Lo Splicing dell RNA. Geni non interrotti

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Lo Splicing dell RNA. Geni non interrotti"


1 Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti, in misura estremamente ridotta nei batteri e nei batteriofagi. Geni non interrotti

2 La scoperta dello splicing Lo splicing fu scoperto nel 1977 attraverso studi di ibridazione DNA-RNA nell adenovirus. La comparazione della mappa di restrizione eseguita sul cdna e quella sul DNA genomico confermò l esistenza principalmente nei eucariotici dei geni interrotti.

3 Caratteristiche generali 1) I Geni sono spaccati più che dispersi 2) Stessa struttura in tutti i tessuti 3) Gli introni presentano codoni di stop in tutti e tre i frames di lettura (UAA-UGA-UAG) Gli esoni sono mediamente circa 150 nucleotidi Gli introni vanno da 200 a nucleotidi, In media circa basi

4 Il paradosso del valore-c Il DNA genomico totale (aploide) caratteristico di un organismo è detto volore-c. Una relazione diretta tra contenuto di DNA e complessità dell organismo si riscontra fino ai nematodi. In alcuni phyla evolutivi si hanno grosse variazioni del contenuto di DNA tra organismi che mostrano la stessa complessità. Comparazione mrna DNA genomico Geni molto complessi sono il risultato di numerosi e lunghi introni e non di prodotti proteici molto lunghi Species Average exon N Average gene length (Kb) Average mrna length (kb) S. cerevisiae 1 1,6 1,6 Fungi 3 1,5 1,5 10 C. elegans ,0 times D. melanogaster 4 11,3 2,7 Chicken 9 13,9 2,4 Mammals 7 16,6 2,2

5 Il rimescolamento degli esoni Modello degli introni precoci: perdita degli introni nei batteri Modello degli introni tardivi: comparsa degli introni durante l evoluzione Probabilmente proteine formate da subunità ripetute come le immunoglobuline si sono evolute per duplicazione e divergenza degli esoni Gli esoni codificano per domini funzionali LDL (plasma low density lipoprotein) EGF (epidermal growth factor).

6 Organizzazione dei geni per l actina Probabilmente alcuni introni sono andati perduti. Il gene primordiale aveva circa 20 introni. 19 differenti posizioni degli introni in differenti organismi

7 La Chimica dello Splicing Lo splicing avviene mediante 2 reazioni di transesterificazione in cui un gruppo OH libero attacca un legame fosfodiesterico. Le sequenze più conservate sono: GU (sito 5 ), AG (sito 3 ) e la A della branch site. 1 Attacco nucleofilo 2 Attacco nucleofilo degradazione Teoricamente ogni sito di splicing 5 potrebbe reagire con qualunque sito di splicing 3 ma normalmente lo splicing avviene tra i siti 5 e 3 dello stesso introne.

8 Struttura della giunzione a tre vie che si forma durante la reazione di splicing Punto di ramificazione C-2 Sito 5 (GU) C-3 Nelle due reazioni di esterificazione non vi è dispendio di energia. L ATP viene poi consumata nell assemblaggio e nel funzionamento del complesso macchinario di splicing.

9 snrna (Fattori di splicing) U1 U2 U5 Il Macchinario dello Spliceosoma Un singolo small nuclear RNA ( basi) + diverse proteine formano lo small nuclear ribonuclear protein (snrnp, snurp ). Lo spliceosoma è formato da circa 150 proteine. U4/U6 Struttura secondaria del U1 snrna umano I domini identificati dalle strutture stem-loop A,B,C e D forniscono i siti di legame per proteine specifiche del U1 snrnp. Il dominio Sm è richiesto per l interazione con proteine comuni. La regione a singolo filamento è complementare al sito 5 di splicing dell introne. Struttura dell snrna U1

10 Le interazioni RNA-RNA e RNA-proteina sono fondamentali per il funzionamento dello spliceosoma U1 e U6 legano il sito 5 di splicing U2 riconosce il punto di ramificazione (branch site) Branch-point binding protein Interazione U2-U6

11 Le fasi della reazione di splicing U1 lega il sito 5 mentre il fattore ausiliario 2AF65 contatta il tratto di pirimidine e il sito 3 di splicing Legame di U2 con il sito di ramificazione (rimozione di BBP) Complesso E (early) U6 lega il sito 5 di splicing Tripla Complesso A La A della branch site viene spinta fuori dal RNA e resa disponibile per la reazione con il sito 5 di splicing U1 viene rilasciato Complesso B Avvicinamento dei siti di splicing U4 viene rilasciato, U6 interagisce con U2 formando il sito attivo in cui avviene la I reazione di transesterificazione (formazione della lariat) Complesso C U5 promuove la II reazione di transesterificazione tra i siti 5 e 3 con conseguente unione dei 2 esoni Degradazione dell introne

12 Formazione del centro catalitico L appaiamento U6-U4 nella tripla è incompatibile con l appaiamento U6-U2. U5 è invece legato alla tripla mediante interazioni proteina-proteina. Il rilascio di U4 permette un cambiamento conformazionale di U6 dove una parte della sequenza rilasciata forma una forcina mentre l altra parte si appaia con una sequenza complementare di U2. Il fattore U2 lega la branch site. Rilascio U4 Spliceosoma di mammifero contenente U1, U2, U4, U5, U6 e proteine addizionali (25 nm x 50 nm). Lo spliceosona è equivalente per grandezza ad una subunità del ribosoma.

13 Self- Splicing (introni del gruppo I e II) Splicing nucleare:richiede il complesso apparato di splicing ed è tipico degli eucarioti. Introni del gruppo II: la chimica e gli intermedi di reazione sono simili ai pre-mrna nucleari. La reazione produce una lariat (introne a cappio). Si ritrova nei geni mitoncondriali ed in alcuni geni procariotici. Introni del gruppo I: un nucleoside libero G con il suo 3 -OH attacca il sito 5 di splicing. La seconda reazione procede normalmente ed il sito 3 dell esone 1 attacca sito 3 di spicing il (5 dell esone 2). L introne rilasciato è lineare. Si ritrova nei geni mitoncondriali ed in alcuni geni procariotici. La struttura secondaria dell RNA negli introni di gruppo I e II è cruciale (non puo essere mutata) per la loro funzione ( nt). In vitro ad opportune concentrazione di ioni positivi si osserva self-splicing.

14 La struttura del sito catalitico formata da U6 ed U2 nello spliceosoma è molto simile alla struttura secondaria intramolecolare che si forma negli introni di gruppo II. Gli introni del gruppo I possono formare riboenzimi

15 Affidabilità del sistema di splicing Un gene umano contiene circa 9 esoni. Gli esoni sono in media 150 nucleotidi mentre gli introni (circa 3000 nt) possono arrivare a molte migliaia di nucleotidi. Di conseguenza gli esoni sono dispersi tra un oceano di sequenze introniche. Meccanismo 1 La subunità maggiore della RNA Polimerasi II ha una coda (CTD) formata dall esapeptide Tyr-Ser-Pro-Thr-Ser-Pro-Ser che va incontro a fosforilazione. Il grado di fosforilazione controlla il richiamo di fattori di splicing e della maturazione dell RNA. La RNA Pol II trasferisce i fattori di splicing sul sito 5 che poi interagiscono con quelli al sito 3 successivo appena questo viene trascritto. Questo meccanismo diminuisce la possibilità di salto degli esoni.

16 Meccanismo 2 Le proteine SR (ricche in Ser ed Arg) si legano agli esoni alle sequenze dette ESE (exonic splicing enhancer) e reclutano alcuni componenti (U1 e U2AF) dello spliceosoma alle giunzioni 5 e 3. Questo meccanismo evita l uso di siti di splicing non corretti. Lo splicing alternativo (troponina T) Lo splicing alternativo può generare centinaia o migliaia di prodotti proteici differenti (gene slo di ratto o DSCAM di Drosophila). Splicing alternativo della troponina T, proteina muscolare di mammifero. Le due forme differiscono per un esone (3 o 4).

17 Cinque modi differenti di splicing alternativo per un mrna Lo splicing alternativo costitutivo Il gene per l antigene T del virus SV40 di scimmia codifica per due proteine: Large T e Small t che sono il risultato dell uso di 2 siti 5 differenti. Rappresenta un caso di estensione dell esone. Si osserva l estensione dell esone 1. Vengono usati i siti di splicing 5 sst e 3 SST. L esone 1 viene fuso con l esone 2. Vengono usati i siti di splicing 5 SST e 3 SST. Entrambe le forme vengono prodotte in una cellula infettata da SV40 ma elevati livelli di SF2/ASF (SR protein) favoriscono l uso dei siti di splicing più vicini e quindi la formazione dello small t

18 Lo splicing alternativo regolato da attivatori e repressori Regolatori: Splicing regolato - Momenti diversi - Condizioni diverse - Diversi tessuti o tipi cellulari ESE o ISE exonic-intronic splicing enhancers ESS o ISS exonic-intronic splicing silencers Proteine SR - Il dominio C-terminale (SR) interagisce con il macchinario di splicing - Il dominio RRM riconosce l RNA

19 Determinazione del sesso in Drosophila Regolazione del gene Sxl Pm Promotore mantenimento Pe Promotore embrionale Nei maschi se la proteina Sxl precoce venisse sintetizzata risulterebbe abortiva per la presenza di un codone di stop Nel moscerino il sesso è determinato dal rapporto tra cromosomi X ed autosomi. Due attivatori SisA e SisB trascrizionali codificati dal cromosoma X stimolano la trascrizione del gene Sxl (Sex-Lethal). Un repressore Dpn (Deadpan), codificato da cromosoma 2, inibisce la trascrizione del gene Sxl. Negli embrioni future femmine si ha un espressione piu elevata degli attivatori SisA-SisB e quindi della proteina Sxl.

20 Inizialmente la proteina Sxl precoce promuove lo splicing alternativo del suo stesso gene (rimozione dell introne che contiene il sito di stop) determinando la formazione di una proteina Sxl attiva. 150 a.a. al CTD 30 a.a. al CTD Altri due regolatorari Tra e Dsx sono coinvolti nella cascata regolativa dello splicing alternativo che determina il sesso nella Drosophila. Sxl promuove l eliminazione dell esone che contiene il sito di stop e favorisce lo splicing alternativo del gene tra. A sua volta il regolatore Tra con Tra-2 stimolano lo splicing alternativo del gene dsx (Double sex). Le proteine Dsx che differiscono per il C- terminale nel maschio e nella femmina controllano i geni del differenziamento del sesso.

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di


Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per



MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e


www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze


Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.


Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta


C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni


eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni


Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione


La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per


Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,


La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)



REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.



DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac


La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:


Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi





Trascrizione negli eucarioti

Trascrizione negli eucarioti Trascrizione negli eucarioti TRASCRIZIONE EUCARIOTI Fattori di trascrizione fattori basali, attivatori (costitutivi, non costitutivi), co-attivatori, repressori Enhancer Promotore 100bp 200bp Enhancer:


La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta


La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle


Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come


Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno


DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti



TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi


Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la


Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,



NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato


Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli


Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina



LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole


LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%


10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo


You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione



REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)


Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo



GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza


Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami


RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)


RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso


Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto


RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.


La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici


Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la



V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una



REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma







L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione


Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO


Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra





Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione


Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi


Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della


Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte


Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi


Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:


Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici


David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi


I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina


RNA 29/10/2014. Struttura chimica del RNA

RNA 29/10/2014. Struttura chimica del RNA I Nucleotidi Hanno Tre Componenti Solo DNA Solo RNA Acidi nucleici RNA http://www.uic.edu/classes/phys/phys461/phys450/anjum04/ Struttura chimica del RNA http://www.ncbi.nlm.nih.gov/b ooks/nbk26887/figure/a978/?



GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e


Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione






IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune


Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)



ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette


Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di


Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà Bioinformatica RNA non codificanti ed RNAi Dott. Alessandro Laganà Piccoli RNA non codificanti Struttura dell RNA RNA regolatore microrna RNAi e sirna 2 Bioinformatica: RNA non codificanti ed RNAi L RNA


DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,


Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso


Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:


Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule





Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati


LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?


DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni


LE MOLECOLE DI RNA: rrna trna mrna

LE MOLECOLE DI RNA: rrna trna mrna LE MOLECOLE DI RNA: rrna trna mrna RNA polimerasi Localizzazione Prodotti Effetti dell α-amanitina I Nucleolo 25S, 17S e 5.8S rrna Nessuno II Nucleoplasma mrna, U1, U2, U4 e U5 Fortemente inibitori III





INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi


Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi


Corso di aggiornamento sulle Biotecnologie CusMiBio

Corso di aggiornamento sulle Biotecnologie CusMiBio Corso di aggiornamento sulle Biotecnologie CusMiBio Regolazione dell espressione genica dal DNA alle proteine Prof. Paolo Plevani, Aula 200, 22/09/2014 LEARNING WEEK Qualche novità e/o stimolo sul controllo


Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.


Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA


Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata
