Malattie da singolo gene non ereditate in modo mendeliano. (Mitocondriali)

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Malattie da singolo gene non ereditate in modo mendeliano. (Mitocondriali)"

Transcript

1 Malattie da singolo gene non ereditate in modo mendeliano (Mitocondriali)

2 Solo per queste non si seguono le leggi di Mendel E' stato stimato che ogni cellula puo contenere da un centinaio a qualche migliaio di mitocondri, e che ogni mitocondrio contiene approssimativamente cinque molecole di DNA mitocondriale. Delle oltre 900 proteine mitocondriali, solo 13 sono codificate dal genoma mitocondriale (fosforilazione ossidativa), 22tRNA e 2rRNA. E privo di istoni, ha una scarsa capacita di riparazione (mutazioni 10 volte superiori a quello nucleare), e esposto a ROS.

3 Trasmissione dei mitocondri mutati dalla madre ai figli. Quindi una madre con mutazioni del DNA mitocondriale le trasferisce a tutta la sua progenie in modo variabile PERCHE IL DNA MITOCONDRIALE SEGREGA IN MODO CASUALE. Solo le figlie potranno a loro volta trasferire la mutazione Caratteristiche peculiari delle malattie dovute a mutazioni nel DNA mitocondriale sono: - l'ereditarieta materna (mitocondri solo da parte materna) - l'eteroplasmia - l effetto soglia

4 ETEROPLASMIA Ci sono centinaia di molecole di DNA mitocondriale in ogni cellula, e in generale le mutazioni patogenetiche sono presenti in alcuni ma non in tutti questi genomi. Come conseguenza, le cellule e i tessuti del futuro nascituro avranno sia DNA mitocondriale normale che mutato, una situazione conosciuta come eteroplasmia. EFFETTO SOGLIA Nei soggetti con eteroplasmia, prima che compaiano disfunzioni fisiologiche e sintomi clinici e necessario che il rapporto tra DNA mitocondriale mutato e il normale superi un valore soglia, che e tanto piu basso quanto piu il tessuto o l'organo ha un elevato fabbisogno energetico.

5 Principali organi e tessuti colpiti dalle malattie mitocondriali. I mitocondri sono ubiquitari, quindi potenzialmente ogni tessuto dell'organismo puo essere colpito dalla presenza di mutazioni nel DNA mitocondriale. Questo e uno dei motivi per cui spesso le patologie mitocondriali sono multisistemiche. Nei soggetti con eteroplasmia, prima che compaiano disfunzioni fisiologiche e sintomi clinici e necessario che il rapporto tra DNA mitocondriale mutato e il normale superi un valore soglia, che e tanto piu basso quanto piu il tessuto o l'organo ha elevato fabbisogno energetico. Questo e anche il motivo per cui le patologie mitocondriali colpiscono soprattutto il sistema nervoso, il muscolo scheletrico e il cuore (tutti organi e tessuti ad elevato fabbisogno energetico).

6 Malattie Mitocondriali (III) Pedigree della Malattia di Leber Leber s hereditary optic neuropathy (LHON) Da 1,25 a 3 casi ogni bambini all'anno Progressiva degenerazione dei fotorecettori della retina Mutazioni nelle posizioni G to A, 3460 G to A and T to C, nelle subunità ND4, ND1 and ND6 del complesso I della catena della fosforilazione ossidativa

7 The loss of the optic nerve fibers is attributed to the death of retinal ganglion cells (RGC) as a result of the high energy demand placed on the unmyelinated portion of the optic nerve fibers anterior to the lamina cribosa, an area associated with high mitochondrial density. ROS: important for disease (studies with reducing agents)

8 Malattie da Espansione di Triplette

9 Replication Slippage

10 Replication Slippage

11 X-Fragile Syndrome (penetranza ridotta) Gene codificante FMR-1 (fragile X mental retardation 1 ) Strozzatura Necessario per lo Sviluppo neuronale Le ripetizioni inducono Metilazione e repressione

12

13 X-Fragile Syndrome (II) Associata a ritardo mentale Non tutti I maschi portatori sono affetti dalla malattia (affetti 80%) Il 50% delle femmine portatrici é affetto dalla malattia Anticipazione: il fenotipo peggiora ad ogni generazione

14 X-Fragile Syndrome (III) Ripetizione di CGG nella regione 5 UTR del gene FMR-1 Individui: Normali: 6-46 ripetizioni Portatori sani: (premutazione) Malati: (Full mutation) I maschi trasmettono la mutazione senza grandi alterazioni nel numero di triplette Le femmine amplificano le triplette (amplificazione durante la gametogenesi)

15 Pedigree della sindrome dell X fragile Lyonization? Non e chiaro.?

16

17 Huntington Disease Corea di Huntington (còrea dal greco, danza) George Huntington 1872 Gene presente sul cromosoma 4p16

