Regolazione dell espressione genica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Regolazione dell espressione genica"


1 Regolazione dell espressione genica 1

2 Eucarioti pluricellulari -un singolo organismo, utilizzando un unico genoma, deve produrre centinaia di tipi cellulari differenti e specializzati. -le cellule differenziate sono prodotte da popolazioni di cellule immature, non specializzate, dette cellule staminali, attraverso un processo noto come differenziamento cellulare. 2

3 I meccanismi di controllo usati per regolare l espressione dei geni umani a differenza di quelli dei procarioti, devono riuscire a gestire quantità molto superiori di DNA, impacchettati in strutture apparentemente inaccessibili. 3

4 Regolazione trascrizionale Regolazione post-trascrizionale Meccanismi epigenetici e controllo dell espressione genica a lunga distanza 4

5 Cellula umana contiene circa geni RNA genes (rrna, trna, mirna o MIR) Geni per proteine Ogni cellula in un determinato momento esprime solo una piccola parte di questo potenziale ( 5000 geni) Geni housekeeping metabolismo biosintesi membrane cellulari istoni RNA ribosomiali Geni tessuto - specifici DIFFERENZIAMENTO CELLULARE 5

6 NUCLEO Esistono molteplici livelli di regolazione dell espressione genica negli eucarioti controllo trascrizionale: legame di fattori trascrizionali tessuto specifici, legame diretto di ormoni, fattori di crescita o elementi intermedi a elementi responsivi di geni inducibili DNA Trascritto primario (precursore) Meccanismi epigenetici: controllo a lungo raggio mediante rimodellamento della struttura della cromatina controllo post-trascrizionale: splicing alternativo, polya alternativo, RNA editing tessuto-specifico CITOPLASMA controllo traduzionale traduzione mrna mrna controllo del trasporto controllo della stabilità degradazione PROTEINA controllo post-traduzionale PROTEINA attiva o inattiva 6

7 Controllo Genomico Decondensazione della cromatina e espressione genica 7

8 Se si procede all estrazione della cromatina dalle cellule, la si tratta con endonucleasi aspecifiche e si procede quindi all estrazione del DNA, si nota, dopo corsa elettroforetica, che la maggior parte del DNA viene rotto in frammenti di 200 bp o in multipli di tale lunghezza. Il DNA cromosomico è protetto dall azione delle nucleasi perché associato alle proteine istoniche. 8

9 Negli eucarioti superiori i geni inattivi da un punto di vista trascrizionale hanno una struttura cromatinica meno accessibile BamHI 4,6 kb BamHI BamHI 4,6 kb BamHI Globina Globina DNAseI DNAseI Eritroblasto embrionale di 14 giorni Cellule non differenziate MSB Isolamento dei nuclei e digestione con quantità crescente di DnasiI. Estrazione DNA digestione con BamHI Analisi mediante Southern Blot Ibridazione con globina 9

10 Geni attivi da un punto trascrizionale sono più suscettibili di quelli inattivi alla digestione con DNAsiI Sono in una conformazione cromatinica particolare che li rende più accessibili a DNAsiI Il DNA trascrizionalmente inattivo assume una conformazione cromatinica più condensata che protegge il gene globinico dalla digestione con DNAsiI DNA da Eritroblasti di 14 giorni DNA da cellule MBS DnaseI (µg/ml) 0 0,01 0,05 0,1 0,5 1 1,5 1,5 4,6kb 10

11 Esistono anche siti di ipersensibilità alla DnasiI, evidenziabili con trattamenti più blandi. Sono siti probabilmente localizzati al 5 dei geni nelle regioni regolatorie dei geni e sono considerate regioni in cui i nucleosomi sono stati rimossi e quindi più accesibili alle proteine regolatorie 11

12 Gene Expression La regolazione dell espressione genica può avvenire ad ogni passaggio Per la maggior parte dei geni avviene a livello dell inizio della trascrizione. Esso coinvolge cambiamenti della struttura della cromatina al promotore, accompagnati dal legame del apparato basale di trascrizione (inclusa RNA polymerase II) al promotore. Eventi successivi possono modificare il tipo di proteina che viene espressa. 12

13 La decondensazione della cromatina rappresenta un prerequisito dell attivazione trascrizionale 13

14 CROMATINA EUCROMATINA -> TRASCRIZIONE POTENZIALE a) geni housekeeping b) geni tessuto-specifici ETEROCROMATINA FACOLTATIVA -> inattiva quando condensata. Fornisce un meccanismo di compensazione: rapporto geni autosomici/geni X-linked ETEROCROMATINA COSTITUTIVA -> sempre inattiva; Localizzata nelle regioni peri - e centromeriche 14

15 I meccanismi epigenetici Fattori che vengono trasmessi alla progenie, ma che non sono direttamente attribuibili alla sequenza del DNA. I geni mappano tutti in regioni le cui caratteristiche generali possono essere definite inizialmente eucromatiche. In questa regioni, ancora una volta, agiscono i meccanismi epigenetici per tenerle più o meno aperte e quindi più o meno disponibili ad interagire con i meccanismi di controllo trascrizionale. Durante il differenziamento alcune di queste regioni possono eterocromatizzare definitivamente. 15


17 L inattivazione del cromosoma X è un processo epigenetico, cioè un processo che influenza l espressione di geni specifici ed è ereditato dalle cellule figlie senza che avvenga alcuna variazione nella sequenza del DNA. L attività dei geni del cromosoma X nelle femmine dei mammiferi è controllata da strutture cromatiniche piuttosto che dalla sequenza nucleotidica del DNA che forma il cromosoma. Il cromosoma X inattivato (sia esso X materno o X paterno ) è mantenuto nello stato di cromosoma inattivo nella progenie che deriva dalle future divisioni cellulari poiché gli istoni, modificati in modo da determinare repressione trascrizionale, sono fedelmente ereditati in questo stato ad ogni divisione della cellula. 17

18 I meccanismi epigenetici Metilazione del DNA Nelle cellule eucariotiche la metilazione è a carico della Citosina. Solo il 3% delle Citosine sono metilate ed in genere è bersaglio della metilazione la Citosina della doppietta CpG (dinucleotide citosina-guanina). Modificazioni degli istoni Acetilazioni, fosforilazioni e metilazioni, responsabili di cambiamenti conformazionali della cromatina. 18

19 Meccanismi epigenetici: Metilazione del DNA La metilazione del DNA è un processo post-replicativo. L estensione delle modificazioni riguardanti la metilazione del DNA è fondamentalmente decisa durante lo sviluppo. La metilazione del DNA è quindi uno dei meccanismi correlati con il differenziamento cellulare, tramite l inibizione dell espressione genica a livello trascrizionale. 19

20 CpG islands sono bersagli di regolazione CpG islands circondano i promotori di geni espressi costitutivamente e sono non-metilate. Si trovano anche ai promotori di qualche gene tessuto-regolato. Ci sono ~29,000 CpG islands nel genoma umano. La metilazione di una CpG island impedisce la attivazione di un promotore. La repressione è causata da proteine che si legano alle doppietta CpG metilate. 20

21 Quali regioni sono bersaglio della metilazione? Nel genoma umano il 56% dei geni sono associati a isole CpG: tutti i geni housekeeping ed il 40% dei geni con espressione tessuto-specifica I geni tessuto-specifici sono metilati in CpG nei tessuti dove non sono espressi in quanto i geni metilati sono silenti. (B) 21

22 Cambiamenti dello stato di metilazione del DNA durante lo sviluppo dei mammiferi Durante la segmentazione si ha subito una fase di demetilazione, seguita da una metilazione de novo dispersa su tutto il genoma, dopo l impianto. La metilazione de novo è rara dopo la gastrulazione, ma è stata vista frequentemente durante la stabilizzazione di colture in vitro e nei tumori. 22

23 Metilazione del DNA e divisione cellulare La metilazione del DNA è mantenuta durante la replicazione 23

24 espressione genica è associata alla demetilazione Demetilazione al 5 del gene è necessaria per la trascrizione. 24

25 Meccanismi epigenetici: Modificazioni degli Istoni I residui amminoacidici all N-terminale di ciascun istone (20-60 residui) si estendono al di fuori della superficie del nucleosoma. Queste regioni sono particolarmente ricche in lisina (K) che può essere reversibilmente modificata mediante acetilazione, fosforilazione e metilazione. 25

26 26

27 Modificazioni degli istoni H3 e H4 La lisina 9 di H3 può essere sia acetilata che metilata. L acetilazione è associata alla cromatina trascrizionalmente attiva, ma se la regione cromatinica viene metilata a livello del DNA (CpG). Le proteine che si legano al DNA metilato richiamano le deacetilasi istoniche, che rimuovono i gruppi acetile e le metil transferasi istoniche, legate alle CpG binding protein, metilano gli istoni. Il risultato è la condensazione della cromatina. 27

28 L acetilazione degli istoni è associata al controllo dell espressione genica. Il grado di acetilazione degli istoni regola l espressione genica. Gli istoni acetilati hanno un affinità ridotta per il DNA, quindi la cromatina è più aperta. La repressione delle sequenze CpG metilate nei promotori è legata a due proteine che si legano a CpG metilati ed attivano la deacetilazione degli istoni. MeCP1 e MeCP2 (methylated Cpg-binding proteins 1 and 2) 28

29 L acetilazione degli istoni è associata al controllo dell espressione genica MeCP2 acts as a trascriptional repressor and recruits a corepressor complex consisting of the tracription factor repressor msin3a and histone deacetylase. MeCP2 è essenziale per lo sviluppo embrionale e si comporta come repressore funzionale. MeCP2 silenzia l espressione di geni mediante il reclutamento dell attività di HDAC (histone deacetylase) che causa il rimodellamento della cromatina. La rimozione del gruppo acetile dell istone 3 lisina 9 (H3-K9) è seguita dalla metilazione che rappresenta il segnale per proteine quali HP1 che causa la condensazione della cromatina 29

30 Nelle cellule umane, la proteina HP1 si lega alle code dell istone H3, metilato a livello della lisina 9 HP1 Me 9 Me 9 30

31 Silenziamento del telomero I telomeri (e centromeri) sono generalmente nell eterocromatina. I geni sono silenziati Nel telomeri agisce la prot Rap1 che recluta SIR. Sir2 è una deacetilasi, Sir3 e 4 reclutano altri SIR ed espandono il silenziamento SIR = Silent Information Regulator 31

32 Le modificazioni delle code istoniche sono importanti per il successivo assemblamento di fattori di eterocromatinizzazione. In lievito, le proteine SIR si legano alla coda di H4 non acetilata Me 9 Me 9 32

33 Le proteine eterocromatiniche condensano la fibra di 30nm in una struttura maggiormente impaccata 33

34 Le modificazioni delle code istoniche controllano la condensazione e la funzione della Cromatina Le code istoniche sono necessarie affinchè la cromatina possa condensarsi da una struttura a filo di perle ad una fibra di 30nm. Recenti esperimenti indicano che le estrmità N-terminali dell istone H4, in particolare la lisina 16, sono elementi cruciali per la formazione della fibra da 30 nm. Le code istoniche sono soggette a modificazioni post-trduzionali multiple, quali acetilazione, metilazione, fosforilazioe, e ubiquitinazione. Una proteina istonica non ha mai tutte queste modificazioni simultaneamente, ma gli istoni di un singolo nucleosoma possono contenere diversi tipi di modificazioni. 34

35 Attivazione per alterazione della struttura della cromatina L attivatore recluta: Istone acetilasi o chromatin remodeling complexes Facilita il reclutamento di proteine con bromodomini (es. TFIID) 35

36 Legame cooperativo degli attivatori Gli attivatori agiscono in modo sinergico. Ciò può avvenire in diversi modi, e con legami cooperativi 36

37 Modificazioni covalenti delle code degli istoni alterano l accessibilità della cromatina. Lisine: acetilate o metilate Serine: fosforilate Acetilazione: trascrizione attiva Deacetilazione: trascrizione repressa Metilazione: sia attivazione che repressione Proteine con bromodominio riconoscono code istoniche acetilate Proteine con cromodominio riconoscono code istoniche metilate 37

38 Il cromodominio HP1 lega la coda N-terminale dell istone H3 solo quando la lisina 9 è trimetilata. HP1 contiene un secondo dominio, chiamato dominio cromo-ombra, che si trova frequentemente in proteine che contengono cromo domini. Il dominio cromo-ombra, lega altri domini cromo-ombra ed è per questo che la cromatina con la lisina 9 di H3 trimetilata tende a condensarsi per mezzo di HP1. Oltre a legare se stesso il dominio cromo ombra lega l enzima che metila la lisina 9 di H3, noto come meliltrasferasi istonica H3K9 (HMT- H3K9). 38

39 Gli attivatori alterano la cromatina Acetilazione degli istoni e rimodellament o dei nucleosmi sono indotti dagli attivatori 39

40 Acetilazione degli istoni L attivatore lega HAT la cui attività chiama altri attivatori Il bromodomain di TFIID riconosce alcune lisine acetilate della coda di H4, che sono associate a regioni della cromatina attive nella trascrizione 40

41 CARATTERISTICHE DELLA CROMATINA Caratteristica Cromatina attiva Cromatina inattiva Conformazione della cromatina Estesa, aperta Condensata Metilazione del DNA Acetilazione degli istoni Poco metilata Metilata specialmente nelle regioni del promotore Istoni acetilati Istoni non acetilati 41

42 Controllo Trascrizionale Il metodo principale col quale avviene il controllo dell espressione genica negli eucarioti è una trascrizione selettiva, che si ottiene grazie a specifiche DNA binding proteins. 42


44 Fattori coinvolti in gene expression I fattori basali insieme alla RNA polymerase, si legano allo startpoint e TATA box Gli Attivatori sono fattori di trascrizione che riconoscono specifici elementi di corte sequenze consenso. Si legano a siti nel promotore o negli enhancers. Le sequenze che legano vengano chiamate response elements. I Coattivatori danno un collegamento tra gli attivatori e l apparato basale. Non legano il DNA Alcuni regolatori inducono cambiamenti nella cromatina 44

45 Sinergia nella trascrizione Gli attivatori agiscono su molti passaggi diversi e la loro azione è sinergica 45

46 Attivatori hanno domini di legano il DNAbinding e di attivazione Le attività DNA-binding e di attivazione della trascrizione sono in domini indipendenti di un attivatore. Il ruolo del dominio DNA-binding è di portare il dominio di attivazione della trascrizione vicino al promotore. Gal4 regola la trascrizione del gene del galattosio in S. cerevisiae. Si lega a un sito di 17 bp. Ci sono 4 siti, ciascuno lega un dimero di Gal4, che formano la UAS G (Upstream Activating Sequence di Gal) 46

47 Come fa un attivatore a stimolare la trascrizione Due modelli generali : Il modello di reclutamento implica che il solo effetto è di aumentare il legame della RNA polimerase al promotore. Un modello alternativo è che esso induca dei cambiamenti conformazionali nel complesso trascrizionale, che ne aumenta l efficienza. 47

48 Attivazione per reclutamento L attivatore può legare il mediatore che è associato alla pol-ii o a fattori di trascrizione (TFII-D) 48

49 I coattivatori sono fattori di trascrizione la cui specificità è data dalla capacità di legare DNA-binding transcription factors invece di legare direttamente il DNA. Quando un attivatore funziona tramite un coattivatore la connessione prevede legami non covalenti tra le due proteine I contatti con l apparato basale possono essere fatti con ognuno dei vari fattori basali, tipicamente TF II D, TF II B, or TF II A. 49

50 Tutti i componenti necessari per una trascrizione efficiente: basal factors, RNA polymerase, activators, coactivators formano un apparato molto grande, di >40 proteine. Alcuni attivatori, coattivatori, e fattori basali possono assemblarsi uno dopo l altro al promotore, ma poi possono unirsi ad un complesso molto grande fatto dalla RNA polimerasi preassemblata con altri attivatori e coattivatori. 50

51 Una serie di fattori trascrizionali deve legarsi al promotore prima che possa farlo la RNA polimerasi. Quindi se la RNA polimerasi potrà iniziare la trascrizione dipenderà anche dal legame di proteine regolatorie, attivatori e repressori. Elementi distali Elementi prossimali Promotore basale 51

52 Il promotore del gene umano dell insulina Nero: fattori ubiquitari Rossi: fattori specifici delle cellule beta pancreatiche 52

53 Gli attivatori trascrizionali sono proteine modulari composte da distinti domini funzionali 53

54 Repressori e attivatori possono dirigere la deacetilazione/acetilazione degli istoni a livello di specifici geni Importanza della struttura modulare e delle interazioni proteina-proteina 54

55 55

56 Attività a distanza: anse e isolatori Gli enhancers agiscono anche a 100 kb dal gene. Essi possono essere portati sul gene dalla formazione di anse e dalla struttura della cromatina Gli insulators bloccano l attivazione promossa dagli enhancers 56

57 Enhancer Una sequenza enhancer classica contiene al suo interno parecchi elementi di controllo differenti, ognuno dei quali è costituito da una corta sequenza di DNA che funziona da sito di legame per uno specifico fattore di trascrizione regolativo (attivatore). Spesso i siti di legame possono essere gli stessi presenti nelle sequenze prossimali. I silencer sono meno abbondanti, legano fattori in grado di ridurre l efficienza di trascrizione (repressori). 57

58 L enhanceosome dell interferone IFN-beta è indotto da infezione virale Questa causa la sintesi di NFkB, IRF e Jun/ATF Questi si legano ad unsito 1 kb upstream il promotore in un complesso cui partecipa HMG, un fattore strutturale beta 58

59 Insulators Gli insulators delimitano un dominio di espressione si localizzano preferenzialmente nelle interbande possono bloccare il passaggio degli effetti attivanti o disattivanti dagli enhancers, silencers, o LCRs. possono agire da barriera contro la propagazione della heterochromatin 59

60 Insulators e struttura della Forse gli insulators agiscono sulla struttura del DNA cromatina Possono organizzare anse di DNA che limitano le interazioni attivatore-promotore 60

61 L espressione dei 5 geni cambia con lo sviluppo Tutti i geni sono sotto il controllo di LCR LCR controlla la condensazione della cromatina Il cluster dei geni delle betaglobine 61

62 Regioni di controllo: LCR Il Locus Control Region (LCR) è kb a monte dei geni della beta-globina. Regola l apertura della cromatina per l accesso dei fattori di regolazione 62

63 10_23_2.jpg COMPETIZIONE l espressione di alcuni geni (geni umani delle globine) è coordinata da una regione di controllo dominante LCR localizzata a monte dei geni delle globine 63

64 z 2 e 2, Emoglobina Embrionale (espressione nel sacco vitellino) a 2 g 2 HbF Emoglobina fetale (espressione nel fegato e nella milza) a 2 d 2 HbA 2 Emoglobina dell adulto a 2 b 2 HbA Le LCR funzionano da enhancer per la trascrizione dei geni globinici Siti ipersensibili a DNAsi I Eritroide-specifici (enhancer) Altri siti ipersensibili nella regione dei promotori dei singoli geni -> specificità dello stadio di sviluppo. Siti ipersensibili del fegato fetale Siti ipersensibili nel midollo osseo adulto 64

65 Esempio: beta globina Proteine regolatorie: GATA-1 (fattore di trascrizione) è eritroidespecifica CP1 (fattore di trascrizione) ubiquitaria 65

66 Alcune proteine che legano il promotore sono repressori. La repressione solitamente avviene modificando la struttura della cromatina, ma ci sono repressori che agiscono legandosi a promotori specifici. repressori Eucariotici che bloccano la trascrizione sono relativamente rari. Un esempio è il repressore globale NC2/Dr1/DRAP1, un eterodimero che lega TBP(TATA Box-Binding protein) per impedirne la interazione con altri componenti del apparato basale 66

67 Repressori 67

68 SWI/SNF: (proteine che rimodellano la cromatina) HAT: (histon acetiltransferasi) Gli attivatori interagiscono con i coattivatori e stimolano il rimodellamento della cromatina e l acetilazione degli istoni Un grosso complesso multiproteico, detto mediatore funge da ponte, legando sia le proteine attivatrici, associate all enhancer, sia la RNA pol., in modo da connettere gli enhancer con i componenti coinvolti nell inizio della trascrizione genica. 68

69 Ciascun elemento presente in un promotore possiede una specifica sequenza consenso che lega i fattori di attivazione ubiquitari della trascrizione. Il legame dei fattori trascrizionali avviene nel sito consenso che include un numero variabile di nucleotidi a seconda del promotore. CTF è un membro di una famiglia proteica di fattori trascrizionali NF-1 è un fattore nucleare-1 SP-1 è un fattore trascrizionale ubiquitario 69

70 Regolazione della trascrizione da glucocorticoidi Gli ormoni lipofili diffondono attraverso la membrana plasmatica, ma solo nelle cellule bersaglio trovano il loro recettore specifico ad elevata affinità, con cui si associano. Il complesso ormone-recettore va incontro ad una reazione di attivazione temperatura e concentrazione salina dipendente, che ne determina un cambiamento delle dimensioni, della conformazione e della carica superficiale che lo rendono capace di legarsi alla cromatina. In alcuni casi, come nel caso del recettore per i glucocorticoidi, l attivazione provoca la dissociazione del recettore da un altra proteina come la proteina 90 da shock termico (HSP 90). 70

71 HSP90 maschera il sito legante il DNA dei Recettori per gli steroidi DNA SR hsp90 Elementi di Fisiologia A.A

72 Attivazione della trascrizione genica operata da recettori nucleari per gli ormoni steroidei (ER) hsp50 hsp70 hsp90 ER E 2 ER hsp50 hsp70 hsp90 ERER hsp90 hsp90 hsp50 hsp50 hsp70 HAT Histone-Acetyl-Transferase hsp70 ERER TATA Elementi di Fisiologia A.A

73 Il complessso recettore-ormone si lega a specifici regioni del DNA (dette elementi di risposta dell ormone) determinando l attivazione oppure l inattivazione di specifici geni. Si ha cosi una selettiva modulazione della trascrizione di particolari geni e della produzione delle corrispondenti molecole di mrna, in questo modo gli ormoni riescono a controllare la sintesi di specifiche proteine e a influenzare i processi metabolici della cellula. 73

74 L HRE deve associarsi con altri elementi per agire in modo ottimale. Questi complessi di DNA sono detti unita di risposta all ormone (HRU). Quindi una HRU è costituita da una o più HRE e uno o più elementi di DNA asssociati con fattori accessori. La comunicazione tra un HRU e l apparato trascrizionale di base è resa possibile dall intervento di una o piu molecole appartenenti a una classe di coregolatori. La prima di queste molecole ad essere stata descritta è la proteina legante CREB (la proteina legante l elemento di risposta al camp) detta CBP. 74

75 CBP attraverso un dominio amminoterminale, lega il residuo fosforilato di serina 137 di CREB mediante la transattivazione in risposta al camp. CBP e un altra proteina strettamente correlata, la P300, interagiscono con diverse molecole segnalatrici tra cui la proteina attivatrice-1 (AP-1), trasduttori del segnale, attivatori della trascrizione (STAT), recettori nucleari e CREB. E importante notare che il complesso CBP/P300 presenta anche un attivita intrinseca istone acetil-transferasica (HAT). 75

76 Regolazione della trascrizione da ormoni steroidi In molti geni regolati dagli ormoni steroidei è stato individuato un secondo elemento di risposta (HRE) che si trova all estremita 5 rispetto all elemento promotore. L HRE presumibilmente modula la frequenza di inizio della trascrizione e dipende in misura minore dalla posizione e dall orientamento. Sembra che sia simile agli elementi amplificatori della trascrizione presenti in altri geni. 76

77 Diversi elementi hanno effetti diversi sul livello di trascrizione, alcuni con effetti maggiori di altri, e alcuni possono anche attivare la risposta tessuto specifica. Il legame dei fattori trascrizionali all elemento di risposta per gli steroidi, modula la frequenza di trascrizione del messaggero. MyoD è un fattore specifico delle cellule muscolari GRE è l elemento di risposta ai glucocorticoidi 77

78 Somiglianza fra i diversi recettori steroidei Nei recettori steroidei, le regioni di legame per il DNA e quelle di legame per gli ormoni condividono un alto grado di omologia. Il recettore per gli estrogeni è meno simile al recettore dei glucocorticoidi di quanto non lo siano gli altri recettori steroidei. AR=recettore degli androgeni; ER=recettore per gli estrogeni; GR=recettore per i glucocorticoidi; MR=recettore per i mineralcorticoidi; PR=recettore per il progesterone. I numeri indicano il grado di omologia 78

79 Come avviene l interazione DNAproteine? Le proteine con DNA binding domains hanno dei motivi particolari: A) Motivo helix-turn-helix (elicagiro-elica), consiste di due a eliche separate da un ripiegamento della catena polipeptidica. Il motivo è sempre lo stesso: una a elica di riconoscimento, che con le catene laterali dei suoi residui amminoacidici riconosce specifiche sequenze di DNA (posizionate nel solco maggiore della doppia elica) alle quali si lega (leg. idrogeno). La seconda a elica stabilizza la conformazione generale. C) Motivo Zinc finger (a dita di zinco), è constituito da una a elica e da due segmenti a foglietti b, tenuti insieme da residui di cisteina o istidina, posti in modo preciso, con un atomo di zinco. Il numero di zinc finger varia tra un fattore di trascrizione e un altro. Le strutture zinc finger protrudono dalla superficie della proteina e servono da punto di contatto con specifiche sequenze di DNA posizionate nel solco maggiore della doppia elica. 79

80 Le dita di zinco sono sequenze molto comuni che permettono alla proteina di legare il DNA a doppio filamento. X= qualsiasi amminoacido 80

81 D) Motivo leucine zipper (a cerniera di leucine), è formato dall interazione di due catene polipeptidiche, ognuna contenente una α elica con residui di leucina (a.a. idrofobico) regolarmente spaziati. Le leucine, interagendo tra di loro, provocano un attorcigliamento delle due eliche. Il motivo è utilizzato per unire due polipeptidi uguali o diversi. Il legame al DNA è reso possibile dalla presenza di due ulteriori regioni ad α elica che interagiscono con le sequenze del solco maggiore. E) Motivo helix-loop-helix (elicaansa-elica), consiste di due α eliche una più piccola e una più grande, separate da un ansa. I motivi helix-loop-helix contengono regioni idrofobiche che permettono di connettere due polipeptidi uguali o diversi. La formazione di un fascio di 4 α eliche provoca la giustapposizione dell elica di riconoscimento di un polipeptide con quella dell altro, creando così un dominio di legame al DNA bipartito. 81

82 Il legame dei fattori trascrizionali al DNA coinvolge una piccola porzione di proteina, la quale entra in contatto con il solco maggiore e/o solco minore della doppia elica del DNA che deve essere trascritto. Le cerniere di leucina possiedono sempre dei residui idrofobici di leucina da un lato dell elica, che permettono a due cerniere di leucina d interagire tra loro attraverso legami idrofobici. HTL= elica-ansa-elica; HTH= elica-giro-elica 82

83 Controllo post-trascrizionale 83

84 L uso di promotori alternativi, di splicing alternativi, di poliadenilazioni alternative e di editing, può dare luogo a isoforme diverse con proprietà differenti quali : Isoforme tessuto-specifiche. Gene DMD (gene mutato nella distrofia muscolare di Duchenne) presenta otto promotori diversi a seconda del tessuto, che danno origine a 8 diverse proteine Isoforme stadio di sviluppo specifiche Isoforme transmembrana o solubili Diversa localizzazione cellulare Funzione cambiata -> isoforme di fattori trascrizionali che agiscono da attivatori o repressori a seconda dei domini contenuti Lo splicing alternativo è controllato da proteine che si legano alle molecole di premrna e fanno in modo che alcuni siti di splicing non vengano utilizzati e altri siano invece attivati. 84

85 L editing ( modifica ) dell RNA del gene APOB nell uomo genera trascritti tessuto-specifici Nell intestino tenue, l editing del nucleotide 6666 del mrna di ApoB, cambia una citosina in uracile, converte un codone per la glutammina nel mrna per ApoB 100 in un codone stop prematuro e quindi produce la proteina troncata ApoB

86 Il legame di proteine specifiche all elemento di risposta per il ferro (IRE) dell mrna di un gene che risponde alle variazioni delle concentrazioni di ferro, può alterare in diversi modi la traduzione dell mrna in proteine funzionali. Quando si manifesta una carenza di ferro, la proteina che lega l elemento di risposta al ferro (IRE-BP) è attiva e può legarsi all estremità 3 dell mrna per il recettore della trasferrina. Questo evento previene la degradazione dell mrna e quindi aumenta la quantità di recettore per la trasferrina che può essere sintetizzata (parte sinistra della figura) aumentando di conseguenza la quantità di ferro che il recettore può inviare alla cellula. La IRE-BP lega anche l estremità 5 dell mrna per la ferritina e blocca la traduzione. La ferritina è una proteina che sequestra e immagazzina nel citoplasma il ferro e risulta meno richiesta in condizione di carenza di ferro. 86

87 I cromosomi sessuali sono di due tipi, X e Y, con l X sostanzialmente più grande dell Y. Le femmine possiedono due cromosomi X, mentre i maschi hanno un cromosoma X e uno Y. Una regione del cromosoma Y è identica a una regione del cromosoma X, ma il cromosoma X contiene anche geni che non sono presenti sul cromosoma Y, per esempio SRY un gene determinante il sesso. Questi geni sono monoallelici e non hanno alcuna possibilità di scelta per quale allele verrà scelto. Nell uomo, i geni sono stati identificati come biallelici, ma solo un allele, materno o paterno, è espresso prevalentemente, nonostante entrambi gli alleli siano perfettamente normali e identici. 87

88 Il risultato è che il 50% dei prodotti genici viene sintetizzato, ma il prodotto è funzionalmente attivo. Quindi, in ogni caso, nelle femmine uno dei due cromosomi X è inattivato durante una fase precoce dell embriogenesi. Il cromosoma X-inattivato può ancora esprimere alcuni geni, incluso l XIST ( trascritto specifico dell X inattivato ) il quale codifica per un RNA che gioca un ruolo fondamentale nella inattivazione dell X. Il cromosoma X-inattivato viene riattivato nelle femmine durante l ovogenesi. 88

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,



REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)


Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.


Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di


Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della


eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni


Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la


Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per





La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza



REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.





Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di


Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi


C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni


COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.!

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! rimodellatori? Svolgimento del DNA nucleosmale a par6re


Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e


Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti


Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli


Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,



DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze



REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma


Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo


Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte


Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI


Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,


Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,


Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette


DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,


Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili.

Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. La sensibilita delle vie di trasduzione dipende da 3 fattori: -l affinita


- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi Ciclo Cellulare M --> G1--> S --> G2 --> M S, G2 e M hanno durata sempre uguale mentre la fase G1 (in media 10 ore) può subire enormi variazioni da tessuto a tessuto (fino a migliaia di ore per i neuroni).



LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello



V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici Fattori estrinseci Ambiente Danno genotossico


Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,


scaricato da

scaricato da Recettori a tirosina chinasi I recettori a tirosina chinasi presentano vari domini Una regione di legame (extracellulare) Una regione transmembrana Una coda intracellulare con numerose tirosine scaricato


Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello


Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti


04/04/14. Fondamenti di biochimica Terza edizione. Le ghiandole principali del sistema endocrino. Capitolo 13 La segnalazione biochimica

04/04/14. Fondamenti di biochimica Terza edizione. Le ghiandole principali del sistema endocrino. Capitolo 13 La segnalazione biochimica Fondamenti di biochimica Terza edizione Donald Voet Judith G. Voet Charlotte W. Pratt La segnalazione biochimica Copyright 2013 Zanichelli editore S.p.A. Gli ormoni Conce& chiave 13.1 Gli ormoni endocrini


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti NUCLEO Il nucleo è la centrale operativa che controlla i vari processi che si svolgono dentro la cellula. Contiene il materiale genetico DNA e proteine. Quando la cellula è a riposo il DNA è sotto forma


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:


Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione



MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e


La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta


Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione


RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.


Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis


Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula Mediatore chimico Recettore Trasduzione del segnale Risposta della cellula I mediatori chimici sono prodotti da cellule specializzate e sono diffusi nell organismo da apparati di distribuzione Sistemi


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina



SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e


Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule


Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico

Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico rocessi biologici in cui sono coinvolti sistemi a due componenti Utilizzazione di elementi necessari alla crescita (azoto); NtrC Virulenza (BvgAS di Bordetella pertussis) Resistenza a metalli pesanti (pco)





Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione


Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e



GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e





Relazione struttura-funzione

Relazione struttura-funzione Biotecnologie applicate alla progettazione e sviluppo di molecole biologicamente attive A.A. 2010-2011 Modulo di Biologia Strutturale Relazione struttura-funzione Marco Nardini Dipartimento di Scienze





Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso


Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO


Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità



MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della


Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4 Indice Prefazione XIII Protein Data Bank: una nota degli autori XIV Nota all edizione italiana XV Ringraziamenti XVI CAPITOLO 1 Dalla sequenza alla struttura 1.0 Visione d insieme: funzione e architettura


Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto


Gene number 19,000 30,000

Gene number 19,000 30,000 Gene number 6000 19,000 13,500 30,000 30,000 MODULI: Nucleotidi (4) Amino acidi (21) Domini proteici/proteine (Domini di interazione proteina-proteina Proteina/DNA o Proteina /RNA Interazione con membrana


D ora in poi ci occuperemo, per semplicità, soltanto della RNA polimerasi II.

D ora in poi ci occuperemo, per semplicità, soltanto della RNA polimerasi II. RNA Polimerasi di eucarioti (vedi Alberts III ed. pag.483) Il processo di sintesi di RNA su di uno stampo di DNA presenta, negli eucarioti, una complessità assai elevata. A tutt oggi mancano ancora alcune


Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%





Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno


DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti


LE MOLECOLE DI RNA: rrna trna mrna

LE MOLECOLE DI RNA: rrna trna mrna LE MOLECOLE DI RNA: rrna trna mrna RNA polimerasi Localizzazione Prodotti Effetti dell α-amanitina I Nucleolo 25S, 17S e 5.8S rrna Nessuno II Nucleoplasma mrna, U1, U2, U4 e U5 Fortemente inibitori III


Corso di aggiornamento sulle Biotecnologie CusMiBio

Corso di aggiornamento sulle Biotecnologie CusMiBio Corso di aggiornamento sulle Biotecnologie CusMiBio Regolazione dell espressione genica dal DNA alle proteine Prof. Paolo Plevani, Aula 200, 22/09/2014 LEARNING WEEK Qualche novità e/o stimolo sul controllo


Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari



MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE Nell ultima fase della sintesi proteica la catena polipeptidica neosintetizzata assume spontaneamente la sua conformazione nativa (massimo numero di legami


Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro


SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli FARMACODINAMICA La farmacodinamica può essere definita come lo studio degli effetti biochimici e fisiologici dei farmaci e dei loro meccanismi d azione. Gli obiettivi dell analisi


Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse


LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?


Citosol Ribosomi Sintesi proteica

Citosol Ribosomi Sintesi proteica CITOSOL (1) Citosol Ribosomi Sintesi proteica Biotecnologie_2012 Tutta la porzione non strutturata che costituisce la parte liquida del citoplasma. In esso si trovano in soluzione tutte le molecole necessarie







PROTEINE. Amminoacidi

PROTEINE. Amminoacidi PROTEINE Le proteine sono le macromolecole alla base delle attività cellulari. Sono oltre diecimila per cellula, dove svolgono differenti funzioni: Sono ad esempio: enzimi: aumentano la velocità delle


Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte


unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie


Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere


Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la


Trasduzione del Segnale da Recettori di Superfice

Trasduzione del Segnale da Recettori di Superfice Trasduzione del Segnale da Recettori di Superfice MEMBRANA 1. Legame recettore-ligando 2. oligomerizzazione 3. Attivazione TYR-K -Dominio citosolico dei RTK -Reclutamento TYR-K (src, jak, fak, abl) 4.
