Analisi di sequenziamento degli acidi nucleici

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Analisi di sequenziamento degli acidi nucleici"

Transcript

1 Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati con apparecchiature automatiche. Il sequenziamento del DNA viene sempre più usato nella diagnostica medica perché molti laboratori, anche di piccole dimensioni, cominciano ad essere dotati delle apparecchiature necessarie. Sequenziare un frammento di DNA, per esempio per la identificazione di mutazioni del genoma, è diventato relativamente facile e veloce, senza dubbio più veloce che sequenziare una proteina, cioè determinare la sequenza amminoacidica di una proteina. A tal punto che, come sapete, la determinazione della sequenza dell intero genoma umano è già stata portata a compimento. Sequenziare un frammento di DNA significa stabilire la successione dei nucleotidi che ne formano la molecola: ACGGGGGGTTTAGCGCGATTCCAT Il sequenziamento del DNA viene attualmente effettuato con un metodo descritto già alla metà degli anni settanta da un certo Sanger. Sono stati abbandonati i metodi chimici di Maxam e Gilbert. Oggi in molte applicazioni si effettua il sequenziamento diretto: che cosa vuol dire? Fino a non molto tempo fa una sequenza di DNA prevedeva il clonaggio del frammento da sequenziare, una procedura che richiedeva e richiede l inserimento del frammento in un vettore, ad esempio un plasmide, che viene poi inserito in un batterio per poterlo replicare. Oggi è possibile evitare il clonaggio del frammento da sequenziale grazie alla possibilità di amplificare il DNA bersaglio con l uso della PCR (clonaggio a-cellulare). Il metodo di Sanger si basa sulla metodica di terminazione della catena coi di-deossi nucleotidi. E attualmente il metodo più usato per definire mutazioni specifiche. I vantaggi principali di questo metodo risiedono nella facilità d uso, e questa è stata aumentata negli anni recenti con l introduzione di marcature fluorescenti e sistemi automatizzati che hanno ovviato alla necessità di sostanze radioattive. Anche se il prezzo iniziale delle apparecchiature è elevato esso è compensato da una chimica single tube (in una sola provetta) e da una rapida analisi e definizione delle basi (base calling). Il vantaggio principale di sequenziare direttamente il DNA usando la PCR anziché sequenziare col clonaggio è che solo una sequenza deve essere determinata. I dati ottenuti rappresentano una media della sequenza dei DNA bersaglio in soluzione. Alternativamente, quando vengono sequenziati cloni di PCR un minimo di 4 o 5 differenti set di dati devono essere determinati.

2 Il principio su cui si basa il sequenziamento del DNA consiste nel blocco della reazione di estensione della catena DNA mediante i cosiddetti analoghi delle basi. Queste sono molecole molto simili a deossiribonucleotidi ma mancano dell ossidrile nel carbonio 3 (di-deossiribonucleotidi) per cui possono essere incorporati in una catena di DNA in fase di sintesi ma ad essi non possono essere legati altri dntp. Quindi se un di-deossi viene per caso incorporato nella catena nascente di DNA l ulteriore allungamento viene bloccato e la reazione termina. Quindi i di-deossi sono chiamati anche terminatori di catena. In pratica vengono allestite 4 reazioni in parallelo, ciascuna contenente una delle 4 basi sotto forma di di-deossi in concentrazione molto debole. Il frammento di DNA da sequenziare (stampo) viene incubato con una DNA polimerasi termostabile in presenza di desossiribonucleotide fosfati (dntps) e di un primer oligonucleotidico, complementare alla parte iniziale del DNA da sequenziare. tgcacacgcgcgctatatag... ACGTGTGCGCGCGATATATCGCTATATGACGGATCGGCGCTATAGC La polimerasi a partire dal primer genera un filamento complementare allo stampo, che si estende per una lunghezza indefinita a valle del primer. Ciò dà luogo a una amplificazione lineare dei prodotti di estensione.

3 Siccome la sintesi del DNA viene effettuata per esterificazione dell ossidrile 3 di un nucleotide, già incorporato mediante l estremità 5 fosfato, sul carbonio in alfa di un deossi nel momento in cui viene incorporato un di-deossi la sintesi si arresta (poiché non possiede un 3 ossidrile). Dal momento che questo nucleotide è presente in una concentrazione molto bassa esso verrà incorporato molto raramente e in modo casuale. Statisticamente si otterranno così tanti frammenti abortivi quante sono le volte in cui le basi corrispondenti sono rappresentate nel pezzo di DNA in questione. La dimensione dei frammenti sintetizzati corrisponde alla distanza tra l inizio del primer e la base a livello della quale si è fermata la replicazione. Il principio statistico è lo stesso utilizzato anche nei metodi chimici. La dimensione dei frammenti viene stimata attraverso un autoradiografia, che consiste in un elettroforesi del DNA marcato con radioisotopi o con molecole fluorescenti. In generale il metodo di sequenziamento più usato è il cosiddetto cicle sequencing cioè il metodo di sequenziamento ciclico basato sulla PCR. Si può utilizzare solo quando la zona di cui si vuole determinare la sequenza è conosciuta. La sua principale applicazione è la evidenziazione rapida della natura di una mutazione puntiforme. Questo lavoro, che normalmente necessita di parecchi mesi, può ora essere realizzato in qualche giorno. Si basa sull uso di una DNA polimerasi termostabile come quella descritta. La sequenza da analizzare è dapprima amplificata direttamente a a partire da un po di DNA gnomico mediante la tecnica del sequenziamento a doppia elica, utilizzando dei primer interni al segmento da amplificare. Uno degli oligonucleotidi è utilizzato in un primo tempo per determinare la sequenza della prima elica. Questa sequenza viene poi confermata mediante la determinazione dell elica complementare, fatta utilizzando un secondo oligonucleotide. Più gli oligo sono scelti vicino alla mutazione da cercare più la realizzazione sarà facile ed il risultato preciso. In una provetta si introducono il DNA campione, il cosiddetto templato, la DNA polimerasi i dntp e un primer di sequenza che funge da innesco per la polimerasi. Sono presenti i cosiddetti terminatori che essendo strutturalmente analoghi ai dntp vengono incorporati dalla polimerasi ma non possono a loro volta essere allungati. Il tutto viene introdotto in un termal cycler e sottoposto a oscillazioni termiche a cicli ripetuti. Il risultato è un amplificazione lineare dei prodotti di estensione. E un metodo che ha molti vantaggi tra cui l uso di piccole quantità di DNA campione (meno di 1 microgrammo). La natura ciclica dà origine ad un segnale forte e riduce la possibilità di inneschi parassiti (random priming) che producono rumore di fondo. L uso di una DNA polimerasi termostabile consente di sequenziale a 60 C e di ridurre le strutture secondarie nel templato dando più efficienti letture nelle regioni ricche in GC. Uno degli svantaggi della Taq è che l efficienza di incorporazione dei terminatori dipende strettamente dalla sequenza e

4 questo dà origine a profili di segnale molto irregolari. Se questo è un problema si può prendere in considerazione l uso di una polimerasi non termostabile come la Sequenase. Questo enzima dà incorporazioni molto più regolari e profili di segnale più uniformi ma non può essere usata a 60 C e quindi problemi di struttura secondaria danno origine a una porzione di sequenza illeggibile in gran parte delle sequenze. Disegno dei primer di sequenza Regole generali Esistono dei software che possono essere scaricati da siti web. Sono importanti la composizione in basi, l eventuale formazione di strutture secondarie, la stabilità. 1. La lunghezza del primer deve essere sufficiente da avere una elevata probabilità di formare un ibrido unico col templato. La temperatura di fusione del primer deve consentire la formazione di una quota significativa di ibridi stabili nelle condizioni di amplificazione prescelte. 2. Lunghezza ideale (minimo 17) % GC 4. Primer troppo ricchi in AT in genere formano ibridi scarsamente stabili 5. La sequenza del primer deve assomigliare il più possibile ad una successione random delle 4 basi evitare regioni omopolimeriche, specialmente al 3 6. Confrontare il primer candidato con sequenze ripetitive note (p.e. Alu) per evitare alineamenti multipli. 7. Evitare sequenze simmetriche che possono dare autocomplementarietà (problema nei primer ricchi in GC che esaltano ogni imperfezione) 8. Fare attenzione al nucleotide al 3. L esperienza insegna di scegliere come base terminale G e come penultima base se possibile una pirimidina C o T 9. Il primer deve essere disegnato da regioni conservate della sequenza, non deve contenere polimorfismi, inserzioni, delezioni Per decenni la marcatura utilizzata è stata quella con radioisotopi, fosforo 32 o fosforo 33, oppure per le sequenze zolfo 35 che ha una vita media più lunga e dà delle bande più definite all autoradiografia. I sequenziatori automatici sono basati invece sulla marcatura con sostanze fluorescenti. I radioisotopi sono stati il metodo di elezione per la marcatura delle macromolecole. Tuttavia restrizioni crescenti all uso dei radioisotopi insieme alla richiesta sempre maggiore di