18 Caratteristiche cliniche Trasmissione autosomica dominante penetranza quasi 100% Fenomeno dell anticipazione Insorgenza tardiva (inizio a anni); Sintomi: perdita del controllo motorio (corea), cambi della personalitá, amnesia, diminuite capacitá intellettive (demenza); la morte sopraggiunge anni dopo l inizio dei sintomi, Progressiva atrofia dello striato

19 HD Sano Degeneration of Striatum (pianificazione e modulazione dei movimenti): caudate nucleus putamen

20 Età di esordio vs numero di ripetizioni

21 Qual e la funzione della proteina wt?

22 Huntingtin Espansione di una tripletta -CAG- presente nel 1 esone Da11 a 34 Q nella popolazione da nei malati di HD (correlazione:espansione, insorgenza, severita fenotipo) L espansione avviene durante la spermatogenesi La proteina naturale é essenziale per la neurogenesi (topi) La proteina wild-type é citoplasmica, quella mutata trasloca al nucleo La proteina e grande (348kd, 3144aa) e solubile Anche la perdita della proteina wt causa alcune manifestazioni tipiche della malattia Importanza della funzione della proteina wt (RNA interference and farmaci selettivi per la proteina mutata, NON DEVONO ridurre la wt)

23 Apoptosi Apoptosi Toxicity by NMDA Apoptosi

24 Huntingtin Protein Flessibilità strutturale: Differenti epitopi della proteina sono accessibili in differenti compartimenti cellulari (alterazione causata da polyq)

25 Quali sono i meccanismi responsabili della perdita progressiva di funzionalità e morte neuronale in un intervallo di tempo di 20 anni?

26

27 La Deregolazione Trascrizionale è un meccanismo Centrale nella Patogenesi della Corea di Huntington

28

29 RE1/NRSE Brain-Derived Neurotrophic Factor (BDNF) (Neurotropina per le cellule dello striato) REST= Repressor Element-1 Silencing Trascription factor RE1 o NRSE=Neuron Restrictive Silencer Element (e la sequenza)

30 Brain-Derived Neurotrophic Factor (BDNF) is a survival factor for the striatal neurons that die in the disease. Wild-type huntingtin inhibits the silencing activity of NRSE, increasing transcription of BDNF. This effect occurs through cytoplasmic sequestering of repressor element-1 transcription factor/neuron restrictive silencer factor (REST/NRSF), the transcription factor that binds to NRSE

31 Mutant Huntingnit Interagisce con fattori nucleari

32

33

34 a, PC12 cells induced to express 25QP-GFP or 103QP-GFP show a reduction in the level of acetylation of both histones H3 and H4. b, A second strain of stably transfected PC12 cells, grown in the absence of butyrate but induced to express F103QP-EGFP, show a reduction in the level of acetylation of H4, which can be reversed by butyrate treatment. Equivalent levels of histones are shown by Coomassie blue staining (a and b) or with anti-histone H3 (a).

35

36

37 Histone acetylation/ deacetylation regulates nucleosomal conformation and transcription HAT s Ac Ac Ac Hypo-acet ylat ed chromat in HDAC s Ac Hypo-acetylated Histones Hyper-acetylated histones Transcriptional Repression Transcriptional activation

38 Diagnosi Malattie Genetiche

39 MALATTIE GENETICHE La maggior parte delle malattie possono considerarsi come originate almeno in parte da disordini genetici

40 Perche si Effettua un Test Genetico? Identificazione portatori sani (eterozigoti recessivi) Diagnosi Genetica Preimpianto Diagnosi prenatale (amniocentesi, villocentesi) Diagnosi presintomatica per predire l insorgenza di malattie a sviluppo tardivo (nell eta adulta come la Corea di Huntington) Diagnosi presintomatica per valutare il fattore di rischio nello sviluppo di malattie come tumore al seno/ovaio Diagnosi di conferma di individui sintomatici

41 Quando viene fatta PGD Coppie ad alto rischio per trasmissione di malattie ereditarie (autosomiche dominanti, recessive, X-linked) Screening di aneuploidie per le coppie che utilizzano IVF per aumentare la probabilita di impianto e di successo della gravidanza Le tecniche utilizzate normalmente per la diagnosi sono PCR (malattie monogeniche) e la FISH (per anomalie cromosomiche)

42 Esempi di tumori ereditari diagnosticabili mediante PGD (Pre-implantation genetic diagnosis) Familial breast/ovarian cancer (BRCA1/BRCA2) tumor suppressor Retinoblastoma (RB1) tumor suppressor Familial melanoma (p16) Li-Fraumeni sindrome (p53) tumor suppressor Familial adenomatous polyposis (APC) tumor suppressor Neurofibromatosis (NF1/NF2) tumor suppressor Von Hippel Lindau sindrome (VHL) (Kidney cancer) tumor suppressor Multiple endocrine neoplasia (MEN1-MEN2-FMCT) Tuberous sclerosis (TSC1-TSC-2) Hereditary colon cancer (MSH2/MLH1)

43 Legislazione in Italia La legge 40/2004 disciplina, in Italia, l accesso e l uso delle tecniche di PMA (procreazione medicalmente assistita), imponendo severe restrizioni per i pazienti e gli operatori del settore La legge in questione limita a 3 il numero di ovociti che possono essere fertilizzati durante ciascun ciclo di IVF ed obbliga il trasferimento simultaneo in utero di tutti e tre i possibili embrioni La crioconservazione di zigoti ed embrioni e vietata, mentre quella degli ovociti e permessa La legge 40, inoltre, vieta qualsiasi forma di diagnosi genetica sull embrione; quindi in Italia non sarebbe possibile eseguire la diagnosi preimpianto La legge italiana sulla IVG (Interruzione Volontaria della Gravidanza) è la Legge n.194 del 22 maggio 1978

44 La legge 40/2004 Modificazioni Possibilità di ricorrere alle tecniche di PMA viene estesa anche alla coppia in cui l uomo sia portatore di malattie virali sessualmente trasmissibili, e in particolare del virus HIV e di quelli delle Epatiti B e C L eliminazione dei commi delle precedenti linee guida che limitavano la possibilità di indagine a quella di tipo osservazionale ha introdotto la possibilità di effettuare la diagnosi genetica preimpianto Facoltà di creare un numero variabile di embrioni (in base alle singole problematiche delle coppie es. età della donna) con possibilità di crioconservare quelli non impiantati in utero Rimane il divieto, quello indicato nell'art. 4 comma 3, dove si dice che È vietato il ricorso a tecniche di procreazione medicalmente assistita di tipo eterologo

45 Malattie Genetiche In funzione dell estensione della mutazione posso essere suddivise in: 1) Mutazioni genomiche (ANEUPLOIDIA): perdita o acquisto di interi cromosomi (ex. Sindrome di Down) 2) Mutazioni cromosomiche (riarrangiamento di materiale genomico, ex. traslocazioni) Definite anche come: Aberrazioni Cromosomiche 3) Mutazioni Geniche

46 Colchicina Analisi Citogenetica (Cariotipo)

47 Down s Syndrome or Trisomy 21

48

49 FLUORESCENT IN SITU HYBRIDIZATION

50 Mutazioni Cromosomiche (Traslocazioni)

51 CITOGENETICA MOLECOLARE SKY: Spectral Karyotyping

52 Mutazioni Geniche Possono verificarsi nelle regioni codificanti, regolatorie (ex promotori) e nei siti di splicing Mutazioni puntiformi: sostituzione di aa, stop codon Frame-shift: delezione o inserzione di nucleotidi Inserzione/delezione di triplette: aggiunta o eliminazione di aa Espansione di triplette: caratterizzate dall essere dinamiche (perchè aumentano durante la gametogenesi, fenomeno dell anticipazione ) La loro identificazione richiede metodiche diagnostiche fini: PCR (Polymerase chain reaction) RFLP (Restriction Fragment Length Polymorphism) Sequenziamento

53 Easy tests : Single gene - common mutations Difficult tests : multiple mutations - Private mutations

54 Easy tests Disease Gene Mutation Fragile X FMR1 Repeat FRAXE FMR2 Repeat Friedreich ataxia FRDA Repeat Haw River DRPLA Repeat Huntington type 1 HD Repeat Kennedy AR Repeat Myotonic dystrophy type 1 DMPK Repeat Spinocerebellar ataxia SCA1,2, 3, 6, 7, 8,10, 12,17 Repeat Alpha 1 antitrypsin PI 2 common mutations Charcot-Marie-Tooth Type 1A PMP22 1 common mutation Cystic fibrosis CFTR Common mutations Deafness GJB2 1 common mutation Hemochromatosis type1 HFE 2 common mutations Hereditary neuropathy (HNPP) PMP22 1 common mutation Sickle cell anemia HBB 1 common mutation Spinal muscular atrophy SMN1 1 common mutation Beta thalassemia HBB 1 exon

55 Direct Detection of Mutations RFLP (Restriction Fragment Length Polymorphism) Alcune mutazioni distruggono un sito di restrizione (ex. Fattore V) Fattore per la coagulazione. La mutazione predispone alle trombosi Cosa ci aspettiamo?

