La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della"

Transcript

1

2 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

3 L RNA (Acido Ribonucleico) è un polimero organico costituito da ribonucleotidi. E sintetizzato da enzimi detti RNA polimerasi, solitamente sulla base di uno stampo di DNA. Esistono diversi tipi di RNA, ognuno dei quali svolge una determinata funzione. L mrna (RNA Messaggero) trasporta l informazione per la sintesi delle proteine dal nucleo al citoplasma. L informazione principale sta nella sua sequenza, ma studi recenti hanno rivelato l importanza della sua struttura nella regolazione dell espressione genica.

4 I trna (RNA Transfer) sono in grado di riconoscere i codoni nelle sequenze di mrna e di trasportare gli aminoacidi corrispondenti nei ribosomi, durante la sintesi proteica. La loro struttura secondaria è ben determinata ed è fondamentale per la loro funzione.

5 L rrna (RNA Ribosomiale) è un costituente dei ribosomi ed ha funzione catalitica assieme alle proteine ribosomiali. Gli RNA con funzione di catalizzatore sono generalmente chiamati Ribozimi (RNA-Enzimi) e tale funzione gli viene conferita dalla loro struttura tridimensionale. Quindi questo tipo di RNA sono simili alle proteine, in quanto devono assumere una struttura particolare per poter svolgere la loro funzione. Data la loro capacità di immagazzinare informazione e di partecipare alle reazioni chimiche, gli RNA sono considerati tra le molecole più antiche, ancor più di DNA e proteine.

6 La catena di RNA ha un backbone (scheletro) formato da gruppi zucchero-fosfato aventi come catene laterali le basi Adenina (A), Guanina (G), Citosina (C) e Uracile (U). Le catene di RNA hanno lunghezza che varia solitamente tra le 100 e le basi, molto inferiore quindi a quella del DNA. Esistono RNA a doppio e a singolo filamento; questi ultimi sono particolarmente interessanti, data la loro capacità di assumere strutture tridimensionali anche molto complesse.

7 Appaiamenti canonici di Watson-Crick Legami idrogeno A=U e G C Wobbles Legami idrogeno G=U (virtualmente stabili come A=U)

8 I legami G=U introducono una deformazione nella struttura dell RNA. Tale deformazione produce un adattamento della struttura che promuove l attività catalitica. Esperimenti effettuati su molecole di trna, mostrano come i legami G=U siano indispensabili per lo svolgimento della funzione. Infatti, la correzione di tali appaiamenti ad appaiamenti canonici di W/C, inattiva il trna impedendogli di funzionare correttamente. Le coppie G=U sono meno stabili delle coppie canoniche e questo rende le molecole più reattive.

9 Si definisce struttura secondaria di una molecola di RNA il preciso ripiegamento bidimensionale adottato in seguito alla formazione di legami idrogeno tra coppie di basi complementari. La struttura secondaria dell RNA è considerata come una combinazione di diversi elementi strutturali, ciascuno dei quali contribuisce in modo indipendente all energia libera della struttura complessiva. La struttura secondaria di una molecola di RNA è definita come l insieme di appaiamenti di basi, s ij, tra i nucleotidi i e j, sempre con i<j. Per una coppia di basi (i,j) si ha sempre j-i>3, ovvero ci sono sempre tre basi tra una coppia di basi appaiate. Questo perché lo scheletro dell RNA non può ripiegarsi e tornare indietro in meno di 3 basi.

10

11 Due coppie di basi (i,j) e (h,k) con i<h possono essere: Annidate, se i<h<k<j Non correlate, se i<j<h<k Collegate, se i<h<j<k Due coppie di basi collegate formano uno collegamento incrociato detto pseudoknot:

12 Una struttura secondaria di RNA è un insieme di coppie di basi annidate o non correlate, privo quindi di basi collegate (pseudoknot). Quindi una struttura secondaria di RNA può essere rappresentata mediante un grafo lineare senza intersezioni tra archi: Ovviamente non tutti gli insiemi di coppie di basi rappresentano una struttura secondaria valida dal punto di vista dei vincoli chimico-fisici.

13 Oltre alle regioni duplex (a doppio filamento) dette stem, gli elementi base della struttura di un RNA sono: Regioni a singolo filamento Hairpins (forcine) Bulge loops (protuberanze) Mismatch Internal loops Giunzioni

14 Le regioni a singolo filamento consistono di nucleotidi non appaiati, alle estremità 5 o 3 della molecola o tra regioni duplex della struttura secondaria.

15 Una forcina consiste in un duplex collegato da un loop. Gli hairpin sono spesso siti di legame per le proteine e sono coinvolti nelle strutture terziarie di RNA. La dimensione minima di un loop è di 3 basi, ma i loop di 4 o 5 nucleotidi sono i più stabili. E possibile avere loop anche molto grandi.

16 Una protuberanza consiste di nucleotidi non appaiati su un filamento di un duplex nel quale il filamento opposto ha tutti i nucleotidi appaiati. I bulge loops creano delle pieghe nella struttura della doppia elica del duplex, che dipendono dal tipo di nucleotidi coinvolti e da quelli nelle immediate vicinanze. La distorsione introdotta dalle protuberanze può estendersi alle regioni duplex vicine.

17 I mismatch consistono di due nucleotidi che non possono formare un legame canonico ma che instaurano un qualche tipo di legame o formano un loop di due nucleotidi (si respingono ). I wobble G=U possono essere classificati come dei mismatch. Tuttavia le deformazioni introdotte da tali legami non formano pieghe significative nello scheletro.

18 I loop interni contengono 3 o più nucleotidi che non sono in grado di formare legami di W/C e contengono almeno un nucleotide spaiato su ciascun filamento. I loop possono chiudersi instaurando legami non canonici o restare aperti, permettendo la formazione di interazioni terziarie con altre parti della molecola. I loop possono essere simmetrici o asimmetrici; questi ultimi sono termodinamicamente meno stabili.

19 Le giunzioni contengono 3 o più regioni duplex con un numero variabile di nucleotidi spaiati che congiungono le eliche. I nucleotidi spaiati nelle giunzioni controllano i legami tra le eliche e determinano la struttura tridimensionale della molecola.

20 La struttura secondaria di RNA può essere rappresentata attraverso stringhe nell alfabeto {(,., )}: Nel caso evidenziato si avrà: UCCUAACAAGAGGA ((((...))))

21 Sia dato: UCCUAACAAGAGGA ((((...)))) Ogni parentesi aperta corrisponde ad una parentesi chiusa, secondo una logica a stack. Le parentesi più interne si chiudono prima di quelle più esterne. La parentesi relativa alla quarta base U si chiude con la parentesi relativa alla quart ultima base C, e così via. I punti indicano nucleotidi non appaiati.

22 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

23 Molti RNA omologhi possiedono strutture simili senza tuttavia condividere una similarità di sequenza significativa. Cambiamenti nella sequenza sono spesso tollerati purché delle mutazioni compensatorie mantengano la complementarietà delle basi appaiate. La struttura rappresentata in figura è il consenso di un sito di legame per una proteina del fago R17. Nella struttura rappresentata in figura, solo 4 nucleotidi sono specificati e 2 di essi sono degenerati (R = Purina, Y = Pirimidina).

24 Se volessimo ricercare tale regione in sequenze nucleotidiche, non avrebbe senso utilizzare un metodo di allineamento di sequenze standard. Se cercassimo infatti la sequenza NNNNNNNRNNANYANNNNNNN nel genoma del fago MS2 (correlato ad R17) troveremmo ben 38 corrispondenze! Tuttavia, aggiungendo informazioni sulle coppie appaiate nella struttura secondaria, troveremmo un solo match, nella regione di legame autentica.

25 In un allineamento multiplo di RNA strutturalmente corretto, le coppie di basi conservate sono spesso rivelate dalla presenza di mutazioni compensatorie correlate frequenti. E pertanto possibile predire in maniera abbastanza affidabile la struttura secondaria mediante analisi comparativa di sequenze correlate. Le due posizioni evidenziate covariano mantenendo la complementarietà. Questa covariazione implica una coppia di basi.

26 Ricavare la struttura corretta attraverso analisi comparativa richiede un allineamento multiplo strutturalmente corretto. Ma ricavare un allineamento multiplo strutturalmente corretto richiede la conoscenza della struttura corretta! La struttura viene dunque determinata mediante un processo di raffinamento iterativo. Inizialmente viene eseguito un allineamento di sequenze senza informazioni strutturali e tale allineamento viene utilizzato per ricavare una struttura. Tale struttura viene dunque utilizzata per riallineare le sequenze e ricavare una nuova struttura. Il processo viene iterato finché la struttura si stabilizza.

27 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

28 A partire da una certa sequenza di RNA, si possono ricavare molte strutture secondarie plausibili, ed il numero di possibili strutture cresce esponenzialmente con la lunghezza della sequenza. Una sequenza di sole 200 basi ha circa possibili strutture! Occorre dunque distinguere tra strutture biologicamente corrette e strutture non corrette: Attraverso una funzione di scoring che assegni alle strutture corrette il punteggio più alto; Attraverso un algoritmo che permetta di valutare gli score di tutte le strutture possibili.

29 L algoritmo di Nussinov è un algoritmo di programmazione dinamica che determina la struttura con il maggior numero di basi appaiate. Si tratta di un criterio troppo semplicistico in quanto non è detto che la struttura reale sia quella con il maggior numero di basi appaiate, tuttavia questo algoritmo è alla base di altri algoritmi più sofisticati di minimizzazione energetica e basati su probabilità. L algoritmo di Nussinov è ricorsivo; esso calcola la struttura migliore della sequenza in input a partire dalle strutture migliori di piccole sottosequenze.

30 L idea chiave dell algoritmo è basata sull osservazione che ci sono solo 4 possibili modi di ottenere la migliore struttura per la sequenza i, j a partire dalle migliori strutture delle sottosequenze più piccole: Aggiungi la posizione non appaiata i alla struttura migliore per la sottosequenza i+1, j; Aggiungi la posizione non appaiata j alla struttura migliore per la sottosequenza i, j-1; Aggiungi la coppia i,j alla struttura migliore per la sottosequenza i +1, j-1; Combina due sottostrutture ottimali i, k e k+1, j.

31 Sia data una sequenza x di lunghezza L x 1, x 2,, x L. Si definisce la funzione di scoring δ(i,j) tale che δ(i,j)=1 se x i e x j sono basi complementari e δ(i,j)=0 altrimenti. Si calcolano ricorsivamente gli score γ(i,j), che rappresentano il numero massimo di coppie di basi possibili per la sottosequenza x i,, x j.

32 Passo iniziale: Passo ricorsivo (a partire dalle sottosequenze di lunghezza 2 fino ad L):

33 Applichiamo l algoritmo di Nussinov alla sequenza GGGAAAUCC. Consideriamo una matrice LxL, in questo caso 9x9: G 0 G G G A A A U C C G 0 0 G 0 0 A 0 0 A 0 0 A 0 0 U 0 0 C 0 0 C 0 0

34 G G G A A A U C C G 0 0 G 0 0 G 0 0 A 0 0 A 0 0 A 0 0 U 0 0 C 0 0 C 0 0

35 G G G A A A U C C G 0 0 G G 0 0 A 0 0 A 0 0 A 0 0 U 0 0 C 0 0 C 0 0

36 G G G A A A U C C G 0 0 G G A A A U 0 0 C 0 0 C 0 0

37 Gli score per sottosequenze di lunghezza 2: G G G A A A U C C G 0 0 G G A A A U C C 0 0

38 G G G A A A U C C G G G A A A U C C 0 0

39 G G G A A A U C C G G G A A A U C C 0 0

40 Il valore in posizione (1,L), in questo caso γ(1,9)=3 è lo score massimo, ovvero il numero di coppie di basi nella struttura col maggior numero di basi appaiate. G G G A A A U C C G G G A A A U C C 0 0 Ci sono spesso diverse strutture con lo stesso numero di basi appaiate. Per trovarle eseguiamo il traceback a partire dalla entry (1,L).

41 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 Ricorsione Ripeti finchè lo stack non è vuoto: pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break.

42 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (1,9)=3

43 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (2,9)=3 (i,j)=(1,9)=3

44 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (3,8)=2 (i,j)=(2,9)=3 2::G-C::9

45 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (4,7)=1 (i,j)=(3,8)=2 3::G-C::8 2::G-C::9

46 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (5,6)=0 (i,j)=(4,7)=1 4::A-U::7 3::G-C::8 2::G-C::9

47 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (6,6)=0 (i,j)=(5,6)=0 4::A-U::7 3::G-C::8 2::G-C::9

48 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. (i,j)=(6,6)=0 4::A-U::7 3::G-C::8 2::G-C::9

49 Inizializzazione: Push (1,L) onto stack (pila); G G G A A A U C C G G G A A A U C C 0 0 pop (i,j) (Estrai dalla pila) if i>=j continue; else if γ(i+1,j)= γ(i,j) push(i+1,j) else if γ(i,j-1)= γ(i,j) push(i,j-1); else if γ(i+1,j-1)+δ i,j = γ(i,j): record i,j base pair; push (i+1,j-1); else for k=i+1 to j-1: if γ(i,k)+ γ(k+1,j)= γ(i,j): push (k+1,j); push (i,k); break. 5::A A::6 4::A-U::7 3::G-C::8 2::G-C::9 1::G

50 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

51 Il folding dell RNA è determinato dalla biofisica piuttosto che dal conteggio e dalla massimizzazione delle coppie di basi. La stabilità termodinamica di una molecola di RNA ripiegata in una particolare struttura secondaria può essere misurata in termini di Energia Libera ΔG che viene liberata passando da una molecola lineare a singolo filamento a una molecola che ha assunto la sua struttura secondaria più stabile. Molecole di RNA di piccole dimensioni si ripiegano con alta probabilità nella struttura di minima energia, ma non è noto se molecole di dimensioni maggiori, a causa del numero elevato di strutture possibili, adottino una struttura di minimo energetico locale piuttosto che assoluto.

52 Secondo Tinoco et al., la diminuzione complessiva di energia libera è pari alla somma dei contributi indipendenti di ogni motivo elementare presente nella struttura. Quindi, se è noto il valore di energia libera di ogni motivo elementare di struttura secondaria, è possibile calcolare con buona approssimazione il valore globale di energia libera. La diminuzione di energia libera prodotta dall appaiamento delle basi può essere calcolata sommando i contributi indipendenti di ogni possibile coppia di basi, G-C, A-U o G-U, dove ΔG GC < ΔG AU < ΔG GU

53 In realtà è stato osservato che la stabilizzazione energetica della doppia elica è dovuta in gran parte alle interazioni delle basi adiacenti impilate lungo l asse dell elica (energia di stacking). Per questa ragione, dato che il contributo energetico di ciascuna coppia di basi dipende dalla coppia di basi adiacenti, la diminuzione di energia libera può essere stabilita più correttamente per ciascuna combinazione di coppie di paia di basi. In questo modo l energia libera di uno stem di N basi può essere calcolato dalla somma dei contributi delle N-1 coppie di basi appaiate.

54 Stacking 5 - GU AU UA CG GC 3 - GU -0,5-0,5-0,7-1,5-1,3 AU -0,5-0,9-1,1-1,8-2,3 UA -0,7-0,9-0,9-1,7-2,1 CG -1,9-2,1-2,3-2,9-3,4 GC -1,5-1,7-1,8-2 -2,9 Bulge loop (in funzione della lunghezza) ,2 5,2 6 6,7 7,4 8,2 9, , ,8 12, , ,8

55 Hairpin loop (in funzione della lunghezza) Closing CG 99,9 99,9 7,4 5,9 4,4 4,3 4,1 4,1 4,2 4,3 4,9 5,6 6,1 6,7 7,1 8,1 AU 99,9 99,9 7,4 5,9 4,4 4,3 4,1 4,1 4,2 4,3 4,9 5,6 6,1 6,7 7,1 8,1 Internal loop (in funzione della lunghezza) Closing CG-CG 99,9 0,8 1,3 1,7 2,1 2,5 2,6 2,8 3,1 3,6 4,4 5,1 5,6 6,2 6,6 7,6 CG-AU 99,9 0,8 1,3 1,7 2,1 2,5 2,6 2,8 3,1 3,6 4,4 5,1 5,6 6,2 6,6 7,6 AU-AU 99,9 0,8 1,3 1,7 2,1 2,5 2,6 2,8 3,1 3,6 4,4 5,1 5,6 6,2 6,6 7,6 Gli appaiamenti closing sono quelli alla base del loop.

56 Utilizzando i valori riportati nelle tabelle di Freier, calcoliamo l energia libera della struttura in figura, relativa alla sequenza: 5 - AAGAUGCUACGGUGAAGCAUCA -3 ΔG = ΔG GC/AU + ΔG AU/UA + ΔG UA/GC + ΔG GC/CG + ΔG CG/UA + ΔG hairpin_loop = (-2,3) + (-0,9) + (-1,8) + (-3,4) + (-1,7) + 4,1 = -6.0 Kcal/mol

57 La struttura a minima energia può essere calcolata ricorsivamente mediante l algoritmo di Zuker, un algoritmo di programmazione dinamica molto simile a quello di Nussinov. Una variante efficiente dell algoritmo di Zuker è implementata all interno del pacchetto Mfold, disponibile su web e in versione scaricabile per l uso locale. Data una sequenza di RNA, Mfold restituisce le strutture secondarie a minima energia più probabili, dato che la struttura biologicamente corretta è di solito sub-ottimale, piuttosto che quella a minima energia.

58 La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un tool per la predizione della struttura secondaria: Mfold

59 Il tool Mfold è disponibile all indirizzo: frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/rnaform1.cgi

60

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Quando A e B coincidono una coppia ordinata é determinata anche dalla loro posizione.

Quando A e B coincidono una coppia ordinata é determinata anche dalla loro posizione. Grafi ed Alberi Pag. /26 Grafi ed Alberi In questo capitolo richiameremo i principali concetti di due ADT che ricorreranno puntualmente nel corso della nostra trattazione: i grafi e gli alberi. Naturale

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

AA 2006-07 LA RICORSIONE

AA 2006-07 LA RICORSIONE PROGRAMMAZIONE AA 2006-07 LA RICORSIONE AA 2006-07 Prof.ssa A. Lanza - DIB 1/18 LA RICORSIONE Il concetto di ricorsione nasce dalla matematica Una funzione matematica è definita ricorsivamente quando nella

Dettagli

LA MEMBRANA PLASMATICA

LA MEMBRANA PLASMATICA LA MEMBRANA PLASMATICA 1. LE FUNZIONI DELLA MEMBRANA PLASMATICA La membrana plasmatica svolge le seguenti funzioni: 1. tenere concentrate tutte le sostanze indispensabili alla vita: è proprio la membrana

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

Tipologie di pianificatori. Pianificazione. Partial Order Planning. E compiti diversi. Pianificazione gerarchica. Approcci integrati

Tipologie di pianificatori. Pianificazione. Partial Order Planning. E compiti diversi. Pianificazione gerarchica. Approcci integrati Tipologie di pianificatori Pianificazione Intelligenza Artificiale e Agenti II modulo Pianificazione a ordinamento parziale (POP) (HTN) pianificazione logica (SatPlan) Pianificazione come ricerca su grafi

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

RICORSIONE - schema ricorsivo (o induttivo) si esegue l'azione S, su un insieme di dati D, mediante eventuale esecuzione di

RICORSIONE - schema ricorsivo (o induttivo) si esegue l'azione S, su un insieme di dati D, mediante eventuale esecuzione di RICORSIONE - schema ricorsivo (o induttivo) si esegue l'azione S, su un insieme di dati D, mediante eventuale esecuzione di esempio CERCA 90 NEL SACCHETTO = estrai num Casi num 90 Effetti CERCA 90 NEL

Dettagli

Ricorsione. Rosario Culmone. - p. 1/13

Ricorsione. Rosario Culmone. - p. 1/13 Ricorsione Rosario Culmone - p. 1/13 Induzione e Ricorsione Spesso utilizzeremo le definizioni induttive. Sono forme di definizione compatte che descrivono un numero infinito di elementi. I contesti di

Dettagli

Esercizi Capitolo 5 - Alberi

Esercizi Capitolo 5 - Alberi Esercizi Capitolo 5 - Alberi Alberto Montresor 19 Agosto, 2014 Alcuni degli esercizi che seguono sono associati alle rispettive soluzioni. Se il vostro lettore PDF lo consente, è possibile saltare alle

Dettagli

Poniamo il carbonio al centro, tre idrogeni sono legati al carbonio direttamente e uno attraverso l ossigeno

Poniamo il carbonio al centro, tre idrogeni sono legati al carbonio direttamente e uno attraverso l ossigeno Strutture di Lewis E un metodo semplice per ottenere le formule di struttura di composti covalenti nota la formula molecolare, la configurazione elettronica del livello di valenza degli atomi e la connettività

Dettagli

Elementi di Statistica

Elementi di Statistica Elementi di Statistica Contenuti Contenuti di Statistica nel corso di Data Base Elementi di statistica descrittiva: media, moda, mediana, indici di dispersione Introduzione alle variabili casuali e alle

Dettagli

CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE. un atomo compie all atto di formazione di un composto al fine di formare un maggior

CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE. un atomo compie all atto di formazione di un composto al fine di formare un maggior CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE L ibridizzazione o ibridazione è una ricombinazione dei propri orbitali atomici che un atomo compie all atto di formazione di un composto al fine

Dettagli

Fondamenti dell Informatica Ricorsione e Iterazione Simona Ronchi Della Rocca (dal testo: Kfoury, Moll and Arbib, cap.5.2)

Fondamenti dell Informatica Ricorsione e Iterazione Simona Ronchi Della Rocca (dal testo: Kfoury, Moll and Arbib, cap.5.2) Fondamenti dell Informatica Ricorsione e Iterazione Simona Ronchi Della Rocca (dal testo: Kfoury, Moll and Arbib, cap.5.2) Definiamo innanzitutto una relazione d ordine tra le funzioni. Siano φ e ψ funzioni

Dettagli

Prof. Caterina Rizzi Dipartimento di Ingegneria Industriale

Prof. Caterina Rizzi Dipartimento di Ingegneria Industriale RUOLO DELLA MODELLAZIONE GEOMETRICA E LIVELLI DI MODELLAZIONE PARTE 2 Prof. Caterina Rizzi... IN QUESTA LEZIONE Modelli 2D/3D Modelli 3D/3D Dimensione delle primitive di modellazione Dimensione dell oggettoy

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

Semplici Algoritmi di Ordinamento

Semplici Algoritmi di Ordinamento Fondamenti di Informatica Semplici Algoritmi di Ordinamento Fondamenti di Informatica - D. Talia - UNICAL 1 Ordinamento di una sequenza di elementi Esistono molti algoritmi di ordinamento. Tutti ricevono

Dettagli

Esercitazione 7. Procedure e Funzioni

Esercitazione 7. Procedure e Funzioni Esercitazione 7 Procedure e Funzioni Esercizio Scrivere un programma che memorizza in un array di elementi di tipo double le temperature relative al mese corrente e ne determina la temperatura massima,

Dettagli

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali:

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali: Gli enzimi Nel metabolismo energetico le cellule producono notevoli quantità di CO 2 che deve essere eliminata con l apparato respiratorio. Il trasferimento della CO 2 dalle cellule al sangue e da esso

Dettagli

Il problema del massimo flusso. Preflow-push e augmenting path: un approccio unificante

Il problema del massimo flusso. Preflow-push e augmenting path: un approccio unificante Introduzione Il problema del massimo flusso. Preflow-push e augmenting path: un approccio unificante Il problema del massimo flusso è uno dei fondamentali problemi nell ottimizzazione su rete. Esso è presente

Dettagli

Ricorsione. Corso di Fondamenti di Informatica

Ricorsione. Corso di Fondamenti di Informatica Dipartimento di Informatica e Sistemistica Antonio Ruberti Sapienza Università di Roma Ricorsione Corso di Fondamenti di Informatica Laurea in Ingegneria Informatica (Canale di Ingegneria delle Reti e

Dettagli

modulo: CHIMICA DEI POLIMERI

modulo: CHIMICA DEI POLIMERI CORSO PON Esperto nella progettazione, caratterizzazione e lavorazione di termoplastici modulo: CHIMICA DEI POLIMERI Vincenzo Venditto influenza delle caratteristiche strutturali, microstrutturali e morfologiche

Dettagli

+ / operatori di confronto (espressioni logiche/predicati) / + 5 3 9 = > < Pseudo codice. Pseudo codice

+ / operatori di confronto (espressioni logiche/predicati) / + 5 3 9 = > < Pseudo codice. Pseudo codice Pseudo codice Pseudo codice Paolo Bison Fondamenti di Informatica A.A. 2006/07 Università di Padova linguaggio testuale mix di linguaggio naturale ed elementi linguistici con sintassi ben definita e semantica

Dettagli

PROBLEMA DELLA RICERCA DI UN ELEMENTO IN UN ARRAY E ALGORITMI RISOLUTIVI

PROBLEMA DELLA RICERCA DI UN ELEMENTO IN UN ARRAY E ALGORITMI RISOLUTIVI PROBLEMA DELLA RICERCA DI UN ELEMENTO IN UN ARRAY E ALGORITMI RISOLUTIVI PROBLEMA DELLA RICERCA in termini generali: Dati in input un insieme S di elementi (numeri, caratteri, stringhe, ) e un elemento

Dettagli

METODI ITERATIVI PER SISTEMI LINEARI

METODI ITERATIVI PER SISTEMI LINEARI METODI ITERATIVI PER SISTEMI LINEARI LUCIA GASTALDI 1. Metodi iterativi classici Sia A R n n una matrice non singolare e sia b R n. Consideriamo il sistema (1) Ax = b. Un metodo iterativo per la soluzione

Dettagli

METODO DEI MINIMI QUADRATI. Quest articolo discende soprattutto dai lavori di Deming, Press et al. (Numerical Recipes) e Jefferys.

METODO DEI MINIMI QUADRATI. Quest articolo discende soprattutto dai lavori di Deming, Press et al. (Numerical Recipes) e Jefferys. METODO DEI MINIMI QUADRATI GIUSEPPE GIUDICE Sommario Il metodo dei minimi quadrati è trattato in tutti i testi di statistica e di elaborazione dei dati sperimentali, ma non sempre col rigore necessario

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Esercizi sull Association Analysis

Esercizi sull Association Analysis Data Mining: Esercizi sull Association Analysis 1 Esercizi sull Association Analysis 1. Si consideri il mining di association rule da un dataset T di transazioni, rispetto a delle soglie minsup e minconf.

Dettagli

Esercizi per il corso di Algoritmi e Strutture Dati

Esercizi per il corso di Algoritmi e Strutture Dati 1 Esercizi per il corso di Algoritmi e Strutture Dati Esercizi sulla Tecnica Divide et Impera N.B. Tutti gli algoritmi vanno scritti in pseudocodice (non in Java, né in C++, etc. ). Di tutti gli algoritmi

Dettagli

Flusso a costo minimo e simplesso su reti

Flusso a costo minimo e simplesso su reti Flusso a costo minimo e simplesso su reti La particolare struttura di alcuni problemi di PL può essere talvolta utilizzata per la progettazione di tecniche risolutive molto più efficienti dell algoritmo

Dettagli

Ricerca non informata in uno spazio di stati

Ricerca non informata in uno spazio di stati Università di Bergamo Facoltà di Ingegneria Intelligenza Artificiale Paolo Salvaneschi A5_2 V2.4 Ricerca non informata in uno spazio di stati Il contenuto del documento è liberamente utilizzabile dagli

Dettagli

-uno o più IONI INORGANICI

-uno o più IONI INORGANICI Coenzimi e vitamine Alcuni enzimi, per svolgere la loro funzione, hanno bisogno di componenti chimici addizionali, i COFATTORI APOENZIMA + COFATTORE = OLOENZIMA = enzima cataliticamente attivo Il cofattore

Dettagli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli DAI GENI AI SEMI genetica e biotecnologie in agricoltura Simona Baima e Giorgio Morelli Copyright 2010 Editori: Simona Baima e Giorgio Morelli Copertina e disegni: Franco Marchiolli [www.francomarchiolli.com]

Dettagli

Ricerca Operativa Branch-and-Bound per problemi di Programmazione Lineare Intera

Ricerca Operativa Branch-and-Bound per problemi di Programmazione Lineare Intera Ricerca Operativa Branch-and-Bound per problemi di Programmazione Lineare Intera L. De Giovanni AVVERTENZA: le note presentate di seguito non hanno alcuna pretesa di completezza, né hanno lo scopo di sostituirsi

Dettagli

Unità 12. La corrente elettrica

Unità 12. La corrente elettrica Unità 12 La corrente elettrica L elettricità risiede nell atomo Modello dell atomo: al centro c è il nucleo formato da protoni e neutroni ben legati tra di loro; in orbita intorno al nucleo si trovano

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Acidi nucleici non codificanti

Acidi nucleici non codificanti Vol. Giacca 4bozza 17-02-2011 11:05 Pagina 19 Acidi nucleici non codificanti 19 maniera controllata in modo da non favorire la crescita di eventuali tumori presenti in sedi lontane da quella in cui sono

Dettagli

GEOMETRIA MOLECOLARE

GEOMETRIA MOLECOLARE GEOMETRIA MOLECOLARE Le molecole hanno geometrie spaziali ben definite caratterizzate da distanze di legame ed angoli di legame. Questi possono essere determinati sperimentalmente (es. raggi X). Si vede

Dettagli

IL PROBLEMA DELLO SHORTEST SPANNING TREE

IL PROBLEMA DELLO SHORTEST SPANNING TREE IL PROBLEMA DELLO SHORTEST SPANNING TREE n. 1 - Formulazione del problema Consideriamo il seguente problema: Abbiamo un certo numero di città a cui deve essere fornito un servizio, quale può essere l energia

Dettagli

L identificazione e la denominazione delle sostanze chimiche in ambito REACH

L identificazione e la denominazione delle sostanze chimiche in ambito REACH I DETERGENTI: COME CONIUGARE PRESTAZIONI ELEVATE E RISPETTO PER L AMBIENTE L identificazione e la denominazione delle sostanze chimiche in ambito REACH Resana, 5 ottobre 2007 FEDERICA CECCARELLI Ist. Sup.

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Gestione dinamica di una pila

Gestione dinamica di una pila Gestione dinamica di una pila Una pila o stack è una lista lineare a lunghezza variabile in cui inserimenti (push) ed estrazioni (pop) vengono effettuate ad un solo estremo, detto testa (top) della pila.

Dettagli

CAPITOLO PRIMO IL CONCETTO DI ALGORITMO 1

CAPITOLO PRIMO IL CONCETTO DI ALGORITMO 1 1.1 Che cos è un algoritmo CAPITOLO PRIMO IL CONCETTO DI ALGORITMO 1 Gli algoritmi sono metodi per la soluzione di problemi. Possiamo caratterizzare un problema mediante i dati di cui si dispone all inizio

Dettagli

Cos'è esattamente la gelatina

Cos'è esattamente la gelatina Cos'è esattamente la gelatina LA GELATINA È PURA E NATURALE La gelatina attualmente in commercio viene prodotta in moderni stabilimenti operanti in conformità ai più rigorosi standard di igiene e sicurezza.

Dettagli

Massimo Paolucci (paolucci@dist.unige.it) DIST Università di Genova. Metodi per supportare le decisioni relative alla gestione di progetti

Massimo Paolucci (paolucci@dist.unige.it) DIST Università di Genova. Metodi per supportare le decisioni relative alla gestione di progetti Project Management Massimo Paolucci (paolucci@dist.unige.it) DIST Università di Genova Project Management 2 Metodi per supportare le decisioni relative alla gestione di progetti esempi sono progetti nell

Dettagli

Strutture. Strutture e Unioni. Definizione di strutture (2) Definizione di strutture (1)

Strutture. Strutture e Unioni. Definizione di strutture (2) Definizione di strutture (1) Strutture Strutture e Unioni DD cap.10 pp.379-391, 405-406 KP cap. 9 pp.361-379 Strutture Collezioni di variabili correlate (aggregati) sotto un unico nome Possono contenere variabili con diversi nomi

Dettagli

Formule di Struttura delle Molecole Organiche

Formule di Struttura delle Molecole Organiche Formule di Struttura delle Molecole Organiche Costituzione L ordine in cui gli atomi di una molecola sono connessi è chiamata costituzione o connettività. La costituzione di una molecola deve essere determinata

Dettagli

Algoritmo euclideo, massimo comun divisore ed equazioni diofantee

Algoritmo euclideo, massimo comun divisore ed equazioni diofantee Algoritmo euclideo, massimo comun divisore ed equazioni diofantee Se a e b sono numeri interi, si dice che a divide b, in simboli: a b, se e solo se esiste c Z tale che b = ac. Si può subito notare che:

Dettagli

V ar i a nt e spec if ic a ai s ens i de l l a rt. 17 c o mm a 8 de l l a L.R. 56 /7 7 e s.m.i.

V ar i a nt e spec if ic a ai s ens i de l l a rt. 17 c o mm a 8 de l l a L.R. 56 /7 7 e s.m.i. Inquadramento generale e obiettivi delle modifiche La Variante specifica art. 17 comma 7 definita nei suoi obiettivi generali come anticipatoria di alcuni contenuti della variante Strutturale Qualità è

Dettagli

Laboratorio di Calcolatori 1 Corso di Laurea in Fisica A.A. 2006/2007

Laboratorio di Calcolatori 1 Corso di Laurea in Fisica A.A. 2006/2007 Laboratorio di Calcolatori 1 Corso di Laurea in Fisica A.A. 2006/2007 Dott.Davide Di Ruscio Dipartimento di Informatica Università degli Studi di L Aquila Lezione del 08/03/07 Nota Questi lucidi sono tratti

Dettagli

1. Si consideri uno spazio di indirizzamento logico di otto pagine di 1024 parole ognuna, mappate su una memoria fisica di 32 frame.

1. Si consideri uno spazio di indirizzamento logico di otto pagine di 1024 parole ognuna, mappate su una memoria fisica di 32 frame. 1. Si consideri uno spazio di indirizzamento logico di otto pagine di 1024 parole ognuna, mappate su una memoria fisica di 32 frame. (a) Da quanti bit è costituito l indirizzo logico? (b) Da quanti bit

Dettagli

Informazioni generali

Informazioni generali Informazioni generali Esercitazioni del corso di Fondamenti di informatica Tutor: Ing. Rughetti Diego Esercitazione: Martedì 9.30-11.15 Tutoraggio: Martedì 11.30-13.00 Contatto: rughettidiego@tiscali.it

Dettagli

LA COMUNICAZIONE E GLI ASSIOMI DELLA COMUNICAZIONE

LA COMUNICAZIONE E GLI ASSIOMI DELLA COMUNICAZIONE LA COMUNICAZIONE E GLI ASSIOMI DELLA COMUNICAZIONE ASSIOMI DELLA COMUNICAZIONE UMANA Proprietà semplici della comunicazione Un essere umano è coinvolto fin dall inizio della sua esistenza in un complesso

Dettagli

LEZIONI DAI CAMPI DI GRANO

LEZIONI DAI CAMPI DI GRANO Corrado Malanga - Luciano Pederzoli - Silvio Nevischi LEZIONI DAI CAMPI DI GRANO (I cerchi nel grano di Chilbolton 2001) Sui campi di cereali che circondano il radioosservatorio di Chilbolton, nel sud

Dettagli

7.9 Reazioni che introducono un centro Stereogenico

7.9 Reazioni che introducono un centro Stereogenico 7.9 eazioni che introducono un centro tereogenico Molte reazioni convertono reagenti achirali a prodotti chirali. E importante ricordare, comunque che se tutti i i componenti iniziali (reagenti, catalizzatori,

Dettagli

Modello OSI e architettura TCP/IP

Modello OSI e architettura TCP/IP Modello OSI e architettura TCP/IP Differenza tra modello e architettura - Modello: è puramente teorico, definisce relazioni e caratteristiche dei livelli ma non i protocolli effettivi - Architettura: è

Dettagli

Minimizzazione di Reti Logiche Combinatorie Multi-livello

Minimizzazione di Reti Logiche Combinatorie Multi-livello Minimizzazione di Reti Logiche Combinatorie Multi-livello Maurizio Palesi Maurizio Palesi 1 Introduzione Obiettivo della sintesi logica: ottimizzazione delle cifre di merito area e prestazioni Prestazioni:

Dettagli

Ricerca Operativa Esercizi sul metodo del simplesso. Luigi De Giovanni, Laura Brentegani

Ricerca Operativa Esercizi sul metodo del simplesso. Luigi De Giovanni, Laura Brentegani Ricerca Operativa Esercizi sul metodo del simplesso Luigi De Giovanni, Laura Brentegani 1 1) Risolvere il seguente problema di programmazione lineare. ma + + 3 s.t. 2 + + 2 + 2 + 3 5 2 + 2 + 6,, 0 Soluzione.

Dettagli

Gli orbitali: modello atomico probabilistico

Gli orbitali: modello atomico probabilistico 1 Approfondimento 2.1 Gli orbitali: modello atomico probabilistico Modello atomico planetario (o a gusci): gli elettroni ruotano intorno al nucleo percorrendo orbite prefissate. Il modello atomico planetario

Dettagli

Percorsi di matematica per il ripasso e il recupero

Percorsi di matematica per il ripasso e il recupero Giacomo Pagina Giovanna Patri Percorsi di matematica per il ripasso e il recupero 1 per la Scuola secondaria di secondo grado UNITÀ CMPIONE Edizioni del Quadrifoglio à t i n U 1 Insiemi La teoria degli

Dettagli

Sostituzioni sull anello aromatico

Sostituzioni sull anello aromatico Sostituzioni sull anello aromatico Criteri per stabilire l esistenza di carattere aromatico 1. Il composto deve essere ciclico, planare e deve avere una nuvola ininterrotta di elettroni π sopra e sotto

Dettagli

LICEO SCIENTIFICO G. LEOPARDI A.S. 2010-2011 FENOMENI MAGNETICI FONDAMENTALI

LICEO SCIENTIFICO G. LEOPARDI A.S. 2010-2011 FENOMENI MAGNETICI FONDAMENTALI LICEO SCIENTIFICO G. LEOPARDI A.S. 2010-2011 FENOMENI MAGNETICI FONDAMENTALI Prof. Euro Sampaolesi IL CAMPO MAGNETICO TERRESTRE Le linee del magnete-terra escono dal Polo geomagnetico Nord ed entrano nel

Dettagli

Il fabbisogno alimentare e il ruolo dei nutrienti

Il fabbisogno alimentare e il ruolo dei nutrienti Il fabbisogno alimentare e il ruolo dei nutrienti Le necessità del nostro corpo Cibo e bevande sono i mezzi con cui il nostro organismo si procura le sostanze di cui ha bisogno per le sue attività vitali.

Dettagli

Algebra di Boole: Concetti di base. Fondamenti di Informatica - D. Talia - UNICAL 1. Fondamenti di Informatica

Algebra di Boole: Concetti di base. Fondamenti di Informatica - D. Talia - UNICAL 1. Fondamenti di Informatica Fondamenti di Informatica Algebra di Boole: Concetti di base Fondamenti di Informatica - D. Talia - UNICAL 1 Algebra di Boole E un algebra basata su tre operazioni logiche OR AND NOT Ed operandi che possono

Dettagli

Analisi statistica di dati biomedici Analysis of biologicalsignals

Analisi statistica di dati biomedici Analysis of biologicalsignals Analisi statistica di dati biomedici Analysis of biologicalsignals II Parte Verifica delle ipotesi (a) Agostino Accardo (accardo@units.it) Master in Ingegneria Clinica LM in Neuroscienze 2013-2014 e segg.

Dettagli

Realizzazione di Politiche di Gestione delle Risorse: i Semafori Privati

Realizzazione di Politiche di Gestione delle Risorse: i Semafori Privati Realizzazione di Politiche di Gestione delle Risorse: i Semafori Privati Condizione di sincronizzazione Qualora si voglia realizzare una determinata politica di gestione delle risorse,la decisione se ad

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

Progetti reali con ARDUINO

Progetti reali con ARDUINO Progetti reali con ARDUINO Introduzione alla scheda Arduino (parte 2ª) ver. Classe 3BN (elettronica) marzo 22 Giorgio Carpignano I.I.S. Primo LEVI - TORINO Il menù per oggi Lettura dei pulsanti Comunicazione

Dettagli

Abstract Data Type (ADT)

Abstract Data Type (ADT) Abstract Data Type Pag. 1/10 Abstract Data Type (ADT) Iniziamo la nostra trattazione presentando una nozione che ci accompagnerà lungo l intero corso di Laboratorio Algoritmi e Strutture Dati: il Tipo

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

LA VITA 6 DAL BIG BANG ALLA VITA 9

LA VITA 6 DAL BIG BANG ALLA VITA 9 1 2 LA VITA 6 DAL BIG BANG ALLA VITA 9 L evoluzione fisica dell universo 9 L evoluzione fisica ha prodotto le diverse forme di energia 9 La materia si organizza... in grande 10... ed anche in piccolo.

Dettagli

Una formula molecolare è una formula chimica che dà l'esatto numero degli atomi di una molecola.

Una formula molecolare è una formula chimica che dà l'esatto numero degli atomi di una molecola. Una formula molecolare è una formula chimica che dà l'esatto numero degli atomi di una molecola. La formula empirica e una formula in cui il rappporto tra gli atomi e il piu semplice possibil Acqua Ammoniaca

Dettagli

END-TO-END SERVICE QUALITY. LA CULTURA DELLA QUALITÀ DAL CONTROLLO DELLE RISORSE ALLA SODDISFAZIONE DEL CLIENTE

END-TO-END SERVICE QUALITY. LA CULTURA DELLA QUALITÀ DAL CONTROLLO DELLE RISORSE ALLA SODDISFAZIONE DEL CLIENTE END-TO-END SERVICE QUALITY. LA CULTURA DELLA QUALITÀ DAL CONTROLLO DELLE RISORSE ALLA SODDISFAZIONE In un mercato delle Telecomunicazioni sempre più orientato alla riduzione delle tariffe e dei costi di

Dettagli

Esercizio di Sincronizzazione tra Processi: Ponte a Senso Unico Alternato con Capacità Limitata

Esercizio di Sincronizzazione tra Processi: Ponte a Senso Unico Alternato con Capacità Limitata Esercizio di Sincronizzazione tra Processi: Ponte a Senso Unico Alternato con Capacità Limitata Supponiamo sempre di avere un ponte stretto che permette il passaggio delle auto solo in un verso per volta,

Dettagli

UTILIZZO DEI METODI MULTICRITERI O MULTIOBIETTIVI NELL OFFERTA ECONOMICAMENTE PIÙ VANTAGGIOSA. Filippo Romano 1

UTILIZZO DEI METODI MULTICRITERI O MULTIOBIETTIVI NELL OFFERTA ECONOMICAMENTE PIÙ VANTAGGIOSA. Filippo Romano 1 UTILIZZO DEI METODI MULTICRITERI O MULTIOBIETTIVI NELL OFFERTA ECONOMICAMENTE PIÙ VANTAGGIOSA Filippo Romano 1 1. Introduzione 2. Analisi Multicriteri o Multiobiettivi 2.1 Formule per l attribuzione del

Dettagli

Programmazione Funzionale

Programmazione Funzionale Programmazione Funzionale LP imperativi: apparenza simile modello di progettazione = macchina fisica Famiglia dei LP imperativi = progressivo miglioramento del FORTRAN Obiezione: pesante aderenza dei LP

Dettagli

Prolog: aritmetica e ricorsione

Prolog: aritmetica e ricorsione Capitolo 13 Prolog: aritmetica e ricorsione Slide: Aritmetica e ricorsione 13.1 Operatori aritmetici In logica non vi è alcun meccanismo per la valutazione di funzioni, che è fondamentale in un linguaggio

Dettagli

Corso di Informatica Medica Esercitazione 1I 2013-2014.! Alessandro A. Nacci nacci@elet.polimi.it - alessandronacci.com

Corso di Informatica Medica Esercitazione 1I 2013-2014.! Alessandro A. Nacci nacci@elet.polimi.it - alessandronacci.com Corso di Informatica Medica Esercitazione 1I 2013-2014! Alessandro A. Nacci nacci@elet.polimi.it - alessandronacci.com 1 2 Esercizio 1 Scrivere un programma che legga due array di interi da tastiera dica

Dettagli

Gli algoritmi. Gli algoritmi. Analisi e programmazione

Gli algoritmi. Gli algoritmi. Analisi e programmazione Gli algoritmi Analisi e programmazione Gli algoritmi Proprietà ed esempi Costanti e variabili, assegnazione, istruzioni, proposizioni e predicati Vettori e matrici I diagrammi a blocchi Analisi strutturata

Dettagli

Equazioni non lineari

Equazioni non lineari CORSO DI LAUREA SPECIALISTICA IN INGEGNERIA ELETTRICA Equazioni non lineari Metodi iterativi per l approssimazione di radici Corso di calcolo numerico 2 01/11/2010 Manuela Carta INDICE Introduzione Metodo

Dettagli

Quando troncare uno sviluppo in serie di Taylor

Quando troncare uno sviluppo in serie di Taylor Quando troncare uno sviluppo in serie di Taylor Marco Robutti October 13, 2014 Lo sviluppo in serie di Taylor di una funzione è uno strumento matematico davvero molto utile, e viene spesso utilizzato in

Dettagli

Università di Torino Facoltà di Scienze MFN Corso di Studi in Informatica. Programmazione I - corso B a.a. 2009-10. prof.

Università di Torino Facoltà di Scienze MFN Corso di Studi in Informatica. Programmazione I - corso B a.a. 2009-10. prof. Università di Torino Facoltà di Scienze MFN Corso di Studi in Informatica Programmazione I - corso B a.a. 009-10 prof. Viviana Bono Blocco 9 Metodi statici: passaggio parametri, variabili locali, record

Dettagli

Appunti di Chimica Organica Elementi per CdL Ostetricia CHIMICA ORGANICA. Appunti di Lezione. Elementi per il corso di Laurea In Ostetricia

Appunti di Chimica Organica Elementi per CdL Ostetricia CHIMICA ORGANICA. Appunti di Lezione. Elementi per il corso di Laurea In Ostetricia CHIMICA ORGANICA Appunti di Lezione Elementi per il corso di Laurea In Ostetricia Autore: Roberto Zanrè A.A. 2009/2010 1 Atomo di C e ibridizzazione sp 2 Nel suo stato fondamentale l atomo di C presenta

Dettagli

Matlab: Funzioni. Informatica B. Daniele Loiacono

Matlab: Funzioni. Informatica B. Daniele Loiacono Matlab: Funzioni Informatica B Funzioni A cosa servono le funzioni? 3 x = input('inserisci x: '); fx=1 for i=1:x fx = fx*x if (fx>220) y = input('inserisci y: '); fy=1 for i=1:y fy = fy*y A cosa servono

Dettagli

Le Stringhe. Un introduzione operativa. Luigi Palopoli

Le Stringhe. Un introduzione operativa. Luigi Palopoli Le Stringhe p.1/19 Le Stringhe Un introduzione operativa Luigi Palopoli ReTiS Lab - Scuola Superiore S. Anna Viale Rinaldo Piaggio 34 Pontedera - Pisa Tel. 050-883444 Email: palopoli@sssup.it URL: http://feanor.sssup.it/

Dettagli

Cos è una stringa (1) Stringhe. Leggere e scrivere stringhe (1) Cos è una stringa (2) DD Cap. 8 pp. 305-341 KP Cap. 6 pp. 241-247

Cos è una stringa (1) Stringhe. Leggere e scrivere stringhe (1) Cos è una stringa (2) DD Cap. 8 pp. 305-341 KP Cap. 6 pp. 241-247 Cos è una stringa (1) Stringhe DD Cap. 8 pp. 305-341 KP Cap. 6 pp. 241-247 Una stringa è una serie di caratteri trattati come una singola unità. Essa potrà includere lettere, cifre, simboli e caratteri

Dettagli

Fisica delle Particelle: esperimenti. Fabio Bossi (LNF-INFN) fabio.bossi@lnf.infn.it

Fisica delle Particelle: esperimenti. Fabio Bossi (LNF-INFN) fabio.bossi@lnf.infn.it Fisica delle Particelle: esperimenti Fabio Bossi (LNF-INFN) fabio.bossi@lnf.infn.it Il processo scientifico di conoscenza Esperimento Osservazione quantitativa di fenomeni riguardanti alcune particelle

Dettagli

Quesiti e problemi. 6 Indica quali dei seguenti sistemi sono da considerare. 7 Come puoi giustificare la liberazione di calore in

Quesiti e problemi. 6 Indica quali dei seguenti sistemi sono da considerare. 7 Come puoi giustificare la liberazione di calore in SUL LIBRO DA PAG 306 A PAG 310 Quesiti e problemi ESERCIZI 1 Le reazioni producono energia 1 Qual è il fattore più importante per stabilire se una reazione è esotermica o endotermica? Per stabilire se

Dettagli