Molecole di campione matrice Ioni positivi Ioni negativi

42

43 Caratteristiche MALDI MALDI è utilizzato per determinare il peso molecolare di peptidi, proteine, oligonucleotidi,, ed altri composti di origine biologica o sintetica (polimeri sintetici). La quantità di campione richiesta è molto piccola (1( to 10 pmol/ul). - MALDI tollera l impiego di sali e tamponi. Anche se è meglio rimuoverli per ottenere migliori performance.

44 Ionizzazione elettrospray (ESI) L ESI è una tecnica di ionizzazione soft che consente di analizzare molecole grandi, non volatili generando ioni molecolari [M+H[ M+H] + direttamente da una SOLUZIONE del campione. Il campione è sciolto in un solvente opportuno in presenza di piccole quantità di un acido. Capillare dell eletrospray eletrospray FLUSSO DI GAS Controelettrodo CAPILLARE

45 Nebulizzazione La soluzione (<10-3 M) dell analita analita, passando attraverso un capillare di acciaio inossidabile, viene NEBULIZZATA. Si forma un aerosol di piccole goccioline di solvente contenenti il campione. La ionizzazione di solito è spontanea, ma può essere indotta con l aggiunta di reagenti adatti. Capillare dell eletrospray eletrospray Solvente/campione

46 Nebulizzazione In particolare,, poiché l estremità del capillare si trova ad un POTENZIALE ELEVATO (3-6 kv) la nebulizzazione porta alla formazione di goccioline cariche che contengono l analita IONIZZATO. Capillare dell eletrospray eletrospray

47 Nebulizzazione: formazione delle goccioline cariche Meccanismo di formazione delle goccioline cariche Se il potenziale del capillare è positivo,, gli IONI POSITIVI della soluzione elettrolitica si allontanano dal capillare e si accumuleranno sulla superficie del liquido che si trova sulla punta del capillare. are. Gli IONI NEGATIVI saranno invece trattenuti all interno del capillare.

48 Nebulizzazione: formazione delle goccioline cariche Quando la repulsione degli ioni positivi presenti sulla superficie, assieme alla forza esercitata su di essi dal campo elettrico,, vincono la tensione superficiale del liquido si ha l espansione del liquido ido (che si muove seguendo il campo) in un cono (cono( di Taylor),

49 Nebulizzazione: formazione delle goccioline cariche La punta del cono di Taylor,, essendo la parte meno stabile, si allunga a formare un getto sottile si scinde in singole goccioline cariche (spray).

50 Evaporazione del solvente (evaporazione ionica) Le goccioline cariche positivamente,, vengono attratte da un controelettrodo,, che può essere costituito grossolanamente da un capillare mantenuto sotto vuoto e a un potenziale negativo; ; in tal modo e con l aiuto di un flusso di gas ausiliario inerte (N 2 ) riscaldato,, coassiale rispetto alla direzione del flusso di soluzione, il sovente evapora FLUSSO DI GAS Controelettrodo CAPILLARE

51 Evaporazione del solvente Man mano che il solvente contenuto nelle goccioline EVAPORA, queste si rimpiccioliscono (il raggio si riduce), mentre aumenta la densità di carica. In questo modo la forza di repulsione elettrostatica coulombiana, aumentata a causa della forte densità elettrica.

52 Evaporazione del solvente Ad un certo valore del raggio della gocciolina, quando la repulsione supera l effetto di coesione esercitato dalla tensione superficiale della goccia (limite( di Rayleigh*),, si osserva L ESPLOSIONE delle goccioline con formazione di piccolissime goccioline cariche. *Il limite di Rayleigh (il punto in cui la forza di repulsione di Coulomb delle cariche e sulla superficie è uguale alla tensione superficiale della soluzione).

53 Formazione di ioni La formazione di ioni mono e multicarica dalle goccioline è un fenomeno che ha luogo in più stadi attraverso meccanismi tuttora oggetto di discussione:?

54 Evaporazione del solvente e meccanismi di formazione di ioni Meccanismo del residuo carico, (CRM), charged residue model, Dole. Le goccie vanno incontro ad una serie di scissioni che portano alla fine alla produzione di piccole goccie con una o più cariche che trasportano una sola molecola di analita: ioni monocarica o multicarica

55 Evaporazione del solvente e meccanismi di formazione di ioni Meccanismo di evaporazione ionica (IME) ion evaporation model, Iribarne and Thomson). Singole molecole cariche vengono espulse direttamente dalla goccia per ridurre la densità di carica sulla superficie.

56 Gli ioni generati vengono poi indirizzati da un gradiente di campo verso l analizzatore

57 Caratteristiche (ESI) E un metodo di ionizzazione soft per cui si osserva uno ione molecolare integro. Si può formare: - uno ione a carica singola (M+H) + Es. Pentapeptide leucine enkephalin (C 28 PM = Da 28 H N 5 O 7 )

58 Caratteristiche (ESI) - Si possono formare addotti con il sodio (M+Na) + Lo spettro EI non è utile, in quanto il lattosio ha una bassa tensione di vapore ed è termicamente labile: lo spettro non presenta alcun picco caratteristico. ristico. Lo spettro ESI mostra un debole picco dello ione molecolare a m/z 342 e un picco caratteristico [M + 23] +, il picco ione molecolare più sodio. Poiché gli ioni sodio sono ubiquitari in soluzione acquosa, questi addotti con il sodio sono molto comuni.

59 Caratteristiche (ESI) - Spesso vengono prodotti ioni multicarica (z > 1) (multiply charged ions) (M+nH) n+. L ESI infatti può dislocare sulle molecole un numero di cariche (protoni) anche elevato. Siccome ogni misura di MS è una misura del rapporto m/z ne consegue che all'aumentare di z,, il rapporto m/z diminuisce e quindi possono essere analizzate anche sostanze con una elevatissima massa molecolare. Ad esempio, se una molecola di massa relativa M = 9990 Dalton dà uno ione con 10 cariche positive, tale segnale avrà la composizione (M+10 10H) 10 + e quindi il picco corrispondente apparirà a: m/z = (M+10) 10 ( ) = = = 1000 Ciò consente di analizzare anche molecole con ELEVATO PESO MOLECOLARE (ad esempio le proteine) impiegando analizzatori che hanno un range ridotto (limite superiore di PM 1200 Da), ad esempio i quadrupoli.

60 ESI: calcolo della massa degli ioni multicarica Quando la massa molecolare relativa (RMM) è incognita, la si può calcolare da due semplici formule (o meglio il calcolatore la deduce da semplici formule) date da: m/z m 1 e m/z m 2 sono due picchi adiacenti dove m1<m2 n 2 = numero delle cariche dello ione a m/z m 2 H = la massa di un protone M = la massa molecolare relativa (RMM) dell'incognito. Dal momento che i picchi dell'insieme sperimentale formano una serie s in cui ciascun termine differisce dal vicino per una carica, risulta facile per il sistema di elaborazione dati: - identificare la carica associata a ciascun picco - calcolare la massa molecolare da ciascun picco usando M=n(m (m-h) - mediare i valori di massa molecolare. Un opportuno programma di trasformazione presenta poi i dati in uno spettro di massa ricostruito.

61 ESI: calcolo della massa degli ioni multicarica Esempio 1: Spettro ESI di ioni positivi della mioglobina equina (peso molecolare medio 16950,5) Insieme di picchi ciascuno corrispondente alla molecola intatta, ma con diverse cariche (protoni) a partire da z=24 con m/z 707 fino a z=12 con m/z 1413.

62 ESI: calcolo della massa degli ioni multicarica Esempio 1: Deconvoluzione dello spettro ESI multicarica della mioglobina. (peso molecolare 16950,5) Spettro ESI ricostruito

63 ESI: calcolo della massa degli ioni multicarica Esempio 2: protein hen egg white lysozyme MW = Da

64 ESI: calcolo della massa degli ioni multicarica Esempio 2: Deconvoluzione protein hen egg white lysozyme MW = Da Spettro ESI ricostruito

65 Caratteristiche (ESI) ioni multicarica Il numero di cariche positive che una molecola può supportare dipende dal numero di centri basici presenti sulla molecola. La ionizzazione di un peptide ha generato una popolazione di peptidi carichi e non carichi. (In positive ion mode the analyte is sprayed at low ph to encourage positive ion formation. In negative ion the analysis is normally carried out well above a molecules isoelectric point to deprotonate the molecule).

66 Caratteristiche (ESI) ioni multicarica [M+2H] ++ z = 2 [M+H] + m/z z è la carica dello ione = 2 m/z Lo spettro contiene ioni a carica singola (m/z( 379.2) e a doppia carica (m/z( 190.1)

67 Caratteristiche (ESI) ESI è un processo a pressione atmosferica. Ciò rende l ESI un metodo più semplice che può essere accoppiato molto bene con interfacce di tipo HPLC E il metodo di scelta per l analisi di molecole termolabili.. Può essere utilizzato per biopolimeri di piccole e grandi dimensioni (peptides, proteins, carbohydrates,, and DNA fragments), and lipids. Il campione deve essere solubile e stabile in soluzione, deve essere polare e relativamente pulito (free( of nonvolatile buffers, detergents, salts,, etc.).

Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per

Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per Perché la spettrometria di massa potrebbe essere di interesse per Voi? La spettrometria di massa è una tecnica analitica potente usata per identificare prodotti incogniti, per determinazioni quantitative

Dettagli

2. Analisi dei segmenti a. Frammentare le subunità in peptidi

2. Analisi dei segmenti a. Frammentare le subunità in peptidi 1. Preliminari a. Biochimica delle proteine Prof. M. Bolognesi Denaturazione a.a. 2007/2008 delle proteine b. Riduzione e alchilazione dei ponti disolfuro c. Determinazione delle subunità 2. Analisi dei

Dettagli

Spettrometria di Massa

Spettrometria di Massa Spettrometria di Massa Cosa è la spettrometria di massa? Metodo analitico per misurare il peso molecolare di un campione Sono richieste solo concentrazioni picomolari Accuratezza entro lo 0.01% del peso

Dettagli

Che Cos è la SPETTROMETRIA DI MASSA

Che Cos è la SPETTROMETRIA DI MASSA Che Cos è la SPETTROMETRIA DI MASSA AMERICAN SOCIETY FOR MASS SPECTROMETRY SOCIETÀ CHIMICA ITALIANA DIVISIONE DI SPETTROMETRIA DI MASSA Traduzione da What is MASS SPECTROMETRY, ASMS (American Society for

Dettagli

METODI FISICI IN CHIMICA ORGANICA

METODI FISICI IN CHIMICA ORGANICA METODI FISICI IN CHIMICA ORGANICA Spettrometria di massa Testi consigliati: -B. Gioia, R. Stradi,, E. Rossi, Guida al corso di metodi fisici in chimica organica, Vol II, (Massa), Ed. CUSL, Milano 1989

Dettagli

IMPORTANZA DELLA SPETTROMETRIA DI MASSA NEL CAMPO BIOTECNOLOGICO

IMPORTANZA DELLA SPETTROMETRIA DI MASSA NEL CAMPO BIOTECNOLOGICO UNIVERSITA DEGLI STUDI DI URBINO Carlo Bo FACOLTA DI SCIENZE e TECNOLOGIE Corso di laurea in Biotecnologie IMPORTANZA DELLA SPETTROMETRIA DI MASSA NEL CAMPO BIOTECNOLOGICO Docente: Anna Rita Mastrogiacomo

Dettagli

Lenti con orifizi molto piccoli (skimmer o coni) devono comunque permettere passaggio di più ioni possibile per garantire sensibilità

Lenti con orifizi molto piccoli (skimmer o coni) devono comunque permettere passaggio di più ioni possibile per garantire sensibilità IONIZZAZIONE A PRESSIONE ATMOSFERICA ESI Elettrospray API APCI Ionizzazione chimica a pressione atmosferica APPI Fotoionizzazione a pressione atmosferica La CI richiede P più elevata rispetto a quella

Dettagli

LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da

LOTTO 1 - CAPITOLATO TECNICO. Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da 1 All.to 1 LOTTO 1 - CAPITOLATO TECNICO Spettrometro di Massa lineare/reflectron MALDI completo di sistema 2D-gel e HPLC con Spotting caratterizzato da Analizzatore Tubo di volo lineare di almeno 1,5m

Dettagli

PIANO DIDATTICO SCIENZA DEI MATERIALI PER LA CONVERSIONE FOTOVOLTAICA

PIANO DIDATTICO SCIENZA DEI MATERIALI PER LA CONVERSIONE FOTOVOLTAICA PIANO DIDATTICO SCIENZA DEI MATERIALI PER LA CONVERSIONE FOTOVOLTAICA Celle solari: dai mirtilli agli spaghetti CONVERSIONE FOTOVOLTAICA: L ENERGIA DEL FUTURO v Energia inesauribile e rinnovabile v Non

Dettagli

Miscela omogenea monofasica i cui costituenti non è possibile separare meccanicamente

Miscela omogenea monofasica i cui costituenti non è possibile separare meccanicamente Miscela omogenea monofasica i cui costituenti non è possibile separare meccanicamente Soluzioni Sistema Omogeneo (presenta le stesse proprietà in qualsiasi sua porzione) Monofasico Nella fase omogenea

Dettagli

Cromatografia Dal greco chroma : colore, graphein : scrivere 1903 Mikhail Twsett (pigmenti vegetali su carta)

Cromatografia Dal greco chroma : colore, graphein : scrivere 1903 Mikhail Twsett (pigmenti vegetali su carta) Cromatografia Dal greco chroma : colore, graphein : scrivere 1903 Mikhail Twsett (pigmenti vegetali su carta) E il termine generico che indica una serie di tecniche di separazione di molecole simili in

Dettagli

INTERVENTO DI CLAUDIA RICCARDI PLASMAPROMETEO - Dipartimento di Fisica Università degli Studi di Milano - Bicocca

INTERVENTO DI CLAUDIA RICCARDI PLASMAPROMETEO - Dipartimento di Fisica Università degli Studi di Milano - Bicocca INTERVENTO DI CLAUDIA RICCARDI PLASMAPROMETEO - Dipartimento di Fisica Università degli Studi di Milano - Bicocca La ricerca come strumento per lo sviluppo aziendale: sinergia tra università e industria

Dettagli

Tecniche di spettrometria di massa applicabili all analisi del proteoma

Tecniche di spettrometria di massa applicabili all analisi del proteoma Tecniche di spettrometria di massa applicabili all analisi del proteoma In proteomica, la spettrometria di massa non rappresenta soltanto la procedura di elezione per ottenere misure precise della massa

Dettagli

1. Un elemento Ä formato da particelle indivisibili chiamate atomi. 2. Gli atomi di uno specifico elemento hanno proprietå identiche. 3.

1. Un elemento Ä formato da particelle indivisibili chiamate atomi. 2. Gli atomi di uno specifico elemento hanno proprietå identiche. 3. Atomi e molecole Ipotesi di Dalton (primi dell 800) 1. Un elemento Ä formato da particelle indivisibili chiamate atomi. 2. Gli atomi di uno specifico elemento hanno proprietå identiche. 3. Gli atomi dei

Dettagli

L ACQUA : STRUTTURA E PROPRIETA

L ACQUA : STRUTTURA E PROPRIETA L ACQUA : STRUTTURA E PROPRIETA 1. Sostanza più abbondante in tutti gli esseri viventi 2. Più del 70% del peso di tutti gli esseri viventi 3. Influenza la struttura e la proprietà di tutte le molecole

Dettagli

IL MARCATORE TUMORALE

IL MARCATORE TUMORALE IL MARCATORE TUMORALE Un marcatore tumorale è una sostanza rilevabile nei fluidi biologici la cui positività indica la presenza di un tumore. Il marcatore tumorale ideale dovrebbe presentare una completa

Dettagli

Selezione test GIOCHI DELLA CHIMICA

Selezione test GIOCHI DELLA CHIMICA Selezione test GIOCHI DELLA CHIMICA CLASSE A Velocità - Equilibrio - Energia Regionali 2010 36. Se il valore della costante di equilibrio di una reazione chimica diminuisce al crescere della temperatura,

Dettagli

DENSITA La densità è una grandezza fisica che indica la massa, di una sostanza o di un corpo, contenuta nell unità di volume; è data dal rapporto:

DENSITA La densità è una grandezza fisica che indica la massa, di una sostanza o di un corpo, contenuta nell unità di volume; è data dal rapporto: Richiami di Chimica DENSITA La densità è una grandezza fisica che indica la massa, di una sostanza o di un corpo, contenuta nell unità di volume; è data dal rapporto: d = massa / volume unità di misura

Dettagli

APPLICAZIONI INDUSTRIALI DEL PLASMA

APPLICAZIONI INDUSTRIALI DEL PLASMA APPLICAZIONI INDUSTRIALI DEL PLASMA Caratteristiche che rendono il plasma utile per applicazioni industriali: ² È caratterizzato da un ampio range di densità di potenza/energia (plasmi termici in archi

Dettagli

Determinazione della composizione elementare dello ione molecolare. Metodo dell abbondanza isotopica. Misure di massa esatta

Determinazione della composizione elementare dello ione molecolare. Metodo dell abbondanza isotopica. Misure di massa esatta Determinazione della composizione elementare dello ione molecolare Metodo dell abbondanza isotopica Misure di massa esatta PREMESSA: ISOTOPI PICCHI ISOTOPICI Il picco dello ione molecolare è spesso accompagnato

Dettagli

1 atm = 760 mm Hg = 760 torr = 101300 N/m 2 =101300 Pa. Anodo = Polo Positivo Anione = Ione Negativo. Catodo = Polo Negativo Catione = Ione Positivo

1 atm = 760 mm Hg = 760 torr = 101300 N/m 2 =101300 Pa. Anodo = Polo Positivo Anione = Ione Negativo. Catodo = Polo Negativo Catione = Ione Positivo 1) Concetti Generali 1. Unità di Misura: A. Pressione 1 atm = 760 mm Hg = 760 torr = 101300 N/m 2 =101300 Pa. B. Calore 1 joule = 10 7 Erg. 1 caloria = 4,185 joule. Anodo = Polo Positivo Anione = Ione

Dettagli

FILTRO A TESSUTO. Allegato n. Azienda. Punto di emissione n. Temperatura emissione (K) Altezza geometrica di emissione (m)

FILTRO A TESSUTO. Allegato n. Azienda. Punto di emissione n. Temperatura emissione (K) Altezza geometrica di emissione (m) REGIONE EMILIA-ROMAGNA Allegato n. Azienda ASSESSORATO AMBIENTE E DIFESA DEL SUOLO FILTRO A TESSUTO Punto di emissione n. Temperatura emissione (K) Altezza geometrica di emissione (m) Portata massima di

Dettagli

Esame di Chimica Generale (M-Z) A.A. 2011-2012 (25 gennaio 2012)

Esame di Chimica Generale (M-Z) A.A. 2011-2012 (25 gennaio 2012) CORSO DI LAUREA IN SCIENZE BIOLOGICHE Esame di Chimica Generale (M-Z) A.A. 2011-2012 (25 gennaio 2012) 1) Bilanciare la seguente ossidoriduzione: KMnO 4 + H 2 O 2 + H 2 SO 4 MnSO 4 + K 2 SO 4 + O 2 + H

Dettagli

Le condizioni necessarie affinché si produca una combustione sono l esistenza

Le condizioni necessarie affinché si produca una combustione sono l esistenza INCENDI Nell industria di processo l incendio rappresenta il processo più frequente: il calore prodotto e irraggiato provoca generalmente notevoli danni all impianto e pone in serio pericolo l incolumità

Dettagli

ENERGIA DA BIOMASSA. sistemi di combustione e problematiche connesse Bologna 11 novembre 2011. Ing. Francesco Gallucci. Ing.

ENERGIA DA BIOMASSA. sistemi di combustione e problematiche connesse Bologna 11 novembre 2011. Ing. Francesco Gallucci. Ing. ENERGIA DA BIOMASSA sistemi di combustione e problematiche connesse Bologna 11 novembre 2011 Ing. Francesco Gallucci CRA-ING Monterotondo (RM) Ing. Fulvio Palmieri DIMI ROMA TRE Per informazioni, francesco.gallucci@entecra.it

Dettagli

PROTEOMA E PROTEOMICA

PROTEOMA E PROTEOMICA PROTEOMA E PROTEOMICA "The analysis of the entire PROTEin content expressed by a genome, or by a cell or tissue type. Wasinger VC et al, Electrophoresis 16 (1995) PROTEOMICS is the systematic analysis

Dettagli

Cap. 1 - Stati di aggregazione della materia.

Cap. 1 - Stati di aggregazione della materia. Cap. 1 - Stati di aggregazione della materia. Lo stato di aggregazione di un sistema è determinato dalla energia cinetica delle particelle e dall energia potenziale dovuta alle forze di coesione fra le

Dettagli

Tecniche analitiche più usate per le sostanze organiche

Tecniche analitiche più usate per le sostanze organiche Tecniche analitiche più usate per le sostanze organiche Le tecniche analitiche strumentali sono un utilissimo strumento per identificare sostanze incognite (analisi qualitativa), ad esempio per riconoscere

Dettagli

Le tecniche combinate TG/IR e TG/IR/GCMS: principi ed applicazioni

Le tecniche combinate TG/IR e TG/IR/GCMS: principi ed applicazioni Le tecniche combinate TG/IR e TG/IR/GCMS: principi ed applicazioni November 7, Maria 2014 Grazia Garavaglia Materials Characterization Product Specialist San Vito di Altivole, 05 Novembre 2014 2009 PerkinElmer

Dettagli

A cura di Elisa, Alessandro e Riccardo 5ACH. IS Fermi Mantova Progetto Scuola 21 AS 2012-2013

A cura di Elisa, Alessandro e Riccardo 5ACH. IS Fermi Mantova Progetto Scuola 21 AS 2012-2013 A cura di Elisa, Alessandro e Riccardo 5ACH IS Fermi Mantova Progetto Scuola 21 AS 2012-2013 Cromatografia??? La cromatografia è un metodo chimico-fisico che sfrutta la tendenza delle sostanze a distribuirsi

Dettagli

Titolo 1- Sistema strumentale analitico

Titolo 1- Sistema strumentale analitico SCHEDA TECNICA REQUISITI MINIMI LOTTO N. 1 Caratteristiche tecniche dell Unità di Laboratorio per analisi da campionamenti aeriformi ambientali Titolo 1- Sistema strumentale analitico Il sistema dovrà

Dettagli

Corrente elettrica. Esempio LA CORRENTE ELETTRICA CONTINUA. Cos è la corrente elettrica? Definizione di intensità di corrente elettrica

Corrente elettrica. Esempio LA CORRENTE ELETTRICA CONTINUA. Cos è la corrente elettrica? Definizione di intensità di corrente elettrica Corrente elettrica LA CORRENTE ELETTRICA CONTINUA Cos è la corrente elettrica? La corrente elettrica è un flusso di elettroni che si spostano dentro un conduttore dal polo negativo verso il polo positivo

Dettagli

Advertorial. Tramite distillazione molecolare e a film sottile. Tecniche di separazione

Advertorial. Tramite distillazione molecolare e a film sottile. Tecniche di separazione Gli impianti VTA vengono impiegati per la purificazione, la concentrazione, la rimozione dei residui di solventi, la decolorazione e l essiccazione di prodotti in diversi settori industriali: chimico,

Dettagli

Sistema LC/MS Agilent Serie 6210 Time-of-Flight Dai campioni alle risposte

Sistema LC/MS Agilent Serie 6210 Time-of-Flight Dai campioni alle risposte Sistema LC/MS Agilent Serie 6210 Time-of-Flight Dai campioni alle risposte Dai campioni alle risposte Se analizzi sostanze farmaceutiche o campioni ambientali, proteine o peptidi sintetici, il sistema

Dettagli

MODELLO di domanda di autorizzazione alle emissioni in atmosfera da redigere in carta da bollo.

MODELLO di domanda di autorizzazione alle emissioni in atmosfera da redigere in carta da bollo. MODELLO di domanda di autorizzazione alle emissioni in atmosfera da redigere in carta da bollo. Alla Provincia della Spezia Il/la sottoscritto/a... legale rappresentante/titolare della (riportare l esatta

Dettagli

Appunti & trasparenze - Parte 7

Appunti & trasparenze - Parte 7 CdL Scienza dei Materiali - Fisica delle Nanotecnologie - a.a. 2003/4 Appunti & trasparenze - Parte 7 Versione 2, Novembre 2003 Francesco Fuso, tel 0502214305, 0502214293 - fuso@df.unipi.it http://www.df.unipi.it/~fuso/dida

Dettagli

MATERIALI PER L ELETTRONICA - Epitassia 49

MATERIALI PER L ELETTRONICA - Epitassia 49 8 Epitassia Per epitassia si intende la deposizione di sottili strati di materiale cristallino su un substrato massivo, anch'esso cristallino, che ne indirizza la crescita e ne determina le proprietà strutturali.

Dettagli

1. La natura elettrica della materia 2. La scoperta delle proprietà elettriche 3. Le particelle fondamentali dell atomo 4. La scoperta dell elettrone

1. La natura elettrica della materia 2. La scoperta delle proprietà elettriche 3. Le particelle fondamentali dell atomo 4. La scoperta dell elettrone Unità n 7 Le particelle dell atomo 1. La natura elettrica della materia 2. La scoperta delle proprietà elettriche 3. Le particelle fondamentali dell atomo 4. La scoperta dell elettrone 5. L esperimento

Dettagli

Corso di Laurea in OSTETRICIA

Corso di Laurea in OSTETRICIA Disciplina: STATISTICA MEDICA Docente: Prof. Marco FERRARIO Processo induttivo e deduttivo della conoscenza: definizione di popolazioni, campione e unità statistiche, nozioni di teoria del campionamento;

Dettagli

DETERMINATION OF THE ACIDIC PROPERTIES OF MODIFIED SILICAS BY THERMOGRAVIMETRIC ANALYSIS

DETERMINATION OF THE ACIDIC PROPERTIES OF MODIFIED SILICAS BY THERMOGRAVIMETRIC ANALYSIS DETERMINATION OF THE ACIDIC PROPERTIES OF MODIFIED SILICAS BY THERMOGRAVIMETRIC ANALYSIS Antonella Gervasini, Simona Bennici e Paolo Carniti Dipartimento di Chimica Fisica ed Elettrochimica, Università

Dettagli

Capitolo 2 Le trasformazioni fisiche della materia

Capitolo 2 Le trasformazioni fisiche della materia Capitolo 2 Le trasformazioni fisiche della materia 1.Gli stati fisici della materia 2.I sistemi omogenei e i sistemi eterogenei 3.Le sostanze pure e i miscugli 4.I passaggi di stato 5. la teoria particellare

Dettagli

1.3.8.3 Termogravimetro (TG)

1.3.8.3 Termogravimetro (TG) 1.3.8.3 Termogravimetro (TG) Il termogravimetro è un particolare strumento che tramite un'analisi termogravimetrica misura la variazione percentuale di peso di un materiale, quando esso viene riscaldato,

Dettagli

accoppiato con la Spettrometria di Massa. Sviluppo ed Applicazioni in Biochimica Clinica per la Diagnosi e lo

accoppiato con la Spettrometria di Massa. Sviluppo ed Applicazioni in Biochimica Clinica per la Diagnosi e lo Dispositivo per il Desorbimento e la Ionizzazione a Pressione Atmosferica accoppiato con la Spettrometria di Massa. Sviluppo ed Applicazioni in Biochimica Clinica per la Diagnosi e lo Screening degli Errori

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

APPUNTI DI OPTOELETTRONICA ad uso degli studenti

APPUNTI DI OPTOELETTRONICA ad uso degli studenti APPUNTI DI OPTOELETTRONICA ad uso degli studenti Guide ottiche integrate Massimo Brenci IROE-CNR Firenze Esempio di guida ottica integrata Propagazione della luce in una guida ottica integrata (vista in

Dettagli

Dipendenza della Solubilità dalla temperatura

Dipendenza della Solubilità dalla temperatura SOLUBILIZZAZIONE Simile scioglie il simile: le molecole di sostanze diverse si mescolano intimamente nelle miscele se possiedono forze intermolecolari simili (soluzioni ideali). Anche se le forze intermolecolari

Dettagli

La base di partenza per la maggior parte dei processi produttivi di materiali ceramici sono le sospensioni. Queste si ottengono dalla miscelazione di

La base di partenza per la maggior parte dei processi produttivi di materiali ceramici sono le sospensioni. Queste si ottengono dalla miscelazione di La base di partenza per la maggior parte dei processi produttivi di materiali ceramici sono le sospensioni. Queste si ottengono dalla miscelazione di un solido (polvere) che diverrà il ceramico, con un

Dettagli

Elettroforesi degli acidi nucleici

Elettroforesi degli acidi nucleici Elettroforesi degli acidi nucleici Una volta che i frammenti del DNA o del RNA da analizzare sono stati amplificati con la reazione PCR è necessario separarli ed identificarli. A tale scopo si utilizza

Dettagli

Proprietà Elettriche della Materia

Proprietà Elettriche della Materia Proprietà Elettriche della Materia Importanza delle proprietà elettriche della materia Momento di dipolo elettrico (µ) Polarizzabilità (α) Permittività elettrica (ε) Forze intermolecolari Attività ottica

Dettagli

OSSIDORIDUZIONI N H H. H ammoniaca. acido nitroso N = + 3. acido nitrico N = + 5

OSSIDORIDUZIONI N H H. H ammoniaca. acido nitroso N = + 3. acido nitrico N = + 5 OSSIDORIDUZIONI Le reazioni acido-base sono quelle in cui viene scambiato, fra due specie reagenti, un H. Come si è visto, esistono casi di reazioni acido-base in cui ciò non avviene (definizione di Lewis),

Dettagli

Sistemi di separazione di miscele omogenee

Sistemi di separazione di miscele omogenee Sistemi di separazione di miscele omogenee Sistemi di separazione di miscele omogenee I sistemi di separazione delle miscele omogenee riguardano la separazione di un soluto da un solvente (come nel caso

Dettagli

Never impure protein PURIFICAZIONE DI PROTEINE

Never impure protein PURIFICAZIONE DI PROTEINE Never waste pure thoughts on an impure protein PURIFICAZIONE DI PROTEINE PURIFICARE Purificare significa ottenere solamente la nostra molecola di interesse. Purificare una proteina per: Determinarne la

Dettagli

INFORMATIVA N. 7/2011. Tecnologia Plasma a pressione atmosferica Made in Italy

INFORMATIVA N. 7/2011. Tecnologia Plasma a pressione atmosferica Made in Italy INFORMATIVA N. 7/2011 Tecnologia Plasma a pressione atmosferica Made in Italy Lo sviluppo della tecnologia Plasma a livello industriale è, da anni, argomento di studio di molti centri di ricerca a livello

Dettagli

funzionamento degli accumulatori al piombo/acido.

funzionamento degli accumulatori al piombo/acido. Il triangolo dell Incendio Possibili cause d incendio: I carrelli elevatori Particolare attenzione nella individuazione delle cause di un incendio va posta ai carrelli elevatori, normalmente presenti nelle

Dettagli

FISICA-TECNICA Miscela di gas e vapori. Igrometria

FISICA-TECNICA Miscela di gas e vapori. Igrometria FISICA-TECNICA Miscela di gas e vapori. Igrometria Katia Gallucci Spesso è necessario variare il contenuto di vapore presente in una corrente gassosa. Lo studio di come si possono realizzare queste variazioni

Dettagli

Elettroerosione Macchina per elettroerosione

Elettroerosione Macchina per elettroerosione Elettroerosione 1 Macchina per elettroerosione 2 Politecnico di Torino 1 Il processo di elettroerosione Viene generato un campo elettrico tra elettrodo e pezzo Si forma un canale ionizzato tra elettrodo

Dettagli

Leggi dei gas. PV = n RT SISTEMI DI PARTICELLE NON INTERAGENTI. perché le forze tra le molecole sono differenti. Gas perfetti o gas ideali

Leggi dei gas. PV = n RT SISTEMI DI PARTICELLE NON INTERAGENTI. perché le forze tra le molecole sono differenti. Gas perfetti o gas ideali Perché nelle stesse condizioni di temperatura e pressione sostanze differenti possono trovarsi in stati di aggregazione differenti? perché le forze tra le molecole sono differenti Da che cosa hanno origine

Dettagli

L H 2 O nelle cellule vegetali e

L H 2 O nelle cellule vegetali e L H 2 O nelle cellule vegetali e il suo trasporto nella pianta H 2 O 0.96 Å H O 105 H 2s 2 2p 4 tendenza all ibridizzazione sp 3 H δ+ O δ- δ+ 1.75 Å H legame idrogeno O δ- H H δ+ δ+ energia del legame

Dettagli

Spettroscopia UV-visibile (parte 2) Bande di assorbimento. Assorbimento UV-vis da parte di proteine ed acidi nucleici

Spettroscopia UV-visibile (parte 2) Bande di assorbimento. Assorbimento UV-vis da parte di proteine ed acidi nucleici (parte 2) Bande di assorbimento Assorbimento UV-vis da parte di proteine ed acidi nucleici Bande d assorbimento Absorbance 1.0 legge di Lambert-Beer A(l)=e l cb 0.5 0.0 350 400 450 Bande d assorbimento

Dettagli

U.O. FISICA SANITARIA

U.O. FISICA SANITARIA REGIONE LAZIO AZIENDA SANITARIA LOCALE VITERBO U.O. FISICA SANITARIA RADIAZIONI IONIZZANTI E LASER IN AMBIENTE MEDICALE (Informazioni a cura del Dott. L. Chiatti) 1 Parametri caratteristici della radiazione

Dettagli

Dissociazione elettrolitica

Dissociazione elettrolitica Dissociazione elettrolitica Le sostanze ioniche si solubilizzano liberando ioni in soluzione. La dissociazione elettrolitica è il processo con cui un solvente separa ioni di carica opposta e si lega ad

Dettagli

Utilizzo degli Alimentatori a Corrente Costante nelle Applicazioni Industriali

Utilizzo degli Alimentatori a Corrente Costante nelle Applicazioni Industriali Utilizzo degli Alimentatori a Corrente Costante nelle Applicazioni Industriali September, 2012 Nel vasto mondo degli alimentatori possiamo identificare due principali categorie: a Tensione Costante ed

Dettagli

Università telematica Guglielmo Marconi

Università telematica Guglielmo Marconi Università telematica Guglielmo Marconi GGGGG CF Chimica 1 Gli equilibri chimici Argomenti Gli argomenti che fanno parte di questa unità didattica sono: L equilibrio dinamico nelle reazioni chimiche Le

Dettagli

Combustione energia termica trasmissione del calore

Combustione energia termica trasmissione del calore Scheda riassuntiva 6 capitoli 3-4 Combustione energia termica trasmissione del calore Combustibili e combustione Combustione Reazione chimica rapida e con forte produzione di energia termica (esotermica)

Dettagli

di questi il SECONDO PRINCIPIO ΔU sistema isolato= 0

di questi il SECONDO PRINCIPIO ΔU sistema isolato= 0 L entropia e il secondo principio della termodinamica La maggior parte delle reazioni esotermiche risulta spontanea ma esistono numerose eccezioni. In laboratorio, ad esempio, si osserva come la dissoluzione

Dettagli

TECNICHE SPETTROSCOPICHE PER I BENI CULTURALI: SPETTROMETRIA DI FLUORESCENZA X

TECNICHE SPETTROSCOPICHE PER I BENI CULTURALI: SPETTROMETRIA DI FLUORESCENZA X Dipartimento di Scienze Chimiche TECNICHE SPETTROSCOPICHE PER I BENI CULTURALI: SPETTROMETRIA DI FLUORESCENZA X Analisi superficiali via XRF: Le misure sono effettuate in tempi dell ordine di qualche centinaio

Dettagli

NUOVE ENERGIE nella Scuola 4 DICEMBRE, 2012

NUOVE ENERGIE nella Scuola 4 DICEMBRE, 2012 NUOVE ENERGIE nella Scuola 4 DICEMBRE, 2012 ISTITUTO L.PIRELLI - ROMA EMISSIONE DI NEUTRONI LENTI DA PLASMA IN CELLA ELETTROLITICA DOMENICO CIRILLO PRESUPPOSTI IN QUESTA PRESENTAZIONE SI ILLUSTRANO EVIDENZE

Dettagli

L ENERGIA. L energia si trasforma. L energia compie lavoro. A cura di M. Aliberti

L ENERGIA. L energia si trasforma. L energia compie lavoro. A cura di M. Aliberti A cura di M. Aliberti L ENERGIA Spunti per la ricerca Che cos è l energia? Come si manifesta concretamente l energia? Quali forme può assumere? E possibile passare da una forma di energia all altra? Con

Dettagli

STATO LIQUIDO. Si definisce tensione superficiale (γ) il lavoro che bisogna fare per aumentare di 1 cm 2 la superficie del liquido.

STATO LIQUIDO. Si definisce tensione superficiale (γ) il lavoro che bisogna fare per aumentare di 1 cm 2 la superficie del liquido. STTO LIQUIDO Una sostanza liquida è formata da particelle in continuo movimento casuale, come in un gas, tuttavia le particelle restano a contatto le une alle altre e risentono sempre delle notevoli forze

Dettagli

10) Se ad una soluzione aumentiamo la temperatura cosa succede? Dire quale delle seguenti affermazioni è corretta.

10) Se ad una soluzione aumentiamo la temperatura cosa succede? Dire quale delle seguenti affermazioni è corretta. Associazione di Promozione Sociale Lesina (FG) Cognome e Nome Sede: Via Principe di Piemonte, 93-71010 - Lesina (FG) - C.F. 93034730718 Tel. 0882.992808 E-mail: mail@antoniotucci.net - www.agora.lesina.org

Dettagli

RIASSUNTO DI FISICA 3 a LICEO

RIASSUNTO DI FISICA 3 a LICEO RIASSUNTO DI FISICA 3 a LICEO ELETTROLOGIA 1) CONCETTI FONDAMENTALI Cariche elettriche: cariche elettriche dello stesso segno si respingono e cariche elettriche di segno opposto si attraggono. Conduttore:

Dettagli

Stati di aggregazione della materia

Stati di aggregazione della materia SOLIDO: Forma e volume propri. Stati di aggregazione della materia LIQUIDO: Forma del recipiente in cui è contenuto, ma volume proprio. GASSOSO: Forma e volume del recipiente in cui è contenuto. Parametri

Dettagli

La corrente elettrica

La corrente elettrica PROGRAMMA OPERATIVO NAZIONALE Fondo Sociale Europeo "Competenze per lo Sviluppo" Obiettivo C-Azione C1: Dall esperienza alla legge: la Fisica in Laboratorio La corrente elettrica Sommario 1) Corrente elettrica

Dettagli

Facoltà di Medicina e Chirurgia - Corso di Laurea Magistrale a Ciclo Unico in Odontoiatria e Protesi Dentaria. Università degli Studi dell Insubria

Facoltà di Medicina e Chirurgia - Corso di Laurea Magistrale a Ciclo Unico in Odontoiatria e Protesi Dentaria. Università degli Studi dell Insubria Università degli Studi dell Insubria Corso integrato: FISICA E STATISTICA Disciplina: FISICA MEDICA Docente: Dott. Raffaele NOVARIO Recapito: raffaele.novario@uninsubria.it Orario ricevimento: Da concordare

Dettagli

Chimica. Ingegneria Meccanica, Elettrica e Civile Simulazione d'esame

Chimica. Ingegneria Meccanica, Elettrica e Civile Simulazione d'esame Viene qui riportata la prova scritta di simulazione dell'esame di Chimica (per meccanici, elettrici e civili) proposta agli studenti alla fine di ogni tutoraggio di Chimica. Si allega inoltre un estratto

Dettagli

Amminoacidi e Proteine

Amminoacidi e Proteine Amminoacidi e Proteine Struttura generale di un α-amminoacido R = catena laterale AMMINOACIDI (AA) CELLULARI Gli amminoacidi presenti nella cellula possono essere il prodotto di idrolisi delle proteine

Dettagli

ENZIMI CINETICA ENZIMATICA

ENZIMI CINETICA ENZIMATICA ENZIMI PERCHE UNA REAZIONE AVVENGA, SI DEVONO SODDISFARE TRE CONDIZIONI I SUBSTRATI DEVONO ENTRARE IN COLLISIONE LA COLLISIONE DEVE AVVENIRE CON ORIENTAMENTO CORRETTO I REAGENTI DEVONO AVERE ENERGIA SUFFICIENTE

Dettagli

AUSILIARI DI TINTURA

AUSILIARI DI TINTURA Appunti di chimica conciaria lasciati dal prof. Mauro Berto AUSILIARI DI TINTURA Vanno sotto tale denominazione tutti quei composti che vengono aggiunti al bagno di tintura, o prima della vera fase di

Dettagli

PROPRIETÁ CHIMICHE, ELETTRICHE E MAGNETICHE DELL ACQUA

PROPRIETÁ CHIMICHE, ELETTRICHE E MAGNETICHE DELL ACQUA Se si considera l equilibrio alla traslazione verticale tra la tensione superficiale e la forza peso del volume di acqua contenuta in un vaso capillare, si perviene all espressione della quota h che può

Dettagli

Condensazione e premiscelazione con ARENA

Condensazione e premiscelazione con ARENA Condensazione e premiscelazione con ARENA La tecnologia imita la natura 2 PRINCIPIO DI FUNZIONAMENTO DELLA CONDENSAZIONE Nel loro processo di combustione (tabella 1) tutti i combustibili contenenti idrogeno

Dettagli

Indice generale Capitolo 1 Soluzioni e sospensioni Capitolo 2 Sospensioni: separazione delle fasi Capitolo 3 Proprietà colligative delle soluzioni

Indice generale Capitolo 1 Soluzioni e sospensioni Capitolo 2 Sospensioni: separazione delle fasi Capitolo 3 Proprietà colligative delle soluzioni Indice generale Capitolo 1 Soluzioni e sospensioni 1 Soluzioni 2 Sospensioni 4 Soluzioni di elettroliti 5 9 Capitolo 2 Sospensioni: separazione delle fasi 11 Filtrazione 11 Centrifugazione 12 20 Capitolo

Dettagli

Tecniche di Analisi Termica e Diffrazione di Raggi X

Tecniche di Analisi Termica e Diffrazione di Raggi X ESERCITAZIONI DI CHIMICA FISICA A.A 2010/2011 I MODULO 6 crediti (Anna Corrias) Tecniche di Analisi Termica e Diffrazione di Raggi X Analisi Termica Cenni teorici Descrizione esperienze di laboratorio

Dettagli

Trattamenti al plasma per i processi tessili di tintura e finissaggio

Trattamenti al plasma per i processi tessili di tintura e finissaggio Dipartimento di Scienze dei Materiali e Ingegneria Chimica- Politecnico di Torino- Sede di Biella Trattamenti al plasma per i processi tessili di tintura e finissaggio IKME-International Exhibition of

Dettagli

UNIVERSITÀ - OSPEDALE di PADOVA MEDICINA NUCLEARE 1. Medicina Nucleare in Vitro o metodiche radionuclidiche non imaging.

UNIVERSITÀ - OSPEDALE di PADOVA MEDICINA NUCLEARE 1. Medicina Nucleare in Vitro o metodiche radionuclidiche non imaging. UNIVERSITÀ - OSPEDALE di PADOVA MEDICINA NUCLEARE 1 Medicina Nucleare in Vitro o metodiche radionuclidiche non imaging Lezione 1: INTRODUZIONE ED APPARECCHIATURE D. Cecchin, F. Bui INTRODUZIONE Circa il

Dettagli

Competizione tra reazioni di sostituzione e di eliminazione

Competizione tra reazioni di sostituzione e di eliminazione Competizione tra reazioni di sostituzione e di eliminazione C δ + δ - CH 2 G Centro elettrofilo δ + H Centro elettrofilo Potenziale buon gruppo uscente Si distinguono due principali meccanismi di eliminazione:

Dettagli

La materia. La materia è ogni cosa che occupa uno spazio (e possiamo percepire con i nostri sensi).

La materia. La materia è ogni cosa che occupa uno spazio (e possiamo percepire con i nostri sensi). La materia La materia è ogni cosa che occupa uno spazio (e possiamo percepire con i nostri sensi). Essa è costituita da sostanze, ciascuna delle quali è formata da un determinato tipo di particelle piccolissime,

Dettagli

Istituto Superiore di Stato per l'enogastronomia e l'ospitalità Alberghiera. "A. Prever" PROGRAMMAZIONE DISCIPLINARE

Istituto Superiore di Stato per l'enogastronomia e l'ospitalità Alberghiera. A. Prever PROGRAMMAZIONE DISCIPLINARE Istituto Superiore di Stato per l'enogastronomia e l'ospitalità Alberghiera DISCIPLINA: "A. Prever" PROGRAMMAZIONE DISCIPLINARE ANALISI E CONTROLLI CHIMICI DEI PRODOTTI ALIMENTARI CLASSE: IV sez A, B,

Dettagli

4.4 CROMATOGRAFIA LIQUIDA AD ALTE PRESTAZIONI (HPLC)

4.4 CROMATOGRAFIA LIQUIDA AD ALTE PRESTAZIONI (HPLC) 4.4 CROMATOGRAFIA LIQUIDA AD ALTE PRESTAZIONI (HPLC) L HPLC (cromatografia in fase liquida ad alte prestazioni o ad alta pressione) è la moderna evoluzione della cromatografia liquida su colonna (LC).

Dettagli

IMPIANTI PER DEPOSIZIONE A FILM SOTTILE

IMPIANTI PER DEPOSIZIONE A FILM SOTTILE P&P Thin Film Advanced Technologies IMPIANTI PER DEPOSIZIONE A FILM SOTTILE Breve introduzione delle principali parti di un impianto per deposizione sotto vuoto e delle tecnologie più utilizzate TECNOLOGIE

Dettagli

Preparazione e caratterizzazione di nanocompositi polimerici attraverso precursori organo-silanici

Preparazione e caratterizzazione di nanocompositi polimerici attraverso precursori organo-silanici Preparazione e caratterizzazione di nanocompositi polimerici attraverso precursori organo-silanici Ezio Amerio Politecnico di Torino, Dipartimento di Scienza dei Materiali ed Ingegneria Chimica C.so Duca

Dettagli

Metodi di abbattimento delle emissioni. Università di Roma La Sapienza Sistemi Energetici II

Metodi di abbattimento delle emissioni. Università di Roma La Sapienza Sistemi Energetici II Metodi di abbattimento delle emissioni Metodi per l abbattimento l delle emissioni I sistemi di abbattimento delle emissioni a valle della camera di combustione risultano indispensabili qualsiasi sia la

Dettagli

Riccardo Di Liberto Struttura Complessa di Fisica Sanitaria Fondazione IRCCS Policlinico San Matteo -Pavia

Riccardo Di Liberto Struttura Complessa di Fisica Sanitaria Fondazione IRCCS Policlinico San Matteo -Pavia Effetti biologici derivanti da dall interazione tra fasci laser utilizzati nelle applicazioni industriali ed il corpo umano Riccardo Di Liberto Struttura Complessa di Fisica Sanitaria Fondazione IRCCS

Dettagli

La legge di Lambert-Beer

La legge di Lambert-Beer La legge di Lambert-Beer In questa esperienza determinerete la concentrazione di una soluzione incognita di permanganato di potassio per via spettrofotometrica. Generalita La spettroscopia si occupa dell

Dettagli

Spettroscopia 13 C NMR

Spettroscopia 13 C NMR L analisi degli spettri 13 C NMR non differisce molto da quella dell 1 H. La principale differenza risiede nella minore sensibilità osservata nella registrazione degli d spettri 13 C che pertanto richiedono

Dettagli

CAPITOLO I CORRENTE ELETTRICA. Copyright ISHTAR - Ottobre 2003 1

CAPITOLO I CORRENTE ELETTRICA. Copyright ISHTAR - Ottobre 2003 1 CAPITOLO I CORRENTE ELETTRICA Copyright ISHTAR - Ottobre 2003 1 INDICE CORRENTE ELETTRICA...3 INTENSITÀ DI CORRENTE...4 Carica elettrica...4 LE CORRENTI CONTINUE O STAZIONARIE...5 CARICA ELETTRICA ELEMENTARE...6

Dettagli

Danni Biologici da radiazioni ionizzanti

Danni Biologici da radiazioni ionizzanti Università degli Studi di Cagliari Servizio di Fisica Sanitaria e Radioprotezione Danni Biologici da radiazioni ionizzanti Qualità delle radiazioni Dose Danno biologico Limiti di legge Confronto fra esposizioni

Dettagli

EQUILIBRI SIMULTANEI

EQUILIBRI SIMULTANEI EQUILIBRI SIMULTANEI 1. Soluzioni tampone. Per soluzione tampone si intende una soluzione acquosa in grado di mantenere pressoché inalterato il proprio ph, in seguito all'aggiunta di moderate quantità

Dettagli

Introduzione ai metodi strumentali di analisi. Francesco Nobili

Introduzione ai metodi strumentali di analisi. Francesco Nobili Introduzione ai metodi strumentali di analisi Francesco Nobili Le TECNICHE STRUMENTALI prevedono l acquisizione di un SEGNALE ANALITICO di solito di natura elettrica o meccanica che è espressione di una

Dettagli

Quesiti e problemi. 9 Calcola, con l aiuto della tavola periodica, la massa. 10 Calcola la massa molecolare di tre acidi piuttosto

Quesiti e problemi. 9 Calcola, con l aiuto della tavola periodica, la massa. 10 Calcola la massa molecolare di tre acidi piuttosto SUL LIBRO DA PAG 101 A PAG 10 Quesiti e problemi 1 La massa atomica e la massa molecolare 1 Qual è la definizione di unità di massa atomica u? a) è uguale a 1/12 della massa dell atomo di 12 C b) è uguale

Dettagli

2014 2015 CCS - Biologia CCS - Fisica I gas e loro proprietà. I liquidi e loro proprietà

2014 2015 CCS - Biologia CCS - Fisica I gas e loro proprietà. I liquidi e loro proprietà 2014 2015 CCS - Biologia CCS - Fisica I gas e loro proprietà 1 I liquidi e loro proprietà 2 Proprietà Generali dei Gas I gas possono essere espansi all infinito. I gas occupano i loro contenitori uniformemente

Dettagli