56 Direct Detection of Mutations Alcune mutazioni distruggono un sito di restrizione (ex. Fattore V) Fattore per la coagulazione. La mutazione predispone alle trombosi Esone 10

57 Corea di Huntington: espansione di una tripletta in una sequenza codificante

58 PCR

59 Mutazioni che interessano la lunghezza del gene PCR (ex. Corea di Huntington) Perche ci sono 2 bande?

60 Difficult tests Disease Gene Mutation Breast cancer BRCA1 Private BRCA2 Private Colon cancer MLH1 Private MSH2 Private MSH6 Private

61 BRCA testing BRCA1 : 23 exons, 1863 AA, bp22 BRCA2 : 28 exons, 3418 AA, bp Total : > bp sequence 1600 mutazioni in BRCA mutazioni in BRCA2

62 Una donna su dieci nel mondo occidentale è candidata ad ammalarsi di tale malattia entro gli 85 anni di età, con una mortalità pari al circa 25% delle donne affette Soltanto il 5% dei tumori della mammella sono ereditari e solo l'80% di essi possono essere ricondotti a mutazioni a carico di due geni: BRCA1 e BRCA2 Test genetici specifici per BRCA1 e BRCA2 hanno valore predittivo. Assegnano un fattore di rischio al portatore della mutazione. I test per questi geni si trovano ormai in protocolli internazionali particolarmente attenti anche agli aspetti di natura etica

63

64

65 The haploid human genome occupies a total of just over 3 billion DNA base pairs

66 DNA Sequencing > 2005 Radio - gel Fluorescent - capillary Next generation Thousand bp / day Million bp / day Billion bp / day

67 DNA SEQUENCING SANGER S METHOD

68 DNA SEQUENCING ILLUMINA

69 Single Nucleotide Polymorphism (SNP) A single nucleotide polymorphism (SNP),is a DNA sequence variation occurring when a single nucleotide, in the genome, differs between members of a species Variations in the DNA sequences of humans can affect how humans develop diseases and respond to pathogens, chemicals, drugs, vaccines and other agents

70

Patologie da mutazioni dinamiche

Patologie da mutazioni dinamiche Patologie da mutazioni dinamiche Mutazioni dinamiche mutazioni progressive, nei tessuti e nelle generazioni, di ripetizioni instabili Alleli normali Pre-mutazioni Mutazioni Le alterazioni fenotipiche (patologia)

Dettagli

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Ereditarietà delle PSE e counselling genetico Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Paraparesi

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2 fenotipo Dominante o recessivo? Scala fenotipica fenotipo A 1 A 1 A 2 A 2 fenotipo A 1 A 2 A 1 dominante A 1 e A 2. codominanti A 2 dominante A 1 dominanza incompleta A 2 dominanza incompleta Nei casi

Dettagli

Gene Mutations and Disease

Gene Mutations and Disease Gene Mutations and Disease Mutazioni somatiche: Nuove mutazioni che insorgono casualmente nelle cellule somatiche o nella linea germinale di singoli individui. Le mutazioni germinali possono essere trasmesse

Dettagli

Diversità. Variabilità genetica. Selezione naturale

Diversità. Variabilità genetica. Selezione naturale E vecchia esperienza che attraverso i suoi errori la Natura ci offre spesso possibilità inattese di intuire i suoi segreti che sarebbero altrimenti impenetrabili A.Loewy e C. Neuberg Evoluzione Variabilità

Dettagli

Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna

Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna Eredità mitocondriale Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna I mitocondri dello spermatozoo non entrano a far

Dettagli

La Diagnosi Genetica Preimpianto

La Diagnosi Genetica Preimpianto CRA Centro Riproduzione Assistita - Catania www.cragroup.it 19-20-21 Giugno 2012 La Diagnosi Genetica Preimpianto Dott.ssa Raffaella Cavallaro Cos è la PGD? È una procedura ormai collaudata utilizzata

Dettagli

Analisi genetica nell uomo: alberi genealogici problemi interpretazione

Analisi genetica nell uomo: alberi genealogici problemi interpretazione Analisi genetica nell uomo: alberi genealogici problemi interpretazione Tipi di ereditarietà monofattoriale autosomica dominante recessiva legata al sesso dominante recessiva Alberi genealogici o pedigrees

Dettagli

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott.

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott. CONSENSO INFORMATO PER DIAGNOSI GENETICA PRE-IMPIANTO (PGD)* PER MALATTIE GENETICHE EREDITARIE O ALTERAZIONI CROMOSOMICHE NUMERICHE E/O STRUTTURALI SBILANCIATE. *(Preimplantation Genetic Diagnosis) Ai

Dettagli

Eredità non mendeliana

Eredità non mendeliana Eredità non mendeliana eredità extranucleare o citoplasmatica effetto materno eredità epigenetica (imprinting) anticipazione Eredità extranucleare eredità materna o paterna geni non nucleari: genomi mitocondriali

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

La predisposizione genetica ai tumori

La predisposizione genetica ai tumori La predisposizione genetica ai tumori Il Cancro è una malattia genetica Il sillogismo aristotelico nell era del DNA Socrate è un uomo. Gli uomini sono mortali. Socrate è mortale. Socrate è mortale. Il

Dettagli

Unità Operativa di GENETICA MEDICA. Azienda Ospedaliera Universitaria S.Anna AOSPFE, Ferrara. Prestazioni richieste

Unità Operativa di GENETICA MEDICA. Azienda Ospedaliera Universitaria S.Anna AOSPFE, Ferrara. Prestazioni richieste Unità Operativa di GENETICA MEDICA Azienda Ospedaliera Universitaria S.Anna AOSPFE, Ferrara Direttore: Prof.ssa Alessandra Ferlini www.ospfe.it/geneticamedica LABORATORIO DI GENETICA MOLECOLARE Responsabile:

Dettagli

6 modulo didattico- Le malattie genetiche non mendeliane,

6 modulo didattico- Le malattie genetiche non mendeliane, 6 modulo didattico- Le malattie genetiche non mendeliane, diagnosi e terapia. CLASSIFICAZIONE DELLE MALATTIE GENETICHE Malattie monogeniche ( 1%) Autsomiche dominanti Autosomiche recessive Legate al sesso

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA2013/14 Prof Alberto Turco Lezioni 57 e 58 11.12.2013 Test Genetici Storiche date. 1865 1859 1953.momenti memorabili dell impresa intellettuale e scientifica

Dettagli

Marcatori Genetici Tumorali

Marcatori Genetici Tumorali a scuola di scienze della vita Liceo Scientifico N. Tron Schio (VI), 16 dicembre 2008 Marcatori Genetici Tumorali Tommaso Scarpa Schio (VI) - 16 Dicembre 2008 Il Tumore è una malattia genetica. 1 sola

Dettagli

CORSO INTEGRATO DI GENETICA AA 2011/12. Prof Alberto Turco. Giovedi 27.10.11 Lezioni 21 e 22 DIAGNOSI PRENATALE DIAGNOSI PREIMPIANTO

CORSO INTEGRATO DI GENETICA AA 2011/12. Prof Alberto Turco. Giovedi 27.10.11 Lezioni 21 e 22 DIAGNOSI PRENATALE DIAGNOSI PREIMPIANTO CORSO INTEGRATO DI GENETICA AA 2011/12 Prof Alberto Turco Giovedi 27.10.11 Lezioni 21 e 22 DIAGNOSI PRENATALE DIAGNOSI PREIMPIANTO Definizione DPN Peculiarità - Non è richiesta dall interessato - Non correlazione

Dettagli

Lo studio della genetica umana e casi di malattie genetiche

Lo studio della genetica umana e casi di malattie genetiche Lo studio della genetica umana e casi di malattie genetiche Alcuni strumenti di studio della genetica umana Studio dei cromosomi, attraverso il cariotipo Analisi dell ereditarietà familiare attraverso

Dettagli

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI Ogni individuo possiede un proprio patrimonio genetico che lo rende unico e diverso da tutti gli altri. Il patrimonio genetico è costituito da

Dettagli

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y L infertilità è considerata dall Organizzazione Mondiale della Sanità una patologia. Per infertilità si intende l assenza di concepimento dopo 12/24 mesi di rapporti mirati non protetti. Il fenomeno dell

Dettagli

Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI

Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Introduzione Cromosoma Cellula Nucleo Ormai a tutti è noto il ruolo del

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA 2015/16. Alberto Turco. Lezioni 43 e 44 Gio 26.11.15 CONSULENZA GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA 2015/16. Alberto Turco. Lezioni 43 e 44 Gio 26.11.15 CONSULENZA GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA 2015/16 Alberto Turco Lezioni 43 e 44 Gio 26.11.15 CONSULENZA GENETICA Definizione La consulenza genetica è un servizio con il quale i pazienti o i

Dettagli

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche La patogenesi di aborti dovuti ad anomalie cromosomiche è dovuta a: A) Ipoplasia placentare; B) Malformazioni

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

Variazioni del genoma possono determinare:

Variazioni del genoma possono determinare: Variazioni del genoma possono determinare: Insorgenza di malattie genetiche Differente predisposizione a determinate patologie Differente risposta a specifiche terapie Differente risposta a stress ambientali,

Dettagli

5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti

Dettagli

DAI TEST GENETICI AL RISCHIO DI MALATTIA

DAI TEST GENETICI AL RISCHIO DI MALATTIA DAI TEST GENETICI AL RISCHIO DI MALATTIA Conosciamo il nostro Genoma Varese, 20 aprile 2013 Elisabetta Lenzini LE TAPPE DELLA 1953 Watson and Crick Struttura del DNA 1956 Tijo e Levan Cariotipo 46 cr 1959

Dettagli

Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI

Dettagli

TARIFFARIO PRESTAZIONI LABORATORIO DI GENETICA MOLECOLARE, SEZIONE DI PSICOLOGIA CLINICA SANITARIA, DELLE ORGANIZZAZIONI E DEL BENESSERE

TARIFFARIO PRESTAZIONI LABORATORIO DI GENETICA MOLECOLARE, SEZIONE DI PSICOLOGIA CLINICA SANITARIA, DELLE ORGANIZZAZIONI E DEL BENESSERE TARIFFARIO PRESTAZIONI LABORATORIO DI GENETICA MOLECOLARE, SEZIONE DI PSICOLOGIA CLINICA SANITARIA, DELLE ORGANIZZAZIONI E DEL BENESSERE PRESTAZIONE IMPONIBILE IVA TOTALE Consulenza genetica 50,00 0,00

Dettagli

Diagnosi delle aneuploidie

Diagnosi delle aneuploidie Diagnosi delle aneuploidie DIAGNOSI PRENATALE NON INVASIVA: UNA RIVOLUZIONE La diagnosi prenatale delle malattie monogeniche e delle aneuploidie Bologna, è attualmente 6 Giugno eseguita2014 nel I-II trimestre

Dettagli

Genetica e cancro della mammella

Genetica e cancro della mammella LEZIONE DI AGGIORNAMENTO Genetica e cancro della mammella Moderatore: P. Grammatico Relatore: M. Guenzi GENETICA E CANCRO DELLA MAMMELLA Rischio specifico ca mammella e ovaio (BRCA1, BRCA2, PALB2,.) Rischio

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

4 modulo didattico - Modalità di trasmissione delle malattie

4 modulo didattico - Modalità di trasmissione delle malattie 4 modulo didattico - Modalità di trasmissione delle malattie monogeniche. L analisi dell albero genealogico: uno strumento indispensabile della genetica medica I SIMBOLI DELL ALBERO GENEALOGICO L ANEMIA

Dettagli

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali Milano Marittima 05/06/2010 Dr. Francesco Pigliapoco Lab. Citogenetica A.O.U.-Salesi- Ancona Le sindromi DiGeorge

Dettagli

RITARDO MENTALE. - Conoscere la definizione

RITARDO MENTALE. - Conoscere la definizione RITARDO MENTALE - Conoscere la definizione - Conoscere l epidemiologia e le cause - identificare I fattori prevenibili - Saper richiedere la consulenza genetica - Conoscere I rischi e i bisogni speciali

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Biotecnologie Mediche Prevenzione Diagnostica

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Researchers C Di Pietro Slides http://www.bgbunict.it/ Researchers C Di Pietro Articoli Studenti COSA SONO LE

Dettagli

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi Patogenesi Terapia Diagnosi Dalla Genomica alla Medicina Molecolare Chimica Biochimica Biologia Biologia Molecolare Decodificazione Genoma Umano Post-Genomica Medicina Molecolare La CELLULA Nasce Si sviluppa

Dettagli

Genomica e modelli animali di malattie umane

Genomica e modelli animali di malattie umane I giovedì della cultura scientifica Etica e sperimentazione animale nella ricerca biomedica Genomica e modelli animali di malattie umane Mariateresa Mancuso BIOTEC-MED Mus Musculus : organismo modello

Dettagli

FINALITA : evidenziare la. cromosomiche fetali.

FINALITA : evidenziare la. cromosomiche fetali. Il Cariotipo Fetale Molecolare l (array-cgh) Il Cariotipo Fetale e TRADIZIONALE FINALITA : evidenziare la presenza di eventuali anomalie cromosomiche fetali. TECNICA: comporta la coltura delle cellule

Dettagli

SEMINARIO SUL CANCRO COLORETTALE EREDITARIO (Sindrome di Lynch)

SEMINARIO SUL CANCRO COLORETTALE EREDITARIO (Sindrome di Lynch) SEMINARIO SUL CANCRO COLORETTALE EREDITARIO (Sindrome di Lynch) Modena, 19 Dicembre 2007 I TUMORI EREDITARI: UNA VISIONE D INSIEME Maurizio Ponz de Leon PATOGENESI DEI TUMORI TUMORI SPORADICI CANCRO 70-80%

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

Sperimenta il BioLab. Da un albero genealogico al DNA e ritorno. Università degli Studi di Milano

Sperimenta il BioLab. Da un albero genealogico al DNA e ritorno. Università degli Studi di Milano Sperimenta il BioLab Da un albero genealogico al DNA e ritorno Università degli Studi di Milano Indice 1. Conoscenze propedeutiche p. 3 1.1 Le mutazioni p. 3 1.2 Mutazioni geniche 1.3 Alcuni concetti base

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

Tumore della mammella rischio eredo-familiare

Tumore della mammella rischio eredo-familiare Università di Torino Dipartimento di Genetica Biologia e Biochimica barbara pasini Tumore della mammella rischio eredo-familiare problematiche linee guida ipotesi di progetto regionale Tumore della mammella

Dettagli

Cor o t r e t e C os o t s it i uzi uz o i na U f f i f c i io i o S ta t mpa L g e ge e s ulla f e f c e o c ndazione e a ssist s ita

Cor o t r e t e C os o t s it i uzi uz o i na U f f i f c i io i o S ta t mpa L g e ge e s ulla f e f c e o c ndazione e a ssist s ita La diagnosi pre-impianto Claudia Livi Centro DEMETRA Firenze www.centrodemetra.com Corte Costituzionale Ufficio Stampa Legge sulla fecondazione assistita La Corte ha dichiarato l illegittimità costituzionale

Dettagli

La predisposizione genetica ai tumori WWW.FISIOKINESITERAPIA.BIZ

La predisposizione genetica ai tumori WWW.FISIOKINESITERAPIA.BIZ La predisposizione genetica ai tumori WWW.FISIOKINESITERAPIA.BIZ Il Cancro è una malattia genetica Il sillogismo aristotelico nell era del DNA Socrate è un uomo. Gli uomini sono mortali. Socrate è mortale.

Dettagli

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI?

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? CARATTERE AUTOSOMICO -codificato da geni su cromosomi non sessuali -non ci sono differenze di trasmissione

Dettagli

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune

Dettagli

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene eseguita su cellule

Dettagli

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie TEST GENETICI INDIRETTI per la diagnosi di patologie genetiche ereditarie Diagnosi molecolare indiretta Quando non è nota la mutazione malattia, la diagnosi molecolare di quella malattia in una data famiglia

Dettagli

Dalla diagnosi prenatale alla diagnosi preconcezionale:stato dell arte e prospettive per la prevenzione delle malattie a trasmissione genetica

Dalla diagnosi prenatale alla diagnosi preconcezionale:stato dell arte e prospettive per la prevenzione delle malattie a trasmissione genetica 25-26-27 Marzo 2011 IV Incontro-Convegno Dalla diagnosi prenatale alla diagnosi preconcezionale:stato dell arte e prospettive per la prevenzione delle malattie a trasmissione genetica L. Ghisoni Presupposti

Dettagli

Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3

Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Grazia Cantelmi, AIF SUN Napoli Prof.ssa L.Perrone, Dipartimento della donna, del bambino, di chirurgia generale e specialistica

Dettagli

JOURNAL CLUB Maria Elena Conidi

JOURNAL CLUB Maria Elena Conidi JOURNAL CLUB Maria Elena Conidi MITOCONDRI «organelli citoplasmatici presenti nelle cellule eucariotiche» Molteplici funzioni: 1) metabolismo energetico con la produzione di ATP (ciclo di Krebs e Fosforilazione

Dettagli

Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule.

Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule. Il patrimonio genetico, base della vita Il patrimonio genetico (genoma) è l insieme di tutte le informazioni necessarie per costruire ogni embrione, attraverso complessi meccanismi di moltiplicazione delle

Dettagli

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Ad integrazione delle lezioni e del testo di studio Genetica Umana e Medica Neri- Genuardi 3a edizione 2014 Masson (www.mediquiz.it) GENETICA MEDICA

Dettagli

GENETICA ed EREDITARIETÀ

GENETICA ed EREDITARIETÀ GENETICA ed EREDITARIETÀ 1. Introduzione L Epidermolisi Bollosa (EB) è una malattia di carattere genetico, la cui causa è pertanto da ricercare nei caratteri ereditari di un individuo. I processi che avvengono

Dettagli

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre più di non conoscere, nell avvedersi di saper sempre meno,

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica SEZIONE DI CITOGENETICA E GENETICA MOLECOLARE DIAGNOSI PRENATALE DIAGNOSI MOLECOLARE PRE E POSTNATALE DI MALATTIE GENETICHE DIAGNOSTICA GENETICA DELLA INFERTILITA

Dettagli

Seconda Parte Specifica di scuola - Genetica medica - 31/07/2015

Seconda Parte Specifica di scuola - Genetica medica - 31/07/2015 Domande relative alla specializzazione in: Genetica medica Domanda #1 (codice domanda: n.311) : Qualora una donna risultasse positiva al test genetico per la ricerca di mutazioni del gene BRCA1, per quale

Dettagli

I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni

Dettagli

LA LEGGE 1514 E LE SCELTE RIPRODUTTIVE DELLE COPPIE DI PORTATORI FC, DEI SOGGETTI MASCHI E FEMMINE AFFETTI DA FC.

LA LEGGE 1514 E LE SCELTE RIPRODUTTIVE DELLE COPPIE DI PORTATORI FC, DEI SOGGETTI MASCHI E FEMMINE AFFETTI DA FC. LA LEGGE 1514 E LE SCELTE RIPRODUTTIVE DELLE COPPIE DI PORTATORI FC, DEI SOGGETTI MASCHI E FEMMINE AFFETTI DA FC. Per necessità l esposizione è schematica. Si rimanda alla consultazione del genetista il

Dettagli

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA

Dettagli

Le mutazioni Quando le informazioni sono errate

Le mutazioni Quando le informazioni sono errate Le mutazioni Quando le informazioni sono errate Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Storia delle mutazioni Dal 1927 viene usato il concetto di mutazione così come è inteso oggi Il primo

Dettagli

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS DIRECT SEQUENCING TTCACTGAGAGTCGC TCCCAATAAAAGTGACTCTCAGCGAGC TTCACTGAGAGTCGG TCCCAATAAAAGTGACTCTCAGCCAGC wt mut wt wt/mut mut The Sanger method 07_01.jpg

Dettagli

Introduction. scaricato da www.sunhope.it. The choice of materials to test. Three possible questions: DNA RNA Protein

Introduction. scaricato da www.sunhope.it. The choice of materials to test. Three possible questions: DNA RNA Protein Introduction The choice of materials to test DNA RNA Protein Three possible questions: Gene testing has to be targeted. Does the patient have any mutation in this particular gene that may cause disease.

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica - Facoltà di Medicina e Chirurgia PUGD - Università degli Studi di Udine

Dettagli

GENETICA DEL TUMORE DEL COLON-RETTO

GENETICA DEL TUMORE DEL COLON-RETTO GENETICA DEL TUMORE DEL COLON-RETTO EPIDEMIOLOGIA In tutto l'occidente, il cancro del colon-retto occupa, per incidenza, il secondo posto tra i tumori maligni, preceduto dal tumore al polmone nell'uomo

Dettagli

La trasmissione delle malattie genetiche. Anna Onofri

La trasmissione delle malattie genetiche. Anna Onofri La trasmissione delle malattie genetiche Gli alberi genealogici Anna Onofri I simboli maggiormente utilizzati Le malattie genetiche Molte malattie genetiche sono legate ad un singolo gene e possono verificarsi

Dettagli

Insorgenza tumorale B C

Insorgenza tumorale B C Genetica dei tumori Corso di Genetica Medica Corsi di Laurea in Fisioterapia, Logopedia, Ortott. Ass. Oft, T.N.P.E. Facoltà di Medicina e Chirurgia Alberto Piazza Insorgenza tumorale Processo patologico

Dettagli

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente!

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente! LEUCEMIE tessuto ematopoieitico MIELOMI più precisamente! TUMORI EVOLUZIONE E SELEZIONE CLONALE Cambiano: Velocita proliferazione Velocità di mutazione Stabilità genetica Attività telomerasica Vantaggi

Dettagli

Crescita e divisione cellulare

Crescita e divisione cellulare 08-04-14 CANCRO Crescita e divisione cellulare ogni cellula deve essere in grado di crescere e riprodursi una cellula che cresce e si divide genera due nuove cellule figlie gene4camente iden4che alla cellula

Dettagli

Malattie metaboliche e genetiche del Sistema Nervoso. www.fisiokinesiterapia.biz

Malattie metaboliche e genetiche del Sistema Nervoso. www.fisiokinesiterapia.biz Malattie metaboliche e genetiche del Sistema Nervoso www.fisiokinesiterapia.biz Malattie metaboliche del Sistema Nervoso Metabolismo: insieme delle reazioni chimiche alla base dei processi vitali tissuto-cellulari

Dettagli

L eredita legata al sesso

L eredita legata al sesso L eredita legata al sesso La maggior parte delle specie animali e vegetali presenta dimorfismo sessuale Individui maschi Individui femmine Il sesso e determinato da specifici cromosomi sessuali Nell uomo

Dettagli

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di GENETICA MEDICA Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di Perugia Centro Riferimento Regionale

Dettagli

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed anche la maggiore dipendenza dalle proteine policomb per

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Mutazioni. Basi molecolari della variabilità

Mutazioni. Basi molecolari della variabilità Mutazioni Basi molecolari della variabilità Il DNA non è un entità statica ma è soggetto a cambiamenti ereditari (mutazioni) che insorgono casualmente e che sono alla base del PROCESSO EVOLUTIVO ALLELE

Dettagli

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013 La sindrome di Lynch Cancro colonrettale ereditario non poliposico o HNPCC G. A. Pablo Cirrone 1 Caratteristiche generali I HNPCC (Hereditary Non-Polyposis Colonrectal Cancer) è caratterizzato dalla comparsa,

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

-malattie monogeniche o mendeliane:

-malattie monogeniche o mendeliane: Martedì 16 Febbraio è venuta nella nostra classe la dr.ssa Petrelli Maria a spiegarci le malattie sessualmente trasmissibili e ereditarie, sessualità e affettività. Ci ha spiegato la divisione delle cellule

Dettagli

Diagnosi invasiva delle anomalie fetali: dall amniocentesi alla villocentesi

Diagnosi invasiva delle anomalie fetali: dall amniocentesi alla villocentesi Diagnosi invasiva delle anomalie fetali: dall amniocentesi alla villocentesi Gianluigi Pilu Clinica Ginecologica e Ostetrica, Università di Bologna GynePro Medical Centers Bologna, Italy Amniocentesi e

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY) http://www.molecularstation.com/molecular-biology-images/data/502/human-genome-gene.png

Dettagli