5 velocità e sensibilità hanno shiftato verso tecnologie alternative di marcatura come la fluorescenza o la chemiluminescenza. Fluorocromi: sono molecole che possono assorbire energia, vengono eccitate e successivamente decadono ad un livello di energia più basso emettendo una parte dell energia assorbita nel processo, di solito sotto forma di luce visibile o a lunghezza d onda ancora maggiore. Per esempio se una molecola fluorescente viene illuminata da luce blu può emettere una luce verde. Questa tendenza recente ad esplorare e sfruttare le possibilità della fluorescenza sono dovute ad una combinazione di recenti sviluppi: sintesi di nuove molecole fluorescenti (fluorocromi) che possono più facilmente essere legate in modo covalente a macromolecole (DNA!), strumentazione migliore, uso di laser che consentono livelli di energia luminosa più alti e metodi migliori per la rivelazione e l analisi del segnale fluorescente. Le applicazioni della fluorescenza vanno dal sequenziamento del DNA all analisi dei cromosomi allo studio delle membrane cellulari, del trasporto ionico, dell apoptosi e della cinetica enzimatica, della struttura cellulare (microscopia confocale in fluorescenza). Negli ultimi 10 anni la fluorescenza ha sostituito la marcatura radioattiva soprattutto in quei campi dove è richiesto il processamento di un gran numero di dati. Per esempio nei laboratori del Progetto Genoma Umano cha ha determinati i circa geni che compongono il genoma umano non avrebbe senza il sequenziamento in cui il vantaggio principale è l automazione che risulta in un processamento più veloce ed efficiente. Il sequenziamento diretto di prodotti di PCR usando il metodo della terminazione della catena con i dideossi sviluppato da Sanger è attualmente il metodo più usato per definire mutazioni specifiche. Benefici principali: facilità di uso ed è stata aumentata recentemente con l introduzione di marcatura fluorescente e sistemi automatizzati che ovviano alla radioattività. Invece di frammenti di DNA marcati con radioisotopi su pellicola autoradiografica il DNA marcato in fluorescenza usando singole molecole può essere separato con elettroforesi. I dati sono raccolti in linea mediante strumentazione automatizzata. Un progresso recente in questo campo è lo sviluppo di marcature basate sul principio della fluorescenza a trasferimento di energia di fluorescenza tra due molecole. Le molecole (oligo) sono state attaccate due molecole fluorescenti. La prima detta molecola donatrice viene scelta per la capacità di trasferire in maniera efficiente energia elettromagnetica alla seconda molecola (accettrice). Questa molecola accettrice emette la luce assorbita come fluorescenza alla lunghezza d onda che le è propria e adatta agli strumenti di rivelazione. In questo modo l intensità effettiva è da 6 a 12 volte maggiore della sola prima molecola.

6 Un altra strategia è quella di marcare i terminatori. Questa variazione presenta tre vantaggi. Basta una sola incubazione invece di 4, perché il colore dipende solo dal dideossi incorporato. Per la stessa ragione gli arresti casuali delle polimerasi (falsi stop) che rendono spesso illeggibili le sequenze con tecniche classiche, sono senza effetto sulla lettura. Infine gli oligo che servono da primer non devono essere marcati, cosa che permette un economia importante. Un miglioramento radicale è stata la sostituzione del gel di poliacrilammide verticali per la separazione elettroforetica con capillari. Altro miglioramento è stato l introduzione di sistemi multicapillari che consentono la separazione elettroforetica di più prodotti di reazione in parallelo. Con i capillari si eliminano le lastre di gel e quindi il caricamento manuale, uno degli aspetti più noiosi della procedura. Invece di pipettare manualmente, il caricamento del campione viene effettuato con una iniezione elettrocinetica direttamente da una piastra da microtitolazione, il gel viene sostituito automaticamente e non ci sono vetri da lavare. L oligo viene marcato all estremità 5 con un fluorocromo di colore differente. A ciascuna di queste frazioni viene quindi aggiunto uno dei 4 dideossi trifosfati e viene condotta un incubazione di determinazione della sequenza. Tutti i frammenti la cui replicazione viene fermata dall incorporazione di un dato dideossi saranno dunque marcati con lo stesso colore, per esempio blu per le C, rosso per le T, arancio per le G e verde per le A. Le quattro miscele di reazione vengono quindi mescolate. Ciascuna banda osservata avrà il colore dell oligo che è servito da primer per la sintesi del frammento corrispondente. Il sequenziatore non è altro che una camera per l elettroforesi verticale di un gel di poliacrilammide. Ciò consente una risoluzione di una base dei prodotti di sequenza. I frammenti marcati con fluorocromi passano attraverso una finestra di lettura, 24 cm dai pozzetti di caricamento, che è scannerizzata da un laser e sono rivelati da filtri girevoli e fotomoltiplicatori. I segnali in fluorescenza sono inviati ad un computer che analizza la loro posizione e intensità produce un cromatogramma consistente di picchi colorati. L area sottesa al picco rappresenta l intensità del segnale e il colore del picco è specifico per la base che si trova in quella posizione. Il software attribuisce una base A, T, C o G a ciascuna posizione o assegna N se la posizione è ambigua. Sistemi di marcatura Marcatura dei primer In questo caso il fluorocromo deve essere attaccato al primer di sequenza. La marcatura viene introdotta al momento della sintesi dell oligo. Esistono dei kit commerciali che consentono di

7 farsi in casa la marcatura. Funzionano abbastanza bene però bisogna purificare il primer per togliere l eccesso di marcatura non legata. Occorrono 4 reazioni di sequenza separate, ognuna contenente un diverso terminatore. I prodotti sono poi mescolati tra loro ed estratti per eliminare l eccesso di primer marcati prima dell elettroforesi. Vantaggi: l intensità del segnale è indipendente dalla sequenza e quindi il profilo del segnale è più uniforme e non si vedono anamlie delle A delle T o problemi di rumore di fondo Maggiore lunghezza delle letture. Svantaggi: maggiore costo (4 marcature) Marcatura dei terminatori Vantaggi: si può usare qualsiasi tipo di primer 4 reazioni di sequenza in una sola provetta: meno pipettate Ideale quando si devono fare sequenze ripetute nella stessa regione Meno falsi stop dovuti al distacco prematuro della DNA polimerasi (non c è marcatura) Svantaggi: profilo del segnale poco uniforme Minore lunghezza delle letture I fluorocromi sono attaccati alle molecole dei dideossi terminatori e così il sequencing può essere ottenuto in una singola provetta Preparazione del campione Il campione di DNA da sequenziale deve essere perfetto. La resa e la purezza dell amplificato sono di importanza critica per ottenere sequenze di buona qualità. Cinque microlitri di amplificato vanno fat correre in agaros al 2% per stimare la concentrazione e la purezza. Se si vedono prodotti aspecifici la reazione di amplificazione deve essere ripetuta in condizioni più stringenti, in presenza di DMSO, etc. Amplificare il DNA mediante PCR e farlo correre in agarosio al 2% contenete bromuro di etidio Visualizzare il gel sul transilluminatore e ritagliare la banda corretta con un bisturi o un ago sterile, eluire overnigth la banda in 50 microlitri di acqua sterile deionizzata in una provetta da centrifuga. Usare 5 microlitri della soluzione quale temprato di una seconda PCR con gli stessi primer. Chekkare una aliquota del secondo prodotto di PCR per concentrazione e purezza oppure purificare il prodotto di PCR con colonnine da ultrafiltrazione tipo centricon che sono molto efficaci.

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction)

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Immagine di una sequenza ben riuscita. Sequences troubleshooting

Immagine di una sequenza ben riuscita. Sequences troubleshooting Immagine di una sequenza ben riuscita. Sequences troubleshooting Sequenza fallita Reazione fallita: non presenta picchi definiti e ha un alto rumore di fondo. il primer non trova sito di annealing il DNA

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

Tecniche di sequenziamento del DNA

Tecniche di sequenziamento del DNA Tecniche di sequenziamento del DNA -Metodo di Maxam e Gilbert (della degradazione chimica del DNA) -Metodo di Sanger (a terminazione di catena) Metodo di Maxam-Gilbert Questo metodo, basato sulla degradazione

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

MARCATURA DEGLI ACIDI NUCLEICI

MARCATURA DEGLI ACIDI NUCLEICI MARCATURA DEGLI ACIDI NUCLEICI MARCATURA DEGLI ACIDI NUCLEICI La marcatura degli acidi nucleici è una delle tecniche di base nello studio della Biologia Molecolare, rappresenta infatti una tappa preliminare

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA.

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA. ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE Margherita Vinciguerra U.O. Ematologia II Laboratorio per lo Studio e la Diagnosi Molecolare Prenatale di Talassemia A.O. V. Cervello, Palermo. Analisi di sequenza

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Esperienza 2: gli enzimi di restrizione

Esperienza 2: gli enzimi di restrizione Esperienza 2: gli enzimi di restrizione Gli enzimi di restrizione sono delle proteine sintetizzate dai batteri per proteggersi dalle infezioni virali (batteriofagi). Questi enzimi tagliano il DNA virale

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Perché abbiamo deciso di sequenziare il genoma umano

Perché abbiamo deciso di sequenziare il genoma umano L'immagine sopra rappresenta le tappe fondamentali per la scoperta del genoma umano. Una versione più interattiva della mappa è disponibile nel sito del progetto genoma umano, nella sezione dedicata alla

Dettagli

ELETTROFORESI SU GEL

ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test U.O.C. di Epatologia Clinica e Biomolecolare Lotto N. DESCRIZIONE PRODOTTO Quantità annua richiesta Unità di misura Repertorio CND Codice Prodotto, Confezione Offerta e nome commerciale Prezzo unitario

Dettagli

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Il tecnico di laboratorio biomedico: Applicazioni nel laboratorio di anatomia patologica

Dettagli

SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA Sequenziamento del DNA Preparazione di librerie Library di cdna e di DNA genomico Analisi di librerie Sequenziamento del DNA 1) Metodo di Maxam&Gilbert (taglio chimico): il DNA viene marcato ad un estremità

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Ingegneria Genetica e Microbiologia Applicata

Ingegneria Genetica e Microbiologia Applicata Corso di Laurea in Biotecnologie Anno Accademico 2009-2010 Ingegneria Genetica e Microbiologia Applicata Percorso n 3: Clonaggio di segmenti di DNA Settima esercitazione - 13 maggio 2010 F 1 1 1: taglio

Dettagli

SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica

SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica SAPIENZA Università di Roma Laurea magistrale in Ingegneria delle Nanotecnologie A.A. 2014-2015 Corso di Laboratorio di Biofotonica Prof. Francesco Michelotti SAPIENZA Università di Roma Facoltà di Ingegneria

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

Elettroforesi degli acidi nucleici

Elettroforesi degli acidi nucleici Elettroforesi degli acidi nucleici Una volta che i frammenti del DNA o del RNA da analizzare sono stati amplificati con la reazione PCR è necessario separarli ed identificarli. A tale scopo si utilizza

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Preparazione dei campioni da inviare per il sequenziamento

Preparazione dei campioni da inviare per il sequenziamento Preparazione dei campioni da inviare per il sequenziamento PCR preparativa Buffer 10x dntp 2mM Taq polimerasi Oligonucleotidi up e down 100 ng/ul Volume finale 2 ul/campione 2 ul/campione 0,5 U/campione

Dettagli

Progetto della classe II C

Progetto della classe II C Progetto della classe II C Preparazione allo svolgimento dell esperienza La II C è preparata all esperienza presso il centro di ricerca E.B.R.I. iniziando un intenso lavoro di approfondimento sulla genetica

Dettagli

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del

Dettagli

03/11/15. Metodi vigorosi

03/11/15. Metodi vigorosi Metodi blandi Lisi cellulare con detergenti Metodi vigorosi 1 1. Centrifugazione preparativa Centrifugazione preparativa permette di separare i vari elementi di un omogenato cellulare 2. Ultracentrifugazione

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Principali tecniche di base

Principali tecniche di base Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione (Southern blotting) PCR (Polymerase Chain Reaction) (Sequenziamento) Tecniche di base Enzimi di di restrizione

Dettagli

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING DALL ESTRAZIONE DEL DNA AL FINGERPRINTING SCOPO DELL'ATTIVITÀ Ciascuno studente estrae il proprio DNA da cellule della mucosa boccale. Quindi, mediante PCR, vengono amplificati frammenti corrispondenti

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

Real Time PCR. La PCR Real Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico.

Real Time PCR. La PCR Real Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico. eal Time PC La PC eal Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico. Gli strumenti per PC eal Time, oltre a fungere da termociclatori,

Dettagli

Strategie di purificazione di proteine

Strategie di purificazione di proteine Laurea Magistrale in Scienze e Biotecnologie degli Alimenti Strategie di purificazione di proteine Lezione n.xx-2-23 PRINCIPIO - ALIMENTI DA MATRICI SOLIDE E LIQUIDE MATRICI SOLIDE - ROMPERE LA STRUTTURA

Dettagli

Tecniche di microscopia

Tecniche di microscopia Tecniche di microscopia I microscopi permettono di vedere l estremamente piccolo I microscopi ottici utilizzano lenti di vetro in grado di deflettere e focalizzare i raggi luminosi per riprodurre le immagini

Dettagli

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale L evoluzione della professione tecnica tra robotica, automazione e nuove tecnologie

Dettagli

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010 Percorso nº 3: Clonaggio di segmenti di DNA 11-5-2010 I plasmidi: un mondo da esplorare. Elementi genetici capaci di replicarsi autonomamente

Dettagli

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA

Dettagli

Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è

Dettagli

Biosintesi non ribosomiale di metaboliti peptidici bioattivi

Biosintesi non ribosomiale di metaboliti peptidici bioattivi Biosintesi non ribosomiale di metaboliti peptidici bioattivi Principali bersagli degli antibiotici Gli antibiotici derivano per la maggior parte da composti naturali Strutture di alcuni peptidi bioattivi

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo

ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo INTRODUZIONE Acidi nucleici Gli acidi nucleici sono una famiglia eterogenea di macromolecole distribuite all interno di tutte le cellule

Dettagli

PCR Polymerase Chain Reaction = Reazione a catena della polimerasi

PCR Polymerase Chain Reaction = Reazione a catena della polimerasi PR Polymerase hain Reaction = Reazione a catena della polimerasi mplifica un frammento di D di cui si conosce almeno in parte la sequenza Utilizza un enzima, la D Polimerasi, per copiare una molecola di

Dettagli

SISTEMA INTEGRATO A LETTURA AUTOMATICA DI RIVELATORI A TRACCIA PADC CON ANALISI DEI DATI COMPUTERIZZATA

SISTEMA INTEGRATO A LETTURA AUTOMATICA DI RIVELATORI A TRACCIA PADC CON ANALISI DEI DATI COMPUTERIZZATA SISTEMA INTEGRATO A LETTURA AUTOMATICA DI RIVELATORI A TRACCIA PADC CON ANALISI DEI DATI COMPUTERIZZATA 1. INTRODUZIONE Il Radon ( 222 Rn) è un gas radioattivo monoatomico presente nell atmosfera e generato

Dettagli

Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16

Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16 Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16 L'immunoistochimica e' una tecnica ampiamente utilizzata per l'identificazione e la localizzazione di costituenti cellulari

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

METODI ALTERNATIVI. PCR digitale per la rilevazione e quantificazione. assoluta del DNA

METODI ALTERNATIVI. PCR digitale per la rilevazione e quantificazione. assoluta del DNA METODI ALTERNATIVI PCR digitale per la rilevazione e quantificazione assoluta del DNA Roma, 25 settembre 2013 Giuseppina Buonincontro IZS PLV- S.S. Controllo Alimenti La prima generazione di PCR consente

Dettagli

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale

Dettagli

Introduzione. Il principio di localizzazione... 2 Organizzazioni delle memorie cache... 4 Gestione delle scritture in una cache...

Introduzione. Il principio di localizzazione... 2 Organizzazioni delle memorie cache... 4 Gestione delle scritture in una cache... Appunti di Calcolatori Elettronici Concetti generali sulla memoria cache Introduzione... 1 Il principio di localizzazione... 2 Organizzazioni delle memorie cache... 4 Gestione delle scritture in una cache...

Dettagli

RADIOSITY TUTORIAL. versione originale su: http://www.mvpny.com/radtutmv/radiositytut1mv.html

RADIOSITY TUTORIAL. versione originale su: http://www.mvpny.com/radtutmv/radiositytut1mv.html RADIOSITY TUTORIAL La "Profondità Diffusione" che si imposta nella finesta Settaggi Radiosity (render- >parametri rendering->radiosity) stabilisce quante volte una fonte di illuminazione andrà a riflettersi

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi.

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi. Sommario La molecola di DNA è deputata a conservare le informazioni genetiche necessarie per lo sviluppo ed il funzionamento degli organismi viventi. Poiché contiene le istruzioni per la costruzione delle

Dettagli