La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della"

Transcript

1

2 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

3 L RNA (Acido Ribonucleico) è un polimero organico costituito da ribonucleotidi. E sintetizzato da enzimi detti RNA polimerasi, solitamente sulla base di uno stampo di DNA. Esistono diversi tipi di RNA, ognuno dei quali svolge una determinata funzione. L mrna (RNA Messaggero) trasporta l informazione per la sintesi delle proteine dal nucleo al citoplasma. L informazione principale sta nella sua sequenza, ma studi recenti hanno rivelato l importanza della sua struttura nella regolazione dell espressione genica.

4 I trna (RNA Transfer) sono in grado di riconoscere i codoni nelle sequenze di mrna e di trasportare gli aminoacidi corrispondenti nei ribosomi, durante la sintesi proteica. La loro struttura secondaria è ben determinata ed è fondamentale per la loro funzione.

5 L rrna (RNA Ribosomiale) è un costituente dei ribosomi ed ha funzione catalitica assieme alle proteine ribosomiali. Gli RNA con funzione di catalizzatore sono generalmente chiamati Ribozimi (RNA-Enzimi) e tale funzione gli viene conferita dalla loro struttura tridimensionale. Quindi questo tipo di RNA sono simili alle proteine, in quanto devono assumere una struttura particolare per poter svolgere la loro funzione. Data la loro capacità di immagazzinare informazione e di partecipare alle reazioni chimiche, gli RNA sono considerati tra le molecole più antiche, ancor più di DNA e proteine.

6 La catena di RNA ha un backbone (scheletro) formato da gruppi zucchero-fosfato aventi come catene laterali le basi Adenina (A), Guanina (G), Citosina (C) e Uracile (U). Le catene di RNA hanno lunghezza che varia solitamente tra le 100 e le basi, molto inferiore quindi a quella del DNA. Esistono RNA a doppio e a singolo filamento; questi ultimi sono particolarmente interessanti, data la loro capacità di assumere strutture tridimensionali anche molto complesse.

7 Appaiamenti canonici di Watson-Crick Legami idrogeno A=U e G C Wobbles Legami idrogeno G=U (virtualmente stabili come A=U)

8 I legami G=U introducono una deformazione nella struttura dell RNA. Tale deformazione produce un adattamento della struttura che promuove l attività catalitica. Esperimenti effettuati su molecole di trna, mostrano come i legami G=U siano indispensabili per lo svolgimento della funzione. Infatti, la correzione di tali appaiamenti ad appaiamenti canonici di W/C, inattiva il trna impedendogli di funzionare correttamente. Le coppie G=U sono meno stabili delle coppie canoniche e questo rende le molecole più reattive.

9 Si definisce struttura secondaria di una molecola di RNA il preciso ripiegamento bidimensionale adottato in seguito alla formazione di legami idrogeno tra coppie di basi complementari. La struttura secondaria dell RNA è considerata come una combinazione di diversi elementi strutturali, ciascuno dei quali contribuisce in modo indipendente all energia libera della struttura complessiva. La struttura secondaria di una molecola di RNA è definita come l insieme di appaiamenti di basi, s ij, tra i nucleotidi i e j, sempre con i<j. Per una coppia di basi (i,j) si ha sempre j-i>3, ovvero ci sono sempre tre basi tra una coppia di basi appaiate. Questo perché lo scheletro dell RNA non può ripiegarsi e tornare indietro in meno di 3 basi.

10

11 Due coppie di basi (i,j) e (h,k) con i<h possono essere: Annidate, se i<h<k<j Non correlate, se i<j<h<k Collegate, se i<h<j<k Due coppie di basi collegate formano uno collegamento incrociato detto pseudoknot:

12 Una struttura secondaria di RNA è un insieme di coppie di basi annidate o non correlate, privo quindi di basi collegate (pseudoknot). Quindi una struttura secondaria di RNA può essere rappresentata mediante un grafo lineare senza intersezioni tra archi: Ovviamente non tutti gli insiemi di coppie di basi rappresentano una struttura secondaria valida dal punto di vista dei vincoli chimico-fisici.

13 Oltre alle regioni duplex (a doppio filamento) dette stem, gli elementi base della struttura di un RNA sono: Regioni a singolo filamento Hairpins (forcine) Bulge loops (protuberanze) Mismatch Internal loops Giunzioni

14 Le regioni a singolo filamento consistono di nucleotidi non appaiati, alle estremità 5 o 3 della molecola o tra regioni duplex della struttura secondaria.

15 Una forcina consiste in un duplex collegato da un loop. Gli hairpin sono spesso siti di legame per le proteine e sono coinvolti nelle strutture terziarie di RNA. La dimensione minima di un loop è di 3 basi, ma i loop di 4 o 5 nucleotidi sono i più stabili. E possibile avere loop anche molto grandi.

16 Una protuberanza consiste di nucleotidi non appaiati su un filamento di un duplex nel quale il filamento opposto ha tutti i nucleotidi appaiati. I bulge loops creano delle pieghe nella struttura della doppia elica del duplex, che dipendono dal tipo di nucleotidi coinvolti e da quelli nelle immediate vicinanze. La distorsione introdotta dalle protuberanze può estendersi alle regioni duplex vicine.

17 I mismatch consistono di due nucleotidi che non possono formare un legame canonico ma che instaurano un qualche tipo di legame o formano un loop di due nucleotidi (si respingono ). I wobble G=U possono essere classificati come dei mismatch. Tuttavia le deformazioni introdotte da tali legami non formano pieghe significative nello scheletro.

18 I loop interni contengono 3 o più nucleotidi che non sono in grado di formare legami di W/C e contengono almeno un nucleotide spaiato su ciascun filamento. I loop possono chiudersi instaurando legami non canonici o restare aperti, permettendo la formazione di interazioni terziarie con altre parti della molecola. I loop possono essere simmetrici o asimmetrici; questi ultimi sono termodinamicamente meno stabili.

19 Le giunzioni contengono 3 o più regioni duplex con un numero variabile di nucleotidi spaiati che congiungono le eliche. I nucleotidi spaiati nelle giunzioni controllano i legami tra le eliche e determinano la struttura tridimensionale della molecola.

20 La struttura secondaria di RNA può essere rappresentata attraverso stringhe nell alfabeto {(,., )}: Nel caso evidenziato si avrà: UCCUAACAAGAGGA ((((...))))

21 Sia dato: UCCUAACAAGAGGA ((((...)))) Ogni parentesi aperta corrisponde ad una parentesi chiusa, secondo una logica a stack. Le parentesi più interne si chiudono prima di quelle più esterne. La parentesi relativa alla quarta base U si chiude con la parentesi relativa alla quart ultima base C, e così via. I punti indicano nucleotidi non appaiati.

22 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

23 Molti RNA omologhi possiedono strutture simili senza tuttavia condividere una similarità di sequenza significativa. Cambiamenti nella sequenza sono spesso tollerati purché delle mutazioni compensatorie mantengano la complementarietà delle basi appaiate. La struttura rappresentata in figura è il consenso di un sito di legame per una proteina del fago R17. Nella struttura rappresentata in figura, solo 4 nucleotidi sono specificati e 2 di essi sono degenerati (R = Purina, Y = Pirimidina).

24 Se volessimo ricercare tale regione in sequenze nucleotidiche, non avrebbe senso utilizzare un metodo di allineamento di sequenze standard. Se cercassimo infatti la sequenza NNNNNNNRNNANYANNNNNNN nel genoma del fago MS2 (correlato ad R17) troveremmo ben 38 corrispondenze! Tuttavia, aggiungendo informazioni sulle coppie appaiate nella struttura secondaria, troveremmo un solo match, nella regione di legame autentica.

25 In un allineamento multiplo di RNA strutturalmente corretto, le coppie di basi conservate sono spesso rivelate dalla presenza di mutazioni compensatorie correlate frequenti. E pertanto possibile predire in maniera abbastanza affidabile la struttura secondaria mediante analisi comparativa di sequenze correlate. Le due posizioni evidenziate covariano mantenendo la complementarietà. Questa covariazione implica una coppia di basi.

26 Ricavare la struttura corretta attraverso analisi comparativa richiede un allineamento multiplo strutturalmente corretto. Ma ricavare un allineamento multiplo strutturalmente corretto richiede la conoscenza della struttura corretta! La struttura viene dunque determinata mediante un processo di raffinamento iterativo. Inizialmente viene eseguito un allineamento di sequenze senza informazioni strutturali e tale allineamento viene utilizzato per ricavare una struttura. Tale struttura viene dunque utilizzata per riallineare le sequenze e ricavare una nuova struttura. Il processo viene iterato finché la struttura si stabilizza.

27 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

28 A partire da una certa sequenza di RNA, si possono ricavare molte strutture secondarie plausibili, ed il numero di possibili strutture cresce esponenzialmente con la lunghezza della sequenza. Una sequenza di sole 200 basi ha circa possibili strutture! Occorre dunque distinguere tra strutture biologicamente corrette e strutture non corrette: Attraverso una funzione di scoring che assegni alle strutture corrette il punteggio più alto; Attraverso un algoritmo che permetta di valutare gli score di tutte le strutture possibili.

29 L algoritmo di Nussinov è un algoritmo di programmazione dinamica che determina la struttura con il maggior numero di basi appaiate. Si tratta di un criterio troppo semplicistico in quanto non è detto che la struttura reale sia quella con il maggior numero di basi appaiate, tuttavia questo algoritmo è alla base di altri algoritmi più sofisticati di minimizzazione energetica e basati su probabilità. L algoritmo di Nussinov è ricorsivo; esso calcola la struttura migliore della sequenza in input a partire dalle strutture migliori di piccole sottosequenze.

30 L idea chiave dell algoritmo è basata sull osservazione che ci sono solo 4 possibili modi di ottenere la migliore struttura per la sequenza i, j a partire dalle migliori strutture delle sottosequenze più piccole: Aggiungi la posizione non appaiata i alla struttura migliore per la sottosequenza i+1, j; Aggiungi la posizione non appaiata j alla struttura migliore per la sottosequenza i, j-1; Aggiungi la coppia i,j alla struttura migliore per la sottosequenza i +1, j-1; Combina due sottostrutture ottimali i, k e k+1, j.

31 Sia data una sequenza x di lunghezza L x 1, x 2,, x L. Si definisce la funzione di scoring δ(i,j) tale che δ(i,j)=1 se x i e x j sono basi complementari e δ(i,j)=0 altrimenti. Si calcolano ricorsivamente gli score γ(i,j), che rappresentano il numero massimo di coppie di basi possibili per la sottosequenza x i,, x j.

32 Passo iniziale: Passo ricorsivo (a partire dalle sottosequenze di lunghezza 2 fino ad L):

33 Applichiamo l algoritmo di Nussinov alla sequenza GGGAAAUCC. Consideriamo una matrice LxL, in questo caso 9x9: G 0 G G G A A A U C C G 0 0 G 0 0 A 0 0 A 0 0 A 0 0 U 0 0 C 0 0 C 0 0

34 G G G A A A U C C G 0 0 G 0 0 G 0 0 A 0 0 A 0 0 A 0 0 U 0 0 C 0 0 C 0 0

35 G G G A A A U C C G 0 0 G G 0 0 A 0 0 A 0 0 A 0 0 U 0 0 C 0 0 C 0 0

36 G G G A A A U C C G 0 0 G G A A A U 0 0 C 0 0 C 0 0

37 Gli score per sottosequenze di lunghezza 2: G G G A A A U C C G 0 0 G G A A A U C C 0 0

38 G G G A A A U C C G G G A A A U C C 0 0

39 G G G A A A U C C G G G A A A U C C 0 0

40 Il valore in posizione (1,L), in questo caso γ(1,9)=3 è lo score massimo, ovvero il numero di coppie di basi nella struttura col maggior numero di basi appaiate. G G G A A A U C C G G G A A A U C C 0 0 Ci sono spesso diverse strutture con lo stesso numero di basi appaiate. Per trovarle eseguiamo il traceback a partire dalla entry (1,L).

41 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 Ricorsione Ripeti finchè lo stack non è vuoto: pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break.

42 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (1,9)=3

43 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (2,9)=3 (i,j)=(1,9)=3

44 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (3,8)=2 (i,j)=(2,9)=3 2::G-C::9

45 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (4,7)=1 (i,j)=(3,8)=2 3::G-C::8 2::G-C::9

46 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (5,6)=0 (i,j)=(4,7)=1 4::A-U::7 3::G-C::8 2::G-C::9

47 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (6,6)=0 (i,j)=(5,6)=0 4::A-U::7 3::G-C::8 2::G-C::9

48 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (i,j)=(6,6)=0 4::A-U::7 3::G-C::8 2::G-C::9

49 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. 5::A A::6 4::A-U::7 3::G-C::8 2::G-C::9 1::G

50 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

51 Il folding dell RNA è determinato dalla biofisica piuttosto che dal conteggio e dalla massimizzazione delle coppie di basi. La stabilità termodinamica di una molecola di RNA ripiegata in una particolare struttura secondaria può essere misurata in termini di Energia Libera ΔG che viene liberata passando da una molecola lineare a singolo filamento a una molecola che ha assunto la sua struttura secondaria più stabile. Molecole di RNA di piccole dimensioni si ripiegano con alta probabilità nella struttura di minima energia, ma non è noto se molecole di dimensioni maggiori, a causa del numero elevato di strutture possibili, adottino una struttura di minimo energetico locale piuttosto che assoluto.

52 Secondo Tinoco et al., la diminuzione complessiva di energia libera è pari alla somma dei contributi indipendenti di ogni motivo elementare presente nella struttura. Quindi, se è noto il valore di energia libera di ogni motivo elementare di struttura secondaria, è possibile calcolare con buona approssimazione il valore globale di energia libera. La diminuzione di energia libera prodotta dall appaiamento delle basi può essere calcolata sommando i contributi indipendenti di ogni possibile coppia di basi, G-C, A-U o G-U, dove ΔG GC < ΔG AU < ΔG GU

53 In realtà è stato osservato che la stabilizzazione energetica della doppia elica è dovuta in gran parte alle interazioni delle basi adiacenti impilate lungo l asse dell elica (energia di stacking). Per questa ragione, dato che il contributo energetico di ciascuna coppia di basi dipende dalla coppia di basi adiacenti, la diminuzione di energia libera può essere stabilita più correttamente per ciascuna combinazione di coppie di paia di basi. In questo modo l energia libera di uno stem di N basi può essere calcolato dalla somma dei contributi delle N-1 coppie di basi appaiate.

54 Stacking 5 - GU AU UA CG GC 3 - GU -0,5-0,5-0,7-1,5-1,3 AU -0,5-0,9-1,1-1,8-2,3 UA -0,7-0,9-0,9-1,7-2,1 CG -1,9-2,1-2,3-2,9-3,4 GC -1,5-1,7-1,8-2 -2,9 Bulge loop (in funzione della lunghezza) ,2 5,2 6 6,7 7,4 8,2 9, , ,8 12, , ,8

55 Hairpin loop (in funzione della lunghezza) Closing CG 99,9 99,9 7,4 5,9 4,4 4,3 4,1 4,1 4,2 4,3 4,9 5,6 6,1 6,7 7,1 8,1 AU 99,9 99,9 7,4 5,9 4,4 4,3 4,1 4,1 4,2 4,3 4,9 5,6 6,1 6,7 7,1 8,1 Internal loop (in funzione della lunghezza) Closing CG-CG 99,9 0,8 1,3 1,7 2,1 2,5 2,6 2,8 3,1 3,6 4,4 5,1 5,6 6,2 6,6 7,6 CG-AU 99,9 0,8 1,3 1,7 2,1 2,5 2,6 2,8 3,1 3,6 4,4 5,1 5,6 6,2 6,6 7,6 AU-AU 99,9 0,8 1,3 1,7 2,1 2,5 2,6 2,8 3,1 3,6 4,4 5,1 5,6 6,2 6,6 7,6 Gli appaiamenti closing sono quelli alla base del loop.

56 Utilizzando i valori riportati nelle tabelle di Freier, calcoliamo l energia libera della struttura in figura, relativa alla sequenza: 5 - AAGAUGCUACGGUGAAGCAUCA -3 ΔG = ΔG GC/AU + ΔG AU/UA + ΔG UA/GC + ΔG GC/CG + ΔG CG/UA + ΔG hairpin_loop = (-2,3) + (-0,9) + (-1,8) + (-3,4) + (-1,7) + 4,1 = -6.0 Kcal/mol

57 La struttura a minima energia può essere calcolata ricorsivamente mediante l algoritmo di Zuker, un algoritmo di programmazione dinamica molto simile a quello di Nussinov. Una variante efficiente dell algoritmo di Zuker è implementata all interno del pacchetto Mfold, disponibile su web e in versione scaricabile per l uso locale. Data una sequenza di RNA, Mfold restituisce le strutture secondarie a minima energia più probabili, dato che la struttura biologicamente corretta è di solito sub-ottimale, piuttosto che quella a minima energia.

58 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

59 Il tool Mfold è disponibile all indirizzo: frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/rnaform1.cgi

60

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà Bioinformatica RNA non codificanti ed RNAi Dott. Alessandro Laganà Piccoli RNA non codificanti Struttura dell RNA RNA regolatore microrna RNAi e sirna 2 Bioinformatica: RNA non codificanti ed RNAi L RNA

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi Università degli Studi di Milano Polo Didattico e di Ricerca di Crema Facoltà di Scienze Matematiche, Fisiche e Naturali Corso di Geometria Computazionale Determinazione della struttura di una molecola

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Le idee della chimica

Le idee della chimica G. Valitutti A.Tifi A.Gentile Seconda edizione Copyright 2009 Zanichelli editore Capitolo 25 Le basi della biochimica 1. I carboidrati 2. I lipidi 3. Gli amminoacidi, i peptidi e le proteine 4. La struttura

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano

trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano Struttura Acidi Nucleici RNA, DNA acidi nucleici = polinucleotidi (polimeri di nucleotidi) in cui

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

DNA sequence alignment

DNA sequence alignment DNA sequence alignment - Introduzione: un possibile modello per rappresentare il DNA. Il DNA (Acido desossiribonucleico) è una sostanza presente nei nuclei cellulari, sia vegetali che animali; a questo

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

Costituzione dei viventi

Costituzione dei viventi Costituzione dei viventi La materia e costituita da elementi chimici in forma pura o in combinazioni dette composti 25 dei 92 elementi naturali sono costituenti essenziali dei viventi 4 (C, O,, N) costituiscono

Dettagli

I Composti Organici. Le Biomolecole

I Composti Organici. Le Biomolecole I Composti Organici I composti organici sono molecole tutte contenenti carbonio. Essi comprendono. 1. composti di interesse energetico che sono gli Idrocarburi ( i derivati del petrolio), 2. composti a

Dettagli

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente 21) Il ph influenza l'attività enzimatica modificando la struttura del sito attivo con il cambiamento della distribuzione delle cariche coinvolte nei legami tra il substrato e il sito attivo. L'intervallo

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

Genetica dei microrganismi

Genetica dei microrganismi Genetica dei microrganismi Dott.ssa Silvia Preziuso Dipartimento di Scienze Veterinarie Università di Camerino Sezione di Patologia Animale, Profilassi e Igiene degli Alimenti Argomenti trattati Gli acidi

Dettagli

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti Dall RNA alle proteine La traduzione nei procarioti e negli eucarioti Codice genetico La sequenza dell mrna viene decodificata a gruppi di tre nucleotidi, e tradotta in una sequenza di amminoacidi 4 x

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

UNITÀ 1. Le molecole della vita

UNITÀ 1. Le molecole della vita Le principali molecole biologiche sono i carboidrati i lipidi le proteine monosaccaridi disaccaridi polisaccaridi grassi e cere fosfolipidi e glicolipidi steroidi Le proteine sono caratterizzate da diverse

Dettagli

RNA 29/10/2014. Struttura chimica del RNA

RNA 29/10/2014. Struttura chimica del RNA I Nucleotidi Hanno Tre Componenti Solo DNA Solo RNA Acidi nucleici RNA http://www.uic.edu/classes/phys/phys461/phys450/anjum04/ Struttura chimica del RNA http://www.ncbi.nlm.nih.gov/b ooks/nbk26887/figure/a978/?

Dettagli

Predizione della struttura terziaria

Predizione della struttura terziaria Predizione della struttura terziaria Metodi di predizione La predizione della struttura tridimensionale è di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R unità 1. La funzione del DN negli organismi La funzione del DN L acido desossiribonucleico o DN (dall inglese deoxyribonucleic acid) è la molecola informazionale delle cellule. Essa contiene e trasmette

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia Ingegneria delle tecnologie per la salute Anatomia e istologia umana Cenni di Biologia Macromolecole: Glucidi Lipidi Proteine Acidi nucleici glucidi Monosaccaridi: glucosio, fruttosio, galattosio, desossiribosio,

Dettagli

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti

Le Biomolecole I parte. Lezioni d'autore di Giorgio Benedetti Le Biomolecole I parte Lezioni d'autore di Giorgio Benedetti LE BIOMOLECOLE Le biomolecole, presenti in tutti gli esseri viventi, sono molecole composte principalmente da carbonio, idrogeno, azoto e ossigeno.

Dettagli

08/01/14. Le basi dei nucleotidi sono derivati di purine e pirimidine. Capitolo 3 Nucleotidi, acidi nucleici e informazioni genetiche

08/01/14. Le basi dei nucleotidi sono derivati di purine e pirimidine. Capitolo 3 Nucleotidi, acidi nucleici e informazioni genetiche Nucleotidi, acidi nucleici e informazioni genetiche Copyright 2013 Zanichelli editore S.p.A. I nucleotidi Conce& chiave 3.1 Le basi azotate dei nucleotidi comprendono due tipi di purine e tre tipi di pirimidine.

Dettagli

Differenze tra RNA e DNA

Differenze tra RNA e DNA Differenze tra RNA e DNA Acidi nucleici RNA TIPI PRINCIPALI DI RNA PRODOTTI NELLE CELLULE Funzione e struttura del RNA Tipo di RNA mrna rrna trna snrna snorna Altri RNA non codificanti Funzione RNA messaggeri,

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Macromolecole Biologiche. I domini (I)

Macromolecole Biologiche. I domini (I) I domini (I) I domini I motivi generalmente si combinano a formare strutture globulari compatte, chiamate domini. Una proteina può essere costituita da uno o più domini. I domini sono definiti come una

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici La seta della tela di ragno è un insieme di macromolecole, dette proteine. Sono le caratteristiche fisico-chimiche di queste

Dettagli

Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1)

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1) CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi http://hyperphysics.phy astr.gsu.edu/hbase/biology/ribosome.html http://www.accessexcellence.org/rc/vl/gg/ecb/ecb_images/01_24_organelles.jpg

Dettagli

Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT

Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT Giuditta Franco Corso di Laurea in Bioinformatica - AA 2012/2013 Uno dei più grossi risultati nell informatica degli

Dettagli

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario Il DN e la duplicazione cellulare Il DN, materiale ereditario Struttura del DN Replicazione del DN Dal DN alla proteina Il odice genetico iclo cellulare Mitosi Meiosi Da Figura 8-11 ampbell & Reece cidi

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Macromolecole Biologiche. I domini (II)

Macromolecole Biologiche. I domini (II) I domini (II) Domini β Nonostante l elevato numero di possibili disposizioni di filamenti β (a costituire foglietti β antiparalleli) connessi da tratti di loop, i domini β più frequentemente osservati

Dettagli

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale:

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: N 2 Il nome ordinario degli amminoacidi prevale su quello della nomenclatura IUPA. Si possono avere α-amminoacidi,

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 7 La struttura delle proteine Concetti chiave: La struttura terziaria di una proteina descrive il ripiegamentodei suoi elementi

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4 Indice Prefazione XIII Protein Data Bank: una nota degli autori XIV Nota all edizione italiana XV Ringraziamenti XVI CAPITOLO 1 Dalla sequenza alla struttura 1.0 Visione d insieme: funzione e architettura

Dettagli

TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica.

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. Concanavalina A Emoglobina subunità Trioso fosfato isomerasi Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. 1 La conformazione è

Dettagli

CAPITOLO 1 INTRODUZIONE ALLE RETI COMPLESSE

CAPITOLO 1 INTRODUZIONE ALLE RETI COMPLESSE CAPITOLO 1 INTRODUZIONE ALLE RETI COMPLESSE Negli ultimi anni si è compreso che sistemi anche molto diversi tra loro possono essere efficacemente descritti in termini di cosiddetti "networks" o reti complesse.

Dettagli

Macromolecole Biologiche. I domini (III)

Macromolecole Biologiche. I domini (III) I domini (III) Domini α/β La cross over connection è l unità costitutiva su cui si basa la topologia di 3 tipi di domini α/β osservati nelle proteine: - α/β barrel - motivi ricchi di Leu (fold a ferro

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI PROTEINE. sono ACIDI NUCLEICI. molecole complesse = POLIMERI. formate dall'unione di

LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI PROTEINE. sono ACIDI NUCLEICI. molecole complesse = POLIMERI. formate dall'unione di LE BIOMOLECOLE LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI LE BIOMOLECOLE sono LIPIDI PROTEINE ACIDI NUCLEICI molecole complesse = POLIMERI formate dall'unione di molecole semplici = MONOMERI

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi.

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi. Sommario La molecola di DNA è deputata a conservare le informazioni genetiche necessarie per lo sviluppo ed il funzionamento degli organismi viventi. Poiché contiene le istruzioni per la costruzione delle

Dettagli

SAGGIO DI LEGAME AI RIBOSOMI: SE L AMMINOACIL-tRNA RICONOSCE LA TRIPLETTA, VI SI LEGA E NON RIESCE A PASSARE IL FILTRO CHE, COSì, DIVIENE RADIOATTIVO.

SAGGIO DI LEGAME AI RIBOSOMI: SE L AMMINOACIL-tRNA RICONOSCE LA TRIPLETTA, VI SI LEGA E NON RIESCE A PASSARE IL FILTRO CHE, COSì, DIVIENE RADIOATTIVO. TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

CELLULE EUCARIOTICHE

CELLULE EUCARIOTICHE CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica, citoplasma, DNA e ribosomi (comuni a

Dettagli

3 Acidi Nucleici : Il RNA può essere catalitico

3 Acidi Nucleici : Il RNA può essere catalitico Caratteristiche Distintive del DNA e del RNA ACIDI NUCLEICI http://www.genome.gov/dmd/img.cfm?node=photos/graphics&id=85209 3 DNA RNA Proteina Il DNA è una molecola informativa. L informazione è immagazzinata

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences Il DNA e la cellula Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

Stop codons & Readthrough. 15 novembre 2013 Alessio Branchini

Stop codons & Readthrough. 15 novembre 2013 Alessio Branchini Stop codons & Readthrough 15 novembre 2013 Alessio Branchini Fedeltà nel trasferimento dell informazione genetica Discriminazione tra basi complementari (Watson-Crick e wobble base pairs) e non complementari

Dettagli

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine.

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. 8.1 LA RIPRODUZIONE La riproduzione è il processo con cui la specie si

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli