SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)"

Transcript

1 SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

2 ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della cellula GENE: regione del DNA che codifica la sequenza primaria di un prodotto genico finale, che può essere un polipeptide o una molecola di RNA con una specifica funzione strutturale o catalitica Oltre ai geni il DNA contiene segmenti o sequenze con funzioni regolatrici SEQUENZE REGOLATRICI: segnali che indicano l inizio o la fine dei geni, che influenzano la trascrizione dei geni, funzionano da inizio della replicazione o della ricombinazione

3 Le molecole di DNA sono molto più lunghe degli involucri che le contengono Rivestimento proteico del batteriofago T2 circondato dalla sua molecola lineare di DNA (batteriofago lisato) Nel batteriofago non lisato tutto il DNA è normalmente impaccato nella testa del fago

4 Le molecole di DNA sono molto più lunghe degli involucri che le contengono La lunghezza totale del DNA di E.coli è circa 1 mm mentre la lunghezza della cellula batterica è circa 1µm La lunghezza totale della molecola di DNA umano è circa 2m, ma questa molecola deve stare in un nucleo di circa 10-15µm di diametro

5 Il DNA cellulare deve essere strettamente compattato, il che implica un elevato grado di organizzazione strutturale Il meccanismo di ripiegamento non deve soltanto impacchettare il DNA, ma deve anche permettere l accesso all informazione contenuta nel DNA per lo svolgimento di processi quali replicazione e trascrizione

6 Un importante proprietà intrinseca della struttura terziaria del DNA è il SUPERAVVOLGIMENTO = AVVOLGIMENTO DI QUALCOSA GIA AVVOLTO Il DNA è avvolto in forma di una doppia elica nella quale entrambe le catene avvolte ruotano intorno a un asse. Un ulteriore ripiegamento o una torsione di tale asse su se stesso determinano un superavvolgimento del DNA. Il superavvolgimento del DNA è in genere la manifestazione di una tensione strutturale; è ubiquitario nel DNA cellulare ed è strettamente regolato in ogni cellula.

7 ORGANIZZAZIONE DEL DNA EUCARIOTICO IN CROMOSOMI Nella cellula, il DNA è associato a proteine per formare un complesso chiamato CROMOSOMA

8 Il termine cromosoma indica in generale una molecola di acido nucleico depositaria dell informazione genetica di un virus, un batterio, una cellula eucariotica o un organello. La parola deriva dal greco: χρῶµα (chroma, colore) and σῶµα (soma, corpo) a causa della proprietà dei cromosomi di essere colorate intensamente da particolari coloranti. Per questa ragione questo termine è stato originariamente usato per indicare le inclusioni densamente colorate all interno dei nuclei eucariotici che possono essere visualizzate al microscopio ottico dopo che le cellule sono state sottoposte a colorazione.

9 L organizzazione strutturale del DNA eucariotico a livelli superiori alla struttura secondaria comporta la sua SPIRALIZZAZIONE Il livello di condensazione è diverso nelle varie fasi del ciclo cellulare La struttura dei cromosomi può essere studiata solo durante la mitosi, quando essi formano strutture più compatte. Durante l interfase la maggior parte dei cromosomi sono troppo despiralizzati e sottili perché si possa osservarne l organizzazione strutturale. La determinazione del tipo di spiralizzazione del DNA in ciascun cromosoma sembra essere una delle funzioni delle regioni non codificanti del DNA, di cui non è ancora completamente noto il ruolo funzionale

10 La spiralizzazione del DNA nelle cellule eucariotiche è importante - per disporre in modo ordinato all interno del nucleo le lunghissime catene di DNA - la precisione con cui in una determinata cellula una regione del genoma è ripiegata può influenzare in modo decisivo l attività dei geni in questa regione Un ruolo fondamentale nel processo di ripiegamento del DNA negli eucarioti è svolto da proteine specializzate

11 Le proteine associate al DNA possono essere: - ENZIMI che catalizzano importanti reazioni quali la sintesi di RNA - PROTEINE CON FUNZIONI STRUTTURALI che servono ad organizzare il DNA all interno del nucleo Le proteine che, negli eucarioti, si legano al DNA sono classificate in - ISTONI (proteine strutturali) - PROTEINE CROMOSOMICHE NON ISTONICHE (migliaia di proteine diverse con numerose differenti funzioni)

12 ISTONI Presenti nelle cellule in quantità enorme (circa 60 milioni di copie di ciascun tipo per cellula) La loro massa complessiva è quasi uguale a quella del DNA presente nella cellula Proteine relativamente piccole contenenti una quantità elevata di aa con cariche positive (Arg e Lys) che favoriscono la formazione di uno stretto legame con il DNA, indipendentemente dalla sequenza nucleotidica del DNA stesso. Il DNA legato agli istoni si chiama CROMATINA

13 -ISTONI NUCLEOSOMICI: piccole proteine responsabili del ripiegarsi del DNA nei nucleosomi H2A, H2B, H3, H4 Sono fra le proteine meglio conservate durante l evoluzione -ISTONE H1: eccettuato il nucleo centrale della molecola, le sequenze aminoacidiche sono meno conservate.

14 L unità strutturale della cromatina è il NUCLEOSOMA, responsabile dell aspetto a filo di perle che la cromatina mostra al microscopio elettronico quando è stata trattata in modo da distendere le ripiegature di ordine superiore

15 Il nucleosoma è stato descritto da Roger Kornberg nel 1974 nucleo istonico: ottamero formato da due copie di ciascun istone H2A, H2B, H3, H4 tratto di DNA che avvolge il nucleo istonico: 147bp tratto di DNA di collegamento: 20-60bp Le code N-terminali degli istoni nucleosomici sporgono esternamente al nucleosoma Il compattamento del DNA in nucleosomi produce un filo di cromatina di circa 10nm di diametro

16 Il legame dell istone H1 porta ad un maggior compattamento del nucleosoma H1 si lega sia al nucleosoma che al DNA linker Le molecole di istone H1 si legano al DNA in maniera COOPERATIVA

17 Gli istoni H1 aiutano i nucleosomi a condensarsi nella fibra di 30nm

18 Le code N-terminali degli istoni del nucleosoma stabilizzano la fibra di cromatina di 30nm.

19 Poiché la condensazione in fibre di cromatina di 30 nm riduce le dimensioni della molecola di DNA di circa 40 volte, è necessaria un ulteriore condensazione I livelli di ripiegamento successivi alla fibra di 30 nm non sono ancora stati completamente chiariti. Implicano la presenza di REGIONI AD ANSA: alcune regioni del DNA si associano con un impalcatura nucleare costituita da diverse proteine non ancora completamente identificate (probabilmente H1 e topoisomerasi) Le proteine si legano al DNA riconoscendo probabilmente sequenze specifiche che formano il collo di ciascuna ansa

20 Il tratto di DNA che forma un ansa può contenere un gruppo di geni correlati tra loro ed è lungo da e bp; ciò significa che un tipico cromosoma umano può contenere circa 2600 regioni ad ansa ed ogni ansa di cromatina è formata da un tratto della fibra di 30 nm lungo in media circa 4000 nm A questo punto la molecola di DNA avrebbe la lunghezza di circa 100 µm; deve quindi ripiegarsi ulteriormente per poter rimanere all interno del nucleo

21 Esistono evidenze sperimentali a favore dell esistenza di ulteriori livelli di organizzazione nei cromosomi eucariotici, ognuno dei quali determina un aumento esponenziale del grado di compattezza. La spiralizzazione del DNA è accompagnata dalla fosforilazione di tutte le molecole di H1 della cellula a livello di cinque diverse specifiche molecole di serina. I progressivi gradi di compattezza variano probabilmente da cromosoma a cromosoma, da una regione all altra di un singolo cromosoma, da un istante all altro nella vita della cellula. Ad oggi, nessun modello è in grado di descrivere adeguatamente questa struttura. LA COMPATTEZZA DEL DNA DEL CROMOSOMA EUCARIOTICO E VEROSIMILMENTE DOVUTA AD AVVOLGIMENTI SUCCESSIVI CHE SI SOVRAPPONGONO AD AVVOLGIMENTI GIA PRESENTI Modello di compattamento del DNA in un cromosoma eucariotico

22

23 Oltre alle proteine istoniche, altre proteine si legano al DNA a livello di sequenze specifiche (PROTEINE CROMOSOMICHE NON ISTONICHE) Sono PROTEINE REGOLATRICI Regolano il processo di trascrizione, l inizio della sintesi del DNA, il ripiegamento della molecola in regioni funzionalmente distinte

24 I nucleosomi limitano l accesso delle proteine regolatrici alle specifiche sequenze di DNA alle quali esse si legano. Nel caso di alcune proteine regolatrici, il legame è possibile solo se quel certo tratto di DNA è completamente privo di nucleosomi o se il loro sito di legame si trova nel DNA linker. Questo fa ipotizzare che in alcune regioni della cromatina i nucleosomi non sono disposti a caso, ma in modo da lasciare relativamente libere quelle sequenze di DNA che devono essere riconosciute da altre proteine cellulari. La disposizione dei nucleosomi a livello di specifiche sequenze è detta MESSA IN FASE O POSIZIONAMENTO DEI NUCLEOSOMI

25 L interazione del DNA con l ottamero istonico è dinamica Il nucleosoma può muoversi per permettere l accesso delle proteine regolatrici alle loro sequenze di legame in risposta alle diverse richieste di accessibilità (Rimodellamento del nucleosoma).

26 Modificazioni delle code N-terminali degli istoni influenzano l accessibilità alla cromatina

27

28 In che modo le modificazioni degli istoni alterano la funzione dei cromosomi? - L acetilazione o la fosforilazione riducono le cariche positive e quindi l affinità delle code istoniche per il DNA - Modificazioni delle code istoniche (in particolare l acetilazione) riducono la capacità del DNA di condensarsi nella fibra di 30 nm. - Alcune modificazioni favoriscono la formazione di siti di legame per proteine regolatorie

29 Le modificazioni degli istoni formano un codice che può essere letto dalle proteine coinvolte nell espressione genica o in altre reazioni a carico del DNA

30 Quindi.. le modificazioni a livello delle code istoniche e i processi di rimodellamento dei nucleosomi lavorano insieme per determinare l accessibilità delle diverse regioni del DNA Passaggio da: eterocromatina trascrizionalmente silente a: eucromatina trascrizionalmente attiva

31 La metilazione del DNA avviene per trasferimento di un gruppo metile da S-adenosilmetionina alla posizione 5 della citidina da parte di enzimi della famiglia delle DNA metiltrasferasi (DNMT). Nei mammiferi sono normalmente metilate citidine seguite da guanosine (CpG). Possono essere metilate anche citidine seguite da altre basi, in particolare adenine (CpA). Nei mammiferi sono metilate tra il 60% ed il 90% delle sequenze CpG. Sequenze CpG non metilate sono raggruppate in clusters chiamati Isole CpG " che sono presenti nelle regioni regolatorie al 5 di molti geni.

32 Gli effetti della metilazione del DNA sull espressione genica si esplicano attraverso meccanismi di diverso tipo e portano generalmente alla riduzione dell espressione genica, chiamata silenziamento genico In generale: La metilazione del DNA si inserisce nel contesto delle modificazioni chimiche delle proteine istoniche. I due processi formano un modello di regolazione flessibile ma preciso che è essenziale per le attività fisiologiche delle cellule e dei tessuti.

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine.

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. 8.1 LA RIPRODUZIONE La riproduzione è il processo con cui la specie si

Dettagli

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010 PLASMIDI puc ALTRI TIPI DI VETTORI VETTORI λ (15-20 Kb) = vettori ottenuti apportando delle modifiche al genoma del batteriofago λ. COSMIDI (40-45 Kb) = plasmidi che contengono i siti cos di λ utili per

Dettagli

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R unità 1. La funzione del DN negli organismi La funzione del DN L acido desossiribonucleico o DN (dall inglese deoxyribonucleic acid) è la molecola informazionale delle cellule. Essa contiene e trasmette

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

PROGRAMMA DI BIOLOGIA. CLASSE 2^ F a. s. 2014 2015. Prof.ssa RUBINO ALESSANDRA

PROGRAMMA DI BIOLOGIA. CLASSE 2^ F a. s. 2014 2015. Prof.ssa RUBINO ALESSANDRA ISTITUTO TECNICO INDUSTRIALE DI STATO "ENRICO FERMI" Via Luosi n. 23-41124 Modena Tel. 059211092 059236398 - (Fax): 059226478 E-mail: info@fermi.mo.it Pagina web: www.fermi.mo.it PROGRAMMA DI BIOLOGIA

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano

trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano Struttura Acidi Nucleici RNA, DNA acidi nucleici = polinucleotidi (polimeri di nucleotidi) in cui

Dettagli

STRUTTURA E FUNZIONE DELLE PROTEINE

STRUTTURA E FUNZIONE DELLE PROTEINE STRUTTURA E FUNZIONE DELLE PROTEINE Le PROTEINE sono i biopolimeri maggiormente presenti all interno delle cellule, dal momento che costituiscono dal 40 al 70% del peso secco. Svolgono funzioni biologiche

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici La seta della tela di ragno è un insieme di macromolecole, dette proteine. Sono le caratteristiche fisico-chimiche di queste

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

Livello di organizzazione degli esseri viventi

Livello di organizzazione degli esseri viventi Livello di organizzazione degli esseri viventi _Organismo; _Apparato; _Organo; _Tessuti; _Cellule; _Organelli cellulari; _Molecole. Atomo, elemento, molecola, composto, formula, legame, elettronegativita.

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente.

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. CHE COS E LA CELLULA? La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. DA COSA SONO COSTITUITE LE CELLULE? Tutte le

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica.

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. Concanavalina A Emoglobina subunità Trioso fosfato isomerasi Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. 1 La conformazione è

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità www.studxwebmedicina.altervista.org

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

CELLULE EUCARIOTICHE

CELLULE EUCARIOTICHE CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica, citoplasma, DNA e ribosomi (comuni a

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 9

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 9 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 9 Funzioni delle proteine Concetti chiave: La varietà strutturale delle proteine consente loro di svolgere un enorme quantità

Dettagli

Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette

Dettagli

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia Ingegneria delle tecnologie per la salute Anatomia e istologia umana Cenni di Biologia Macromolecole: Glucidi Lipidi Proteine Acidi nucleici glucidi Monosaccaridi: glucosio, fruttosio, galattosio, desossiribosio,

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI La Fecondazione Processo con cui due cellule sessuali (gameti) si uniscono per formare un nuovo individuo cha ha un genoma

Dettagli

LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI PROTEINE. sono ACIDI NUCLEICI. molecole complesse = POLIMERI. formate dall'unione di

LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI PROTEINE. sono ACIDI NUCLEICI. molecole complesse = POLIMERI. formate dall'unione di LE BIOMOLECOLE LE BIOMOLECOLE DETTE ANCHE MOLECOLE ORGANICHE; CARBOIDRATI LE BIOMOLECOLE sono LIPIDI PROTEINE ACIDI NUCLEICI molecole complesse = POLIMERI formate dall'unione di molecole semplici = MONOMERI

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

Le idee della chimica

Le idee della chimica G. Valitutti A.Tifi A.Gentile Seconda edizione Copyright 2009 Zanichelli editore Capitolo 25 Le basi della biochimica 1. I carboidrati 2. I lipidi 3. Gli amminoacidi, i peptidi e le proteine 4. La struttura

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo A COSA SERVE il

Dettagli

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4 Indice Prefazione XIII Protein Data Bank: una nota degli autori XIV Nota all edizione italiana XV Ringraziamenti XVI CAPITOLO 1 Dalla sequenza alla struttura 1.0 Visione d insieme: funzione e architettura

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE Tutti i tipi cellulari presenti sul nostro pianeta appartengono ad uno di due gruppi fondamentali: procarioti ed eucarioti. I termini procariota (dal greco pro

Dettagli

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice

Dettagli

Macromolecole Biologiche. I domini (II)

Macromolecole Biologiche. I domini (II) I domini (II) Domini β Nonostante l elevato numero di possibili disposizioni di filamenti β (a costituire foglietti β antiparalleli) connessi da tratti di loop, i domini β più frequentemente osservati

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici www.fisiokinesiterapia.biz Fattori estrinseci Ambiente Danno genotossico

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

FONDAZIONE MALAVASI. Scuola secondaria di 2 grado A. MANZONI

FONDAZIONE MALAVASI. Scuola secondaria di 2 grado A. MANZONI FONDAZIONE MALAVASI Scuola secondaria di 2 grado A. MANZONI PIANO DI LAVORO E PROGRAMMAZIONE DIDATTICA DISCIPLINA: Scienze Naturali DOCENTE: Lucia Roncaglia CLASSE I CLASSICO A.S.2015 /2016 1. OBIETTIVI

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

Dip. Matematica, U. Milano-Bicocca & Progetto Lagrange, ISI-CRT

Dip. Matematica, U. Milano-Bicocca & Progetto Lagrange, ISI-CRT San Pellegrino 3 Sett., 2007 RENZO L. RICCA Dip. Matematica, U. Milano-Bicocca & Progetto Lagrange, ISI-CRT Sommario Struttura e funzione del materiale genetico: analisi matematica di filamenti elastici

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli